>gb|DQ128063.1| Triticum monococcum clone tm3-1, genomic sequence
          Length = 499

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 291 cctctaggcgccagactctctaccgtactcttcatccatgaggtctccttc 341
           |||||||||| | ||||| ||| || |||||||||||||||| || |||||
Sbjct: 345 cctctaggcgtcggactcgctatcgaactcttcatccatgagatcaccttc 295

>gb|DQ128062.1| Triticum monococcum clone p8-3, genomic sequence
          Length = 474

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 291 cctctaggcgccagactctctaccgtactcttcatccatgaggtctccttc 341
           |||||||||| | ||||| ||| || |||||||||||||||| || |||||
Sbjct: 345 cctctaggcgtcggactcgctatcgaactcttcatccatgagatcaccttc 295

>gb|DQ128035.1| Triticum aestivum clone A3-4 Ty3/gypsy-like retrotransposon,
           partial sequence
          Length = 486

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 291 cctctaggcgccagactctctaccgtactcttcatccatgaggtctccttc 341
           |||||||||| ||||||| ||| | || |||||||||||||| || |||||
Sbjct: 333 cctctaggcgtcagactcgctatcatattcttcatccatgagatcgccttc 283

>gb|AY642113.1| Dicentrarchus labrax follicle stimulating hormone receptor precursor
            (fshr) mRNA, complete cds
          Length = 3134

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 442  tgcagatgatggaggtggagt 462
            |||||||||||||||||||||
Sbjct: 1278 tgcagatgatggaggtggagt 1258

>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome
          Length = 2595221

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 369     cgcgatgtcgccgacggcgtc 389
               |||||||||||||||||||||
Sbjct: 1322406 cgcgatgtcgccgacggcgtc 1322426

>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome
          Length = 3551823

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 370     gcgatgtcgccgacggcgtcctgta 394
               |||||||||||| ||||||||||||
Sbjct: 3128846 gcgatgtcgccggcggcgtcctgta 3128870

>ref|XM_758721.1| Theileria parva strain Muguga chromosome 4 hypothetical protein
           (TP04_0179) partial mRNA
          Length = 1095

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 305 actctctaccgtactcttca 324
           ||||||||||||||||||||
Sbjct: 540 actctctaccgtactcttca 521

>emb|AL596217.6| Human DNA sequence from clone RP11-13J14 on chromosome 1 Contains a CpG
              island, complete sequence
          Length = 183774

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 446    gatgatggaggtggagtcac 465
              ||||||||||||||||||||
Sbjct: 111025 gatgatggaggtggagtcac 111044

>emb|AL022323.7|HS243E7 Human DNA sequence from clone CTA-243E7 on chromosome 22q12.1,
            complete sequence
          Length = 183113

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 56   gacagatatattacagtggt 75
            ||||||||||||||||||||
Sbjct: 1340 gacagatatattacagtggt 1359

>emb|AL008583.1|HS327J16 Human DNA sequence from clone RP3-327J16 on chromosome 22q12.3-13.2,
             complete sequence
          Length = 111746

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 524   gcagtgggatctcgatggag 543
             ||||||||||||||||||||
Sbjct: 49548 gcagtgggatctcgatggag 49529

>ref|XM_780757.1| PREDICTED: Strongylocentrotus purpuratus similar to Fc fragment of
            IgG binding protein (LOC580716), mRNA
          Length = 5268

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 43   acactatcataaggacagat 62
            ||||||||||||||||||||
Sbjct: 1049 acactatcataaggacagat 1068

>gb|AY038865.1|AY038861S05 Mus musculus protein tyrosine phosphatase receptor-like protein J
             (Ptprj) gene, intron 1
          Length = 13896

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 122   agtgacgtgacatgccataa 141
             ||||||||||||||||||||
Sbjct: 12146 agtgacgtgacatgccataa 12127

>ref|NM_058178.1| Homo sapiens neuronal pentraxin receptor (NPTXR), transcript variant
            2, mRNA
          Length = 5811

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 524  gcagtgggatctcgatggag 543
            ||||||||||||||||||||
Sbjct: 2168 gcagtgggatctcgatggag 2187

>ref|NM_014293.2| Homo sapiens neuronal pentraxin receptor (NPTXR), transcript variant
            1, mRNA
          Length = 5814

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 524  gcagtgggatctcgatggag 543
            ||||||||||||||||||||
Sbjct: 2171 gcagtgggatctcgatggag 2190

>emb|AL954341.14| Mouse DNA sequence from clone RP23-213D14 on chromosome 2, complete
              sequence
          Length = 178273

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 122    agtgacgtgacatgccataa 141
              ||||||||||||||||||||
Sbjct: 157578 agtgacgtgacatgccataa 157597

>emb|AL939130.1|SCO939130 Streptomyces coelicolor A3(2) complete genome; segment 27/29
          Length = 303450

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 371    cgatgtcgccgacggcgtcc 390
              ||||||||||||||||||||
Sbjct: 231486 cgatgtcgccgacggcgtcc 231467

>emb|AL162057.1|HSM802588 Homo sapiens mRNA; cDNA DKFZp761N0524 (from clone DKFZp761N0524)
          Length = 4459

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 524 gcagtgggatctcgatggag 543
           ||||||||||||||||||||
Sbjct: 812 gcagtgggatctcgatggag 831

>emb|AL161974.1|HSM802567 Homo sapiens mRNA; cDNA DKFZp761M2013 (from clone DKFZp761M2013)
          Length = 5140

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 524  gcagtgggatctcgatggag 543
            ||||||||||||||||||||
Sbjct: 1484 gcagtgggatctcgatggag 1503


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,934,936
Number of Sequences: 3902068
Number of extensions: 3934936
Number of successful extensions: 71668
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 71578
Number of HSP's gapped (non-prelim): 90
length of query: 568
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 545
effective length of database: 17,143,297,704
effective search space: 9343097248680
effective search space used: 9343097248680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)