ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd13i16
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein 1063 0.0
2gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intr... 607 e-170
3gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, c... 502 e-139
4gb|BT016300.1| Zea mays clone Contig133 mRNA sequence 494 e-136
5gb|AY104464.1| Zea mays PCO114899 mRNA sequence 486 e-134
6gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmT... 486 e-134
7gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 440 e-120
8gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nippon... 440 e-120
9dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 440 e-120
10dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, com... 440 e-120
11dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clon... 440 e-120
12dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clon... 440 e-120
13dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clon... 440 e-120
14dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clon... 440 e-120
15ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predic... 422 e-115
16emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative... 337 2e-89
17dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clon... 305 8e-80
18gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral prot... 240 4e-60
19ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predic... 214 2e-52
20dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 214 2e-52
21dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 214 2e-52
22dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D... 214 2e-52
23dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic D... 214 2e-52
24dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic D... 214 2e-52
25dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clon... 214 2e-52
26dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clon... 214 2e-52
27dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mR... 214 2e-52
28dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clon... 214 2e-52
29dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clon... 214 2e-52
30dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clon... 214 2e-52
31dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clon... 214 2e-52
32dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clon... 214 2e-52
33dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clon... 214 2e-52
34dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clon... 214 2e-52
35gb|AY112388.1| Zea mays CL24208_1 mRNA sequence 212 9e-52
36dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clon... 206 6e-50
37gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic prote... 196 5e-47
38gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic prote... 196 5e-47
39gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic prote... 196 5e-47
40gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral prot... 192 8e-46
41gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds 180 3e-42
42gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral prot... 180 3e-42
43gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intr... 180 3e-42
44gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRN... 180 3e-42
45gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral prot... 176 5e-41
46gb|AY105015.1| Zea mays PCO137646 mRNA sequence 176 5e-41
47gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast int... 172 8e-40
48gb|AY106931.1| Zea mays PCO140073 mRNA sequence 172 8e-40
49gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic prote... 155 2e-34
50ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA 149 1e-32
51dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 149 1e-32
52dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic D... 149 1e-32
53dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic D... 149 1e-32
54dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mR... 149 1e-32
55dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clon... 149 1e-32
56emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chro... 149 1e-32
57dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 7e-31
58ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predic... 119 1e-23
59emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4,... 119 1e-23
60dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 119 1e-23
61emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein 101 2e-18
62gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast int... 101 2e-18
63emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Co... 98 4e-17
64dbj|D84669.1| Raphanus sativus mRNA for VM23, complete sequence 92 2e-15
65ref|NM_113559.3| Arabidopsis thaliana TIP2 (TONOPLAST INTRINSIC ... 90 9e-15
66emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative to... 90 9e-15
67gb|AY079114.1| Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, comp... 90 9e-15
68gb|AF419613.1|AF419613 Arabidopsis thaliana AT3g26520/MFE16_3 mR... 90 9e-15
69gb|AF428341.1|AF428341 Arabidopsis thaliana AT3g26520/MFE16_3 mR... 90 9e-15
70gb|AF004393.1|AF004393 Arabidopsis thaliana salt-stress induced ... 90 9e-15
71emb|BX822807.1|CNS0A75T Arabidopsis thaliana Full-length cDNA Co... 90 9e-15
72emb|BX822624.1|CNS0A742 Arabidopsis thaliana Full-length cDNA Co... 90 9e-15
73emb|BX824073.1|CNS0A6T2 Arabidopsis thaliana Full-length cDNA Co... 90 9e-15
74emb|BX822975.1|CNS0A733 Arabidopsis thaliana Full-length cDNA Co... 90 9e-15
75emb|BX824311.1|CNS0A6PE Arabidopsis thaliana Full-length cDNA Co... 90 9e-15
76emb|BX823637.1|CNS0A6I3 Arabidopsis thaliana Full-length cDNA Co... 90 9e-15
77emb|BX823607.1|CNS0A6MK Arabidopsis thaliana Full-length cDNA Co... 90 9e-15
78dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 90 9e-15
79gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protei... 90 9e-15
80dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds 88 4e-14
81ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa822... 86 1e-13
82gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral prot... 86 1e-13
83dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
84dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 1e-13
85dbj|AB048248.1| Pyrus communis Py-gTIP mRNA for gamma tonoplast ... 86 1e-13
86emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for put... 82 2e-12
87gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds 82 2e-12
88gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast i... 80 9e-12
89emb|BX822304.1|CNS0A7A0 Arabidopsis thaliana Full-length cDNA Co... 80 9e-12
90ref|XM_473251.1| Oryza sativa (japonica cultivar-group), predic... 78 3e-11
91emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4,... 78 3e-11
92gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral prot... 78 3e-11
93dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsi... 78 3e-11
94dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intri... 78 3e-11
95dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
96dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds 76 1e-10
97emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic... 74 5e-10
98emb|BX825064.1|CNS0A6TA Arabidopsis thaliana Full-length cDNA Co... 74 5e-10
99emb|BX842211.1|CNS09YE1 Arabidopsis thaliana Full-length cDNA Co... 74 5e-10
100emb|BX842138.1|CNS09YDN Arabidopsis thaliana Full-length cDNA Co... 74 5e-10
101emb|BX842163.1|CNS09YDT Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
102gb|AF057137.1|AF057137 Arabidopsis thaliana gamma tonoplast intr... 72 2e-09
103dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds 68 3e-08
104gb|DQ237285.1| Panax ginseng tonoplast intrinsic protein (TIP1) ... 66 1e-07
105emb|AJ133748.1|PAB133748 Picea abies mRNA for major intrinsic pr... 66 1e-07
106ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative... 64 5e-07
107ref|NM_189871.1| Oryza sativa (japonica cultivar-group), mRNA 64 5e-07
108gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 geno... 64 5e-07
109gb|AF271662.1|AF271662 Vitis berlandieri x Vitis rupestris putat... 64 5e-07
110dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 64 5e-07
111dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 64 5e-07
112gb|AF326506.1|AF326506 Zea mays tonoplast membrane integral prot... 64 5e-07
113dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic D... 64 5e-07
114dbj|AK111931.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 5e-07
115dbj|AB114828.1| Oryza sativa (japonica cultivar-group) OsTIP3 mR... 64 5e-07
116dbj|AK106383.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 5e-07
117gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic p... 64 5e-07
118gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 64 5e-07
119gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence 62 2e-06
120emb|BX823744.1|CNS0A6NJ Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
121gb|AF275315.1|AF275315 Lotus japonicus water-selective transport... 62 2e-06
122dbj|AP004479.1| Lotus japonicus genomic DNA, chromosome 1, clone... 62 2e-06
123ref|NM_188505.1| Oryza sativa (japonica cultivar-group), Ozsa817... 60 8e-06
124dbj|AP002094.1| Oryza sativa (japonica cultivar-group) genomic D... 60 8e-06
125ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT... 58 3e-05
126ref|NM_188626.1| Oryza sativa (japonica cultivar-group), Ozsa822... 58 3e-05
127gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds 58 3e-05
128gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds 58 3e-05
129gb|AF521135.1| Kandelia candel tonoplast intrinsic protein (TIP)... 58 3e-05
130gb|AF133531.1|AF133531 Mesembryanthemum crystallinum water chann... 58 3e-05
131dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 58 3e-05
132dbj|AK099190.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
133dbj|AK069592.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
134emb|BX823560.1|CNS0A7QS Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
135gb|AY130971.1| Brassica oleracea var. botrytis tonoplast intrins... 52 0.002
136gb|U92652.2|BOU92652 Brassica oleracea var. botrytis tonoplast i... 52 0.002
137dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds 52 0.002
138gb|BT016509.1| Zea mays clone Contig342 mRNA sequence 50 0.008
139dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds 50 0.008
140dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds 50 0.008
141emb|X95952.1|HAAP H.annuus mRNA for aquaporin 48 0.030
142emb|X72581.1|ATGTIPMR A.thaliana mRNA for tonoplast intrinsic pr... 48 0.030
143emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquapo... 48 0.030
144gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putat... 48 0.030
145gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 48 0.030
146ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel A... 46 0.12
147ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron... 46 0.12
148gb|AF521142.1| Kandelia candel tonoplast intrinsic protein mRNA,... 46 0.12
149emb|AJ251652.1|MTR251652 Medicago truncatula mRNA for aquaporin ... 46 0.12
150gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic pr... 46 0.12
151gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic pr... 46 0.12
152emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Co... 46 0.12
153emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Co... 46 0.12
154emb|BX822968.1|CNS0A5UC Arabidopsis thaliana Full-length cDNA Co... 46 0.12
155emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Co... 46 0.12
156gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete s... 46 0.12
157gb|AC020922.9| Homo sapiens chromosome 19 clone CTD-2105E13, com... 46 0.12
158gb|AY207429.1| Homo sapiens interleukin 11 (IL11) gene, complete... 46 0.12
159emb|AJ605573.1| Ricinus communis mRNA for aquaporin (Tip1-1 gene... 46 0.12
160dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 46 0.12
161gb|U39486.1|ATU39486 Arabidopsis thaliana delta tonoplast integr... 46 0.12
162gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integr... 46 0.12
163gb|M81890.1|HUMIL11A Human interleukin 11 (IL11) gene, complete ... 46 0.12
164dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, compl... 46 0.12
165ref|XM_851400.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.47
166ref|XM_536333.2| PREDICTED: Canis familiaris similar to actinin,... 44 0.47
167ref|XM_851314.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.47
168ref|XM_851274.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.47
169ref|XM_851189.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.47
170ref|XM_851152.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.47
171ref|XM_851023.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.47
172gb|AF367456.1| Prunus persica clone gTip1 gamma-tonoplast intrin... 44 0.47
173dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.47
174gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water chann... 44 0.47
175emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 44 0.47
176gb|AY112625.1| Zea mays CL46210_1 mRNA sequence 44 0.47
177gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 44 0.47
178emb|AL928775.2|CNS08CC5 Oryza sativa chromosome 12, . BAC OSJNBa... 44 0.47
179gb|AY839872.1| Vitis vinifera aquaporin (TIP1;1) mRNA, complete cds 42 1.9
180gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chr... 42 1.9
181gb|AC154709.2| Mus musculus BAC clone RP24-357I4 from chromosome... 42 1.9
182gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome 42 1.9
183emb|CT025679.5| Mouse DNA sequence from clone RP24-296K22 on chr... 42 1.9
184ref|XM_567655.1| Cryptococcus neoformans var. neoformans JEC21 h... 42 1.9
185gb|AC123532.4| Mus musculus chromosome 14 clone RP23-84B6, compl... 42 1.9
186gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complet... 42 1.9
187gb|AC104099.5| Mus musculus BAC clone RP24-372J8 from 3, complet... 42 1.9
188gb|BC012214.1| Mus musculus Rab geranylgeranyl transferase, a su... 42 1.9
189gb|AY258323.1| Rubella virus strain BRD-II, complete genome 42 1.9
190ref|XM_503667.1| Yarrowia lipolytica CLIB122, YALI0E07557g predi... 42 1.9
191ref|NM_019519.1| Mus musculus Rab geranylgeranyl transferase, a ... 42 1.9
192emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete ... 42 1.9
193emb|BX640430.1| Bordetella parapertussis strain 12822, complete ... 42 1.9
194emb|AL390091.1|NCB12F1 Neurospora crassa DNA linkage group II BA... 42 1.9
195emb|AJ489613.1|CAR489613 Cicer arietinum partial mRNA for tonopl... 42 1.9
196emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 i... 42 1.9
197gb|AC183494.1| Brassica oleracea Contig C, complete sequence 42 1.9
198dbj|AK146917.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 42 1.9
199gb|AF271660.1|AF271660 Vitis berlandieri x Vitis rupestris putat... 42 1.9
200gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsi... 42 1.9
201gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral prot... 42 1.9
202gb|AC135495.2| Oryza sativa (japonica cultivar-group) chromosome... 42 1.9
203ref|NM_214226.1| Sus scrofa inositol(1,3,4,5)tetrakisphosphate r... 42 1.9
204gb|AF127662.1|AF127662 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 1.9
205gb|AF127661.1|AF127661 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 1.9
206gb|AF127660.1|AF127660 Mus musculus strain C57BL/6J RAB geranylg... 42 1.9
207gb|AF127659.1|AF127659 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 1.9
208gb|AF127658.1|AF127658 Mus musculus strain C57BL/6J RAB geranylg... 42 1.9
209gb|AF127657.1|AF127657 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 1.9
210gb|AF127656.1|AF127656 Mus musculus strain C57BL/6J RAB geranylg... 42 1.9
211gb|AF127655.1|AF127655 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 1.9
212gb|AF127654.1|AF127654 Mus musculus strain C57BL/6J RAB geranylg... 42 1.9
213gb|AF466200.2| Sorghum bicolor putative protein kinase gene, par... 42 1.9
214emb|AL845372.6| Zebrafish DNA sequence from clone DKEYP-113C1 in... 42 1.9
215gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP... 42 1.9
216emb|CR381567.9| Zebrafish DNA sequence from clone DKEY-115O4 in ... 42 1.9
217gb|AC159324.2| Mus musculus BAC clone RP23-9D1 from chromosome 1... 42 1.9
218gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 42 1.9
219emb|CR974568.14| Mouse DNA sequence from clone RP23-39N20 on chr... 42 1.9
220emb|CR388420.19| Zebrafish DNA sequence from clone DKEY-37H18 in... 42 1.9
221emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 42 1.9
222gb|U88368.1|SSU88368 Sus scrofa inositol(1,3,4,5)tetrakisphospha... 42 1.9
223gb|L07320.1|HS5E1A Murine cytomegalovirus e1 protein gene, compl... 42 1.9
224ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel A... 40 7.4
225gb|AC164878.2| Mus musculus BAC clone RP23-364G24 from chromosom... 40 7.4
226gb|AC162034.6| Mus musculus chromosome 7, clone RP23-285B12, com... 40 7.4
227ref|XM_476227.1| Oryza sativa (japonica cultivar-group), predic... 40 7.4
228gb|DQ215783.1| Taeniopygia guttata clone 0058P0012B09 proteasome... 40 7.4
229gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, comple... 40 7.4
230ref|XM_414866.1| PREDICTED: Gallus gallus similar to Aquaporin 8... 40 7.4
231gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 40 7.4
232gb|AC145396.3| Oryza sativa (japonica cultivar-group) chromosome... 40 7.4
233emb|AL591789.1|SME591789 Sinorhizobium meliloti 1021 complete ch... 40 7.4
234emb|X53040.1|RNNIP26 R.norvegicus MIP-26 mRNA 40 7.4
235emb|CR847515.10| Zebrafish DNA sequence from clone DKEYP-60A7 in... 40 7.4
236gb|AC012596.4| Homo sapiens BAC clone CTD-2523K17 from 7, comple... 40 7.4
237gb|AY225468.1| Mus musculus interleukin 11 gene, promoter region... 40 7.4
238gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome 40 7.4
239emb|AL161740.16| Human DNA sequence from clone RP6-239D12 on chr... 40 7.4
240emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic p... 40 7.4
241gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g3683... 40 7.4
242gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic... 40 7.4
243emb|X53052.1|RRMIP Rat partial mRNA for main intrinsic protein 40 7.4
244emb|X12514.1|RNMIP26R Rat mRNA fragment for main intrinsic prote... 40 7.4
245gb|AF486513.1| Hordeum vulgare cultivar Yon M Kei GBSSI gene, pr... 40 7.4
246gb|AF486512.1| Hordeum vulgare cultivar CDC Alamo GBSSI gene, pr... 40 7.4
247gb|AF486508.1| Hordeum vulgare cultivar Oderbrucker GBSSI gene, ... 40 7.4
248emb|BX572602.1| Rhodopseudomonas palustris CGA009 complete genom... 40 7.4
249emb|BX897736.7| Zebrafish DNA sequence from clone CH211-181B15 i... 40 7.4
250gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 7.4
251gb|AE005901.1| Caulobacter crescentus CB15 section 227 of 359 of... 40 7.4
252gb|AC023310.4| Homo sapiens chromosome 15, clone RP11-336L20, co... 40 7.4
253tpg|BK001890.1| TPA: TPA_inf: Drosophila melanogaster HDC08154 (... 40 7.4
254gb|AE012138.1| Xanthomonas campestris pv. campestris str. ATCC 3... 40 7.4
255gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map ... 40 7.4
256dbj|AB118808.1| Hordeum vulgare subsp. spontaneum GBSSI gene for... 40 7.4
257dbj|AB089162.1| Hordeum vulgare subsp. vulgare GBSSI gene for gr... 40 7.4
258dbj|AB088761.1| Hordeum vulgare subsp. vulgare GBSSI gene for gr... 40 7.4
259gb|AC100757.2| Homo sapiens chromosome 15, clone RP11-566K19, co... 40 7.4
260gb|AC107487.1| Drosophila melanogaster 3L BAC RP98-10D20 (Roswel... 40 7.4
261emb|BX548249.13| Zebrafish DNA sequence from clone CH211-93A2 in... 40 7.4
262emb|BX119977.10| Zebrafish DNA sequence from clone CH211-198A3 i... 40 7.4
263gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 7.4
264gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 40 7.4
265gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 40 7.4
266dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.4
267emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Co... 40 7.4
268emb|BX819122.1|CNS0AA8S Arabidopsis thaliana Full-length cDNA Co... 40 7.4
269emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Co... 40 7.4
270emb|BX818765.1|CNS0AA8G Arabidopsis thaliana Full-length cDNA Co... 40 7.4
271emb|BX819619.1|CNS0A8TV Arabidopsis thaliana Full-length cDNA Co... 40 7.4
272emb|BX819585.1|CNS0A8ZS Arabidopsis thaliana Full-length cDNA Co... 40 7.4
273emb|BX819242.1|CNS0A8YI Arabidopsis thaliana Full-length cDNA Co... 40 7.4
274emb|BX818836.1|CNS0A8V6 Arabidopsis thaliana Full-length cDNA Co... 40 7.4
275emb|BX818785.1|CNS0A8WQ Arabidopsis thaliana Full-length cDNA Co... 40 7.4
276emb|BX820166.1|CNS0A8IR Arabidopsis thaliana Full-length cDNA Co... 40 7.4
277gb|AY779624.1| Myxococcus xanthus strain DK1622 rod locus, compl... 40 7.4
278gb|AE004695.1| Pseudomonas aeruginosa PAO1, section 256 of 529 o... 40 7.4
279gb|AY087558.1| Arabidopsis thaliana clone 36633 mRNA, complete s... 40 7.4
280ref|XM_343137.2| PREDICTED: Rattus norvegicus major intrinsic pr... 40 7.4
281gb|AC136687.6| Homo sapiens chromosome 15, clone RP11-439M15, co... 40 7.4
282gb|AC134393.6| Homo sapiens chromosome 15, clone CTC-803A3, comp... 40 7.4
283gb|AC131280.9| Homo sapiens chromosome 15, clone RP11-467L19, co... 40 7.4
284dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 7.4
285dbj|AP003712.4| Oryza sativa (japonica cultivar-group) genomic D... 40 7.4
286dbj|AB154356.1| Hordeum vulgare subsp. spontaneum GBSSI gene for... 40 7.4
287dbj|AB118809.1| Hordeum vulgare subsp. spontaneum GBSSI gene for... 40 7.4
288emb|X07932.1|HVWAXYR Barley mRNA pcwx27 for waxy locus 40 7.4
289emb|X07931.1|HVWAXYG Barley DNA for waxy locus encoding starch s... 40 7.4
290dbj|AK109762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.4
291dbj|AK072531.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.4
292dbj|AK060193.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.4
293emb|AL929340.4| Zebrafish DNA sequence from clone CH211-248N16 i... 40 7.4
294emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 40 7.4
295gb|AC006947.2|AC006947 Homo sapiens chromosome 17, clone hRPK.11... 40 7.4
296gb|AE003476.3| Drosophila melanogaster chromosome 3L, section 10... 40 7.4
297gb|U68299.1|MCU68299 Mouse cytomegalovirus 1 complete genomic se... 40 7.4
298emb|CR388150.14| Zebrafish DNA sequence from clone DKEY-115A2 in... 40 7.4
299gb|AF000143.1|HSAF000143 Human putative alternative lens membran... 40 7.4
300gb|AY885250.2| Dermacentor variabilis vitellogenin (Vg) mRNA, co... 40 7.4
301emb|AL929067.8| Mouse DNA sequence from clone RP24-69A20 on chro... 40 7.4
302gb|AF317103.1| Dumontia alaskana specimen-voucher GWS000917 (UNB... 40 7.4
303gb|AF317102.1| Dumontia alaskana specimen-voucher GWS000916 (UNB... 40 7.4
304gb|AF317101.1| Dumontia alaskana specimen-voucher G0221 (UNB) sm... 40 7.4
305gb|M84344.1|ATHGTIP Arabidopsis thaliana tonoplast intrinsic pro... 40 7.4
306dbj|AB054056.1| Hordeum vulgare waxy gene, partial sequence, cul... 40 7.4
307dbj|AB054055.2| Hordeum vulgare waxy gene, partial sequence, cul... 40 7.4
308emb|AL772162.4| Mouse DNA sequence from clone RP23-175J8 on chro... 40 7.4

>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein
          Length = 1020

 Score = 1063 bits (536), Expect = 0.0
 Identities = 542/545 (99%)
 Strand = Plus / Minus

                                                                        
Query: 1    tttacacaagcaaattgacagggtcgatcgtcacaggtttcacagcaccacaaactgatg 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1008 tttacacaagcaaattgacagggtcgatcgtcacaggtttcacagcaccacaaactgatg 949

                                                                        
Query: 61   gaccgatcgaccctgggaatgggatggattcattcattcaaagcaaacttaaacgactca 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 948  gaccgatcgaccctgggaatgggatggattcattcattcaaagcaaacttaaacgactca 889

                                                                        
Query: 121  tgactggaagcaaggggagacgcgatcgaccacacggacggacgggcgggcggggggcag 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 888  tgactggaagcaaggggagacgcgatcgaccacacggacggacgggcgggcggggggcag 829

                                                                        
Query: 181  gcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagag 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 828  gcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagag 769

                                                                        
Query: 241  cagctcgtanatgacgccggcgaggccgncgccgatgagggggccgacccagtacaccca 300
            ||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 768  cagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 709

                                                                        
Query: 301  ctggtacccccactcccagctgacgagggcggggccgaaggagacggcggngttcatgga 360
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 708  ctggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgga 649

                                                                        
Query: 361  cgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgat 420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 648  cgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgat 589

                                                                        
Query: 421  gggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgta 480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 588  gggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgta 529

                                                                        
Query: 481  caccagcccgaaggtcatgacgatctccaggaccaccgcctcccacgcgccgatgccggt 540
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 528  caccagcccgaaggtcatgacgatctccaggaccaccgcctcccacgcgccgatgccggt 469

                 
Query: 541  gagcc 545
            |||||
Sbjct: 468  gagcc 464



to top

>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1133

 Score =  607 bits (306), Expect = e-170
 Identities = 333/343 (97%)
 Strand = Plus / Minus

                                                                       
Query: 195 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtanatga 254
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 845 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 786

                                                                       
Query: 255 cgccggcgaggccgncgccgatgagggggccgacccagtacacccactggtacccccact 314
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 785 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 726

                                                                       
Query: 315 cccagctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaagg 374
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 725 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 666

                                                                       
Query: 375 cgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgc 434
           ||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 665 cgccgcccaccaggatgttggcgcccacgatgaagccgatggcgatgggcgcgatggtgc 606

                                                                       
Query: 435 ccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaagg 494
           |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||
Sbjct: 605 ccaggctgcccttcttggggtccacggccgtggcgtacaccgtgtacaccagcccgaagg 546

                                                      
Query: 495 tcatgacgatctccaggaccaccgcctcccacgcgccgatgcc 537
           |||| ||||||||||| ||||||||||||||||||||||||||
Sbjct: 545 tcatcacgatctccagcaccaccgcctcccacgcgccgatgcc 503



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 101 aagcaaacttaaacgactcatg 122
           ||||||||||||||||||||||
Sbjct: 977 aagcaaacttaaacgactcatg 956



to top

>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds
          Length = 1039

 Score =  502 bits (253), Expect = e-139
 Identities = 313/334 (93%)
 Strand = Plus / Minus

                                                                       
Query: 193 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtanat 252
           |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 754 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 695

                                                                       
Query: 253 gacgccggcgaggccgncgccgatgagggggccgacccagtacacccactggtaccccca 312
           |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 694 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtagcccca 635

                                                                       
Query: 313 ctcccagctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaa 372
           |||||||||||||||||||||||||||||| ||||||| ||||||||||||||||  |||
Sbjct: 634 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 575

                                                                       
Query: 373 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
           ||||||||| || ||||||||||| || ||||||||||||||||||||||| ||||||||
Sbjct: 574 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcgatgggggcgatggt 515

                                                                       
Query: 433 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 492
           |||||||||||||||||| ||||| || || |||||||||||||||||||||||||||||
Sbjct: 514 gcccaggctgcccttcttcgggtccaccgccgtggcgtacaccgtgtacaccagcccgaa 455

                                             
Query: 493 ggtcatgacgatctccaggaccaccgcctcccac 526
           |||||| ||||||||||| |||| ||||||||||
Sbjct: 454 ggtcatcacgatctccagcaccagcgcctcccac 421



to top

>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence
          Length = 1112

 Score =  494 bits (249), Expect = e-136
 Identities = 312/334 (93%)
 Strand = Plus / Minus

                                                                       
Query: 193 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtanat 252
           |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 850 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 791

                                                                       
Query: 253 gacgccggcgaggccgncgccgatgagggggccgacccagtacacccactggtaccccca 312
           |||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 790 gacgccggcgaggccgccgccgatgaggggcccgacccagtacacccactggtagcccca 731

                                                                       
Query: 313 ctcccagctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaa 372
           |||||||||||||||||||||||||||||| ||||||| ||||||||||||||||  |||
Sbjct: 730 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 671

                                                                       
Query: 373 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
           ||||||||| || |||||||||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 670 ggcgccgcccaccaggatgttggcgcccacgatgaagccgatggcgatgggggcgatggt 611

                                                                       
Query: 433 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 492
           |||||||||||||||||| ||||| || || || ||||||||||||||||||||||||||
Sbjct: 610 gcccaggctgcccttcttcgggtccaccgccgtcgcgtacaccgtgtacaccagcccgaa 551

                                             
Query: 493 ggtcatgacgatctccaggaccaccgcctcccac 526
           |||||| ||||||||||| |||| ||||||||||
Sbjct: 550 ggtcatcacgatctccagcaccagcgcctcccac 517



to top

>gb|AY104464.1| Zea mays PCO114899 mRNA sequence
          Length = 1167

 Score =  486 bits (245), Expect = e-134
 Identities = 311/334 (93%)
 Strand = Plus / Minus

                                                                       
Query: 193 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtanat 252
           |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 849 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 790

                                                                       
Query: 253 gacgccggcgaggccgncgccgatgagggggccgacccagtacacccactggtaccccca 312
           |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 789 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtagcccca 730

                                                                       
Query: 313 ctcccagctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaa 372
           |||||||||||||||||||||||||||||| ||||||| ||||||||||||||||  |||
Sbjct: 729 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 670

                                                                       
Query: 373 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
           ||||||||| || ||||||||||| || ||||||||||||||||| ||||| ||||||||
Sbjct: 669 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcaatgggggcgatggt 610

                                                                       
Query: 433 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 492
           |||||||||||||||||| ||||| || || || ||||||||||||||||||||||||||
Sbjct: 609 gcccaggctgcccttcttcgggtccaccgccgtcgcgtacaccgtgtacaccagcccgaa 550

                                             
Query: 493 ggtcatgacgatctccaggaccaccgcctcccac 526
           |||||| ||||||||||| |||| ||||||||||
Sbjct: 549 ggtcatcacgatctccagcaccagcgcctcccac 516



to top

>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds
          Length = 1097

 Score =  486 bits (245), Expect = e-134
 Identities = 311/334 (93%)
 Strand = Plus / Minus

                                                                       
Query: 193 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtanat 252
           |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 846 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 787

                                                                       
Query: 253 gacgccggcgaggccgncgccgatgagggggccgacccagtacacccactggtaccccca 312
           |||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 786 gacgccggcgaggccgccgccgatgaggggcccgacccagtacacccactggtagcccca 727

                                                                       
Query: 313 ctcccagctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaa 372
           |||||||||||||||||||||||||||||| ||||||| ||||||||||||||||  |||
Sbjct: 726 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 667

                                                                       
Query: 373 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
           ||||||||| || ||||||||||| || ||||||||||||||||| ||||| ||||||||
Sbjct: 666 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcaatgggggcgatggt 607

                                                                       
Query: 433 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 492
           |||||||||||||||||| ||||| || || |||||||||||||||||||||||||||||
Sbjct: 606 gcccaggctgcccttcttcgggtccaccgccgtggcgtacaccgtgtacaccagcccgaa 547

                                             
Query: 493 ggtcatgacgatctccaggaccaccgcctcccac 526
           |||||| ||||||||||| |||| ||||||||||
Sbjct: 546 ggtcatcacgatctccagcaccagcgcctcccac 513



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  440 bits (222), Expect = e-120
 Identities = 315/347 (90%)
 Strand = Plus / Plus

                                                                           
Query: 180     ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 239
               ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 2544716 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 2544775

                                                                           
Query: 240     gcagctcgtanatgacgccggcgaggccgncgccgatgagggggccgacccagtacaccc 299
               | | |||||| |||||||||||||||||  |||||||||| ||||| |||||||||||||
Sbjct: 2544776 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 2544835

                                                                           
Query: 300     actggtacccccactcccagctgacgagggcggggccgaaggagacggcggngttcatgg 359
               ||||| || ||||   ||||||||||||||| ||||||||||||||||| | ||||||||
Sbjct: 2544836 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 2544895

                                                                           
Query: 360     acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 419
               | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 2544896 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 2544955

                                                                           
Query: 420     tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 479
               |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 2544956 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 2545015

                                                              
Query: 480     acaccagcccgaaggtcatgacgatctccaggaccaccgcctcccac 526
               | || || ||||||||||||||||||||||| ||||  |||||||||
Sbjct: 2545016 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccac 2545062



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 154     acggacggacgggcgggcggg 174
               |||||||||||||||||||||
Sbjct: 8319519 acggacggacgggcgggcggg 8319499



to top

>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0067N01, from chromosome 3, complete sequence
          Length = 159636

 Score =  440 bits (222), Expect = e-120
 Identities = 315/347 (90%)
 Strand = Plus / Minus

                                                                          
Query: 180    ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 239
              ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 125378 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 125319

                                                                          
Query: 240    gcagctcgtanatgacgccggcgaggccgncgccgatgagggggccgacccagtacaccc 299
              | | |||||| |||||||||||||||||  |||||||||| ||||| |||||||||||||
Sbjct: 125318 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 125259

                                                                          
Query: 300    actggtacccccactcccagctgacgagggcggggccgaaggagacggcggngttcatgg 359
              ||||| || ||||   ||||||||||||||| ||||||||||||||||| | ||||||||
Sbjct: 125258 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 125199

                                                                          
Query: 360    acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 419
              | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 125198 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 125139

                                                                          
Query: 420    tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 479
              |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 125138 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 125079

                                                             
Query: 480    acaccagcccgaaggtcatgacgatctccaggaccaccgcctcccac 526
              | || || ||||||||||||||||||||||| ||||  |||||||||
Sbjct: 125078 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccac 125032



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  440 bits (222), Expect = e-120
 Identities = 315/347 (90%)
 Strand = Plus / Plus

                                                                           
Query: 180     ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 239
               ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 2544826 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 2544885

                                                                           
Query: 240     gcagctcgtanatgacgccggcgaggccgncgccgatgagggggccgacccagtacaccc 299
               | | |||||| |||||||||||||||||  |||||||||| ||||| |||||||||||||
Sbjct: 2544886 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 2544945

                                                                           
Query: 300     actggtacccccactcccagctgacgagggcggggccgaaggagacggcggngttcatgg 359
               ||||| || ||||   ||||||||||||||| ||||||||||||||||| | ||||||||
Sbjct: 2544946 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 2545005

                                                                           
Query: 360     acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 419
               | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 2545006 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 2545065

                                                                           
Query: 420     tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 479
               |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 2545066 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 2545125

                                                              
Query: 480     acaccagcccgaaggtcatgacgatctccaggaccaccgcctcccac 526
               | || || ||||||||||||||||||||||| ||||  |||||||||
Sbjct: 2545126 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccac 2545172



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 154     acggacggacgggcgggcggg 174
               |||||||||||||||||||||
Sbjct: 8317354 acggacggacgggcgggcggg 8317334



to top

>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds
          Length = 1080

 Score =  440 bits (222), Expect = e-120
 Identities = 315/347 (90%)
 Strand = Plus / Minus

                                                                       
Query: 180 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 239
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 844 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 785

                                                                       
Query: 240 gcagctcgtanatgacgccggcgaggccgncgccgatgagggggccgacccagtacaccc 299
           | | |||||| |||||||||||||||||  |||||||||| ||||| |||||||||||||
Sbjct: 784 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 725

                                                                       
Query: 300 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggngttcatgg 359
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| | ||||||||
Sbjct: 724 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 665

                                                                       
Query: 360 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 419
           | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 664 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 605

                                                                       
Query: 420 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 479
           |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 604 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 545

                                                          
Query: 480 acaccagcccgaaggtcatgacgatctccaggaccaccgcctcccac 526
           | || || ||||||||||||||||||||||| ||||  |||||||||
Sbjct: 544 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccac 498



to top

>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full
           insert sequence
          Length = 1034

 Score =  440 bits (222), Expect = e-120
 Identities = 315/347 (90%)
 Strand = Plus / Minus

                                                                       
Query: 180 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 239
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 853 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 794

                                                                       
Query: 240 gcagctcgtanatgacgccggcgaggccgncgccgatgagggggccgacccagtacaccc 299
           | | |||||| |||||||||||||||||  |||||||||| ||||| |||||||||||||
Sbjct: 793 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 734

                                                                       
Query: 300 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggngttcatgg 359
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| | ||||||||
Sbjct: 733 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 674

                                                                       
Query: 360 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 419
           | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 673 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 614

                                                                       
Query: 420 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 479
           |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 613 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 554

                                                          
Query: 480 acaccagcccgaaggtcatgacgatctccaggaccaccgcctcccac 526
           | || || ||||||||||||||||||||||| ||||  |||||||||
Sbjct: 553 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccac 507



to top

>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full
           insert sequence
          Length = 1082

 Score =  440 bits (222), Expect = e-120
 Identities = 315/347 (90%)
 Strand = Plus / Minus

                                                                       
Query: 180 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 239
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 855 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 796

                                                                       
Query: 240 gcagctcgtanatgacgccggcgaggccgncgccgatgagggggccgacccagtacaccc 299
           | | |||||| |||||||||||||||||  |||||||||| ||||| |||||||||||||
Sbjct: 795 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 736

                                                                       
Query: 300 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggngttcatgg 359
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| | ||||||||
Sbjct: 735 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 676

                                                                       
Query: 360 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 419
           | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 675 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 616

                                                                       
Query: 420 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 479
           |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 615 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 556

                                                          
Query: 480 acaccagcccgaaggtcatgacgatctccaggaccaccgcctcccac 526
           | || || ||||||||||||||||||||||| ||||  |||||||||
Sbjct: 555 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccac 509



to top

>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full
           insert sequence
          Length = 551

 Score =  440 bits (222), Expect = e-120
 Identities = 315/347 (90%)
 Strand = Plus / Minus

                                                                       
Query: 180 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 239
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 379 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 320

                                                                       
Query: 240 gcagctcgtanatgacgccggcgaggccgncgccgatgagggggccgacccagtacaccc 299
           | | |||||| |||||||||||||||||  |||||||||| ||||| |||||||||||||
Sbjct: 319 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 260

                                                                       
Query: 300 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggngttcatgg 359
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| | ||||||||
Sbjct: 259 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 200

                                                                       
Query: 360 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 419
           | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 199 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 140

                                                                       
Query: 420 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 479
           |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 139 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 80

                                                          
Query: 480 acaccagcccgaaggtcatgacgatctccaggaccaccgcctcccac 526
           | || || ||||||||||||||||||||||| ||||  |||||||||
Sbjct: 79  agacgaggccgaaggtcatgacgatctccagcaccagggcctcccac 33



to top

>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full
           insert sequence
          Length = 1055

 Score =  440 bits (222), Expect = e-120
 Identities = 315/347 (90%)
 Strand = Plus / Minus

                                                                       
Query: 180 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 239
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 851 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 792

                                                                       
Query: 240 gcagctcgtanatgacgccggcgaggccgncgccgatgagggggccgacccagtacaccc 299
           | | |||||| |||||||||||||||||  |||||||||| ||||| |||||||||||||
Sbjct: 791 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 732

                                                                       
Query: 300 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggngttcatgg 359
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| | ||||||||
Sbjct: 731 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 672

                                                                       
Query: 360 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 419
           | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 671 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 612

                                                                       
Query: 420 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 479
           |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 611 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 552

                                                          
Query: 480 acaccagcccgaaggtcatgacgatctccaggaccaccgcctcccac 526
           | || || ||||||||||||||||||||||| ||||  |||||||||
Sbjct: 551 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccac 505



to top

>ref|XM_470213.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 753

 Score =  422 bits (213), Expect = e-115
 Identities = 303/334 (90%)
 Strand = Plus / Minus

                                                                       
Query: 193 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtanat 252
           |||||||||||||||||||||||||||||||||| ||||||||||||| | |||||| ||
Sbjct: 753 ttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaagaggacctcgtagat 694

                                                                       
Query: 253 gacgccggcgaggccgncgccgatgagggggccgacccagtacacccactggtaccccca 312
           |||||||||||||||  |||||||||| ||||| |||||||||||||||||| || ||||
Sbjct: 693 gacgccggcgaggccaccgccgatgagtgggccaacccagtacacccactgggactccca 634

                                                                       
Query: 313 ctcccagctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaa 372
              ||||||||||||||| ||||||||||||||||| | ||||||||| ||||||  |||
Sbjct: 633 ggaccagctgacgagggccgggccgaaggagacggccgggttcatggaggcgccgtcgaa 574

                                                                       
Query: 373 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
            |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 573 cgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcgatgggggcgatggt 514

                                                                       
Query: 433 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 492
           ||| |||||||||||||||||||| ||||||||||||||||| ||||| || || |||||
Sbjct: 513 gccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgtagacgaggccgaa 454

                                             
Query: 493 ggtcatgacgatctccaggaccaccgcctcccac 526
           |||||||||||||||||| ||||  |||||||||
Sbjct: 453 ggtcatgacgatctccagcaccagggcctcccac 420



to top

>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic
           protein (TIP)
          Length = 1146

 Score =  337 bits (170), Expect = 2e-89
 Identities = 307/353 (86%), Gaps = 3/353 (0%)
 Strand = Plus / Minus

                                                                       
Query: 191 gcttagtagtcggtggtggggagctgctcgtgggtgcgggag---atgaagagcagctcg 247
           |||||||||||||||||||||||||||||||||||| |||||   ||||||||||  |||
Sbjct: 837 gcttagtagtcggtggtggggagctgctcgtgggtgtgggaggagatgaagagcatgtcg 778

                                                                       
Query: 248 tanatgacgccggcgaggccgncgccgatgagggggccgacccagtacacccactggtac 307
           || || |   | |||||  |  | |||||||  |||||||||||||||||||| ||||  
Sbjct: 777 tatataagtgcagcgagtgcagcaccgatgaacgggccgacccagtacacccagtggttg 718

                                                                       
Query: 308 ccccactcccagctgacgagggcggggccgaaggagacggcggngttcatggacgcgccg 367
             |||   |||||||||||| | |||||||||||| ||||||| ||||||||||||||||
Sbjct: 717 ttccaggaccagctgacgagcgaggggccgaaggacacggcggggttcatggacgcgccg 658

                                                                       
Query: 368 gagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcg 427
             |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||
Sbjct: 657 tcgaaggcgccgccgacgaggatgttggcgcccacgatgaagccgatggcgatgggggcg 598

                                                                       
Query: 428 atggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagc 487
           |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| 
Sbjct: 597 atggtgcccaggctgcccttcttggggtcgaccgcggtggcgtacacagtgtacaccaga 538

                                                                
Query: 488 ccgaaggtcatgacgatctccaggaccaccgcctcccacgcgccgatgccggt 540
           ||||||||||| |||||||| || ||||  ||||||||| ||  |||||||||
Sbjct: 537 ccgaaggtcatcacgatctcgagcaccagggcctcccacacggagatgccggt 485



to top

>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full
           insert sequence
          Length = 1024

 Score =  305 bits (154), Expect = 8e-80
 Identities = 228/253 (90%)
 Strand = Plus / Plus

                                                                       
Query: 274 gatgagggggccgacccagtacacccactggtacccccactcccagctgacgagggcggg 333
           |||||| ||||| |||||||||||||||||| || ||||   ||||||||||||||| ||
Sbjct: 219 gatgagtgggccaacccagtacacccactgggactcccaggaccagctgacgagggccgg 278

                                                                       
Query: 334 gccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgtt 393
           ||||||||||||||| | ||||||||| ||||||  ||| ||||||||||||||||||||
Sbjct: 279 gccgaaggagacggccgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgtt 338

                                                                       
Query: 394 ggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggg 453
            ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||
Sbjct: 339 cgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctgcccttcttggg 398

                                                                       
Query: 454 gtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctccaggac 513
           ||| ||||||||||||||||| ||||| || || ||||||||||||||||||||||| ||
Sbjct: 399 gtcaacggcggtggcgtacacggtgtagacgaggccgaaggtcatgacgatctccagcac 458

                        
Query: 514 caccgcctcccac 526
           ||  |||||||||
Sbjct: 459 cagggcctcccac 471



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 55/57 (96%)
 Strand = Plus / Plus

                                                                    
Query: 180 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatga 236
           ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 167 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatga 223



to top

>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA,
           complete cds
          Length = 1021

 Score =  240 bits (121), Expect = 4e-60
 Identities = 207/236 (87%)
 Strand = Plus / Minus

                                                                       
Query: 281 gggccgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaag 340
           |||||||||||||||||||| |||| | ||||  | | | |||||| ||| |||||||||
Sbjct: 682 gggccgacccagtacacccagtggttctcccagacgccggtgacgacggccgggccgaag 623

                                                                       
Query: 341 gagacggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccg 400
           |||||||||| ||||||||| ||||||  ||||||||| ||  | |||||||||||||||
Sbjct: 622 gagacggcggggttcatggaggcgccgtcgaaggcgccccccgccaggatgttggcgccg 563

                                                                       
Query: 401 acgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacg 460
           ||||||||||||||||||||||||||||||  ||| |||  ||||||||||||||| |||
Sbjct: 562 acgatgaagccgatggcgatgggcgcgatgacgccgaggtcgcccttcttggggtccacg 503

                                                                   
Query: 461 gcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctccaggaccac 516
           || |||||||||||||||||||| || |||||||||||||| |||||||| |||||
Sbjct: 502 gccgtggcgtacaccgtgtacacgaggccgaaggtcatgaccatctccagcaccac 447



to top

>ref|NM_189497.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score =  214 bits (108), Expect = 2e-52
 Identities = 167/187 (89%)
 Strand = Plus / Minus

                                                                       
Query: 321 tgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgc 380
           |||||| ||||||||||||||||||||||| ||||||||| ||||||  |||||||||||
Sbjct: 628 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 569

                                                                       
Query: 381 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 440
           || |||||||||||||||||||||||||||||||||||||||| ||||||   || ||| 
Sbjct: 568 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 509

                                                                       
Query: 441 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatga 500
            |||||||||||| || || |||||||||||||| ||||| || || |||||||||||||
Sbjct: 508 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 449

                  
Query: 501 cgatctc 507
           |||||||
Sbjct: 448 cgatctc 442



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  214 bits (108), Expect = 2e-52
 Identities = 170/191 (89%)
 Strand = Plus / Minus

                                                                            
Query: 319      gctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgcc 378
                |||| ||| ||||||||||||||||   || | |||||||||  |||||||||||| |||
Sbjct: 13251010 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 13250951

                                                                            
Query: 379      gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 438
                | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 13250950 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 13250891

                                                                            
Query: 439      gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 498
                    ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 13250890 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 13250831

                           
Query: 499      gacgatctcca 509
                || ||||||||
Sbjct: 13250830 gatgatctcca 13250820



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                       
Query: 256      gccggcgaggccgncgccgatgagggggccgacccagta 294
                ||||||||||||| |||||| ||||||||||||||||||
Sbjct: 13251073 gccggcgaggccgccgccgacgagggggccgacccagta 13251035



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 397      gccgacgatgaagccgatggcgat 420
                ||||| ||||||||||||||||||
Sbjct: 26574317 gccgaggatgaagccgatggcgat 26574294



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  214 bits (108), Expect = 2e-52
 Identities = 167/187 (89%)
 Strand = Plus / Plus

                                                                            
Query: 321      tgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgc 380
                |||||| ||||||||||||||||||||||| ||||||||| ||||||  |||||||||||
Sbjct: 43108799 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 43108858

                                                                            
Query: 381      cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 440
                || |||||||||||||||||||||||||||||||||||||||| ||||||   || ||| 
Sbjct: 43108859 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 43108918

                                                                            
Query: 441      tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatga 500
                 |||||||||||| || || |||||||||||||| ||||| || || |||||||||||||
Sbjct: 43108919 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 43108978

                       
Query: 501      cgatctc 507
                |||||||
Sbjct: 43108979 cgatctc 43108985



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                           
Query: 324     cgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccga 383
               ||||||| ||||||||||||  ||| | ||||||||| ||||||||| |||  |||||| 
Sbjct: 7297479 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 7297420

                                             
Query: 384     cgaggatgttggcgccgacgatgaagccga 413
               ||||||||||||||||||||| || |||||
Sbjct: 7297419 cgaggatgttggcgccgacgacgaggccga 7297390



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                                
Query: 257     ccggcgaggccgncgccgatgagggggccgacccagtacacccactggt 305
               |||||||||||| ||||||||| ||| |||| |||||||||||| ||||
Sbjct: 6644922 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 6644970



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                    
Query: 352     gttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 404
               ||||||||||||||||| ||  ||||||||| ||| | |||||||||||||||
Sbjct: 7302350 gttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 7302298



to top

>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0459B04
          Length = 142475

 Score =  214 bits (108), Expect = 2e-52
 Identities = 167/187 (89%)
 Strand = Plus / Plus

                                                                          
Query: 321    tgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgc 380
              |||||| ||||||||||||||||||||||| ||||||||| ||||||  |||||||||||
Sbjct: 105828 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 105887

                                                                          
Query: 381    cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 440
              || |||||||||||||||||||||||||||||||||||||||| ||||||   || ||| 
Sbjct: 105888 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 105947

                                                                          
Query: 441    tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatga 500
               |||||||||||| || || |||||||||||||| ||||| || || |||||||||||||
Sbjct: 105948 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 106007

                     
Query: 501    cgatctc 507
              |||||||
Sbjct: 106008 cgatctc 106014



to top

>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0427E01
          Length = 146395

 Score =  214 bits (108), Expect = 2e-52
 Identities = 170/191 (89%)
 Strand = Plus / Minus

                                                                         
Query: 319   gctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgcc 378
             |||| ||| ||||||||||||||||   || | |||||||||  |||||||||||| |||
Sbjct: 12820 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 12761

                                                                         
Query: 379   gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 438
             | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 12760 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 12701

                                                                         
Query: 439   gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 498
                 ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 12700 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 12641

                        
Query: 499   gacgatctcca 509
             || ||||||||
Sbjct: 12640 gatgatctcca 12630



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                    
Query: 256   gccggcgaggccgncgccgatgagggggccgacccagta 294
             ||||||||||||| |||||| ||||||||||||||||||
Sbjct: 12883 gccggcgaggccgccgccgacgagggggccgacccagta 12845



to top

>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0012F14
          Length = 168629

 Score =  214 bits (108), Expect = 2e-52
 Identities = 170/191 (89%)
 Strand = Plus / Minus

                                                                          
Query: 319    gctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgcc 378
              |||| ||| ||||||||||||||||   || | |||||||||  |||||||||||| |||
Sbjct: 168198 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 168139

                                                                          
Query: 379    gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 438
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 168138 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 168079

                                                                          
Query: 439    gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 498
                  ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 168078 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 168019

                         
Query: 499    gacgatctcca 509
              || ||||||||
Sbjct: 168018 gatgatctcca 168008



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                     
Query: 256    gccggcgaggccgncgccgatgagggggccgacccagta 294
              ||||||||||||| |||||| ||||||||||||||||||
Sbjct: 168261 gccggcgaggccgccgccgacgagggggccgacccagta 168223



to top

>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full
           insert sequence
          Length = 1346

 Score =  214 bits (108), Expect = 2e-52
 Identities = 167/187 (89%)
 Strand = Plus / Minus

                                                                       
Query: 321 tgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgc 380
           |||||| ||||||||||||||||||||||| ||||||||| ||||||  |||||||||||
Sbjct: 652 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 593

                                                                       
Query: 381 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 440
           || |||||||||||||||||||||||||||||||||||||||| ||||||   || ||| 
Sbjct: 592 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 533

                                                                       
Query: 441 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatga 500
            |||||||||||| || || |||||||||||||| ||||| || || |||||||||||||
Sbjct: 532 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 473

                  
Query: 501 cgatctc 507
           |||||||
Sbjct: 472 cgatctc 466



to top

>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full
           insert sequence
          Length = 1149

 Score =  214 bits (108), Expect = 2e-52
 Identities = 167/187 (89%)
 Strand = Plus / Minus

                                                                       
Query: 321 tgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgc 380
           |||||| ||||||||||||||||||||||| ||||||||| ||||||  |||||||||||
Sbjct: 701 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 642

                                                                       
Query: 381 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 440
           || |||||||||||||||||||||||||||||||||||||||| ||||||   || ||| 
Sbjct: 641 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 582

                                                                       
Query: 441 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatga 500
            |||||||||||| || || |||||||||||||| ||||| || || |||||||||||||
Sbjct: 581 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 522

                  
Query: 501 cgatctc 507
           |||||||
Sbjct: 521 cgatctc 515



to top

>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 970

 Score =  214 bits (108), Expect = 2e-52
 Identities = 167/187 (89%)
 Strand = Plus / Minus

                                                                       
Query: 321 tgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgc 380
           |||||| ||||||||||||||||||||||| ||||||||| ||||||  |||||||||||
Sbjct: 638 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 579

                                                                       
Query: 381 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 440
           || |||||||||||||||||||||||||||||||||||||||| ||||||   || ||| 
Sbjct: 578 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 519

                                                                       
Query: 441 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatga 500
            |||||||||||| || || |||||||||||||| ||||| || || |||||||||||||
Sbjct: 518 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 459

                  
Query: 501 cgatctc 507
           |||||||
Sbjct: 458 cgatctc 452



to top

>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full
           insert sequence
          Length = 1194

 Score =  214 bits (108), Expect = 2e-52
 Identities = 170/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 319 gctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgcc 378
           |||| ||| ||||||||||||||||   || | |||||||||  |||||||||||| |||
Sbjct: 710 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 651

                                                                       
Query: 379 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 438
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 650 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 591

                                                                       
Query: 439 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 498
               ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 590 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 531

                      
Query: 499 gacgatctcca 509
           || ||||||||
Sbjct: 530 gatgatctcca 520



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 256 gccggcgaggccgncgccgatgagggggccgacccagta 294
           ||||||||||||| |||||| ||||||||||||||||||
Sbjct: 773 gccggcgaggccgccgccgacgagggggccgacccagta 735



to top

>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full
           insert sequence
          Length = 1214

 Score =  214 bits (108), Expect = 2e-52
 Identities = 170/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 319 gctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgcc 378
           |||| ||| ||||||||||||||||   || | |||||||||  |||||||||||| |||
Sbjct: 712 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 653

                                                                       
Query: 379 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 438
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 652 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 593

                                                                       
Query: 439 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 498
               ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 592 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 533

                      
Query: 499 gacgatctcca 509
           || ||||||||
Sbjct: 532 gatgatctcca 522



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 256 gccggcgaggccgncgccgatgagggggccgacccagta 294
           ||||||||||||| |||||| ||||||||||||||||||
Sbjct: 775 gccggcgaggccgccgccgacgagggggccgacccagta 737



to top

>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full
           insert sequence
          Length = 1074

 Score =  214 bits (108), Expect = 2e-52
 Identities = 170/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 319 gctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgcc 378
           |||| ||| ||||||||||||||||   || | |||||||||  |||||||||||| |||
Sbjct: 590 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 531

                                                                       
Query: 379 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 438
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 530 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 471

                                                                       
Query: 439 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 498
               ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 470 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 411

                      
Query: 499 gacgatctcca 509
           || ||||||||
Sbjct: 410 gatgatctcca 400



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 256 gccggcgaggccgncgccgatgagggggccgacccagta 294
           ||||||||||||| |||||| ||||||||||||||||||
Sbjct: 653 gccggcgaggccgccgccgacgagggggccgacccagta 615



to top

>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full
           insert sequence
          Length = 1197

 Score =  214 bits (108), Expect = 2e-52
 Identities = 170/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 319 gctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgcc 378
           |||| ||| ||||||||||||||||   || | |||||||||  |||||||||||| |||
Sbjct: 713 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 654

                                                                       
Query: 379 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 438
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 653 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 594

                                                                       
Query: 439 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 498
               ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 593 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 534

                      
Query: 499 gacgatctcca 509
           || ||||||||
Sbjct: 533 gatgatctcca 523



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 256 gccggcgaggccgncgccgatgagggggccgacccagta 294
           ||||||||||||| |||||| ||||||||||||||||||
Sbjct: 776 gccggcgaggccgccgccgacgagggggccgacccagta 738



to top

>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full
           insert sequence
          Length = 1195

 Score =  214 bits (108), Expect = 2e-52
 Identities = 170/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 319 gctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgcc 378
           |||| ||| ||||||||||||||||   || | |||||||||  |||||||||||| |||
Sbjct: 711 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 652

                                                                       
Query: 379 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 438
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 651 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 592

                                                                       
Query: 439 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 498
               ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 591 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 532

                      
Query: 499 gacgatctcca 509
           || ||||||||
Sbjct: 531 gatgatctcca 521



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 256 gccggcgaggccgncgccgatgagggggccgacccagta 294
           ||||||||||||| |||||| ||||||||||||||||||
Sbjct: 774 gccggcgaggccgccgccgacgagggggccgacccagta 736



to top

>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full
           insert sequence
          Length = 1202

 Score =  214 bits (108), Expect = 2e-52
 Identities = 170/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 319 gctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgcc 378
           |||| ||| ||||||||||||||||   || | |||||||||  |||||||||||| |||
Sbjct: 713 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 654

                                                                       
Query: 379 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 438
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 653 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 594

                                                                       
Query: 439 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 498
               ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 593 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 534

                      
Query: 499 gacgatctcca 509
           || ||||||||
Sbjct: 533 gatgatctcca 523



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 256 gccggcgaggccgncgccgatgagggggccgacccagta 294
           ||||||||||||| |||||| ||||||||||||||||||
Sbjct: 776 gccggcgaggccgccgccgacgagggggccgacccagta 738



to top

>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full
           insert sequence
          Length = 1220

 Score =  214 bits (108), Expect = 2e-52
 Identities = 170/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 319 gctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgcc 378
           |||| ||| ||||||||||||||||   || | |||||||||  |||||||||||| |||
Sbjct: 711 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 652

                                                                       
Query: 379 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 438
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 651 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 592

                                                                       
Query: 439 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 498
               ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 591 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 532

                      
Query: 499 gacgatctcca 509
           || ||||||||
Sbjct: 531 gatgatctcca 521



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 256 gccggcgaggccgncgccgatgagggggccgacccagta 294
           ||||||||||||| |||||| ||||||||||||||||||
Sbjct: 774 gccggcgaggccgccgccgacgagggggccgacccagta 736



to top

>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence
          Length = 833

 Score =  212 bits (107), Expect = 9e-52
 Identities = 203/236 (86%)
 Strand = Plus / Plus

                                                                       
Query: 281 gggccgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaag 340
           |||||||||||||||||||| |||| | ||||  | | | ||||||  || |||||||||
Sbjct: 329 gggccgacccagtacacccagtggttctcccagacgccggtgacgacagccgggccgaag 388

                                                                       
Query: 341 gagacggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccg 400
           |||||||||||||||||||| ||||||  |||||||       | |||||||||||||||
Sbjct: 389 gagacggcggngttcatggaggcgccgtcgaaggcgnnnnnngccaggatgttggcgccg 448

                                                                       
Query: 401 acgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacg 460
           ||||||||||||||||||||||||||||||  ||| |||  ||||||||||||||| |||
Sbjct: 449 acgatgaagccgatggcgatgggcgcgatgacgccgaggtcgcccttcttggggtccacg 508

                                                                   
Query: 461 gcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctccaggaccac 516
           || |||||||||||||||||||| || |||||||||||||| |||||||| |||||
Sbjct: 509 gccgtggcgtacaccgtgtacacgaggccgaaggtcatgaccatctccagcaccac 564



to top

>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full
           insert sequence
          Length = 1196

 Score =  206 bits (104), Expect = 6e-50
 Identities = 169/191 (88%)
 Strand = Plus / Minus

                                                                       
Query: 319 gctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgcc 378
           |||| ||| |||||| |||||||||   || | |||||||||  |||||||||||| |||
Sbjct: 712 gctggcgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 653

                                                                       
Query: 379 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 438
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 652 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 593

                                                                       
Query: 439 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 498
               ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 592 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 533

                      
Query: 499 gacgatctcca 509
           || ||||||||
Sbjct: 532 gatgatctcca 522



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 256 gccggcgaggccgncgccgatgagggggccgacccagta 294
           ||||||||||||| |||||| ||||||||||||||||||
Sbjct: 775 gccggcgaggccgccgccgacgagggggccgacccagta 737



to top

>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA,
           complete cds
          Length = 829

 Score =  196 bits (99), Expect = 5e-47
 Identities = 161/182 (88%)
 Strand = Plus / Minus

                                                                       
Query: 328 ggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgag 387
           ||||||||||||||||   || | |||||||||| |||||||||||| |||| |||||||
Sbjct: 663 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggcgacgag 604

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           ||||||||||||||||||||||||||||||||| || ||||||||||| |||   |||||
Sbjct: 603 gatgttggcgccgacgatgaagccgatggcgattggagcgatggtgccgagggacccctt 544

                                                                       
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||||| |||||||||||||||| ||||| || ||||||||||| | || ||||||
Sbjct: 543 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 484

             
Query: 508 ca 509
           ||
Sbjct: 483 ca 482



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 253 gacgccggcgaggccgncgccgatgagggggccgacccagta 294
           |||||||||||||||  |||||||||| |||||| |||||||
Sbjct: 738 gacgccggcgaggccaccgccgatgagcgggccggcccagta 697



to top

>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA,
           complete cds
          Length = 853

 Score =  196 bits (99), Expect = 5e-47
 Identities = 161/182 (88%)
 Strand = Plus / Minus

                                                                       
Query: 328 ggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgag 387
           ||||||||||||||||   || | |||||||||| |||||||||||| |||| | |||||
Sbjct: 666 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggcaacgag 607

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           |||||||||||||||||||||||||||||||||||| ||||||||||| |||   |||||
Sbjct: 606 gatgttggcgccgacgatgaagccgatggcgatgggggcgatggtgccgagggaaccctt 547

                                                                       
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||||| |||||||||||||||| ||||| || ||||||||||| | || ||||||
Sbjct: 546 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 487

             
Query: 508 ca 509
           ||
Sbjct: 486 ca 485



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 253 gacgccggcgaggccgncgccgatgagggggccgacccagta 294
           |||||||||||||||  |||||||||| |||||| |||||||
Sbjct: 741 gacgccggcgaggccaccgccgatgagcgggccggcccagta 700



to top

>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA,
           complete cds
          Length = 817

 Score =  196 bits (99), Expect = 5e-47
 Identities = 161/182 (88%)
 Strand = Plus / Minus

                                                                       
Query: 328 ggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgag 387
           ||||||||||||||||   || | |||||||||| |||||||||||| |||| | |||||
Sbjct: 667 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggccacgag 608

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           |||||||||||||||||||||||||||||||||||| ||||||||||| |||   |||||
Sbjct: 607 gatgttggcgccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 548

                                                                       
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||||| |||||||||||||||| ||||| || ||||||||||| | || ||||||
Sbjct: 547 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 488

             
Query: 508 ca 509
           ||
Sbjct: 487 ca 486



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 253 gacgccggcgaggccgncgccgatgagggggccgacccagtacaccca 300
           |||||||||||||||  |||||||||| |||||| ||||||| |||||
Sbjct: 742 gacgccggcgaggccaccgccgatgagcgggccggcccagtagaccca 695



to top

>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA,
           complete cds
          Length = 1073

 Score =  192 bits (97), Expect = 8e-46
 Identities = 159/180 (88%)
 Strand = Plus / Minus

                                                                       
Query: 328 ggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgag 387
           ||||||||||||||||  ||||| |||||||||  |||||  |||||  ||  || ||||
Sbjct: 682 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 623

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           |||||||||||||||||||||||||||||||||||||||||||||||| |||  ||||||
Sbjct: 622 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagggagccctt 563

                                                                       
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||||| |||||||||||||||| ||||| || ||| ||||||| |||||||||||
Sbjct: 562 cttggggtcggcggcggtggcgtacacggtgtagacgagcgcgaaggtgatgacgatctc 503



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 260 gcgaggccgncgccgatgagggggccgacccagtacaccca 300
           ||||| ||| |||||||||| |||||||||||||| |||||
Sbjct: 750 gcgagtccgccgccgatgagcgggccgacccagtagaccca 710



to top

>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds
          Length = 968

 Score =  180 bits (91), Expect = 3e-42
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 328 ggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgag 387
           ||||||||||||||||  ||| | |||||||||  |||||  ||||| |||| || | ||
Sbjct: 615 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 556

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           |||||||||||||||||||||||||||||| |||||||||||||||||||||   |||||
Sbjct: 555 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 496

                                                                       
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           ||| |||||| | |||||||||||||| |||||||||||| ||||||| || ||||||||
Sbjct: 495 cttcgggtcggccgcggtggcgtacacggtgtacaccagcgcgaaggtgatcacgatctc 436

             
Query: 508 ca 509
           ||
Sbjct: 435 ca 434



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 270 cgccgatgagggggccgacccagtacaccca 300
           |||||| ||||||||||||||||||||||||
Sbjct: 673 cgccgacgagggggccgacccagtacaccca 643



to top

>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA,
           complete cds
          Length = 1042

 Score =  180 bits (91), Expect = 3e-42
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 328 ggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgag 387
           ||||||||||||||||  ||| | |||||||||  |||||  ||||| |||| || | ||
Sbjct: 683 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 624

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           |||||||||||||||||||||||||||||| |||||||||||||||||||||   |||||
Sbjct: 623 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 564

                                                                       
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           ||| |||||| | |||||||||||||| |||||||||||| ||||||| || ||||||||
Sbjct: 563 cttcgggtcggccgcggtggcgtacacggtgtacaccagcgcgaaggtgatcacgatctc 504

             
Query: 508 ca 509
           ||
Sbjct: 503 ca 502



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 270 cgccgatgagggggccgacccagtacaccca 300
           |||||| ||||||||||||||||||||||||
Sbjct: 741 cgccgacgagggggccgacccagtacaccca 711



to top

>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1067

 Score =  180 bits (91), Expect = 3e-42
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 328 ggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgag 387
           ||||||||||||||||   || | |||||||||| ||||||| |||| |||| | |||||
Sbjct: 669 ggcggggccgaaggagcgtgcagggttcatggacccgccggaaaaggggccggccacgag 610

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           ||||||||||||||| |||||||||||||||||||| ||||||||||| |||   |||||
Sbjct: 609 gatgttggcgccgacaatgaagccgatggcgatgggggcgatggtgccgagggatccctt 550

                                                                       
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||||| |||||||||||||||| ||||| || ||||||||||| | || ||||||
Sbjct: 549 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 490

             
Query: 508 ca 509
           ||
Sbjct: 489 ca 488



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 253 gacgccggcgaggccgncgccgatgagggggccgacccagtacaccca 300
           |||||||||||||||  |||||||||| |||||| ||||||| |||||
Sbjct: 744 gacgccggcgaggccaccgccgatgagcgggccggcccagtaaaccca 697



to top

>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds
          Length = 1060

 Score =  180 bits (91), Expect = 3e-42
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 328 ggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgag 387
           ||||||||||||||||  ||| | |||||||||  |||||  ||||| |||| || | ||
Sbjct: 674 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 615

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           |||||||||||||||||||||||||||||| |||||||||||||||||||||   |||||
Sbjct: 614 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 555

                                                                       
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           ||| |||||| | |||||||||||||| |||||||||||| ||||||| || ||||||||
Sbjct: 554 cttcgggtcggccgcggtggcgtacacggtgtacaccagcgcgaaggtgatcacgatctc 495

             
Query: 508 ca 509
           ||
Sbjct: 494 ca 493



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 270 cgccgatgagggggccgacccagtacaccca 300
           |||||| ||||||||||||||||||||||||
Sbjct: 732 cgccgacgagggggccgacccagtacaccca 702



to top

>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA,
           complete cds
          Length = 1110

 Score =  176 bits (89), Expect = 5e-41
 Identities = 154/176 (87%)
 Strand = Plus / Minus

                                                                       
Query: 328 ggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgag 387
           ||||||||||||||||  ||||| |||||||||  |||||  |||||  ||  || ||||
Sbjct: 839 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 780

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           |||||||||||||||||||||||||||||||||||||||||||||||| ||   ||||||
Sbjct: 779 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgagccctt 720

                                                                   
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 503
           |||||||||| |||||||||||||||| ||||| || ||| ||||||| |||||||
Sbjct: 719 cttggggtcggcggcggtggcgtacacggtgtagacgagcgcgaaggtgatgacga 664



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 260 gcgaggccgncgccgatgagggggccgacccagtacaccca 300
           ||||||||| |||||| ||| |||||||||||||| |||||
Sbjct: 907 gcgaggccgccgccgacgagcgggccgacccagtagaccca 867



to top

>gb|AY105015.1| Zea mays PCO137646 mRNA sequence
          Length = 1238

 Score =  176 bits (89), Expect = 5e-41
 Identities = 154/176 (87%)
 Strand = Plus / Minus

                                                                       
Query: 328 ggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgag 387
           ||||||||||||||||  ||||| |||||||||  |||||  |||||  ||  || ||||
Sbjct: 838 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 779

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           |||||||||||||||||||||||||||||||||||||||||||||||| ||   ||||||
Sbjct: 778 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgagccctt 719

                                                                   
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 503
           |||||||||| |||||||||||||||| ||||| || ||| ||||||| |||||||
Sbjct: 718 cttggggtcggcggcggtggcgtacacggtgtagacgagcgcgaaggtgatgacga 663



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 260 gcgaggccgncgccgatgagggggccgacccagtacaccca 300
           ||||||||| |||||| ||| |||||||||||||| |||||
Sbjct: 906 gcgaggccgccgccgacgagcgggccgacccagtagaccca 866



to top

>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein
           (TIP1) mRNA, partial cds
          Length = 662

 Score =  172 bits (87), Expect = 8e-40
 Identities = 176/206 (85%)
 Strand = Plus / Minus

                                                                       
Query: 310 ccactcccagctgacgagggcggggccgaaggagacggcggngttcatggacgcgccgga 369
           |||||||||||| || || |  || |||||||| || || | |||||| ||||| |||  
Sbjct: 632 ccactcccagctcaccagcggcggcccgaaggacaccgccgggttcatcgacgccccgtc 573

                                                                       
Query: 370 gaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 429
           |||||| |||||| | ||||||||||| || |||||||||||||| ||||||||||||||
Sbjct: 572 gaaggccccgccggccaggatgttggcccccacgatgaagccgatcgcgatgggcgcgat 513

                                                                       
Query: 430 ggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagccc 489
            || |||||||| |||||||| ||||| | ||||||||||||||| ||||| || |||||
Sbjct: 512 cgtccccaggctccccttcttcgggtcaatggcggtggcgtacacggtgtagacgagccc 453

                                     
Query: 490 gaaggtcatgacgatctccaggacca 515
           |||||||||||||||||| |||||||
Sbjct: 452 gaaggtcatgacgatctcgaggacca 427



to top

>gb|AY106931.1| Zea mays PCO140073 mRNA sequence
          Length = 1069

 Score =  172 bits (87), Expect = 8e-40
 Identities = 158/182 (86%)
 Strand = Plus / Minus

                                                                       
Query: 328 ggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgag 387
           ||||||||||||||||  ||| | |||||||||  |||||  ||||| |||| || | ||
Sbjct: 692 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 633

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           |||||||||||||||||||||||||||||| |||||||||||||||||||||   |||||
Sbjct: 632 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 573

                                                                       
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           ||| |||||| | |||||||||||||| |||||||||||  ||||||| || ||||||||
Sbjct: 572 cttcgggtcggccgcggtggcgtacacggtgtacaccagagcgaaggtgatcacgatctc 513

             
Query: 508 ca 509
           ||
Sbjct: 512 ca 511



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 270 cgccgatgagggggccgacccagtacaccca 300
           |||||| ||||||||||||||||||||||||
Sbjct: 750 cgccgacgagggggccgacccagtacaccca 720



to top

>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast
             intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes,
             complete cds
          Length = 65979

 Score =  155 bits (78), Expect = 2e-34
 Identities = 114/126 (90%)
 Strand = Plus / Minus

                                                                         
Query: 384   cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgc 443
             ||||||||||||||||||||||||||||||| || ||||||||||||||||| |||  ||
Sbjct: 44785 cgaggatgttggcgccgacgatgaagccgatcgccatgggcgcgatggtgccgagggagc 44726

                                                                         
Query: 444   ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 503
             |||||||||||||| | || || ||||||||||||||||||||| ||||||| || ||||
Sbjct: 44725 ccttcttggggtcggccgccgtcgcgtacaccgtgtacaccagcgcgaaggtgatcacga 44666

                   
Query: 504   tctcca 509
             ||||||
Sbjct: 44665 tctcca 44660



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 257   ccggcgaggccgncgccgatgagggggccgacccagtacaccca 300
             |||||||||||| | || ||||| || |||||||||||||||||
Sbjct: 44912 ccggcgaggccgccaccaatgagtggcccgacccagtacaccca 44869



to top

>ref|XM_467137.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 747

 Score =  149 bits (75), Expect = 1e-32
 Identities = 155/182 (85%)
 Strand = Plus / Minus

                                                                       
Query: 328 ggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgag 387
           ||||||||||||||||   || | |||||||||  |||||  ||| | |||| || ||||
Sbjct: 612 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 553

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           ||||||||||||||||||||||||||| |||||||||||||||||||| ||    |||||
Sbjct: 552 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 493

                                                                       
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           ||| |||||  | || |||||||||||||||||||||||| |||| || |||||||||||
Sbjct: 492 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 433

             
Query: 508 ca 509
           ||
Sbjct: 432 ca 431



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 257 ccggcgaggccgncgccgatgagggggccgacccagtacaccca 300
           |||||||||||| ||||||| || |||||||||||||| |||||
Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 640



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  149 bits (75), Expect = 1e-32
 Identities = 155/182 (85%)
 Strand = Plus / Plus

                                                                            
Query: 328      ggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgag 387
                ||||||||||||||||   || | |||||||||  |||||  ||| | |||| || ||||
Sbjct: 26627254 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 26627313

                                                                            
Query: 388      gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
                ||||||||||||||||||||||||||| |||||||||||||||||||| ||    |||||
Sbjct: 26627314 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 26627373

                                                                            
Query: 448      cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
                ||| |||||  | || |||||||||||||||||||||||| |||| || |||||||||||
Sbjct: 26627374 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 26627433

                  
Query: 508      ca 509
                ||
Sbjct: 26627434 ca 26627435



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                            
Query: 257      ccggcgaggccgncgccgatgagggggccgacccagtacaccca 300
                |||||||||||| ||||||| || |||||||||||||| |||||
Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 26627226



to top

>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0519E06
          Length = 170634

 Score =  149 bits (75), Expect = 1e-32
 Identities = 155/182 (85%)
 Strand = Plus / Plus

                                                                          
Query: 328    ggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgag 387
              ||||||||||||||||   || | |||||||||  |||||  ||| | |||| || ||||
Sbjct: 169635 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 169694

                                                                          
Query: 388    gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
              ||||||||||||||||||||||||||| |||||||||||||||||||| ||    |||||
Sbjct: 169695 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 169754

                                                                          
Query: 448    cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
              ||| |||||  | || |||||||||||||||||||||||| |||| || |||||||||||
Sbjct: 169755 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 169814

                
Query: 508    ca 509
              ||
Sbjct: 169815 ca 169816



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                          
Query: 257    ccggcgaggccgncgccgatgagggggccgacccagtacaccca 300
              |||||||||||| ||||||| || |||||||||||||| |||||
Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 169607



to top

>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1112_F09
          Length = 139371

 Score =  149 bits (75), Expect = 1e-32
 Identities = 155/182 (85%)
 Strand = Plus / Plus

                                                                         
Query: 328   ggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgag 387
             ||||||||||||||||   || | |||||||||  |||||  ||| | |||| || ||||
Sbjct: 61415 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 61474

                                                                         
Query: 388   gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
             ||||||||||||||||||||||||||| |||||||||||||||||||| ||    |||||
Sbjct: 61475 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 61534

                                                                         
Query: 448   cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
             ||| |||||  | || |||||||||||||||||||||||| |||| || |||||||||||
Sbjct: 61535 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 61594

               
Query: 508   ca 509
             ||
Sbjct: 61595 ca 61596



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                         
Query: 257   ccggcgaggccgncgccgatgagggggccgacccagtacaccca 300
             |||||||||||| ||||||| || |||||||||||||| |||||
Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 61387



to top

>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 1013

 Score =  149 bits (75), Expect = 1e-32
 Identities = 155/182 (85%)
 Strand = Plus / Minus

                                                                       
Query: 328 ggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgag 387
           ||||||||||||||||   || | |||||||||  |||||  ||| | |||| || ||||
Sbjct: 685 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 626

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           ||||||||||||||||||||||||||| |||||||||||||||||||| ||    |||||
Sbjct: 625 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 566

                                                                       
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           ||| |||||  | || |||||||||||||||||||||||| |||| || |||||||||||
Sbjct: 565 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 506

             
Query: 508 ca 509
           ||
Sbjct: 505 ca 504



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 257 ccggcgaggccgncgccgatgagggggccgacccagtacaccca 300
           |||||||||||| ||||||| || |||||||||||||| |||||
Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 713



to top

>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full
           insert sequence
          Length = 873

 Score =  149 bits (75), Expect = 1e-32
 Identities = 155/182 (85%)
 Strand = Plus / Minus

                                                                       
Query: 328 ggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgag 387
           ||||||||||||||||   || | |||||||||  |||||  ||| | |||| || ||||
Sbjct: 487 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 428

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           ||||||||||||||||||||||||||| |||||||||||||||||||| ||    |||||
Sbjct: 427 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 368

                                                                       
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           ||| |||||  | || |||||||||||||||||||||||| |||| || |||||||||||
Sbjct: 367 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 308

             
Query: 508 ca 509
           ||
Sbjct: 307 ca 306



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 257 ccggcgaggccgncgccgatgagggggccgacccagtacaccca 300
           |||||||||||| ||||||| || |||||||||||||| |||||
Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 515



to top

>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2
          Length = 339972

 Score =  149 bits (75), Expect = 1e-32
 Identities = 155/182 (85%)
 Strand = Plus / Minus

                                                                          
Query: 328    ggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgag 387
              ||||||||||||||||   || | |||||||||  |||||  ||| | |||| || ||||
Sbjct: 250580 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 250521

                                                                          
Query: 388    gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
              ||||||||||||||||||||||||||| |||||||||||||||||||| ||    |||||
Sbjct: 250520 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 250461

                                                                          
Query: 448    cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
              ||| |||||  | || |||||||||||||||||||||||| |||| || |||||||||||
Sbjct: 250460 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 250401

                
Query: 508    ca 509
              ||
Sbjct: 250400 ca 250399



 Score =  139 bits (70), Expect = 1e-29
 Identities = 112/126 (88%)
 Strand = Plus / Plus

                                                                          
Query: 384    cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgc 443
              ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||    |
Sbjct: 332124 cgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatc 332183

                                                                          
Query: 444    ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 503
              ||||||| |||||  | || |||||||||||||||||||||||| |||| || |||||||
Sbjct: 332184 ccttcttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacga 332243

                    
Query: 504    tctcca 509
              ||||||
Sbjct: 332244 tctcca 332249



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                          
Query: 257    ccggcgaggccgncgccgatgagggggccgacccagtacaccca 300
              |||||||||||| ||||||| || |||||||||||||| |||||
Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 250608



to top

>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full
           insert sequence
          Length = 870

 Score =  143 bits (72), Expect = 7e-31
 Identities = 91/98 (92%)
 Strand = Plus / Minus

                                                                       
Query: 180 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 239
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 689 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 630

                                                 
Query: 240 gcagctcgtanatgacgccggcgaggccgncgccgatg 277
           | | |||||| |||||||||||||||||  ||||||||
Sbjct: 629 ggacctcgtagatgacgccggcgaggccaccgccgatg 592



 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 439 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 498
           |||||||||||||||||| ||||||||||||||||| ||||| || || |||||||||||
Sbjct: 592 gctgcccttcttggggtcaacggcggtggcgtacacggtgtagacgaggccgaaggtcat 533

                                       
Query: 499 gacgatctccaggaccaccgcctcccac 526
           |||||||||||| ||||  |||||||||
Sbjct: 532 gacgatctccagcaccagggcctcccac 505



to top

>ref|XM_473424.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2307

 Score =  119 bits (60), Expect = 1e-23
 Identities = 108/124 (87%)
 Strand = Plus / Minus

                                                                       
Query: 386 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccc 445
           ||||||||||| |||||||||||||||||||| |||||||||| |||||| |||   |||
Sbjct: 557 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaaccc 498

                                                                       
Query: 446 ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatc 505
           ||||| |||||| | || |||||||||||||||||||||||| |||| || || || |||
Sbjct: 497 ttcttcgggtcggccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatcacaatc 438

               
Query: 506 tcca 509
           ||||
Sbjct: 437 tcca 434



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 272 ccgatgagggggccgacccagtacaccca 300
           ||||| || ||||||||||||||||||||
Sbjct: 671 ccgatcagtgggccgacccagtacaccca 643



to top

>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17,
             complete sequence
          Length = 127259

 Score =  119 bits (60), Expect = 1e-23
 Identities = 108/124 (87%)
 Strand = Plus / Plus

                                                                         
Query: 386   aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccc 445
             ||||||||||| |||||||||||||||||||| |||||||||| |||||| |||   |||
Sbjct: 92622 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaaccc 92681

                                                                         
Query: 446   ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatc 505
             ||||| |||||| | || |||||||||||||||||||||||| |||| || || || |||
Sbjct: 92682 ttcttcgggtcggccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatcacaatc 92741

                 
Query: 506   tcca 509
             ||||
Sbjct: 92742 tcca 92745



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 272   ccgatgagggggccgacccagtacaccca 300
             ||||| || ||||||||||||||||||||
Sbjct: 92508 ccgatcagtgggccgacccagtacaccca 92536



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  119 bits (60), Expect = 1e-23
 Identities = 108/124 (87%)
 Strand = Plus / Plus

                                                                            
Query: 386      aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccc 445
                ||||||||||| |||||||||||||||||||| |||||||||| |||||| |||   |||
Sbjct: 27568646 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaaccc 27568705

                                                                            
Query: 446      ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatc 505
                ||||| |||||| | || |||||||||||||||||||||||| |||| || || || |||
Sbjct: 27568706 ttcttcgggtcggccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatcacaatc 27568765

                    
Query: 506      tcca 509
                ||||
Sbjct: 27568766 tcca 27568769



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 191/239 (79%), Gaps = 5/239 (2%)
 Strand = Plus / Minus

                                                                            
Query: 266      ccgncgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacg 325
                ||| |||||||||| || |||| |||||| ||||| ||||  | ||| | ||||| ||||
Sbjct: 26354834 ccggcgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacg 26354775

                                                                            
Query: 326      agggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacg 385
                || || |||||||| | |   || | |||||||| |||||||  ||| | ||| ||| ||
Sbjct: 26354774 agcgccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcg 26354715

                                                                            
Query: 386      aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcc- 444
                |||||||| |||||  |||  ||||||||||||| |||||| |||  |||   || ||| 
Sbjct: 26354714 aggatgttcgcgcccgcgaccaagccgatggcgaggggcgcaatgtcgcc---gccgccg 26354658

                                                                           
Query: 445      cttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 503
                |||||  || |||||||||||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 26354657 cttctccgg-tcgacggcggtggcgtacacggtgtacacgagcccgaacgtcatgacga 26354600



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 272      ccgatgagggggccgacccagtacaccca 300
                ||||| || ||||||||||||||||||||
Sbjct: 27568532 ccgatcagtgggccgacccagtacaccca 27568560



to top

>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein
          Length = 1007

 Score =  101 bits (51), Expect = 2e-18
 Identities = 143/174 (82%)
 Strand = Plus / Minus

                                                                       
Query: 336 cgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttgg 395
           ||||||||  ||||| |||||||||  |||| ||||||| |||  || | | ||||||||
Sbjct: 684 cgaaggagcgggcggggttcatggagccgccagagaaggggcccgcggccaagatgttgg 625

                                                                       
Query: 396 cgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggt 455
           |||| ||||||||||| || || ||||| |||||||||||||||  ||||||||| ||||
Sbjct: 624 cgcccacgatgaagccaatagcaatgggagcgatggtgcccaggtcgcccttcttcgggt 565

                                                                 
Query: 456 cgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctcca 509
           || | ||||||||||| || ||||| |  ||| |||| || || ||||||||||
Sbjct: 564 cggctgcggtggcgtagacggtgtagatgagcgcgaatgtgataacgatctcca 511



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 257 ccggcgaggccgncgccgatgagggggccgacccagtacaccca 300
           ||||| |||||| | |||||||||||||||||||||||||||||
Sbjct: 763 ccggcaaggccgcctccgatgagggggccgacccagtacaccca 720



to top

>gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast intrinsic protein (TIP)
           mRNA, complete cds
          Length = 1235

 Score =  101 bits (51), Expect = 2e-18
 Identities = 205/257 (79%)
 Strand = Plus / Minus

                                                                       
Query: 251 atgacgccggcgaggccgncgccgatgagggggccgacccagtacacccactggtacccc 310
           ||||| |||||||| ||  | |||||||| |||||||||||||| ||||| ||||    |
Sbjct: 749 atgactccggcgagccctcctccgatgagtgggccgacccagtagacccagtggttgttc 690

                                                                       
Query: 311 cactcccagctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggag 370
           ||   ||| ||||| ||||| || ||||| || ||||| | ||||||||| || |||| |
Sbjct: 689 caggtccaactgactagggctggaccgaatgacacggccgggttcatggatgcaccggtg 630

                                                                       
Query: 371 aaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatg 430
           ||||| || ||||| | ||||||||| || |||||||| || ||||| || || || |||
Sbjct: 629 aaggctcctccgaccaagatgttggctccaacgatgaaaccaatggcaattggggcaatg 570

                                                                       
Query: 431 gtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccg 490
            | || ||| ||||  ||||| |||||| ||| ||||||||||| ||||| ||||| |||
Sbjct: 569 attccgaggttgcctctcttgtggtcgatggccgtggcgtacacggtgtagaccaggccg 510

                            
Query: 491 aaggtcatgacgatctc 507
           |||||||| || |||||
Sbjct: 509 aaggtcatcacaatctc 493



to top

>emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH44ZA10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 887

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 135/164 (82%)
 Strand = Plus / Minus

                                                                       
Query: 344 acggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 403
           ||||| | ||||||||| ||||||  ||| || || ||| |||||||||| || || |||
Sbjct: 488 acggctgggttcatggaagcgccgctgaaagctccaccggcgaggatgttcgctccaacg 429

                                                                       
Query: 404 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 463
           ||||| || |||||||| || ||||| || || ||  |||| ||||||||||| ||||| 
Sbjct: 428 atgaaacctatggcgattggtgcgattgttccgagagtgccgttcttggggtcaacggct 369

                                                       
Query: 464 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 368 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 325



to top

>dbj|D84669.1| Raphanus sativus mRNA for VM23, complete sequence
          Length = 1054

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 135/165 (81%)
 Strand = Plus / Minus

                                                                       
Query: 343 gacggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgac 402
           |||||| | ||||||||| || |||  ||| || || ||| |||||||||| || || ||
Sbjct: 679 gacggctgggttcatggaggctccgctgaaagctccaccggcgaggatgttagctccaac 620

                                                                       
Query: 403 gatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggc 462
           |||||| || ||||| || || ||||| || || || || || |||||||||||||||||
Sbjct: 619 gatgaaacctatggcaattggtgcgattgttccgagactaccgttcttggggtcgacggc 560

                                                        
Query: 463 ggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
            |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 559 tgtggcgtaaacggtgtagacgagcccgaaggtcatcacgatctc 515



to top

>ref|NM_113559.3| Arabidopsis thaliana TIP2 (TONOPLAST INTRINSIC PROTEIN 2); water
           channel AT3G26520 (TIP2) mRNA, complete cds
          Length = 1201

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 134/164 (81%)
 Strand = Plus / Minus

                                                                       
Query: 344 acggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 403
           ||||| | ||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 720 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 661

                                                                       
Query: 404 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 463
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 660 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 601

                                                       
Query: 464 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 600 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 557



to top

>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein
           (tip1 gene)
          Length = 1112

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 248/314 (78%), Gaps = 2/314 (0%)
 Strand = Plus / Minus

                                                                       
Query: 195 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtanatga 254
           ||||||| ||||| |||||||| || |||||| ||  |||||| | ||||| ||| | ||
Sbjct: 830 agtagtcagtggttgggagctgttcatgggtgtggttgatgaataacagctggtagacga 771

                                                                       
Query: 255 cgccggcgaggccgncgccgatgagggggccgacccagtacacccactggtacccccact 314
            |||||||| | |  | ||||  || |||||||||||||| | ||| ||||   |||| |
Sbjct: 770 tgccggcgatggctgcaccgactagtgggccgacccagtagatccagtggttaacccagt 711

                                                                       
Query: 315 cccagctgacgagggcggggccgaaggagacggcggngttcatggacgcgccggagaagg 374
            |||||| || | ||| || || ||||  ||||| | ||||||||| || |||| |||| 
Sbjct: 710 tccagctcaccaaggcaggtccaaaggccacggcagggttcatggatgcaccggtgaaga 651

                                                                       
Query: 375 cgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgc 434
           | || ||||||| |||||||||  | || || | ||||||||||| ||| ||||| ||||
Sbjct: 650 ctcctccgacgaagatgttggcagcaacaataaggccgatggcgaggggagcgatagtgc 591

                                                                       
Query: 435 cca-ggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaag 493
           | | |||| || ||||||||||||| |||||||||||| || ||||| || || ||||||
Sbjct: 590 cgatggct-cctttcttggggtcgatggcggtggcgtagacggtgtagactagtccgaag 532

                         
Query: 494 gtcatgacgatctc 507
           ||||| ||||||||
Sbjct: 531 gtcatcacgatctc 518



to top

>gb|AY079114.1| Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds
          Length = 762

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 134/164 (81%)
 Strand = Plus / Minus

                                                                       
Query: 344 acggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 403
           ||||| | ||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 608 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 549

                                                                       
Query: 404 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 463
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 548 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 489

                                                       
Query: 464 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 488 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 445



to top

>gb|AF419613.1|AF419613 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds
          Length = 1061

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 134/164 (81%)
 Strand = Plus / Minus

                                                                       
Query: 344 acggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 403
           ||||| | ||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 670 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 611

                                                                       
Query: 404 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 463
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 610 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 551

                                                       
Query: 464 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 550 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 507



to top

>gb|AF428341.1|AF428341 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds
          Length = 1066

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 134/164 (81%)
 Strand = Plus / Minus

                                                                       
Query: 344 acggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 403
           ||||| | ||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 675 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 616

                                                                       
Query: 404 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 463
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 615 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 556

                                                       
Query: 464 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 555 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 512



to top

>gb|AF004393.1|AF004393 Arabidopsis thaliana salt-stress induced tonoplast intrinsic
           protein mRNA, complete cds
          Length = 1072

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 134/164 (81%)
 Strand = Plus / Minus

                                                                       
Query: 344 acggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 403
           ||||| | ||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 682 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 623

                                                                       
Query: 404 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 463
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 622 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 563

                                                       
Query: 464 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 562 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 519



to top

>emb|BX822807.1|CNS0A75T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB65ZD08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1010

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 134/164 (81%)
 Strand = Plus / Minus

                                                                       
Query: 344 acggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 403
           ||||| | ||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 658 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 599

                                                                       
Query: 404 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 463
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 598 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 539

                                                       
Query: 464 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 538 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 495



to top

>emb|BX822624.1|CNS0A742 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB53ZH08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1020

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 134/164 (81%)
 Strand = Plus / Minus

                                                                       
Query: 344 acggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 403
           ||||| | ||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597

                                                                       
Query: 404 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 463
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537

                                                       
Query: 464 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 536 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 493



to top

>emb|BX824073.1|CNS0A6T2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH1ZE06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1008

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 134/164 (81%)
 Strand = Plus / Minus

                                                                       
Query: 344 acggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 403
           ||||| | ||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597

                                                                       
Query: 404 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 463
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537

                                                       
Query: 464 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 536 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 493



to top

>emb|BX822975.1|CNS0A733 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB78ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1054

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 134/164 (81%)
 Strand = Plus / Minus

                                                                       
Query: 344 acggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 403
           ||||| | ||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 647 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 588

                                                                       
Query: 404 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 463
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 587 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 528

                                                       
Query: 464 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 527 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 484



to top

>emb|BX824311.1|CNS0A6PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH38ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 995

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 134/164 (81%)
 Strand = Plus / Minus

                                                                       
Query: 344 acggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 403
           ||||| | ||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 665 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 606

                                                                       
Query: 404 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 463
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 605 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 546

                                                       
Query: 464 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 545 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 502



to top

>emb|BX823637.1|CNS0A6I3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZE05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 960

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 134/164 (81%)
 Strand = Plus / Minus

                                                                       
Query: 344 acggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 403
           ||||| | ||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 479 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 420

                                                                       
Query: 404 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 463
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 419 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 360

                                                       
Query: 464 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 359 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 316



to top

>emb|BX823607.1|CNS0A6MK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS56ZB09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1012

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 134/164 (81%)
 Strand = Plus / Minus

                                                                       
Query: 344 acggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 403
           ||||| | ||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597

                                                                       
Query: 404 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 463
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537

                                                       
Query: 464 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 536 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 493



to top

>dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16
          Length = 82646

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 134/164 (81%)
 Strand = Plus / Plus

                                                                         
Query: 344   acggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 403
             ||||| | ||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 15518 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 15577

                                                                         
Query: 404   atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 463
             ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 15578 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 15637

                                                         
Query: 464   gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
             |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 15638 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 15681



to top

>gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protein (gamma-TIP2) mRNA,
           complete cds
          Length = 1020

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 134/164 (81%)
 Strand = Plus / Minus

                                                                       
Query: 344 acggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 403
           ||||| | ||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 617 acggctgggttcatggaggctccgctgaaagctccaccggcgaggatgttagctccaacg 558

                                                                       
Query: 404 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 463
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 557 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 498

                                                       
Query: 464 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 497 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 454



to top

>dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds
          Length = 321

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           |||||||||||||||||| ||||||||||| || || || || || ||||| || |||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggcaattggtgcaattgttcccagacttccctt 262

                                                                       
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           ||||||||| |  ||||| ||||| || |||||||| |||||||| ||||| || |||||
Sbjct: 261 cttggggtcaattgcggttgcgtagactgtgtacacaagcccgaacgtcattacaatctc 202



to top

>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA
          Length = 756

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                       
Query: 324 cgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccga 383
           ||||||| ||||||||||||  ||| | ||||||||| ||||||||| |||  |||||| 
Sbjct: 616 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 557

                                         
Query: 384 cgaggatgttggcgccgacgatgaagccga 413
           ||||||||||||||||||||| || |||||
Sbjct: 556 cgaggatgttggcgccgacgacgaggccga 527



to top

>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA,
           complete cds
          Length = 955

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 72/82 (87%)
 Strand = Plus / Minus

                                                                       
Query: 323 acgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccg 382
           ||||| |||||||||||||||   |||| |||||||||||||||||||||||  ||||||
Sbjct: 714 acgagcgcggggccgaaggagcgcgcggggttcatggacgcgccggagaagggcccgccg 655

                                 
Query: 383 acgaggatgttggcgccgacga 404
            |||| | ||||||||||||||
Sbjct: 654 gcgagcacgttggcgccgacga 633



to top

>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0431F01
          Length = 143209

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                         
Query: 324   cgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccga 383
             ||||||| ||||||||||||  ||| | ||||||||| ||||||||| |||  |||||| 
Sbjct: 98909 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 98850

                                           
Query: 384   cgaggatgttggcgccgacgatgaagccga 413
             ||||||||||||||||||||| || |||||
Sbjct: 98849 cgaggatgttggcgccgacgacgaggccga 98820



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                   
Query: 352    gttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 404
              ||||||||||||||||| ||  ||||||||| ||| | |||||||||||||||
Sbjct: 103780 gttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 103728



to top

>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full
           insert sequence
          Length = 1112

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                       
Query: 324 cgagggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccga 383
           ||||||| ||||||||||||  ||| | ||||||||| ||||||||| |||  |||||| 
Sbjct: 619 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 560

                                         
Query: 384 cgaggatgttggcgccgacgatgaagccga 413
           ||||||||||||||||||||| || |||||
Sbjct: 559 cgaggatgttggcgccgacgacgaggccga 530



to top

>dbj|AB048248.1| Pyrus communis Py-gTIP mRNA for gamma tonoplast intrinsic protein,
           complete cds
          Length = 1122

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 100/119 (84%)
 Strand = Plus / Minus

                                                                       
Query: 389 atgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttc 448
           ||||||||||| |||||||| || || |||||||||||||| || |||| ||| || |||
Sbjct: 631 atgttggcgccaacgatgaaaccaatcgcgatgggcgcgattgtccccacgctcccattc 572

                                                                      
Query: 449 ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           || ||||| | ||| || ||||| |||||||| ||||| ||||| ||||| ||||||||
Sbjct: 571 ttcgggtcaatggcagtcgcgtagaccgtgtagaccagtccgaacgtcatcacgatctc 513



to top

>emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for putative aquaporin (aq1 gene)
          Length = 428

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 180/224 (80%), Gaps = 2/224 (0%)
 Strand = Plus / Minus

                                                                       
Query: 285 cgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaaggaga 344
           |||||||||| ||||||||||   |||| | |||||| || | ||| || || ||||  |
Sbjct: 428 cgacccagtaaacccactggttaacccagttccagctcaccaaggcaggtccaaaggcca 369

                                                                       
Query: 345 cggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 404
           |||| | ||||||||| || |||| |||| | || ||| ||| |||||||||  | || |
Sbjct: 368 cggcagggttcatggatgcaccggtgaagactcctccgtcgaagatgttggcagcaacaa 309

                                                                       
Query: 405 tgaagccgatggcgatgggcgcgatggtgccca-ggctgcccttcttggggtcgacggcg 463
           | | ||||||||||| ||| ||||| ||||| | |||| || ||||||||||||| ||||
Sbjct: 308 taaggccgatggcgaggggagcgatagtgccgatggct-cctttcttggggtcgatggcg 250

                                                       
Query: 464 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||| || ||||| || || ||||||||||| ||||||||
Sbjct: 249 gtggcgtagacggtgtagactagtccgaaggtcatcacgatctc 206



to top

>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds
          Length = 1047

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 389 atgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttc 448
           ||||| ||||| || ||||| || ||||||||||| || ||  | ||||   ||||||||
Sbjct: 665 atgttagcgccaacaatgaaaccaatggcgatgggagcaataattcccaaattgcccttc 606

                                                                       
Query: 449 ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctcc 508
           |||||||| ||||| |||||||| || ||||||||||  ||||||||||| |||||||||
Sbjct: 605 ttggggtcaacggcagtggcgtagactgtgtacaccaaaccgaaggtcatcacgatctcc 546

            
Query: 509 a 509
           |
Sbjct: 545 a 545



to top

>gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast intrinsic protein
           bobTIP26-1 mRNA, complete cds
          Length = 942

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 100/120 (83%)
 Strand = Plus / Minus

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           ||||||||| || || ||||| ||||| |||||||| || || || || || || || ||
Sbjct: 597 gatgttggcaccaacaatgaaaccgatagcgatgggagctattgttccaagacttccgtt 538

                                                                       
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||| || |||||||||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 537 cttgggatcaacggcggtggcgtagactgtgtaaactagcccgaaggtcatcacgatctc 478



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 195 agtagtcggtggtggggagctgctcgtgggtg 226
           ||||||||| |||||||||||| |||||||||
Sbjct: 790 agtagtcggcggtggggagctgttcgtgggtg 759



to top

>emb|BX822304.1|CNS0A7A0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB27ZF06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 628

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 103/124 (83%)
 Strand = Plus / Minus

                                                                       
Query: 384 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgc 443
           |||||||||| || || |||||||| || |||||||| || ||||| || || || || |
Sbjct: 182 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 123

                                                                       
Query: 444 ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 503
           | ||||||||||| ||||  |||||||| || ||||| || |||||||||||||| ||||
Sbjct: 122 cgttcttggggtctacggttgtggcgtagacggtgtagacgagcccgaaggtcattacga 63

               
Query: 504 tctc 507
           ||||
Sbjct: 62  tctc 59



to top

>ref|XM_473251.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 191/239 (79%), Gaps = 5/239 (2%)
 Strand = Plus / Minus

                                                                       
Query: 266 ccgncgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacg 325
           ||| |||||||||| || |||| |||||| ||||| ||||  | ||| | ||||| ||||
Sbjct: 701 ccggcgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacg 642

                                                                       
Query: 326 agggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacg 385
           || || |||||||| | |   || | |||||||| |||||||  ||| | ||| ||| ||
Sbjct: 641 agcgccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcg 582

                                                                       
Query: 386 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcc- 444
           |||||||| |||||  |||  ||||||||||||| |||||| |||  |||   || ||| 
Sbjct: 581 aggatgttcgcgcccgcgaccaagccgatggcgaggggcgcaatgtcgcc---gccgccg 525

                                                                      
Query: 445 cttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 503
           |||||  || |||||||||||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 524 cttctccgg-tcgacggcggtggcgtacacggtgtacacgagcccgaacgtcatgacga 467



to top

>emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0038O10,
              complete sequence
          Length = 141545

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 191/239 (79%), Gaps = 5/239 (2%)
 Strand = Plus / Minus

                                                                          
Query: 266    ccgncgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacg 325
              ||| |||||||||| || |||| |||||| ||||| ||||  | ||| | ||||| ||||
Sbjct: 131411 ccggcgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacg 131352

                                                                          
Query: 326    agggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacg 385
              || || |||||||| | |   || | |||||||| |||||||  ||| | ||| ||| ||
Sbjct: 131351 agcgccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcg 131292

                                                                          
Query: 386    aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcc- 444
              |||||||| |||||  |||  ||||||||||||| |||||| |||  |||   || ||| 
Sbjct: 131291 aggatgttcgcgcccgcgaccaagccgatggcgaggggcgcaatgtcgcc---gccgccg 131235

                                                                         
Query: 445    cttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 503
              |||||  || |||||||||||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 131234 cttctccgg-tcgacggcggtggcgtacacggtgtacacgagcccgaacgtcatgacga 131177



to top

>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA,
           complete cds
          Length = 1125

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                       
Query: 326 agggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacg 385
           ||||| ||||||||||||   || | ||||||||||||||||| ||||  ||||||| ||
Sbjct: 768 agggccgggccgaaggagcgtgccgggttcatggacgcgccggtgaagttgccgccggcg 709

                                 
Query: 386 aggatgttggcgccgacgatga 407
           ||| ||||||||||||||||||
Sbjct: 708 aggctgttggcgccgacgatga 687



to top

>dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsic protein 1;1,
           complete cds
          Length = 1067

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 45/47 (95%)
 Strand = Plus / Minus

                                                          
Query: 193 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 239
           |||||| ||||||||||||||||||||||||||| ||||||||||||
Sbjct: 826 ttagtaatcggtggtggggagctgctcgtgggtgtgggagatgaaga 780



to top

>dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intrinsic protein,
           complete cds
          Length = 1143

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 99/119 (83%)
 Strand = Plus / Minus

                                                                       
Query: 389 atgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttc 448
           ||||| ||||| || | ||| ||||| ||||| |||||||| || |||| ||||||  ||
Sbjct: 660 atgttcgcgccaactacgaaaccgatcgcgatcggcgcgattgttcccacgctgcctctc 601

                                                                      
Query: 449 ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           || ||||| | ||| |||||||||||||||||||||| ||| || ||||| ||||||||
Sbjct: 600 ttcgggtcaatggctgtggcgtacaccgtgtacaccaacccaaacgtcatcacgatctc 542



to top

>dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-C05, full
           insert sequence
          Length = 912

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 48/51 (94%)
 Strand = Plus / Minus

                                                              
Query: 453 ggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 503
           |||||||||||||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 583 ggtcgacggcggtggcgtacacggtgtacacgagcccgaacgtcatgacga 533



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 127/161 (78%)
 Strand = Plus / Minus

                                                                       
Query: 266 ccgncgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacg 325
           ||| |||||||||| || |||| |||||| ||||| ||||  | ||| | ||||| ||||
Sbjct: 767 ccggcgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacg 708

                                                                       
Query: 326 agggcggggccgaaggagacggcggngttcatggacgcgccggagaaggcgccgccgacg 385
           || || |||||||| | |   || | |||||||| |||||||  ||| | ||| ||| ||
Sbjct: 707 agcgccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcg 648

                                                    
Query: 386 aggatgttggcgccgacgatgaagccgatggcgatgggcgc 426
           |||||||| |||||  |||  ||||||||||||| ||||||
Sbjct: 647 aggatgttcgcgcccgcgaccaagccgatggcgaggggcgc 607



to top

>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds
          Length = 321

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           |||||||||||||||||||||||||||||| |||||||| || || |||| |   |||||
Sbjct: 321 gatgttggcgccgacgatgaagccgatggcaatgggcgcaattgtccccacgtcaccctt 262

                                                 
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacacca 485
           ||| |||||    |||||| ||||||| ||||||||||
Sbjct: 261 ctttgggtcacatgcggtgccgtacactgtgtacacca 224



to top

>emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic protein
          Length = 992

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 132/164 (80%)
 Strand = Plus / Minus

                                                                       
Query: 346 ggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgat 405
           ||||| |||||| ||||| |||| ||| || || || || || |||||||| ||||||||
Sbjct: 623 ggcggggttcatcgacgcaccggtgaacgccccaccaaccagaatgttggcaccgacgat 564

                                                                       
Query: 406 gaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggt 465
           ||| ||||| || ||||| |||||||| || |     ||||||||||| ||||| || ||
Sbjct: 563 gaatccgatcgcaatgggagcgatggttccaatatcccccttcttgggatcgacagcagt 504

                                                       
Query: 466 ggcgtacaccgtgtacaccagcccgaaggtcatgacgatctcca 509
            |||||||| ||||| || |||||| | ||||| ||||||||||
Sbjct: 503 agcgtacacagtgtagacgagcccgcacgtcatcacgatctcca 460



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 270 cgccgatgagggggccgacccagtacaccca 300
           |||||||||| ||||| ||||||||||||||
Sbjct: 702 cgccgatgagcgggccaacccagtacaccca 672



to top

>emb|BX825064.1|CNS0A6TA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH92ZF07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 931

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 132/164 (80%)
 Strand = Plus / Minus

                                                                       
Query: 344 acggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 403
           ||||| | ||||||||| |||||   ||| || || ||| |||||||||| || || |||
Sbjct: 644 acggctgggttcatggaagcgcccctgaacgctccaccggcgaggatgttcgctccaacg 585

                                                                       
Query: 404 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 463
           ||||| |  |||||||| || |||||  |||| ||  | || ||||||||||| ||||| 
Sbjct: 584 atgaaacttatggcgattggtgcgattttgccgagaataccgttcttggggtcaacggct 525

                                                       
Query: 464 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 524 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 481



to top

>emb|BX842211.1|CNS09YE1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL65ZH05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1014

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 88/105 (83%)
 Strand = Plus / Minus

                                                                       
Query: 403 gatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggc 462
           |||||| || |||||||| || ||||| || || || || || ||||||||||| |||||
Sbjct: 589 gatgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggc 530

                                                        
Query: 463 ggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
            |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 529 tgtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 485



to top

>emb|BX842138.1|CNS09YDN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS54ZD02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1062

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 100/121 (82%)
 Strand = Plus / Minus

                                                                       
Query: 387 ggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccct 446
           ||||||| || || |||||||| || |||||||| || ||||| || || || || || |
Sbjct: 613 ggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactaccgt 554

                                                                       
Query: 447 tcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatct 506
           |||||||||| ||||| |||||||| || ||| | || |||||||||||||| |||||||
Sbjct: 553 tcttggggtcaacggctgtggcgtagacggtgcagacgagcccgaaggtcatcacgatct 494

            
Query: 507 c 507
           |
Sbjct: 493 c 493



to top

>emb|BX842163.1|CNS09YDT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH74ZE01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 921

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 103/124 (83%), Gaps = 1/124 (0%)
 Strand = Plus / Minus

                                                                       
Query: 384 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgc 443
           |||||||||| || || |||||||| || |||||||| |  ||||| || || || || |
Sbjct: 615 cgaggatgttagctccaacgatgaaacctatggcgattgt-gcgattgttccgagactac 557

                                                                       
Query: 444 ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 503
           | ||||||||||| ||||| |||||||| || ||||| || |||||||||||||| ||||
Sbjct: 556 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacga 497

               
Query: 504 tctc 507
           ||||
Sbjct: 496 tctc 493



to top

>gb|AF057137.1|AF057137 Arabidopsis thaliana gamma tonoplast intrinsic protein 2 (TIP2)
           mRNA, complete cds
          Length = 1035

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 102/124 (82%)
 Strand = Plus / Minus

                                                                       
Query: 384 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgc 443
           |||||||||| || || |||||||| || |||||||| || ||||| || || || ||  
Sbjct: 621 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactag 562

                                                                       
Query: 444 ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 503
           | |||||||| || ||||| |||||||| || ||||| || |||||||||||||| ||||
Sbjct: 561 cgttcttgggatcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacga 502

               
Query: 504 tctc 507
           ||||
Sbjct: 501 tctc 498



to top

>dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds
          Length = 321

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           |||||||||||||||||| |||||||||||||| || || || |||||||     |||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggcgatcggtgcaattgtgcccaatgcaccctt 262

                                                 
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacacca 485
           |||||||||    ||||||||||| || ||||||||||
Sbjct: 261 cttggggtcacatgcggtggcgtaaacggtgtacacca 224



to top

>gb|DQ237285.1| Panax ginseng tonoplast intrinsic protein (TIP1) mRNA, complete cds
          Length = 940

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 443 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 502
           |||||||| ||||||| |||||| ||||| || ||||| |||||||| ||||||||||| 
Sbjct: 561 cccttctttgggtcgatggcggttgcgtaaacggtgtaaaccagcccaaaggtcatgaca 502

                
Query: 503 atctc 507
           |||||
Sbjct: 501 atctc 497



to top

>emb|AJ133748.1|PAB133748 Picea abies mRNA for major intrinsic protein
          Length = 1168

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 132/165 (80%)
 Strand = Plus / Minus

                                                                       
Query: 352 gttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagcc 411
           ||||||||| || |||  |||||| |||||| | || || ||||| || || ||||| ||
Sbjct: 706 gttcatggaagccccgtcgaaggcaccgccggccagaatattggcacccactatgaaacc 647

                                                                       
Query: 412 gatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgta 471
           ||| || | ||| || ||||| |||||||| ||| | || |  |||| ||| ||||||||
Sbjct: 646 gatcgcaaggggggctatggttcccaggctcccccttttagcatcgatggccgtggcgta 587

                                                        
Query: 472 caccgtgtacaccagcccgaaggtcatgacgatctccaggaccac 516
            || ||||| ||||||||||| ||||| ||||||||||| |||||
Sbjct: 586 tacagtgtaaaccagcccgaacgtcatcacgatctccagcaccac 542



to top

>ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative beta-tonoplast
           intrinsic protein (OSJNBa0051D19.19), mRNA
          Length = 1186

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 257 ccggcgaggccgncgccgatgagggggccgacccagtacacccactggtacccccactcc 316
           |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 855 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 796

                                  
Query: 317 cagctgacgagggcggggccgaa 339
           |||| |||||| || ||||||||
Sbjct: 795 cagccgacgagcgccgggccgaa 773



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 384 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
           |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 728 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 680



to top

>ref|NM_189871.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 576

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 257 ccggcgaggccgncgccgatgagggggccgacccagtacacccactggtacccccactcc 316
           |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | |
Sbjct: 512 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 453

                      
Query: 317 cagctgacgag 327
           |||| ||||||
Sbjct: 452 cagccgacgag 442



to top

>gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 genomic sequence, complete
             sequence
          Length = 131984

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                         
Query: 257   ccggcgaggccgncgccgatgagggggccgacccagtacacccactggtacccccactcc 316
             |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 26108 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 26167

                                    
Query: 317   cagctgacgagggcggggccgaa 339
             |||| |||||| || ||||||||
Sbjct: 26168 cagccgacgagcgccgggccgaa 26190



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 384   cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
             |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 26235 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 26283



to top

>gb|AF271662.1|AF271662 Vitis berlandieri x Vitis rupestris putative aquaporin TIP2 (TIP2)
           mRNA, partial cds
          Length = 304

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 98/120 (81%)
 Strand = Plus / Minus

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           ||||||||| || |||||||| || || || ||||| || ||| |||| | | |||||||
Sbjct: 274 gatgttggcacccacgatgaaaccaattgcaatgggtgcaatgatgccgatgttgccctt 215

                                                                       
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           ||| ||||| | ||| || ||||| || ||||| ||||| |||||||||||||| |||||
Sbjct: 214 cttcgggtcaatggctgttgcgtatacagtgtaaaccaggccgaaggtcatgacaatctc 155



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                            
Query: 257      ccggcgaggccgncgccgatgagggggccgacccagtacacccactggtacccccactcc 316
                |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 18187020 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 18186961

                                       
Query: 317      cagctgacgagggcggggccgaa 339
                |||| |||||| || ||||||||
Sbjct: 18186960 cagccgacgagcgccgggccgaa 18186938



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                                 
Query: 384      cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
                |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 18186893 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 18186845



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                            
Query: 257      ccggcgaggccgncgccgatgagggggccgacccagtacacccactggtacccccactcc 316
                |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | |
Sbjct: 25641777 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 25641836

                           
Query: 317      cagctgacgag 327
                |||| ||||||
Sbjct: 25641837 cagccgacgag 25641847



to top

>gb|AF326506.1|AF326506 Zea mays tonoplast membrane integral protein ZmTIP4-2 mRNA,
           complete cds
          Length = 1255

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 352 gttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 407
           ||||||||||||||||| ||||  ||||||| ||||| ||||||||||||| ||||
Sbjct: 741 gttcatggacgcgccggtgaagttgccgccggcgaggctgttggcgccgactatga 686



to top

>dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0594D10
          Length = 143200

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                         
Query: 257   ccggcgaggccgncgccgatgagggggccgacccagtacacccactggtacccccactcc 316
             |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | |
Sbjct: 95750 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 95809

                        
Query: 317   cagctgacgag 327
             |||| ||||||
Sbjct: 95810 cagccgacgag 95820



to top

>dbj|AK111931.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-C03, full
           insert sequence
          Length = 1200

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 257 ccggcgaggccgncgccgatgagggggccgacccagtacacccactggtacccccactcc 316
           |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 864 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 805

                                  
Query: 317 cagctgacgagggcggggccgaa 339
           |||| |||||| || ||||||||
Sbjct: 804 cagccgacgagcgccgggccgaa 782



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 384 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
           |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 737 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 689



to top

>dbj|AB114828.1| Oryza sativa (japonica cultivar-group) OsTIP3 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 1178

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 257 ccggcgaggccgncgccgatgagggggccgacccagtacacccactggtacccccactcc 316
           |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 847 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 788

                                  
Query: 317 cagctgacgagggcggggccgaa 339
           |||| |||||| || ||||||||
Sbjct: 787 cagccgacgagcgccgggccgaa 765



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 384 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
           |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 720 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 672



to top

>dbj|AK106383.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-E03, full
           insert sequence
          Length = 1787

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 257 ccggcgaggccgncgccgatgagggggccgacccagtacacccactggtacccccactcc 316
           |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 139 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 198

                                  
Query: 317 cagctgacgagggcggggccgaa 339
           |||| |||||| || ||||||||
Sbjct: 199 cagccgacgagcgccgggccgaa 221



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 384 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
           |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 266 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 314



to top

>gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic protein mRNA,
           partial cds
          Length = 529

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 425 gcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacacc 484
           ||||| || |||| ||| ||||| ||||| || ||||| ||||||||||| |||||||||
Sbjct: 183 gcgattgttcccaagcttccctttttgggatcaacggctgtggcgtacactgtgtacacc 124

                               
Query: 485 agcccgaaggtcatgacgat 504
           |  ||||||||||| |||||
Sbjct: 123 aatccgaaggtcatcacgat 104



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 84/104 (80%)
 Strand = Plus / Minus

                                                                       
Query: 191 gcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtan 250
           ||||| || |||||||| ||||||||||||||||||  |  ||||||||  | |||||| 
Sbjct: 417 gcttaataatcggtggttgggagctgctcgtgggtgttgctgatgaagatgaactcgtag 358

                                                       
Query: 251 atgacgccggcgaggccgncgccgatgagggggccgacccagta 294
           ||||  || ||||| ||  | ||||| ||||| |||||||||||
Sbjct: 357 atgagaccagcgagcccaccaccgataaggggtccgacccagta 314



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                            
Query: 257      ccggcgaggccgncgccgatgagggggccgacccagtacacccactggtacccccactcc 316
                |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 18196273 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 18196214

                                       
Query: 317      cagctgacgagggcggggccgaa 339
                |||| |||||| || ||||||||
Sbjct: 18196213 cagccgacgagcgccgggccgaa 18196191



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                                 
Query: 384      cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
                |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 18196146 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 18196098



to top

>gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence
          Length = 980

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 97/119 (81%)
 Strand = Plus / Minus

                                                                       
Query: 389 atgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttc 448
           |||||||| ||||| ||||| || || ||||| || ||||| || || || || || || 
Sbjct: 573 atgttggctccgactatgaaaccaatagcgattggagcgattgttccgagactcccgttt 514

                                                                      
Query: 449 ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           |||||||| | |||||||||||| || ||||| || |||||||| ||||| ||||||||
Sbjct: 513 ttggggtcaatggcggtggcgtagacagtgtaaacaagcccgaatgtcatcacgatctc 455



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 195 agtagtcggtggtggggagctgctcgtgggtg 226
           ||||||||||||| |||||||| |||||||||
Sbjct: 767 agtagtcggtggttgggagctgttcgtgggtg 736



to top

>emb|BX823744.1|CNS0A6NJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS71ZE09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 573

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 134/166 (80%), Gaps = 2/166 (1%)
 Strand = Plus / Minus

                                                                       
Query: 344 acggcggngttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 403
           ||||| | ||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 183 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 124

                                                                       
Query: 404 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgac-ggc 462
           ||||| || |||||||| || ||||| || || || || || ||||||||||| || |||
Sbjct: 123 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacgggc 64

                                                         
Query: 463 ggtggcgtacac-cgtgtacaccagcccgaaggtcatgacgatctc 507
            |||||||| ||  ||||| || |||||||||||||| ||||||||
Sbjct: 63  tgtggcgtagacgggtgtagacgagcccgaaggtcatcacgatctc 18



to top

>gb|AF275315.1|AF275315 Lotus japonicus water-selective transport intrinsic membrane
           protein 1 mRNA, complete cds
          Length = 1162

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 443 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 502
           ||||||||||| || ||||| |||||||| || ||||||||||  || |||||||| |||
Sbjct: 562 cccttcttgggatcaacggctgtggcgtaaactgtgtacaccaatccaaaggtcatcacg 503

                  
Query: 503 atctcca 509
           |||||||
Sbjct: 502 atctcca 496



to top

>dbj|AP004479.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT03H13, TM0012b,
             complete sequence
          Length = 41820

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                         
Query: 443   cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 502
             ||||||||||| || ||||| |||||||| || ||||||||||  || |||||||| |||
Sbjct: 10234 cccttcttgggatcaacggctgtggcgtaaactgtgtacaccaatccaaaggtcatcacg 10293

                    
Query: 503   atctcca 509
             |||||||
Sbjct: 10294 atctcca 10300



to top

>ref|NM_188505.1| Oryza sativa (japonica cultivar-group), Ozsa8174 predicted mRNA
          Length = 969

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 257 ccggcgaggccgncgccgatgagggggccgacccagtacacccactggt 305
           |||||||||||| ||||||||| ||| |||| |||||||||||| ||||
Sbjct: 881 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 833



to top

>dbj|AP002094.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0483F08
          Length = 148985

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                               
Query: 257    ccggcgaggccgncgccgatgagggggccgacccagtacacccactggt 305
              |||||||||||| ||||||||| ||| |||| |||||||||||| ||||
Sbjct: 125093 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 125141



to top

>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3)
           mRNA, complete cds
          Length = 1051

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 384 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
           ||||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 597 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 549



to top

>ref|NM_188626.1| Oryza sativa (japonica cultivar-group), Ozsa8229 predicted mRNA
          Length = 756

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 352 gttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 404
           ||||||||||||||||| ||  ||||||||| ||| | |||||||||||||||
Sbjct: 588 gttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 536



to top

>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds
          Length = 753

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 384 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
           ||||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 559 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 511



to top

>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds
          Length = 853

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 384 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
           ||||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 587 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 539



to top

>gb|AF521135.1| Kandelia candel tonoplast intrinsic protein (TIP) mRNA, complete
           cds
          Length = 1099

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 191 gcttagtagtcggtggtggggagctgctcgtgggtgc 227
           ||||||||||| | |||||||||||||||||||||||
Sbjct: 859 gcttagtagtcagcggtggggagctgctcgtgggtgc 823



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 86/104 (82%), Gaps = 1/104 (0%)
 Strand = Plus / Minus

                                                                       
Query: 404 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 463
           ||||| ||||||||||||| |||||| |||||||   | ||||||||||| || |  || 
Sbjct: 642 atgaaaccgatggcgatgg-cgcgattgtgcccaaatttcccttcttgggatcaatagcc 584

                                                       
Query: 464 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 507
           || ||||| || |||||||| || |||||||||||||| |||||
Sbjct: 583 gtcgcgtagactgtgtacacgaggccgaaggtcatgactatctc 540



to top

>gb|AF133531.1|AF133531 Mesembryanthemum crystallinum water channel protein MipI (MipI)
           mRNA, complete cds
          Length = 1035

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 443 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 502
           |||||||||||||| || || |||||||| || ||||| || |||||||||||||| || 
Sbjct: 576 cccttcttggggtcaacagcagtggcgtagacggtgtagacaagcccgaaggtcatcaca 517

                
Query: 503 atctc 507
           |||||
Sbjct: 516 atctc 512



to top

>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7
          Length = 80117

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                             
Query: 384  cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
            ||||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 8647 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 8695



to top

>dbj|AK099190.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023108H12, full
           insert sequence
          Length = 1055

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 352 gttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 404
           ||||||||||||||||| ||  ||||||||| ||| | |||||||||||||||
Sbjct: 634 gttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 582



to top

>dbj|AK069592.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023019I12, full
           insert sequence
          Length = 1059

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 352 gttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 404
           ||||||||||||||||| ||  ||||||||| ||| | |||||||||||||||
Sbjct: 637 gttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 585



to top

>emb|BX823560.1|CNS0A7QS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS51ZB01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 676

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 100/124 (80%)
 Strand = Plus / Minus

                                                                       
Query: 384 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgc 443
           |||||||||| || || |||||||| || | |||||| || ||||| || || || |  |
Sbjct: 237 cgaggatgttcgctccaacgatgaaacccaaggcgattggtgcgattgttccgagacgac 178

                                                                       
Query: 444 ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 503
           | ||||||||||| ||||| |||||||  || ||||| || ||||||| |||||| ||||
Sbjct: 177 cgttcttggggtcaacggctgtggcgtcgacggtgtagacgagcccgagggtcatcacga 118

               
Query: 504 tctc 507
           ||||
Sbjct: 117 tctc 114



to top

>gb|AY130971.1| Brassica oleracea var. botrytis tonoplast intrinsic protein
           bobTIP26-2 gene, complete cds
          Length = 1442

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 446 ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatc 505
           |||||||| || |||||||||||||| || ||||| || ||||| || ||||| ||||||
Sbjct: 996 ttcttgggatcaacggcggtggcgtagactgtgtaaactagcccaaatgtcattacgatc 937

             
Query: 506 tc 507
           ||
Sbjct: 936 tc 935



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 195  agtagtcggtggtggggagctg 216
            ||||||||||||||||||||||
Sbjct: 1247 agtagtcggtggtggggagctg 1226



to top

>gb|U92652.2|BOU92652 Brassica oleracea var. botrytis tonoplast intrinsic protein
           bobTIP26-2 mRNA, partial cds
          Length = 599

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 446 ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatc 505
           |||||||| || |||||||||||||| || ||||| || ||||| || ||||| ||||||
Sbjct: 275 ttcttgggatcaacggcggtggcgtagactgtgtaaactagcccaaatgtcattacgatc 216

             
Query: 506 tc 507
           ||
Sbjct: 215 tc 214



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 195 agtagtcggtggtggggagctg 216
           ||||||||||||||||||||||
Sbjct: 526 agtagtcggtggtggggagctg 505



to top

>dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds
          Length = 321

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 388 gatgttggcgccgacgatgaagccgatggc 417
           |||||||||||||||||| |||||||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292



to top

>gb|BT016509.1| Zea mays clone Contig342 mRNA sequence
          Length = 1237

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 243 gctcgtanatgacgccggcgaggccgncgccgatgagggggccgacccagtacacccact 302
           ||||||| | |||||||| ||||||| ||||||  | ||| || |||||||||||||| |
Sbjct: 880 gctcgtagacgacgccggagaggccggcgccgaccatgggccccacccagtacacccatt 821

              
Query: 303 ggt 305
           |||
Sbjct: 820 ggt 818



to top

>dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds
          Length = 321

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 395 gcgccgacgatgaagccgatggcga 419
           |||||||||||||||||||||||||
Sbjct: 314 gcgccgacgatgaagccgatggcga 290



to top

>dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds
          Length = 321

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 392 ttggcgccgacgatgaagccgatggcgat 420
           |||||||||||||| ||||||||||||||
Sbjct: 317 ttggcgccgacgataaagccgatggcgat 289



to top

>emb|X95952.1|HAAP H.annuus mRNA for aquaporin
          Length = 931

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 442 gcccttcttggggtcgacggcggtggcgtacaccgtgtacacca 485
           ||||||||||||||| || ||||||||||| ||  |||||||||
Sbjct: 553 gcccttcttggggtcaactgcggtggcgtaaacgttgtacacca 510



to top

>emb|X72581.1|ATGTIPMR A.thaliana mRNA for tonoplast intrinsic protein gamma (gamma-TIP)
          Length = 933

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 195 agtagtcggtggtggggagctgctcgtg 222
           ||||||||||||| ||||||||||||||
Sbjct: 787 agtagtcggtggttgggagctgctcgtg 760



to top

>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene)
          Length = 1017

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 319 gctgacgagggcggggccgaaggagacggcggngttcat 357
           |||||||| ||||||||||||||||  ||||| ||||||
Sbjct: 624 gctgacgacggcggggccgaaggagcgggcggggttcat 586



to top

>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1)
           mRNA, complete cds
          Length = 1057

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 319 gctgacgagggcggggccgaaggagacggcggngttcat 357
           |||||||| ||||||||||||||||  ||||| ||||||
Sbjct: 666 gctgacgacggcggggccgaaggagcgggcggggttcat 628



to top

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                   
Query: 393     tggcgccgacgatgaagccgatggcgatgggcgcga 428
               |||||||||||||||||||| || ||||||| ||||
Sbjct: 3239016 tggcgccgacgatgaagccggtgacgatgggggcga 3238981



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 395     gcgccgacgatgaagccgatg 415
               |||||||||||||||||||||
Sbjct: 3655270 gcgccgacgatgaagccgatg 3655250



to top

>ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel AT3G16240 (DELTA-TIP)
           mRNA, complete cds
          Length = 1125

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 443 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 502
           ||||||||||| ||  ||||||||||||| || ||||| ||||   ||||||| |||| |
Sbjct: 610 cccttcttgggatcagcggcggtggcgtagacagtgtagaccaaagcgaaggtgatgatg 551

                  
Query: 503 atctcca 509
           |||||||
Sbjct: 550 atctcca 544



to top

>ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron transporter/ iron ion
            binding AT3G16250 mRNA, complete cds
          Length = 1538

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                        
Query: 443  cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 502
            ||||||||||| ||  ||||||||||||| || ||||| ||||   ||||||| |||| |
Sbjct: 1265 cccttcttgggatcagcggcggtggcgtagacagtgtagaccaaagcgaaggtgatgatg 1324

                   
Query: 503  atctcca 509
            |||||||
Sbjct: 1325 atctcca 1331



to top

>gb|AF521142.1| Kandelia candel tonoplast intrinsic protein mRNA, partial cds
          Length = 175

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 391 gttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccca 437
           |||||| || || ||||| ||||||||||| |||||||| |||||||
Sbjct: 62  gttggcacccacaatgaaaccgatggcgattggcgcgattgtgccca 16



to top

>emb|AJ251652.1|MTR251652 Medicago truncatula mRNA for aquaporin (aqp1 gene)
          Length = 1120

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 194 tagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagag 240
           |||||||| || || ||||||||||||||||||| |  |||||||||
Sbjct: 837 tagtagtcagtagttgggagctgctcgtgggtgctgttgatgaagag 791



to top

>gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230)
           mRNA, complete cds
          Length = 853

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 443 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 502
           ||||||||||| ||  ||||||||||||| || ||||| ||||   ||||||| |||| |
Sbjct: 500 cccttcttgggatcagcggcggtggcgtagacagtgtagaccaaagcgaaggtgatgatg 441

                  
Query: 503 atctcca 509
           |||||||
Sbjct: 440 atctcca 434



to top

>gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230;
           MYA6.5) mRNA, complete cds
          Length = 929

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 443 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 502
           ||||||||||| ||  ||||||||||||| || ||||| ||||   ||||||| |||| |
Sbjct: 571 cccttcttgggatcagcggcggtggcgtagacagtgtagaccaaagcgaaggtgatgatg 512

                  
Query: 503 atctcca 509
           |||||||
Sbjct: 511 atctcca 505



to top

>emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB95ZE06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 443 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 502
           ||||||||||| ||  ||||||||||||| || ||||| ||||   ||||||| |||| |
Sbjct: 548 cccttcttgggatcagcggcggtggcgtagacagtgtagaccaaagcgaaggtgatgatg 489

                  
Query: 503 atctcca 509
           |||||||
Sbjct: 488 atctcca 482



to top

>emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB88ZH07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 957

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 443 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 502
           ||||||||||| ||  ||||||||||||| || ||||| ||||   ||||||| |||| |
Sbjct: 553 cccttcttgggatcagcggcggtggcgtagacagtgtagaccaaagcgaaggtgatgatg 494

                  
Query: 503 atctcca 509
           |||||||
Sbjct: 493 atctcca 487



to top

>emb|BX822968.1|CNS0A5UC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB77ZF06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 945

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 443 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 502
           ||||||||||| ||  ||||||||||||| || ||||| ||||   ||||||| |||| |
Sbjct: 555 cccttcttgggatcagcggcggtggcgtagacagtgtagaccaaagcgaaggtgatgatg 496

                  
Query: 503 atctcca 509
           |||||||
Sbjct: 495 atctcca 489



to top

>emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS72ZD10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 945

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 443 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 502
           ||||||||||| ||  ||||||||||||| || ||||| ||||   ||||||| |||| |
Sbjct: 550 cccttcttgggatcagcggcggtggcgtagacagtgtagaccaaagcgaaggtgatgatg 491

                  
Query: 503 atctcca 509
           |||||||
Sbjct: 490 atctcca 484



to top

>gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete sequence
          Length = 978

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 443 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 502
           ||||||||||| ||  ||||||||||||| || ||||| ||||   ||||||| |||| |
Sbjct: 572 cccttcttgggatcagcggcggtggcgtagacagtgtagaccaaagcgaaggtgatgatg 513

                  
Query: 503 atctcca 509
           |||||||
Sbjct: 512 atctcca 506



to top

>gb|AC020922.9| Homo sapiens chromosome 19 clone CTD-2105E13, complete sequence
          Length = 134793

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 163   cgggcgggcggggggcaggcggc 185
             |||||||||||||||||||||||
Sbjct: 78789 cgggcgggcggggggcaggcggc 78811



to top

>gb|AY207429.1| Homo sapiens interleukin 11 (IL11) gene, complete cds
          Length = 9803

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 163  cgggcgggcggggggcaggcggc 185
            |||||||||||||||||||||||
Sbjct: 1449 cgggcgggcggggggcaggcggc 1427



to top

>emb|AJ605573.1| Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L
          Length = 1057

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 193 ttagtagtcggtggtggggagctgctcgtgggtgc 227
           ||||||||| ||||| ||||||||||| |||||||
Sbjct: 804 ttagtagtcagtggtagggagctgctcatgggtgc 770



to top

>dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYA6
          Length = 75289

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                         
Query: 443   cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 502
             ||||||||||| ||  ||||||||||||| || ||||| ||||   ||||||| |||| |
Sbjct: 19399 cccttcttgggatcagcggcggtggcgtagacagtgtagaccaaagcgaaggtgatgatg 19340

                    
Query: 503   atctcca 509
             |||||||
Sbjct: 19339 atctcca 19333



to top

>gb|U39486.1|ATU39486 Arabidopsis thaliana delta tonoplast integral protein gene, partial
            cds
          Length = 2235

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                        
Query: 443  cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 502
            ||||||||||| ||  ||||||||||||| || ||||| ||||   ||||||| |||| |
Sbjct: 2150 cccttcttgggatcagcggcggtggcgtagacagtgtagaccaaagcgaaggtgatgatg 2091

                   
Query: 503  atctcca 509
            |||||||
Sbjct: 2090 atctcca 2084



to top

>gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integral protein mRNA,
           complete cds
          Length = 939

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 443 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 502
           ||||||||||| ||  ||||||||||||| || ||||| ||||   ||||||| |||| |
Sbjct: 517 cccttcttgggatcagcggcggtggcgtagacagtgtagaccaaagcgaaggtgatgatg 458

                  
Query: 503 atctcca 509
           |||||||
Sbjct: 457 atctcca 451



to top

>gb|M81890.1|HUMIL11A Human interleukin 11 (IL11) gene, complete mRNA
          Length = 6870

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 163 cgggcgggcggggggcaggcggc 185
           |||||||||||||||||||||||
Sbjct: 688 cgggcgggcggggggcaggcggc 666



to top

>dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, complete cds
          Length = 911

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 386 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
           ||||||||||| ||||||||||  || ||||||| ||| ||||||||
Sbjct: 598 aggatgttggcaccgacgatgagaccaatggcgaggggagcgatggt 552



to top

>ref|XM_851400.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 11 (LOC479191), mRNA
          Length = 4681

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 154 acggacggacgggcgggcggggggcaggcggcgg 187
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_536333.2| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 1 (LOC479191), mRNA
          Length = 4681

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 154 acggacggacgggcgggcggggggcaggcggcgg 187
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851314.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 10 (LOC479191), mRNA
          Length = 4663

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 154 acggacggacgggcgggcggggggcaggcggcgg 187
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851274.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 9 (LOC479191), mRNA
          Length = 4438

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 154 acggacggacgggcgggcggggggcaggcggcgg 187
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851189.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 7 (LOC479191), mRNA
          Length = 4777

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 154 acggacggacgggcgggcggggggcaggcggcgg 187
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851152.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 6 (LOC479191), mRNA
          Length = 4696

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 154 acggacggacgggcgggcggggggcaggcggcgg 187
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851023.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 3 (LOC479191), mRNA
          Length = 4681

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 154 acggacggacgggcgggcggggggcaggcggcgg 187
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>gb|AF367456.1| Prunus persica clone gTip1 gamma-tonoplast intrinsic protein mRNA,
           partial cds
          Length = 408

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 316 ccagctgacgagggcggggccgaaggagacggcggngttcatgga 360
           |||||||||||  ||||| ||||||||||| || | |||||||||
Sbjct: 393 ccagctgacgacagcgggtccgaaggagactgccgggttcatgga 349



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 328     ggcggggccgaaggagacggcg 349
               ||||||||||||||||||||||
Sbjct: 8473737 ggcggggccgaaggagacggcg 8473716



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 328     ggcggggccgaaggagacggcg 349
               ||||||||||||||||||||||
Sbjct: 8461221 ggcggggccgaaggagacggcg 8461200



to top

>gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water channel protein MipK (MipK)
           mRNA, complete cds
          Length = 1076

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                       
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 447
           ||||||||| || || ||||| || || || ||||| || ||||||||||    |||| |
Sbjct: 637 gatgttggctccaacaatgaacccaatagcaatgggggcaatggtgcccactgagcccct 578

                                                 
Query: 448 cttggggtcgacggcggtggcgtacaccgtgtacacca 485
           ||||||||| || ||||||||||| || ||||| ||||
Sbjct: 577 cttggggtcaactgcggtggcgtagacggtgtagacca 540



to top

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 400     gacgatgaagccgatggcgatgggcg 425
               ||||||| ||||||||||||||||||
Sbjct: 1047164 gacgatgtagccgatggcgatgggcg 1047139



to top

>gb|AY112625.1| Zea mays CL46210_1 mRNA sequence
          Length = 479

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 253 gacgccggcgaggccgncgccgatgagggggccgacccagtacacccactggt 305
           |||||||| ||||||| ||||||  | ||| || |||||||||||||| ||||
Sbjct: 289 gacgccggagaggccggcgccgaccatgggccccacccagtacacccattggt 341



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 328     ggcggggccgaaggagacggcg 349
               ||||||||||||||||||||||
Sbjct: 8473620 ggcggggccgaaggagacggcg 8473599



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 328     ggcggggccgaaggagacggcg 349
               ||||||||||||||||||||||
Sbjct: 8461104 ggcggggccgaaggagacggcg 8461083



to top

>emb|AL928775.2|CNS08CC5 Oryza sativa chromosome 12, . BAC OSJNBa0030N06 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 146444

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 328   ggcggggccgaaggagacggcg 349
             ||||||||||||||||||||||
Sbjct: 80400 ggcggggccgaaggagacggcg 80379



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 328   ggcggggccgaaggagacggcg 349
             ||||||||||||||||||||||
Sbjct: 67884 ggcggggccgaaggagacggcg 67863



to top

>gb|AY839872.1| Vitis vinifera aquaporin (TIP1;1) mRNA, complete cds
          Length = 993

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 443 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 502
           |||||||| || || || || ||||| ||||| ||||| ||||| ||||||||||| || 
Sbjct: 553 cccttctttggatccactgctgtggcatacactgtgtaaaccaggccgaaggtcatcaca 494

                
Query: 503 atctc 507
           |||||
Sbjct: 493 atctc 489



to top

>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete
              sequence
          Length = 1019846

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 300    actggtacccccactcccagc 320
              |||||||||||||||||||||
Sbjct: 290624 actggtacccccactcccagc 290604



to top

>gb|AC154709.2| Mus musculus BAC clone RP24-357I4 from chromosome 12, complete sequence
          Length = 136354

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 154   acggacggacgggcgggcggg 174
             |||||||||||||||||||||
Sbjct: 94084 acggacggacgggcgggcggg 94104



to top

>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome
          Length = 3814139

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 388     gatgttggcgccgacgatgaagccg 412
               ||||||| |||||||||||||||||
Sbjct: 2949085 gatgttgtcgccgacgatgaagccg 2949061



to top

>emb|CT025679.5| Mouse DNA sequence from clone RP24-296K22 on chromosome 14, complete
              sequence
          Length = 160805

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 154    acggacggacgggcgggcggg 174
              |||||||||||||||||||||
Sbjct: 155955 acggacggacgggcgggcggg 155935



to top

>ref|XM_567655.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
            (CNK00920) partial mRNA
          Length = 2340

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 300  actggtacccccactcccagc 320
            |||||||||||||||||||||
Sbjct: 2133 actggtacccccactcccagc 2113



to top

>gb|AC123532.4| Mus musculus chromosome 14 clone RP23-84B6, complete sequence
          Length = 166421

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 154  acggacggacgggcgggcggg 174
            |||||||||||||||||||||
Sbjct: 7846 acggacggacgggcgggcggg 7826



to top

>gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complete sequence
          Length = 240151

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 154   acggacggacgggcgggcggg 174
             |||||||||||||||||||||
Sbjct: 37973 acggacggacgggcgggcggg 37953



to top

>gb|AC104099.5| Mus musculus BAC clone RP24-372J8 from 3, complete sequence
          Length = 148259

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 154   acggacggacgggcgggcggg 174
             |||||||||||||||||||||
Sbjct: 37509 acggacggacgggcgggcggg 37489



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 151   cacacggacggacgggcgggcggg 174
             ||||||||||||||| ||||||||
Sbjct: 37516 cacacggacggacggacgggcggg 37493



to top

>gb|BC012214.1| Mus musculus Rab geranylgeranyl transferase, a subunit, mRNA (cDNA
           clone MGC:19255 IMAGE:3967218), complete cds
          Length = 2176

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 154 acggacggacgggcgggcggg 174
           |||||||||||||||||||||
Sbjct: 23  acggacggacgggcgggcggg 43



to top

>gb|AY258323.1| Rubella virus strain BRD-II, complete genome
          Length = 9778

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 163  cgggcgggcggggggcaggcggcgg 187
            ||||||||| |||||||||||||||
Sbjct: 2327 cgggcgggctgggggcaggcggcgg 2303



to top

>ref|XM_503667.1| Yarrowia lipolytica CLIB122, YALI0E07557g predicted mRNA
          Length = 2157

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 432  tgcccaggctgcccttcttgg 452
            |||||||||||||||||||||
Sbjct: 1060 tgcccaggctgcccttcttgg 1040



to top

>ref|NM_019519.1| Mus musculus Rab geranylgeranyl transferase, a subunit (Rabggta),
           mRNA
          Length = 2547

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 154 acggacggacgggcgggcggg 174
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete genome; segment 6/16
          Length = 349876

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 388    gatgttggcgccgacgatgaagccg 412
              ||||| |||||||||||||||||||
Sbjct: 151437 gatgtcggcgccgacgatgaagccg 151461



to top

>emb|BX640430.1| Bordetella parapertussis strain 12822, complete genome; segment 8/14
          Length = 348014

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 388   gatgttggcgccgacgatgaagccg 412
             ||||| |||||||||||||||||||
Sbjct: 62418 gatgtcggcgccgacgatgaagccg 62442



to top

>emb|AL390091.1|NCB12F1 Neurospora crassa DNA linkage group II BAC clone B12F1
          Length = 68478

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 154   acggacggacgggcgggcggg 174
             |||||||||||||||||||||
Sbjct: 42894 acggacggacgggcgggcggg 42914



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 151   cacacggacggacgggcgggcggg 174
             ||||||||||||||| ||||||||
Sbjct: 42887 cacacggacggacggacgggcggg 42910



to top

>emb|AJ489613.1|CAR489613 Cicer arietinum partial mRNA for tonoplast intrinsic protein (tip
           gene)
          Length = 716

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 194 tagtagtcggtggtggggagctgctcgtgggtg 226
           |||||||| ||||| ||||| ||||||||||||
Sbjct: 428 tagtagtcagtggtagggagttgctcgtgggtg 396



to top

>emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 in linkage group 3,
             complete sequence
          Length = 198900

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 154   acggacggacgggcgggcggg 174
             |||||||||||||||||||||
Sbjct: 27616 acggacggacgggcgggcggg 27596



to top

>gb|AC183494.1| Brassica oleracea Contig C, complete sequence
          Length = 285752

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                               
Query: 384    cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
              ||||||||||||| || |||||||| || || ||||| || ||||||||
Sbjct: 123743 cgaggatgttggcaccaacgatgaaaccaatagcgattggtgcgatggt 123695



to top

>dbj|AK146917.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920074L06 product:Rab geranylgeranyl
           transferase, a subunit, full insert sequence
          Length = 2422

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 154 acggacggacgggcgggcggg 174
           |||||||||||||||||||||
Sbjct: 41  acggacggacgggcgggcggg 61



to top

>gb|AF271660.1|AF271660 Vitis berlandieri x Vitis rupestris putative aquaporin TIP3 (TIP3)
           mRNA, complete cds
          Length = 1133

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 443 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 502
           |||||||| || || || || ||||| ||||| ||||| ||||| ||||||||||| || 
Sbjct: 573 cccttctttggatccactgctgtggcatacactgtgtaaaccaggccgaaggtcatcaca 514

                
Query: 503 atctc 507
           |||||
Sbjct: 513 atctc 509



to top

>gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsic protein mRNA, complete
           cds
          Length = 997

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
           ||||||||| || || |||||||||||||| ||||| || |||||
Sbjct: 592 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggt 548



to top

>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA,
           complete cds
          Length = 1021

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 319 gctgacgagggcggggccgaaggagacggcggngttcatggacgcgcc 366
           |||||||| ||| |||||||| |||  ||| | |||||||||||||||
Sbjct: 709 gctgacgacggccgggccgaacgagcgggccgggttcatggacgcgcc 662



to top

>gb|AC135495.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1664B11,
             complete sequence
          Length = 126040

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 154   acggacggacgggcgggcggg 174
             |||||||||||||||||||||
Sbjct: 56775 acggacggacgggcgggcggg 56755



to top

>ref|NM_214226.1| Sus scrofa inositol(1,3,4,5)tetrakisphosphate receptor (CENTA1),
           mRNA
          Length = 1544

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 155 cggacggacgggcgggcggggggca 179
           |||||||||||||||||||| ||||
Sbjct: 56  cggacggacgggcgggcgggcggca 80



to top

>gb|AF127662.1|AF127662 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) mRNA, complete cds,
           alternatively spliced
          Length = 2466

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 154 acggacggacgggcgggcggg 174
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127661.1|AF127661 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) pseudogene, complete sequence
          Length = 2435

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 154 acggacggacgggcgggcggg 174
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127660.1|AF127660 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) mRNA, complete cds, alternatively
           spliced
          Length = 2492

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 154 acggacggacgggcgggcggg 174
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127659.1|AF127659 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) mRNA, complete cds,
           alternatively spliced
          Length = 2547

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 154 acggacggacgggcgggcggg 174
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127658.1|AF127658 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) mRNA, complete cds, alternatively
           spliced
          Length = 2547

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 154 acggacggacgggcgggcggg 174
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127657.1|AF127657 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) pseudogene, complete sequence
          Length = 2338

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 154 acggacggacgggcgggcggg 174
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127656.1|AF127656 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) mRNA, complete cds, alternatively
           spliced
          Length = 2395

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 154 acggacggacgggcgggcggg 174
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127655.1|AF127655 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) gene, complete cds,
           alternatively spliced
          Length = 2685

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 154 acggacggacgggcgggcggg 174
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127654.1|AF127654 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) gene, complete cds, alternatively
           spliced
          Length = 2685

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 154 acggacggacgggcgggcggg 174
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF466200.2| Sorghum bicolor putative protein kinase gene, partial cds; putative Cf-2,
              fertilization-independent endosperm proteins, hypothetical
              protein, putative non-LTR retroelement reverse
              transcriptase, OCL5 protein, tryptophan synthase
              beta-subunit, hypothetical proteins, putative AP
              endonuclease, putative RNA polymerase II complex component
              SRB7, putative beta-1,3-glucanase, hypothetical protein,
              TNP2-like protein, hypothetical protein, putative
              phosphate/phosphoenolpyruvate translocator, putative
              protein, hypothetical proteins, putative
              galactosyltransferase family, hypothetical protein,
              putative cytochrome P450 family, putative lipid transfer
              protein, putative photoreceptor-interacting protein, and
              hypothetical protein genes, complete cds; and hypothetical
              protein gene, partial cds
          Length = 202197

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 361    cgcgccggagaaggcgccgccgacg 385
              ||||||||||||||||||| |||||
Sbjct: 146358 cgcgccggagaaggcgccggcgacg 146382



to top

>emb|AL845372.6| Zebrafish DNA sequence from clone DKEYP-113C1 in linkage group 20,
             complete sequence
          Length = 80017

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 154   acggacggacgggcgggcggg 174
             |||||||||||||||||||||
Sbjct: 44968 acggacggacgggcgggcggg 44988



to top

>gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP) mRNA, partial cds
          Length = 316

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 388 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 432
           ||||||||| || || |||||||||||||| ||||| || |||||
Sbjct: 289 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggt 245



to top

>emb|CR381567.9| Zebrafish DNA sequence from clone DKEY-115O4 in linkage group 23,
             complete sequence
          Length = 142417

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 154   acggacggacgggcgggcggg 174
             |||||||||||||||||||||
Sbjct: 45131 acggacggacgggcgggcggg 45151



to top

>gb|AC159324.2| Mus musculus BAC clone RP23-9D1 from chromosome 12, complete sequence
          Length = 207280

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 154   acggacggacgggcgggcggg 174
             |||||||||||||||||||||
Sbjct: 13760 acggacggacgggcgggcggg 13780



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 165     ggcgggcggggggcaggcggcggtg 189
               ||||||||||||||| |||||||||
Sbjct: 2074504 ggcgggcggggggcatgcggcggtg 2074480



to top

>emb|CR974568.14| Mouse DNA sequence from clone RP23-39N20 on chromosome 12, complete
              sequence
          Length = 251037

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 154    acggacggacgggcgggcggg 174
              |||||||||||||||||||||
Sbjct: 108741 acggacggacgggcgggcggg 108721



to top

>emb|CR388420.19| Zebrafish DNA sequence from clone DKEY-37H18 in linkage group 13,
             complete sequence
          Length = 121689

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 154   acggacggacgggcgggcggg 174
             |||||||||||||||||||||
Sbjct: 73151 acggacggacgggcgggcggg 73131



to top

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia
              lipolytica
          Length = 4224103

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 432    tgcccaggctgcccttcttgg 452
              |||||||||||||||||||||
Sbjct: 867021 tgcccaggctgcccttcttgg 867001



to top

>gb|U88368.1|SSU88368 Sus scrofa inositol(1,3,4,5)tetrakisphosphate receptor mRNA,
           complete cds
          Length = 1544

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 155 cggacggacgggcgggcggggggca 179
           |||||||||||||||||||| ||||
Sbjct: 56  cggacggacgggcgggcgggcggca 80



to top

>gb|L07320.1|HS5E1A Murine cytomegalovirus e1 protein gene, complete cds
          Length = 4536

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 154 acggacggacgggcgggcggg 174
           |||||||||||||||||||||
Sbjct: 745 acggacggacgggcgggcggg 765



to top

>ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel AT2G36830 (GAMMA-TIP)
           mRNA, complete cds
          Length = 1058

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 195 agtagtcggtggtggggagctgctcgtg 222
           ||||||| ||||| ||||||||||||||
Sbjct: 818 agtagtctgtggttgggagctgctcgtg 791



to top

>gb|AC164878.2| Mus musculus BAC clone RP23-364G24 from chromosome 13, complete
             sequence
          Length = 181893

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 154   acggacggacgggcgggcgg 173
             ||||||||||||||||||||
Sbjct: 94623 acggacggacgggcgggcgg 94642



to top

>gb|AC162034.6| Mus musculus chromosome 7, clone RP23-285B12, complete sequence
          Length = 197907

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 163    cgggcgggcggggggcaggc 182
              ||||||||||||||||||||
Sbjct: 122681 cgggcgggcggggggcaggc 122700



to top

>ref|XM_476227.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 756

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 352 gttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 407
           |||||| |||||||||||||||  ||| ||  ||| | ||||||| ||||||||||
Sbjct: 594 gttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 539



to top

>gb|DQ215783.1| Taeniopygia guttata clone 0058P0012B09 proteasome alpha 1 subunit
           variant 1-like mRNA, complete sequence
          Length = 1190

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 163 cgggcgggcggggggcaggcggcg 186
           ||||||||||| ||||||||||||
Sbjct: 38  cgggcgggcggcgggcaggcggcg 15



to top

>gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, complete sequence
          Length = 124050

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 154   acggacggacgggcgggcgg 173
             ||||||||||||||||||||
Sbjct: 72221 acggacggacgggcgggcgg 72202



to top

>ref|XM_414866.1| PREDICTED: Gallus gallus similar to Aquaporin 8 (LOC416566), mRNA
          Length = 1761

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 271  gccgatgagggggccgacccagtacacccactggta 306
            |||||| || || ||||||||||||||||| |||||
Sbjct: 1371 gccgatcagaggcccgacccagtacacccagtggta 1336



to top

>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome
          Length = 3696649

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 389     atgttggcgccgacgatgaagccgatgg 416
               |||| |||||||| ||||||||||||||
Sbjct: 3114875 atgtaggcgccgaagatgaagccgatgg 3114848



to top

>gb|AC145396.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0042F15, complete sequence
          Length = 162959

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                     
Query: 352   gttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 407
             |||||| |||||||||||||||  ||| ||  ||| | ||||||| ||||||||||
Sbjct: 86933 gttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 86878



to top

>emb|AL591789.1|SME591789 Sinorhizobium meliloti 1021 complete chromosome; segment 8/12
          Length = 294800

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    gccgatggcgatgggcgcga 428
              ||||||||||||||||||||
Sbjct: 252331 gccgatggcgatgggcgcga 252350



to top

>emb|X53040.1|RNNIP26 R.norvegicus MIP-26 mRNA
          Length = 336

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 270 cgccgatgagggggccgacccagtacacccactggt 305
           |||||||||  ||||| |||||||||||||| ||||
Sbjct: 294 cgccgatgattgggcccacccagtacacccagtggt 259



to top

>emb|CR847515.10| Zebrafish DNA sequence from clone DKEYP-60A7 in linkage group 9, complete
              sequence
          Length = 153947

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 88     attcattcattcaaagcaaa 107
              ||||||||||||||||||||
Sbjct: 143356 attcattcattcaaagcaaa 143337



to top

>gb|AC012596.4| Homo sapiens BAC clone CTD-2523K17 from 7, complete sequence
          Length = 154859

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 83    gatggattcattcattcaaa 102
             ||||||||||||||||||||
Sbjct: 68036 gatggattcattcattcaaa 68017



to top

>gb|AY225468.1| Mus musculus interleukin 11 gene, promoter region and partial 5'UTR
          Length = 3811

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 163  cgggcgggcggggggcaggc 182
            ||||||||||||||||||||
Sbjct: 3619 cgggcgggcggggggcaggc 3600



to top

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 256     gccggcgaggccgncgccgatga 278
               ||||||||||||| |||||||||
Sbjct: 2006667 gccggcgaggccggcgccgatga 2006689



to top

>emb|AL161740.16| Human DNA sequence from clone RP6-239D12 on chromosome 1p32.1-33
             Contains 3' end of the DAB1 gene for disabled homolog 1
             (Drosophila), a novel gene and the 5' end of a novel gene,
             complete sequence
          Length = 60856

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 83    gatggattcattcattcaaa 102
             ||||||||||||||||||||
Sbjct: 53885 gatggattcattcattcaaa 53904



to top

>emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic protein gamma-TIP(Ara)
          Length = 1398

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 195  agtagtcggtggtggggagctgctcgtg 222
            ||||||| ||||| ||||||||||||||
Sbjct: 1203 agtagtctgtggttgggagctgctcgtg 1176



to top

>gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g36830) mRNA, complete
           cds
          Length = 787

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 195 agtagtcggtggtggggagctgctcgtg 222
           ||||||| ||||| ||||||||||||||
Sbjct: 754 agtagtctgtggttgggagctgctcgtg 727



to top

>gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic protein gamma,
           aquaporin (At2g36830) mRNA, complete cds
          Length = 1030

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 195 agtagtcggtggtggggagctgctcgtg 222
           ||||||| ||||| ||||||||||||||
Sbjct: 812 agtagtctgtggttgggagctgctcgtg 785



to top

>emb|X53052.1|RRMIP Rat partial mRNA for main intrinsic protein
          Length = 936

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 270 cgccgatgagggggccgacccagtacacccactggt 305
           |||||||||  ||||| |||||||||||||| ||||
Sbjct: 628 cgccgatgattgggcccacccagtacacccagtggt 593



to top

>emb|X12514.1|RNMIP26R Rat mRNA fragment for main intrinsic protein 26 (MIP26)
          Length = 543

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 270 cgccgatgagggggccgacccagtacacccactggt 305
           |||||||||  ||||| |||||||||||||| ||||
Sbjct: 235 cgccgatgattgggcccacccagtacacccagtggt 200



to top

>gb|AF486513.1| Hordeum vulgare cultivar Yon M Kei GBSSI gene, promoter and 5'
           untranslated region
          Length = 1201

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 154 acggacggacgggcgggcgg 173
           ||||||||||||||||||||
Sbjct: 883 acggacggacgggcgggcgg 864



to top

>gb|AF486512.1| Hordeum vulgare cultivar CDC Alamo GBSSI gene, promoter and 5'
           untranslated region
          Length = 1197

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 154 acggacggacgggcgggcgg 173
           ||||||||||||||||||||
Sbjct: 884 acggacggacgggcgggcgg 865



to top

>gb|AF486508.1| Hordeum vulgare cultivar Oderbrucker GBSSI gene, promoter and 5'
           untranslated region
          Length = 1195

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 154 acggacggacgggcgggcgg 173
           ||||||||||||||||||||
Sbjct: 882 acggacggacgggcgggcgg 863



to top

>emb|BX572602.1| Rhodopseudomonas palustris CGA009 complete genome; segment 10/16
          Length = 349981

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 256   gccggcgaggccgncgccgatga 278
             ||||||||||||| |||||||||
Sbjct: 60810 gccggcgaggccggcgccgatga 60788



to top

>emb|BX897736.7| Zebrafish DNA sequence from clone CH211-181B15 in linkage group 17,
             complete sequence
          Length = 141987

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 81    gggatggattcattcattca 100
             ||||||||||||||||||||
Sbjct: 10001 gggatggattcattcattca 10020



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 526    cgcgccgatgccggtgagcc 545
              ||||||||||||||||||||
Sbjct: 701330 cgcgccgatgccggtgagcc 701311


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,505,157
Number of Sequences: 3902068
Number of extensions: 4505157
Number of successful extensions: 106948
Number of sequences better than 10.0: 308
Number of HSP's better than 10.0 without gapping: 307
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 104058
Number of HSP's gapped (non-prelim): 2857
length of query: 545
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 522
effective length of database: 17,143,297,704
effective search space: 8948801401488
effective search space used: 8948801401488
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top