>gb|AC093842.3| Homo sapiens BAC clone RP11-443J23 from 4, complete sequence
          Length = 113025

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 63    gattatttgtaactaactaagatgaa 88
             ||||||||||||||| ||||||||||
Sbjct: 16438 gattatttgtaactacctaagatgaa 16413

>gb|AC002375.1|AC002375 Homo sapiens 12q24 PAC RPCI1-74B13 (Roswell Park Cancer Institute
            Human PAC library) complete sequence
          Length = 102579

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 164  gacatcaactttgggcgatt 183
            ||||||||||||||||||||
Sbjct: 6575 gacatcaactttgggcgatt 6594

>gb|AC121587.4| Mus musculus BAC clone RP23-273O2 from 3, complete sequence
          Length = 167573

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 86     gaacatgcaacgatgcatt 104
              |||||||||||||||||||
Sbjct: 132472 gaacatgcaacgatgcatt 132490

>emb|AL356319.18| Human DNA sequence from clone RP11-810G21 on chromosome 13 Contains a
             CpG island, complete sequence
          Length = 137260

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 130   ttagtaactcatagtactt 148
             |||||||||||||||||||
Sbjct: 18245 ttagtaactcatagtactt 18227

>emb|CR936325.2| Medicago truncatula chromosome 5 clone mth2-53m2, COMPLETE SEQUENCE
          Length = 139736

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    ctttccgtttttgccaaaa 28
             |||||||||||||||||||
Sbjct: 11211 ctttccgtttttgccaaaa 11193

>emb|CR931808.2| Medicago truncatula chromosome 5 clone mth2-144o15, COMPLETE SEQUENCE
          Length = 124859

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 10     ctttccgtttttgccaaaa 28
              |||||||||||||||||||
Sbjct: 121073 ctttccgtttttgccaaaa 121055

>emb|BX321868.13| Zebrafish DNA sequence from clone RP71-41I21, complete sequence
          Length = 135717

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 64    attatttgtaactaactaa 82
             |||||||||||||||||||
Sbjct: 45876 attatttgtaactaactaa 45858

>gb|AC126309.8| Homo sapiens 12 BAC RP11-592O2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 121984

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 76    taactaagatgaacatgca 94
             |||||||||||||||||||
Sbjct: 39452 taactaagatgaacatgca 39434

>emb|BX511028.13| Zebrafish DNA sequence from clone DKEY-161N17 in linkage group 20,
             complete sequence
          Length = 225010

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 64    attatttgtaactaactaa 82
             |||||||||||||||||||
Sbjct: 30622 attatttgtaactaactaa 30604

>gb|AC147262.4| Mus musculus BAC clone RP24-211P15 from 3, complete sequence
          Length = 168562

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 86     gaacatgcaacgatgcatt 104
              |||||||||||||||||||
Sbjct: 160813 gaacatgcaacgatgcatt 160831

>gb|AC004562.1|AC004562 Homo sapiens chromosome 17, clone hRPC.34_M_24, complete sequence
          Length = 133925

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    ctttccgtttttgccaaaa 28
             |||||||||||||||||||
Sbjct: 65773 ctttccgtttttgccaaaa 65791

>gb|AC147559.5| Mus musculus BAC clone RP23-391P1 from 3, complete sequence
          Length = 188305

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 86    gaacatgcaacgatgcatt 104
             |||||||||||||||||||
Sbjct: 63194 gaacatgcaacgatgcatt 63212

>gb|AC002539.1|AC002539 Homo sapiens chromosome 17, clone 195o20, complete sequence
          Length = 87246

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 10   ctttccgtttttgccaaaa 28
            |||||||||||||||||||
Sbjct: 2858 ctttccgtttttgccaaaa 2840

>emb|AL844564.14| Mouse DNA sequence from clone RP23-400D4 on chromosome 11, complete
              sequence
          Length = 196136

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 13     tccgtttttgccaaaacac 31
              |||||||||||||||||||
Sbjct: 190948 tccgtttttgccaaaacac 190966


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,311,244
Number of Sequences: 3902068
Number of extensions: 1311244
Number of successful extensions: 81212
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 81186
Number of HSP's gapped (non-prelim): 26
length of query: 187
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 165
effective length of database: 17,147,199,772
effective search space: 2829287962380
effective search space used: 2829287962380
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)