Clone Name | rbasd13j19 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | emb|X89006.1|SHRNAF16B Saccharum hybrid cultivar H65-7052 mRNA f... | 48 | 0.021 | 2 | gb|BT013377.1| Lycopersicon esculentum clone 135407F, mRNA sequence | 40 | 5.1 | 3 | gb|AC084355.28| Homo sapiens 12 BAC RP11-318E11 (Roswell Park Ca... | 40 | 5.1 | 4 | gb|AC093267.2| Homo sapiens chromosome 5 clone RP11-280F11, comp... | 40 | 5.1 |
---|
>emb|X89006.1|SHRNAF16B Saccharum hybrid cultivar H65-7052 mRNA for cytosolic fructose-1,6-bisphosphatase Length = 1318 Score = 48.1 bits (24), Expect = 0.021 Identities = 32/35 (91%) Strand = Plus / Minus Query: 350 tcctccacatnatcgtagctcccgaggaatatcgg 384 |||||||||| |||||||| |||||||||||||| Sbjct: 1056 tcctccacatcgtcgtagctgccgaggaatatcgg 1022
>gb|BT013377.1| Lycopersicon esculentum clone 135407F, mRNA sequence Length = 641 Score = 40.1 bits (20), Expect = 5.1 Identities = 31/35 (88%) Strand = Plus / Minus Query: 347 atctcctccacatnatcgtagctcccgaggaatat 381 ||||||||||||| |||||| || || |||||||| Sbjct: 399 atctcctccacatcatcgtaactaccaaggaatat 365
>gb|AC084355.28| Homo sapiens 12 BAC RP11-318E11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 179759 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 16 acagtctttgtttctgaaac 35 |||||||||||||||||||| Sbjct: 25841 acagtctttgtttctgaaac 25860
>gb|AC093267.2| Homo sapiens chromosome 5 clone RP11-280F11, complete sequence Length = 170999 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 253 tgaacataacttttcctttt 272 |||||||||||||||||||| Sbjct: 36201 tgaacataacttttcctttt 36182 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,768,783 Number of Sequences: 3902068 Number of extensions: 1768783 Number of successful extensions: 26653 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 26648 Number of HSP's gapped (non-prelim): 5 length of query: 385 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 363 effective length of database: 17,147,199,772 effective search space: 6224433517236 effective search space used: 6224433517236 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)