ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd13j01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DQ267106.1| Triticum urartu clone BAC 210J24 chromosome 4A, c... 56 1e-04
2gb|AY821693.1| Australopyrum velutinum beta amylase gene, partia... 44 0.55
3emb|AL662807.8| Mouse DNA sequence from clone RP23-138O19 on chr... 44 0.55
4gb|AC183492.1| Brassica oleracea Contig G, complete sequence 44 0.55
5gb|AC154028.7| Mus musculus 10 BAC RP23-246J13 (Roswell Park Can... 44 0.55
6gb|AY398686.1| Synthetic construct expression cassette for expre... 42 2.2
7emb|AL359706.18| Human DNA sequence from clone RP11-245H20 on ch... 42 2.2
8gb|AY785888.1| Hordeum vulgare subsp. vulgare cultivar Optic HvC... 42 2.2
9gb|AY785858.1| Hordeum vulgare subsp. vulgare cultivar Optic HvC... 42 2.2
10gb|AC012625.7| Homo sapiens chromosome 5 clone CTD-2091N23, comp... 42 2.2
11gb|AF409096.1|AF409096 Capra hircus beta-casein precursor (csn2)... 42 2.2
12gb|AC009498.4| Homo sapiens BAC clone RP11-507C18 from 2, comple... 42 2.2
13emb|BX927095.15| Zebrafish DNA sequence from clone CH211-202E13 ... 42 2.2
14emb|AL929131.5| Zebrafish DNA sequence from clone CH211-286O17, ... 42 2.2
15emb|AJ011018.2|CHI011018 Capra hircus csn2 gene, exons 1 to 9, a... 42 2.2
16emb|AJ011019.2|CHI011019 Capra hircus csn2 gene, exons 1 to 9, a... 42 2.2
17gb|M90562.1|GOTBCAS07 Goat beta-casein gene, exon 9 and complete... 42 2.2
18gb|AC092173.3| Oryza sativa (japonica cultivar-group) chromosome... 40 8.6
19gb|AC091238.2| Oryza sativa (japonica cultivar-group) chromosome... 40 8.6
20gb|AC132441.3| Mus musculus BAC clone RP23-239J2 from chromosome... 40 8.6
21gb|DQ481667.1| Takifugu rubripes HoxCa gene cluster, complete se... 40 8.6
22gb|AC102698.8| Mus musculus chromosome 3, clone RP24-149G20, com... 40 8.6
23gb|AC164575.7| Mus musculus 10 BAC RP23-455M6 (Roswell Park Canc... 40 8.6
24emb|CR626934.1| Triticum aestivum 40 8.6
25gb|AC105404.4| Mus musculus BAC clone RP24-112M13 from chromosom... 40 8.6
26gb|AC114009.4| Mus musculus BAC clone RP23-385K2 from 8, complet... 40 8.6
27emb|CR706305.2|CNS0G7XP Tetraodon nigroviridis full-length cDNA 40 8.6
28emb|CR387996.13| Zebrafish DNA sequence from clone DKEY-183N6 in... 40 8.6
29emb|AL590998.7| Human DNA sequence from clone RP4-677A15 on chro... 40 8.6
30emb|AL096855.48|HS1115A15 Human DNA sequence from clone RP5-1115... 40 8.6
31emb|AL021397.1|HS69E11 Human DNA sequence from clone RP1-69E11 o... 40 8.6
32gb|AC163293.4| Mus musculus BAC clone RP23-156J21 from chromosom... 40 8.6
33emb|AL670011.1|NC18F11 Neurospora crassa DNA linkage group V Cos... 40 8.6
34emb|AL670010.1|NCB10H4 Neurospora crassa DNA linkage group V BAC... 40 8.6
35emb|AL606648.3|OSJN00093 Oryza sativa genomic DNA, chromosome 4,... 40 8.6
36emb|AL669931.9| Mouse DNA sequence from clone RP23-31D18 on chro... 40 8.6
37emb|CR749163.11| Zebrafish DNA sequence from clone CH211-216B21 ... 40 8.6
38gb|AC153013.3| Mus musculus BAC clone RP23-273N8 from chromosome... 40 8.6
39emb|BX927252.5| Zebrafish DNA sequence from clone CH211-212O10 i... 40 8.6
40gb|AC093009.5| Homo sapiens 3 BAC RP11-548O23 (Roswell Park Canc... 40 8.6
41gb|AC114945.2| Homo sapiens chromosome 5 clone CTD-2604I2, compl... 40 8.6
42gb|AC027152.11| Homo sapiens chromosome 17, clone RP11-456D7, co... 40 8.6
43dbj|AB108373.1| Phleum pratense DNA, SSR, microsatellite C02-D09 40 8.6
44gb|AC107216.5| Homo sapiens BAC clone RP11-490A22 from 4, comple... 40 8.6
45gb|AF486809.1| Bactrocera dorsalis strain white eye transposon h... 40 8.6
46gb|AC093913.2| Homo sapiens BAC clone RP11-768G3 from 4, complet... 40 8.6
47gb|AF306829.1|AF306829 Triticum urartu clone 581 cytosolic acety... 40 8.6
48gb|AF306828.1|AF306828 Triticum turgidum subsp. dicoccoides clon... 40 8.6
49gb|AF306827.1|AF306827 Triticum monococcum subsp. monococcum clo... 40 8.6
50gb|AF306826.1|AF306826 Triticum timopheevii subsp. armeniacum cl... 40 8.6
51gb|AF306825.1|AF306825 Triticum timopheevii subsp. timopheevii c... 40 8.6
52gb|AF306824.1|AF306824 Triticum timopheevii subsp. armeniacum cl... 40 8.6
53gb|U70428.1|BDU70428 Bactrocera dorsalis transposon hopper, comp... 40 8.6
54dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.6
55dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.6
56dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.6
57gb|AC022093.6| Homo sapiens chromosome 5 clone CTB-169E12, compl... 40 8.6
58dbj|AP003924.2| Oryza sativa (japonica cultivar-group) genomic D... 40 8.6
59emb|BX470215.5| Mouse DNA sequence from clone RP24-558L5 on chro... 40 8.6
60emb|BX293537.10| Mouse DNA sequence from clone RP23-240M8 on chr... 40 8.6
61emb|BX255927.5| Mouse DNA sequence from clone RP24-87C23 on chro... 40 8.6
62gb|AF223391.1|AF239258S3 Homo sapiens calcium channel alpha1E su... 40 8.6
63emb|BX088688.6| Zebrafish DNA sequence from clone CH211-278F21 i... 40 8.6
64emb|CR962123.2| Medicago truncatula chromosome 5 clone mth2-167a... 40 8.6
65gb|AE015927.1| Clostridium tetani E88, complete genome 40 8.6
66gb|AF017719.1|HSGLRA3S05 Homo sapiens glycine receptor alpha 3 s... 40 8.6
67gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 8.6
68emb|AL772138.15| Mouse DNA sequence from clone RP23-213F17 on ch... 40 8.6
69gb|AC117703.8| Mus musculus chromosome 10, clone RP23-465J13, co... 40 8.6
70gb|AC153943.3| Mus musculus 10 BAC RP24-408O23 (Roswell Park Can... 40 8.6
71emb|AL607041.18| Mouse DNA sequence from clone RP23-434K11 on ch... 40 8.6
72emb|AL935172.8| Mouse DNA sequence from clone RP23-261J24 on chr... 40 8.6
73emb|AL691489.20| Mouse DNA sequence from clone RP23-176N9 on chr... 40 8.6
74gb|AY863213.1| Smittium culisetae mitochondrion, complete genome 40 8.6

>gb|DQ267106.1| Triticum urartu clone BAC 210J24 chromosome 4A, complete sequence
          Length = 111912

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                 
Query: 249   tctaaaacgtcttatattgatgaacagagggagtac 284
             ||||||||||| ||||||| ||||||||||||||||
Sbjct: 74272 tctaaaacgtcctatattggtgaacagagggagtac 74307



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 253   aaacgtcttatattgatgaacagagggagtac 284
             ||||||||| |||| |||||||||||||||||
Sbjct: 74253 aaacgtcttgtattaatgaacagagggagtac 74222



to top

>gb|AY821693.1| Australopyrum velutinum beta amylase gene, partial cds; and Stowaway
            MITE, complete sequence
          Length = 1595

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 247  tctctaaaacgtcttatattgatgaacagagggagtac 284
            ||||||||| | |||||||| | |||||||||||||||
Sbjct: 1341 tctctaaaaagacttatatttaggaacagagggagtac 1378



to top

>emb|AL662807.8| Mouse DNA sequence from clone RP23-138O19 on chromosome 13 Contains the
             Hdgfrp1 gene for hepatoma-derived growth factor related
             protein 1 and a ribosomal protein 27A (Rpl27a) pseudogene,
             complete sequence
          Length = 188325

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 564   aatcccagggttgtttttgttt 585
             ||||||||||||||||||||||
Sbjct: 96044 aatcccagggttgtttttgttt 96023



to top

>gb|AC183492.1| Brassica oleracea Contig G, complete sequence
          Length = 236640

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                    
Query: 247    tctctaaaacgtcttatattgatgaacagagggagtac 284
              ||||||||||| |||||||| |  ||||||||||||||
Sbjct: 235433 tctctaaaacgacttatattaaaaaacagagggagtac 235396



to top

>gb|AC154028.7| Mus musculus 10 BAC RP23-246J13 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 206191

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 564    aatcccagggttgtttttgttt 585
              ||||||||||||||||||||||
Sbjct: 114514 aatcccagggttgtttttgttt 114535



to top

>gb|AY398686.1| Synthetic construct expression cassette for expression of Homo
            sapiens antithrombin (SERPINC1) cDNA controlled by the
            Capra hicrus beta-casein (CSN2) gene
          Length = 14747

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 360  atatcaaattatgtataaaaa 380
            |||||||||||||||||||||
Sbjct: 9206 atatcaaattatgtataaaaa 9226



to top

>emb|AL359706.18| Human DNA sequence from clone RP11-245H20 on chromosome 13 Contains the
             5' end of the NUFIP1 gene for nuclear fragile X mental
             retardation protein interacting protein 1, the gene for
             lipopolysaccharide specific response-7 protein (LSR7) and
             a CpG island, complete sequence
          Length = 61576

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 121   cattaggcagggaggccttca 141
             |||||||||||||||||||||
Sbjct: 44575 cattaggcagggaggccttca 44555



to top

>gb|AY785888.1| Hordeum vulgare subsp. vulgare cultivar Optic HvCBF10B (CBF10B)
           mRNA, complete cds
          Length = 1041

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 247 tctctaaaacgtcttatattgatgaacagagggagta 283
           ||||||||| ||||||||||   ||||||||||||||
Sbjct: 943 tctctaaaaggtcttatattttagaacagagggagta 907



to top

>gb|AY785858.1| Hordeum vulgare subsp. vulgare cultivar Optic HvCBF5 (CBF5) mRNA,
            complete cds
          Length = 1285

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 247  tctctaaaacgtcttatattgatgaacagagggagta 283
            ||||||||| | | |||||| ||||||||||||||||
Sbjct: 1230 tctctaaaatggcgtatatttatgaacagagggagta 1194



to top

>gb|AC012625.7| Homo sapiens chromosome 5 clone CTD-2091N23, complete sequence
          Length = 151225

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 378   aaacattcctagaaatactta 398
             |||||||||||||||||||||
Sbjct: 73860 aaacattcctagaaatactta 73840



to top

>gb|AF409096.1|AF409096 Capra hircus beta-casein precursor (csn2) gene, complete cds
          Length = 13671

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 360   atatcaaattatgtataaaaa 380
             |||||||||||||||||||||
Sbjct: 13455 atatcaaattatgtataaaaa 13475



to top

>gb|AC009498.4| Homo sapiens BAC clone RP11-507C18 from 2, complete sequence
          Length = 199954

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 574    ttgtttttgtttcttcaatat 594
              |||||||||||||||||||||
Sbjct: 144527 ttgtttttgtttcttcaatat 144547



to top

>emb|BX927095.15| Zebrafish DNA sequence from clone CH211-202E13 in linkage group 17,
            complete sequence
          Length = 211277

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 358  atatatcaaattatgtataaaaaca 382
            ||||||||||||||| |||||||||
Sbjct: 4966 atatatcaaattatggataaaaaca 4990



to top

>emb|AL929131.5| Zebrafish DNA sequence from clone CH211-286O17, complete sequence
          Length = 152081

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 218    gtgaatgcactatatatactc 238
              |||||||||||||||||||||
Sbjct: 150812 gtgaatgcactatatatactc 150792



to top

>emb|AJ011018.2|CHI011018 Capra hircus csn2 gene, exons 1 to 9, allele A
          Length = 10088

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 360  atatcaaattatgtataaaaa 380
            |||||||||||||||||||||
Sbjct: 9907 atatcaaattatgtataaaaa 9927



to top

>emb|AJ011019.2|CHI011019 Capra hircus csn2 gene, exons 1 to 9, allele 0(null)
          Length = 10087

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 360  atatcaaattatgtataaaaa 380
            |||||||||||||||||||||
Sbjct: 9906 atatcaaattatgtataaaaa 9926



to top

>gb|M90562.1|GOTBCAS07 Goat beta-casein gene, exon 9 and complete cds
          Length = 494

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 360 atatcaaattatgtataaaaa 380
           |||||||||||||||||||||
Sbjct: 294 atatcaaattatgtataaaaa 314



to top

>gb|AC092173.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBa0095J15,
              complete sequence
          Length = 156023

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                  
Query: 248    ctctaaaacgtcttatattgatgaacagagggagta 283
              ||||||||| |||||||||   ||||||||||||||
Sbjct: 112803 ctctaaaacttcttatattctggaacagagggagta 112838



to top

>gb|AC091238.2| Oryza sativa (japonica cultivar-group) chromosome 10 clone
            OSJNBb0022I16, complete sequence
          Length = 127068

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                
Query: 248  ctctaaaacgtcttatattgatgaacagagggagta 283
            ||||||||| |||||||||   ||||||||||||||
Sbjct: 4230 ctctaaaacttcttatattctggaacagagggagta 4265



to top

>gb|AC132441.3| Mus musculus BAC clone RP23-239J2 from chromosome 18, complete sequence
          Length = 189507

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 561    tgaaatcccagggttgtttt 580
              ||||||||||||||||||||
Sbjct: 150200 tgaaatcccagggttgtttt 150219



to top

>gb|DQ481667.1| Takifugu rubripes HoxCa gene cluster, complete sequence
          Length = 378763

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 109    tcagcatcatctcattaggc 128
              ||||||||||||||||||||
Sbjct: 263058 tcagcatcatctcattaggc 263077



to top

>gb|AC102698.8| Mus musculus chromosome 3, clone RP24-149G20, complete sequence
          Length = 167457

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 561    tgaaatcccagggttgtttt 580
              ||||||||||||||||||||
Sbjct: 131485 tgaaatcccagggttgtttt 131504



to top

>gb|AC164575.7| Mus musculus 10 BAC RP23-455M6 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 196723

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 561    tgaaatcccagggttgtttt 580
              ||||||||||||||||||||
Sbjct: 151329 tgaaatcccagggttgtttt 151348



to top

>emb|CR626934.1| Triticum aestivum
          Length = 94398

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 249   tctaaaacgtcttatattgatgaacagagggagtac 284
             ||||||| | |||||||| | |||||||||||||||
Sbjct: 49946 tctaaaaagacttatatttaggaacagagggagtac 49911



to top

>gb|AC105404.4| Mus musculus BAC clone RP24-112M13 from chromosome 16, complete
             sequence
          Length = 127531

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 561   tgaaatcccagggttgtttt 580
             ||||||||||||||||||||
Sbjct: 71931 tgaaatcccagggttgtttt 71912



to top

>gb|AC114009.4| Mus musculus BAC clone RP23-385K2 from 8, complete sequence
          Length = 202089

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 561   tgaaatcccagggttgtttt 580
             ||||||||||||||||||||
Sbjct: 21951 tgaaatcccagggttgtttt 21932



to top

>emb|CR706305.2|CNS0G7XP Tetraodon nigroviridis full-length cDNA
          Length = 834

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 578 ttttgtttcttcaatatggc 597
           ||||||||||||||||||||
Sbjct: 182 ttttgtttcttcaatatggc 201



to top

>emb|CR387996.13| Zebrafish DNA sequence from clone DKEY-183N6 in linkage group 3, complete
              sequence
          Length = 210145

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 253    aaacgtcttatattgatgaacaga 276
              ||||||||||| ||||||||||||
Sbjct: 146307 aaacgtcttattttgatgaacaga 146330



to top

>emb|AL590998.7| Human DNA sequence from clone RP4-677A15 on chromosome 1 Contains
            parrt of the CACNA1E gene for calcium channel
            voltage-dependent alpha 1E subunit, complete sequence
          Length = 102196

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 223  tgcactatatatactcctct 242
            ||||||||||||||||||||
Sbjct: 8252 tgcactatatatactcctct 8271



to top

>emb|AL096855.48|HS1115A15 Human DNA sequence from clone RP5-1115A15 on chromosome 1p36.11-36.31
             Contains part of the RERE gene for arginine-glutamic acid
             dipeptide (RE) repeats (KIAA0458, FLJ38775), a novel gene
             and a CpG island, complete sequence
          Length = 178403

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 145   acacatcaactcaactaaca 164
             ||||||||||||||||||||
Sbjct: 27844 acacatcaactcaactaaca 27863



to top

>emb|AL021397.1|HS69E11 Human DNA sequence from clone RP1-69E11 on chromosome 1q23-24 Contains
             a novel gene (MGC3794), a ribosomal protein L34 pseudogene
             1,  a NADH dehydrogenase (ubiquinone) 1 alpha subcomplex,
             4, 9kDa (NDUFA4) pseudogene and two CpG islands, complete
             sequence
          Length = 63916

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 262   atattgatgaacagagggag 281
             ||||||||||||||||||||
Sbjct: 14278 atattgatgaacagagggag 14297



to top

>gb|AC163293.4| Mus musculus BAC clone RP23-156J21 from chromosome 16, complete
             sequence
          Length = 205834

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 561   tgaaatcccagggttgtttt 580
             ||||||||||||||||||||
Sbjct: 23094 tgaaatcccagggttgtttt 23113



to top

>emb|AL670011.1|NC18F11 Neurospora crassa DNA linkage group V Cosmid contig 18F11
          Length = 89222

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 545   caatatctcgaatntttgaaatc 567
             ||||||||||||| |||||||||
Sbjct: 59559 caatatctcgaatatttgaaatc 59537



to top

>emb|AL670010.1|NCB10H4 Neurospora crassa DNA linkage group V BAC contig B10H4
          Length = 90763

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 545  caatatctcgaatntttgaaatc 567
            ||||||||||||| |||||||||
Sbjct: 4855 caatatctcgaatatttgaaatc 4833



to top

>emb|AL606648.3|OSJN00093 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0093O08,
             complete sequence
          Length = 148860

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 248   ctctaaaacgtcttatattgatgaacagagggagta 283
             ||||||||| | ||||||| | ||||||||||||||
Sbjct: 22425 ctctaaaacttgttatattcaagaacagagggagta 22390



to top

>emb|AL669931.9| Mouse DNA sequence from clone RP23-31D18 on chromosome 11 Contains the
              Stc2 gene for stanniocalcin 2 and three CpG islands,
              complete sequence
          Length = 252980

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 561    tgaaatcccagggttgtttt 580
              ||||||||||||||||||||
Sbjct: 187590 tgaaatcccagggttgtttt 187609



to top

>emb|CR749163.11| Zebrafish DNA sequence from clone CH211-216B21 in linkage group 5,
             complete sequence
          Length = 189369

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 361   tatcaaattatgtataaaaa 380
             ||||||||||||||||||||
Sbjct: 23111 tatcaaattatgtataaaaa 23092



to top

>gb|AC153013.3| Mus musculus BAC clone RP23-273N8 from chromosome 8, complete sequence
          Length = 196609

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 561    tgaaatcccagggttgtttt 580
              ||||||||||||||||||||
Sbjct: 135394 tgaaatcccagggttgtttt 135375



to top

>emb|BX927252.5| Zebrafish DNA sequence from clone CH211-212O10 in linkage group 5,
              complete sequence
          Length = 176261

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 361    tatcaaattatgtataaaaa 380
              ||||||||||||||||||||
Sbjct: 166282 tatcaaattatgtataaaaa 166301



to top

>gb|AC093009.5| Homo sapiens 3 BAC RP11-548O23 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 89214

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 328   agatgacagtaagtactctg 347
             ||||||||||||||||||||
Sbjct: 85829 agatgacagtaagtactctg 85848



to top

>gb|AC114945.2| Homo sapiens chromosome 5 clone CTD-2604I2, complete sequence
          Length = 129575

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 358   atatatcaaattatgtataa 377
             ||||||||||||||||||||
Sbjct: 97903 atatatcaaattatgtataa 97922



to top

>gb|AC027152.11| Homo sapiens chromosome 17, clone RP11-456D7, complete sequence
          Length = 132735

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 373    tataaaaacattcctagaaatact 396
              |||||||||||| |||||||||||
Sbjct: 104514 tataaaaacatttctagaaatact 104491



to top

>dbj|AB108373.1| Phleum pratense DNA, SSR, microsatellite C02-D09
          Length = 547

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 252 aaaacgtcttatattgatgaacagagggagta 283
           ||||||||||| ||| ||||||||||| ||||
Sbjct: 475 aaaacgtcttacatttatgaacagaggcagta 506



to top

>gb|AC107216.5| Homo sapiens BAC clone RP11-490A22 from 4, complete sequence
          Length = 115109

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 516    tgttattttttgatcctcaatttg 539
              |||||||||| |||||||||||||
Sbjct: 103736 tgttatttttagatcctcaatttg 103759



to top

>gb|AF486809.1| Bactrocera dorsalis strain white eye transposon hopper, complete
           sequence
          Length = 3131

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 361 tatcaaattatgtataaaaacatt 384
           |||| |||||||||||||||||||
Sbjct: 850 tatctaattatgtataaaaacatt 827



to top

>gb|AC093913.2| Homo sapiens BAC clone RP11-768G3 from 4, complete sequence
          Length = 192059

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 422    ccttccagttttctgacagt 441
              ||||||||||||||||||||
Sbjct: 121711 ccttccagttttctgacagt 121692



to top

>gb|AF306829.1|AF306829 Triticum urartu clone 581 cytosolic acetyl-CoA carboxylase gene,
           partial cds
          Length = 1812

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 252 aaaacgtcttatattgatgaacagaggg 279
           ||||||||||||||| | ||||||||||
Sbjct: 739 aaaacgtcttatatttaggaacagaggg 766



to top

>gb|AF306828.1|AF306828 Triticum turgidum subsp. dicoccoides clone 465 cytosolic acetyl-CoA
           carboxylase gene, partial cds
          Length = 1836

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 252 aaaacgtcttatattgatgaacagaggg 279
           ||||||||||||||| | ||||||||||
Sbjct: 739 aaaacgtcttatatttaggaacagaggg 766



to top

>gb|AF306827.1|AF306827 Triticum monococcum subsp. monococcum clone 437 cytosolic
           acetyl-CoA carboxylase gene, partial cds
          Length = 1812

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 252 aaaacgtcttatattgatgaacagaggg 279
           ||||||||||||||| | ||||||||||
Sbjct: 739 aaaacgtcttatatttaggaacagaggg 766



to top

>gb|AF306826.1|AF306826 Triticum timopheevii subsp. armeniacum clone 506 cytosolic
           acetyl-CoA carboxylase gene, partial cds
          Length = 1797

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 252 aaaacgtcttatattgatgaacagagggagta 283
           ||||||||||||||| | ||||||||| ||||
Sbjct: 725 aaaacgtcttatatttaggaacagaggtagta 694



to top

>gb|AF306825.1|AF306825 Triticum timopheevii subsp. timopheevii clone 513 cytosolic
           acetyl-CoA carboxylase gene, partial cds
          Length = 1796

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 252 aaaacgtcttatattgatgaacagagggagta 283
           ||||||||||||||| | ||||||||| ||||
Sbjct: 725 aaaacgtcttatatttaggaacagaggtagta 694



to top

>gb|AF306824.1|AF306824 Triticum timopheevii subsp. armeniacum clone 453 cytosolic
           acetyl-CoA carboxylase gene, partial cds
          Length = 1812

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 252 aaaacgtcttatattgatgaacagaggg 279
           ||||||||||||||| | ||||||||||
Sbjct: 739 aaaacgtcttatatttaggaacagaggg 766



to top

>gb|U70428.1|BDU70428 Bactrocera dorsalis transposon hopper, complete sequence
          Length = 3120

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 361 tatcaaattatgtataaaaacatt 384
           |||| |||||||||||||||||||
Sbjct: 847 tatctaattatgtataaaaacatt 824



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                    
Query: 248      ctctaaaacgtcttatattgatgaacagagggagta 283
                ||||||||| | ||||||| | ||||||||||||||
Sbjct: 31325619 ctctaaaacttgttatattcaagaacagagggagta 31325584



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                   
Query: 248     ctctaaaacgtcttatattgatgaacagagggagta 283
               ||||||||| |||||||||   ||||||||||||||
Sbjct: 5241032 ctctaaaacttcttatattctggaacagagggagta 5241067



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                                
Query: 252      aaaacgtcttatattgatgaacagagggagta 283
                ||||||||||||| ||  ||||||||||||||
Sbjct: 21192973 aaaacgtcttataatgtagaacagagggagta 21193004



to top

>gb|AC022093.6| Homo sapiens chromosome 5 clone CTB-169E12, complete sequence
          Length = 84633

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 358   atatatcaaattatgtataa 377
             ||||||||||||||||||||
Sbjct: 76181 atatatcaaattatgtataa 76162



to top

>dbj|AP003924.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1064G04
          Length = 186704

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 252   aaaacgtcttatattgatgaacagagggagta 283
             ||||||||||||| ||  ||||||||||||||
Sbjct: 90482 aaaacgtcttataatgtagaacagagggagta 90513



to top

>emb|BX470215.5| Mouse DNA sequence from clone RP24-558L5 on chromosome X, complete
              sequence
          Length = 137502

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 561    tgaaatcccagggttgtttt 580
              ||||||||||||||||||||
Sbjct: 112294 tgaaatcccagggttgtttt 112275



to top

>emb|BX293537.10| Mouse DNA sequence from clone RP23-240M8 on chromosome X, complete
             sequence
          Length = 163726

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 561   tgaaatcccagggttgtttt 580
             ||||||||||||||||||||
Sbjct: 35199 tgaaatcccagggttgtttt 35180



to top

>emb|BX255927.5| Mouse DNA sequence from clone RP24-87C23 on chromosome 4, complete
             sequence
          Length = 56759

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 561   tgaaatcccagggttgtttt 580
             ||||||||||||||||||||
Sbjct: 52339 tgaaatcccagggttgtttt 52358



to top

>gb|AF223391.1|AF239258S3 Homo sapiens calcium channel alpha1E subunit (CACNA1E) gene, exons
             7-49, and partial cds, alternatively spliced
          Length = 316704

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 223   tgcactatatatactcctct 242
             ||||||||||||||||||||
Sbjct: 65753 tgcactatatatactcctct 65772



to top

>emb|BX088688.6| Zebrafish DNA sequence from clone CH211-278F21 in linkage group 20,
              complete sequence
          Length = 179801

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 568    ccagggttgtttttgtttct 587
              ||||||||||||||||||||
Sbjct: 120717 ccagggttgtttttgtttct 120736



to top

>emb|CR962123.2| Medicago truncatula chromosome 5 clone mth2-167a19, COMPLETE SEQUENCE
          Length = 128818

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 352    cacttgatatatcaaattat 371
              ||||||||||||||||||||
Sbjct: 115149 cacttgatatatcaaattat 115130



to top

>gb|AE015927.1| Clostridium tetani E88, complete genome
          Length = 2799251

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 365     aaattatgtataaaaacatt 384
               ||||||||||||||||||||
Sbjct: 2414160 aaattatgtataaaaacatt 2414141



to top

>gb|AF017719.1|HSGLRA3S05 Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 5
          Length = 515

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 516 tgttattttttgatcctcaatttg 539
           |||||||||| |||||||||||||
Sbjct: 494 tgttatttttagatcctcaatttg 471



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                   
Query: 248     ctctaaaacgtcttatattgatgaacagagggagta 283
               ||||||||| |||||||||   ||||||||||||||
Sbjct: 5241819 ctctaaaacttcttatattctggaacagagggagta 5241854



to top

>emb|AL772138.15| Mouse DNA sequence from clone RP23-213F17 on chromosome 4, complete
             sequence
          Length = 229213

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 575   tgtttttgtttcttcaatat 594
             ||||||||||||||||||||
Sbjct: 98371 tgtttttgtttcttcaatat 98390



to top

>gb|AC117703.8| Mus musculus chromosome 10, clone RP23-465J13, complete sequence
          Length = 201237

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 561    tgaaatcccagggttgtttt 580
              ||||||||||||||||||||
Sbjct: 200155 tgaaatcccagggttgtttt 200136



to top

>gb|AC153943.3| Mus musculus 10 BAC RP24-408O23 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 171960

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 605   acttgctatgccaatgacat 624
             ||||||||||||||||||||
Sbjct: 85424 acttgctatgccaatgacat 85443



to top

>emb|AL607041.18| Mouse DNA sequence from clone RP23-434K11 on chromosome 11, complete
              sequence
          Length = 198761

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 570    agggttgtttttgtttcttc 589
              ||||||||||||||||||||
Sbjct: 197874 agggttgtttttgtttcttc 197855



to top

>emb|AL935172.8| Mouse DNA sequence from clone RP23-261J24 on chromosome 11, complete
            sequence
          Length = 142614

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 570  agggttgtttttgtttcttc 589
            ||||||||||||||||||||
Sbjct: 1113 agggttgtttttgtttcttc 1094



to top

>emb|AL691489.20| Mouse DNA sequence from clone RP23-176N9 on chromosome 2, complete
              sequence
          Length = 194864

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 577    tttttgtttcttcaatatgg 596
              ||||||||||||||||||||
Sbjct: 132085 tttttgtttcttcaatatgg 132104



to top

>gb|AY863213.1| Smittium culisetae mitochondrion, complete genome
          Length = 58654

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 358   atatatcaaattatgtataa 377
             ||||||||||||||||||||
Sbjct: 54732 atatatcaaattatgtataa 54751


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,124,647
Number of Sequences: 3902068
Number of extensions: 6124647
Number of successful extensions: 130314
Number of sequences better than 10.0: 74
Number of HSP's better than 10.0 without gapping: 72
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 129986
Number of HSP's gapped (non-prelim): 371
length of query: 630
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 607
effective length of database: 17,143,297,704
effective search space: 10405981706328
effective search space used: 10405981706328
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top