ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd13j08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 143 8e-31
2dbj|AP003257.3| Oryza sativa (japonica cultivar-group) genomic D... 143 8e-31
3dbj|AK069339.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 8e-31
4ref|XM_462855.1| Oryza sativa (japonica cultivar-group), predic... 133 7e-28
5gb|AY107398.1| Zea mays PCO119340 mRNA sequence 96 2e-16
6emb|AL139159.10| Human DNA sequence from clone RP5-894H24 on chr... 44 0.52
7emb|AL627228.31| Mouse DNA sequence from clone RP23-137L22 on ch... 44 0.52
8gb|AC138284.9| Mus musculus chromosome 9, clone RP23-356D13, com... 42 2.1
9gb|AC092108.4| Homo sapiens BAC clone RP11-1263I10 from 7, compl... 42 2.1
10gb|AC154816.2| Mus musculus BAC clone RP24-534N1 from chromosome... 42 2.1
11dbj|AK195602.1| Mus musculus cDNA, clone:Y1G0119A07, strand:unsp... 42 2.1
12dbj|AB019230.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 42 2.1
13ref|NM_188632.1| Oryza sativa (japonica cultivar-group), Ozsa823... 40 8.1
14ref|NM_026551.2| Mus musculus dephospho-CoA kinase domain contai... 40 8.1
15gb|AC125151.4| Mus musculus BAC clone RP24-355K8 from chromosome... 40 8.1
16gb|AC162936.3| Mus musculus BAC clone RP23-108K5 from chromosome... 40 8.1
17gb|AC123614.6| Mus musculus chromosome 9, clone RP23-446P16, com... 40 8.1
18gb|BC079186.1| Rattus norvegicus dephospho-CoA kinase domain con... 40 8.1
19ref|NM_001007724.1| Rattus norvegicus dephospho-CoA kinase domai... 40 8.1
20gb|BC031855.1| Mus musculus mRNA similar to hypothetical protein... 40 8.1
21gb|BC005607.1| Mus musculus cDNA clone IMAGE:3498151, **** WARNI... 40 8.1
22dbj|AK133329.1| Mus musculus adult male testis cDNA, RIKEN full-... 40 8.1
23dbj|AK162069.1| Mus musculus in vitro fertilized eggs cDNA, RIKE... 40 8.1
24dbj|AK170762.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 40 8.1
25gb|AC131183.4| Mus musculus BAC clone RP23-225A14 from chromosom... 40 8.1
26dbj|AK002835.1| Mus musculus adult male kidney cDNA, RIKEN full-... 40 8.1
27dbj|AK051022.1| Mus musculus 9 days embryo whole body cDNA, RIKE... 40 8.1
28dbj|AK078460.1| Mus musculus 12 days embryo male wolffian duct i... 40 8.1
29dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
30dbj|AK180764.1| Mus musculus cDNA, clone:Y0G0115L23, strand:plus... 40 8.1
31dbj|AK180504.1| Mus musculus cDNA, clone:Y0G0114J06, strand:plus... 40 8.1
32dbj|BS000240.1| Pan troglodytes chromosome 22 clone:RP43-055A16,... 40 8.1
33gb|AE005057.1| Halobacterium sp. NRC-1 section 88 of 170 of the ... 40 8.1
34dbj|AK120694.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.1
35emb|AL163303.2|HS21C103 Homo sapiens chromosome 21 segment HS21C103 40 8.1
36gb|BC023208.1| Mus musculus dephospho-CoA kinase domain containi... 40 8.1
37gb|BC042685.1| Mus musculus dephospho-CoA kinase domain containi... 40 8.1
38gb|BC045193.1| Mus musculus dephospho-CoA kinase domain containi... 40 8.1
39gb|BC047340.1| Mus musculus dephospho-CoA kinase domain containi... 40 8.1
40gb|AC147245.3| Mus musculus BAC clone RP23-462E12 from 12, compl... 40 8.1
41emb|AL731670.13| Mouse DNA sequence from clone RP23-463E7 on chr... 40 8.1
42emb|AJ011932.1|HSQ4H9 Homo sapiens chromosome 21q22.3, cosmid cl... 40 8.1
43dbj|AP000468.1| Homo sapiens genomic DNA, chromosome 21q22.3, cl... 40 8.1 
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  143 bits (72), Expect = 8e-31
 Identities = 348/440 (79%)
 Strand = Plus / Plus

                                                                            
Query: 156      aaagatcatagcagattcttctgagcaagcagaacccctgctgcggtgcacacgacgata 215
                ||||||||||||||||||||||| ||||||||||||||  |||| || || || || |  
Sbjct: 14662445 aaagatcatagcagattcttctgggcaagcagaacccccactgctgtacataccacaacg 14662504

                                                                            
Query: 216      gagagaaggccatccctggacatcatgcgctccttccatgtcaagggagcagacacctgc 275
                |||| ||| |||||||  ||| |||  |||||||||||||||| |||  |||| || | |
Sbjct: 14662505 gagaaaagaccatcccgagacctcaaccgctccttccatgtcaggggttcagagacgttc 14662564

                                                                            
Query: 276      ttcagcacttcctggaactgctctttcgtatcgtcccgggagcgagagttgtcgatcact 335
                 ||| ||||||||| ||||  ||||| || || ||| | | || ||| ||||||||||| 
Sbjct: 14662565 ctcaacacttcctgaaacttttctttggtttcatccagcgtgccagaattgtcgatcaca 14662624

                                                                            
Query: 336      atgtcggcttccgacttcttccagtccagtgcaagctgcgcgtcgatcctgctctgagcc 395
                ||||| ||||  ||||||||||||||||  ||||||||||| | ||||||  || |||| 
Sbjct: 14662625 atgtctgcttgtgacttcttccagtccaacgcaagctgcgcattgatcctattccgagct 14662684

                                                                            
Query: 396      tgttcctggccgcacccgtctcttgacatgagcctttcgatctgagttttgggatcaacc 455
                ||||| |    |||||| ||||||||||| ||||| || ||||| |||     ||  |||
Sbjct: 14662685 tgttcttcagagcacccatctcttgacattagcctctcaatctgggttgcttcattcacc 14662744

                                                                            
Query: 456      catacgacaaccacggggtccgtccaccggtccatctttgtctcaaacaggagcgggatg 515
                || || ||||  || |||| ||||||  |||||||||||||||||||||  || || |||
Sbjct: 14662745 cacacaacaataacagggtgcgtccattggtccatctttgtctcaaacaacagaggaatg 14662804

                                                                            
Query: 516      tcgacaacgatgaccagggatcccttcacccacagttttagtatctcccagaatataccg 575
                ||||  ||||| |||  | |||| || | ||||||||||||||||||||| ||||| || 
Sbjct: 14662805 tcgaggacgataaccttgcatccttttatccacagttttagtatctcccaaaatatccca 14662864

                                    
Query: 576      catgaaatgtgtggggccag 595
                 ||||||| ||||| |||||
Sbjct: 14662865 gatgaaatatgtggagccag 14662884



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 168     agattcttctgagcaagcag 187
               ||||||||||||||||||||
Sbjct: 7327398 agattcttctgagcaagcag 7327417
to top
>dbj|AP003257.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0460H02
          Length = 155012

 Score =  143 bits (72), Expect = 8e-31
 Identities = 348/440 (79%)
 Strand = Plus / Plus

                                                                         
Query: 156   aaagatcatagcagattcttctgagcaagcagaacccctgctgcggtgcacacgacgata 215
             ||||||||||||||||||||||| ||||||||||||||  |||| || || || || |  
Sbjct: 31545 aaagatcatagcagattcttctgggcaagcagaacccccactgctgtacataccacaacg 31604

                                                                         
Query: 216   gagagaaggccatccctggacatcatgcgctccttccatgtcaagggagcagacacctgc 275
             |||| ||| |||||||  ||| |||  |||||||||||||||| |||  |||| || | |
Sbjct: 31605 gagaaaagaccatcccgagacctcaaccgctccttccatgtcaggggttcagagacgttc 31664

                                                                         
Query: 276   ttcagcacttcctggaactgctctttcgtatcgtcccgggagcgagagttgtcgatcact 335
              ||| ||||||||| ||||  ||||| || || ||| | | || ||| ||||||||||| 
Sbjct: 31665 ctcaacacttcctgaaacttttctttggtttcatccagcgtgccagaattgtcgatcaca 31724

                                                                         
Query: 336   atgtcggcttccgacttcttccagtccagtgcaagctgcgcgtcgatcctgctctgagcc 395
             ||||| ||||  ||||||||||||||||  ||||||||||| | ||||||  || |||| 
Sbjct: 31725 atgtctgcttgtgacttcttccagtccaacgcaagctgcgcattgatcctattccgagct 31784

                                                                         
Query: 396   tgttcctggccgcacccgtctcttgacatgagcctttcgatctgagttttgggatcaacc 455
             ||||| |    |||||| ||||||||||| ||||| || ||||| |||     ||  |||
Sbjct: 31785 tgttcttcagagcacccatctcttgacattagcctctcaatctgggttgcttcattcacc 31844

                                                                         
Query: 456   catacgacaaccacggggtccgtccaccggtccatctttgtctcaaacaggagcgggatg 515
             || || ||||  || |||| ||||||  |||||||||||||||||||||  || || |||
Sbjct: 31845 cacacaacaataacagggtgcgtccattggtccatctttgtctcaaacaacagaggaatg 31904

                                                                         
Query: 516   tcgacaacgatgaccagggatcccttcacccacagttttagtatctcccagaatataccg 575
             ||||  ||||| |||  | |||| || | ||||||||||||||||||||| ||||| || 
Sbjct: 31905 tcgaggacgataaccttgcatccttttatccacagttttagtatctcccaaaatatccca 31964

                                 
Query: 576   catgaaatgtgtggggccag 595
              ||||||| ||||| |||||
Sbjct: 31965 gatgaaatatgtggagccag 31984
to top
>dbj|AK069339.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023014L08, full
           insert sequence
          Length = 1083

 Score =  143 bits (72), Expect = 8e-31
 Identities = 348/440 (79%)
 Strand = Plus / Minus

                                                                       
Query: 156 aaagatcatagcagattcttctgagcaagcagaacccctgctgcggtgcacacgacgata 215
           ||||||||||||||||||||||| ||||||||||||||  |||| || || || || |  
Sbjct: 823 aaagatcatagcagattcttctgggcaagcagaacccccactgctgtacataccacaacg 764

                                                                       
Query: 216 gagagaaggccatccctggacatcatgcgctccttccatgtcaagggagcagacacctgc 275
           |||| ||| |||||||  ||| |||  |||||||||||||||| |||  |||| || | |
Sbjct: 763 gagaaaagaccatcccgagacctcaaccgctccttccatgtcaggggttcagagacgttc 704

                                                                       
Query: 276 ttcagcacttcctggaactgctctttcgtatcgtcccgggagcgagagttgtcgatcact 335
            ||| ||||||||| ||||  ||||| || || ||| | | || ||| ||||||||||| 
Sbjct: 703 ctcaacacttcctgaaacttttctttggtttcatccagcgtgccagaattgtcgatcaca 644

                                                                       
Query: 336 atgtcggcttccgacttcttccagtccagtgcaagctgcgcgtcgatcctgctctgagcc 395
           ||||| ||||  ||||||||||||||||  ||||||||||| | ||||||  || |||| 
Sbjct: 643 atgtctgcttgtgacttcttccagtccaacgcaagctgcgcattgatcctattccgagct 584

                                                                       
Query: 396 tgttcctggccgcacccgtctcttgacatgagcctttcgatctgagttttgggatcaacc 455
           ||||| |    |||||| ||||||||||| ||||| || ||||| |||     ||  |||
Sbjct: 583 tgttcttcagagcacccatctcttgacattagcctctcaatctgggttgcttcattcacc 524

                                                                       
Query: 456 catacgacaaccacggggtccgtccaccggtccatctttgtctcaaacaggagcgggatg 515
           || || ||||  || |||| ||||||  |||||||||||||||||||||  || || |||
Sbjct: 523 cacacaacaataacagggtgcgtccattggtccatctttgtctcaaacaacagaggaatg 464

                                                                       
Query: 516 tcgacaacgatgaccagggatcccttcacccacagttttagtatctcccagaatataccg 575
           ||||  ||||| |||  | |||| || | ||||||||||||||||||||| ||||| || 
Sbjct: 463 tcgaggacgataaccttgcatccttttatccacagttttagtatctcccaaaatatccca 404

                               
Query: 576 catgaaatgtgtggggccag 595
            ||||||| ||||| |||||
Sbjct: 403 gatgaaatatgtggagccag 384
to top
>ref|XM_462855.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 693

 Score =  133 bits (67), Expect = 7e-28
 Identities = 343/435 (78%)
 Strand = Plus / Minus

                                                                       
Query: 161 tcatagcagattcttctgagcaagcagaacccctgctgcggtgcacacgacgatagagag 220
           |||||||||||||||||| ||||||||||||||  |||| || || || || |  |||| 
Sbjct: 693 tcatagcagattcttctgggcaagcagaacccccactgctgtacataccacaacggagaa 634

                                                                       
Query: 221 aaggccatccctggacatcatgcgctccttccatgtcaagggagcagacacctgcttcag 280
           ||| |||||||  ||| |||  |||||||||||||||| |||  |||| || | | ||| 
Sbjct: 633 aagaccatcccgagacctcaaccgctccttccatgtcaggggttcagagacgttcctcaa 574

                                                                       
Query: 281 cacttcctggaactgctctttcgtatcgtcccgggagcgagagttgtcgatcactatgtc 340
           ||||||||| ||||  ||||| || || ||| | | || ||| ||||||||||| |||||
Sbjct: 573 cacttcctgaaacttttctttggtttcatccagcgtgccagaattgtcgatcacaatgtc 514

                                                                       
Query: 341 ggcttccgacttcttccagtccagtgcaagctgcgcgtcgatcctgctctgagcctgttc 400
            ||||  ||||||||||||||||  ||||||||||| | ||||||  || |||| |||||
Sbjct: 513 tgcttgtgacttcttccagtccaacgcaagctgcgcattgatcctattccgagcttgttc 454

                                                                       
Query: 401 ctggccgcacccgtctcttgacatgagcctttcgatctgagttttgggatcaacccatac 460
            |    |||||| ||||||||||| ||||| || ||||| |||     ||  ||||| ||
Sbjct: 453 ttcagagcacccatctcttgacattagcctctcaatctgggttgcttcattcacccacac 394

                                                                       
Query: 461 gacaaccacggggtccgtccaccggtccatctttgtctcaaacaggagcgggatgtcgac 520
            ||||  || |||| ||||||  |||||||||||||||||||||  || || ||||||| 
Sbjct: 393 aacaataacagggtgcgtccattggtccatctttgtctcaaacaacagaggaatgtcgag 334

                                                                       
Query: 521 aacgatgaccagggatcccttcacccacagttttagtatctcccagaatataccgcatga 580
            ||||| |||  | |||| || | ||||||||||||||||||||| ||||| ||  ||||
Sbjct: 333 gacgataaccttgcatccttttatccacagttttagtatctcccaaaatatcccagatga 274

                          
Query: 581 aatgtgtggggccag 595
           ||| ||||| |||||
Sbjct: 273 aatatgtggagccag 259
to top
>gb|AY107398.1| Zea mays PCO119340 mRNA sequence
          Length = 1414

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 216/272 (79%)
 Strand = Plus / Minus

                                                                       
Query: 246 tccttccatgtcaagggagcagacacctgcttcagcacttcctggaactgctctttcgta 305
           |||||||||||||||||  | || || | | ||| |||||| ||||| |||| ||| || 
Sbjct: 870 tccttccatgtcaagggctccgagactttcatcaacacttcttggaattgctgtttggtg 811

                                                                       
Query: 306 tcgtcccgggagcgagagttgtcgatcactatgtcggcttccgacttcttccagtccagt 365
           || ||| |||| | ||| ||||| ||||||||||| ||||| || ||||||||||| |||
Sbjct: 810 tcatccagggaaccagaattgtcaatcactatgtctgcttctgatttcttccagtctagt 751

                                                                       
Query: 366 gcaagctgcgcgtcgatcctgctctgagcctgttcctggccgcacccgtctcttgacatg 425
           |||||||| || | ||||||  ||||||| ||| | ||   ||| || |||||||| |||
Sbjct: 750 gcaagctgtgcattgatcctattctgagcttgtccttgagagcatccatctcttgaaatg 691

                                                                       
Query: 426 agcctttcgatctgagttttgggatcaacccatacgacaaccacggggtccgtccaccgg 485
           ||||| || |||||   ||| ||||||||||| |  ||||  |  || | |||||| |  
Sbjct: 690 agcctctcaatctggacttttggatcaacccagagaacaatgattggattcgtccatcta 631

                                           
Query: 486 tccatctttgtctcaaacaggagcgggatgtc 517
           |||||||||||||||||||| |||||||||||
Sbjct: 630 tccatctttgtctcaaacagcagcgggatgtc 599
to top
>emb|AL139159.10| Human DNA sequence from clone RP5-894H24 on chromosome 1 Contains the
            5' end of the CACNA1S gene for calcium channel
            voltage-dependent L type alpha 1S subunit, the TMEM9 gene
            for transmembrane protein 9 and a CpG island, complete
            sequence
          Length = 132131

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 383  cctgctctgagcctgttcctgg 404
            ||||||||||||||||||||||
Sbjct: 8676 cctgctctgagcctgttcctgg 8697
to top
>emb|AL627228.31| Mouse DNA sequence from clone RP23-137L22 on chromosome 4, complete
              sequence
          Length = 193813

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 432    tcgatctgagttttgggatcaa 453
              ||||||||||||||||||||||
Sbjct: 134927 tcgatctgagttttgggatcaa 134906
to top
>gb|AC138284.9| Mus musculus chromosome 9, clone RP23-356D13, complete sequence
          Length = 220266

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 167   cagattcttctgagcaagcagaacc 191
             ||||||| |||||||||||||||||
Sbjct: 41709 cagattcgtctgagcaagcagaacc 41685
to top
>gb|AC092108.4| Homo sapiens BAC clone RP11-1263I10 from 7, complete sequence
          Length = 26349

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 92    acttggaaattttcaaccaat 112
             |||||||||||||||||||||
Sbjct: 15743 acttggaaattttcaaccaat 15723
to top
>gb|AC154816.2| Mus musculus BAC clone RP24-534N1 from chromosome 13, complete sequence
          Length = 155476

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 540   ttcacccacagttttagtatc 560
             |||||||||||||||||||||
Sbjct: 54729 ttcacccacagttttagtatc 54709
to top
>dbj|AK195602.1| Mus musculus cDNA, clone:Y1G0119A07, strand:unspecified
          Length = 396

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 167 cagattcttctgagcaagcagaacc 191
           ||||||| |||||||||||||||||
Sbjct: 211 cagattcgtctgagcaagcagaacc 187
to top
>dbj|AB019230.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MEB5
          Length = 74968

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 154   gaaaagatcatagcagattct 174
             |||||||||||||||||||||
Sbjct: 14037 gaaaagatcatagcagattct 14017
to top
>ref|NM_188632.1| Oryza sativa (japonica cultivar-group), Ozsa8235 predicted mRNA
          Length = 2418

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 168 agattcttctgagcaagcag 187
           ||||||||||||||||||||
Sbjct: 801 agattcttctgagcaagcag 820
to top
>ref|NM_026551.2| Mus musculus dephospho-CoA kinase domain containing (Dcakd), mRNA
          Length = 1715

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 490 tctttgtctcaaacaggagcgggatgtc 517
           |||| |||||||||||||| ||||||||
Sbjct: 558 tcttggtctcaaacaggagggggatgtc 531
to top
>gb|AC125151.4| Mus musculus BAC clone RP24-355K8 from chromosome 14, complete
            sequence
          Length = 202916

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 550  gttttagtatctcccagaat 569
            ||||||||||||||||||||
Sbjct: 6128 gttttagtatctcccagaat 6147
to top
>gb|AC162936.3| Mus musculus BAC clone RP23-108K5 from chromosome 14, complete sequence
          Length = 236917

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 550    gttttagtatctcccagaat 569
              ||||||||||||||||||||
Sbjct: 151327 gttttagtatctcccagaat 151346
to top
>gb|AC123614.6| Mus musculus chromosome 9, clone RP23-446P16, complete sequence
          Length = 210060

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 282    acttcctggaactgctcttt 301
              ||||||||||||||||||||
Sbjct: 181679 acttcctggaactgctcttt 181660
to top
>gb|BC079186.1| Rattus norvegicus dephospho-CoA kinase domain containing, mRNA
           (cDNA clone MGC:94233 IMAGE:7131172), complete cds
          Length = 1735

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 490 tctttgtctcaaacaggagcgggatgtc 517
           |||| |||||||||||||| ||||||||
Sbjct: 531 tcttggtctcaaacaggagggggatgtc 504
to top
>ref|NM_001007724.1| Rattus norvegicus dephospho-CoA kinase domain containing (Dcakd),
           mRNA
          Length = 1735

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 490 tctttgtctcaaacaggagcgggatgtc 517
           |||| |||||||||||||| ||||||||
Sbjct: 531 tcttggtctcaaacaggagggggatgtc 504
to top
>gb|BC031855.1| Mus musculus mRNA similar to hypothetical protein FLJ22955 (cDNA
           clone IMAGE:3153968)
          Length = 1688

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 490 tctttgtctcaaacaggagcgggatgtc 517
           |||| |||||||||||||| ||||||||
Sbjct: 506 tcttggtctcaaacaggagggggatgtc 479
to top
>gb|BC005607.1| Mus musculus cDNA clone IMAGE:3498151, **** WARNING: chimeric clone
           ****
          Length = 1705

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 490 tctttgtctcaaacaggagcgggatgtc 517
           |||| |||||||||||||| ||||||||
Sbjct: 523 tcttggtctcaaacaggagggggatgtc 496
to top
>dbj|AK133329.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
            library, clone:4932433L21 product:unclassifiable, full
            insert sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 550  gttttagtatctcccagaat 569
            ||||||||||||||||||||
Sbjct: 2081 gttttagtatctcccagaat 2100
to top
>dbj|AK162069.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length
           enriched library, clone:7420401P06 product:Weakly
           similar to DEPHOSPHO-CoA kinase (RIKEN cDNA 6720485C15),
           full insert sequence
          Length = 1657

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 490 tctttgtctcaaacaggagcgggatgtc 517
           |||| |||||||||||||| ||||||||
Sbjct: 517 tcttggtctcaaacaggagggggatgtc 490
to top
>dbj|AK170762.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630118N02
           product:Weakly similar to DEPHOSPHO-CoA kinase (RIKEN
           cDNA 6720485C15), full insert sequence
          Length = 1486

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 490 tctttgtctcaaacaggagcgggatgtc 517
           |||| |||||||||||||| ||||||||
Sbjct: 508 tcttggtctcaaacaggagggggatgtc 481
to top
>gb|AC131183.4| Mus musculus BAC clone RP23-225A14 from chromosome 12, complete
             sequence
          Length = 141293

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 263   agcagacacctgcttcagca 282
             ||||||||||||||||||||
Sbjct: 53931 agcagacacctgcttcagca 53912
to top
>dbj|AK002835.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610039G20 product:hypothetical P-loop
           containing nucleotide triphosphate hydrolases structure
           containing protein, full insert sequence
          Length = 1321

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 490 tctttgtctcaaacaggagcgggatgtc 517
           |||| |||||||||||||| ||||||||
Sbjct: 157 tcttggtctcaaacaggagggggatgtc 130
to top
>dbj|AK051022.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:D030055P10 product:weakly
           similar to DEPHOSPHO-COA KINASE (EC 2.7.1.24)
           (DEPHOSPHOCOENZYME A KINASE) [Bacillus subtilis], full
           insert sequence
          Length = 1715

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 490 tctttgtctcaaacaggagcgggatgtc 517
           |||| |||||||||||||| ||||||||
Sbjct: 558 tcttggtctcaaacaggagggggatgtc 531
to top
>dbj|AK078460.1| Mus musculus 12 days embryo male wolffian duct includes surrounding
           region cDNA, RIKEN full-length enriched library,
           clone:6720485C15 product:weakly similar to DEPHOSPHO-COA
           KINASE (EC 2.7.1.24) (DEPHOSPHOCOENZYME A KINASE)
           [Bacillus subtilis], full insert sequence
          Length = 1656

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 490 tctttgtctcaaacaggagcgggatgtc 517
           |||| |||||||||||||| ||||||||
Sbjct: 490 tcttggtctcaaacaggagggggatgtc 463
to top
>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0431F01
          Length = 143209

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 168    agattcttctgagcaagcag 187
              ||||||||||||||||||||
Sbjct: 128828 agattcttctgagcaagcag 128847
to top
>dbj|AK180764.1| Mus musculus cDNA, clone:Y0G0115L23, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000021313, based on BLAT search
          Length = 197

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 490 tctttgtctcaaacaggagcgggatgtc 517
           |||| |||||||||||||| ||||||||
Sbjct: 38  tcttggtctcaaacaggagggggatgtc 11
to top
>dbj|AK180504.1| Mus musculus cDNA, clone:Y0G0114J06, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000021313, based on BLAT search
          Length = 197

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 490 tctttgtctcaaacaggagcgggatgtc 517
           |||| |||||||||||||| ||||||||
Sbjct: 38  tcttggtctcaaacaggagggggatgtc 11
to top
>dbj|BS000240.1| Pan troglodytes chromosome 22 clone:RP43-055A16, map 22, complete
             sequences
          Length = 185079

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    cgacacttggaaattttcaa 107
             ||||||||||||||||||||
Sbjct: 72328 cgacacttggaaattttcaa 72309
to top
>gb|AE005057.1| Halobacterium sp. NRC-1 section 88 of 170 of the complete genome
          Length = 15836

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 459  acgacaaccacggggtccgt 478
            ||||||||||||||||||||
Sbjct: 2839 acgacaaccacggggtccgt 2820
to top
>dbj|AK120694.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013170G05, full
            insert sequence
          Length = 4407

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 168  agattcttctgagcaagcag 187
            ||||||||||||||||||||
Sbjct: 1735 agattcttctgagcaagcag 1754
to top
>emb|AL163303.2|HS21C103 Homo sapiens chromosome 21 segment HS21C103
          Length = 340000

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 88     cgacacttggaaattttcaa 107
              ||||||||||||||||||||
Sbjct: 315255 cgacacttggaaattttcaa 315236
to top
>gb|BC023208.1| Mus musculus dephospho-CoA kinase domain containing, mRNA (cDNA
           clone IMAGE:4014529)
          Length = 1652

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 490 tctttgtctcaaacaggagcgggatgtc 517
           |||| |||||||||||||| ||||||||
Sbjct: 471 tcttggtctcaaacaggagggggatgtc 444
to top
>gb|BC042685.1| Mus musculus dephospho-CoA kinase domain containing, mRNA (cDNA
           clone IMAGE:5138524)
          Length = 1652

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 490 tctttgtctcaaacaggagcgggatgtc 517
           |||| |||||||||||||| ||||||||
Sbjct: 471 tcttggtctcaaacaggagggggatgtc 444
to top
>gb|BC045193.1| Mus musculus dephospho-CoA kinase domain containing, mRNA (cDNA
           clone MGC:49050 IMAGE:5368157), complete cds
          Length = 1716

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 490 tctttgtctcaaacaggagcgggatgtc 517
           |||| |||||||||||||| ||||||||
Sbjct: 511 tcttggtctcaaacaggagggggatgtc 484
to top
>gb|BC047340.1| Mus musculus dephospho-CoA kinase domain containing, mRNA (cDNA
           clone IMAGE:5135325)
          Length = 1652

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 490 tctttgtctcaaacaggagcgggatgtc 517
           |||| |||||||||||||| ||||||||
Sbjct: 471 tcttggtctcaaacaggagggggatgtc 444
to top
>gb|AC147245.3| Mus musculus BAC clone RP23-462E12 from 12, complete sequence
          Length = 179735

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 263   agcagacacctgcttcagca 282
             ||||||||||||||||||||
Sbjct: 39518 agcagacacctgcttcagca 39537
to top
>emb|AL731670.13| Mouse DNA sequence from clone RP23-463E7 on chromosome 11, complete
              sequence
          Length = 198411

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 490    tctttgtctcaaacaggagcgggatgtc 517
              |||| |||||||||||||| ||||||||
Sbjct: 168322 tcttggtctcaaacaggagggggatgtc 168349
to top
>emb|AJ011932.1|HSQ4H9 Homo sapiens chromosome 21q22.3, cosmid clone Q4H9 complete sequence
            bases 1..41604
          Length = 41604

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 88   cgacacttggaaattttcaa 107
            ||||||||||||||||||||
Sbjct: 4797 cgacacttggaaattttcaa 4778
to top
>dbj|AP000468.1| Homo sapiens genomic DNA, chromosome 21q22.3, clone:f60A9, complete
            sequence
          Length = 19636

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 88   cgacacttggaaattttcaa 107
            ||||||||||||||||||||
Sbjct: 2722 cgacacttggaaattttcaa 2703


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,271,231
Number of Sequences: 3902068
Number of extensions: 4271231
Number of successful extensions: 71548
Number of sequences better than 10.0: 43
Number of HSP's better than 10.0 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 71427
Number of HSP's gapped (non-prelim): 107
length of query: 596
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 573
effective length of database: 17,143,297,704
effective search space: 9823109584392
effective search space used: 9823109584392
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top