Clone Name	rbasd13f05
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AY772669.1| Elymus sibiricus ribulose-1,5-bisphosphate carbox...	165	3e-38
2	gb|AY691641.1| Simplicia laxa ribulose-1,5-bisphosphate carboxyl...	165	3e-38
3	gb|AY691640.1| Stenostachys laevis ribulose-1,5-bisphosphate car...	165	3e-38
4	gb|AY691639.1| Stenostachys gracilis ribulose-1,5-bisphosphate c...	165	3e-38
5	gb|AY691636.1| Australopyrum calcis subsp. calcis ribulose-1,5-b...	165	3e-38
6	gb|AY691635.1| Deschampsia cespitosa ribulose-1,5-bisphosphate c...	165	3e-38
7	gb|AY691632.1| Bromus arenarius ribulose-1,5-bisphosphate carbox...	165	3e-38
8	gb|AY395555.1| Poa trivialis ribulose-1,5-bisphosphate carboxyla...	165	3e-38
9	gb|AY395554.1| Phleum pratense ribulose-1,5-bisphosphate carboxy...	165	3e-38
10	gb|AY395547.1| Lolium perenne ribulose-1,5-bisphosphate carboxyl...	165	3e-38
11	gb|AY395541.1| Hordeum secalinum ribulose-1,5-bisphosphate carbo...	165	3e-38
12	gb|AY395539.1| Glyceria fluitans ribulose-1,5-bisphosphate carbo...	165	3e-38
13	gb|AY395531.1| Bromus hordeaceus ribulose-1,5-bisphosphate carbo...	165	3e-38
14	gb|AY395528.1| Alopecurus pratensis ribulose-1,5-bisphosphate ca...	165	3e-38
15	emb|AJ784837.1| Alopecurus pratensis chloroplast partial rbcL ge...	165	3e-38
16	emb|AJ784832.1| Phleum pratense chloroplast partial rbcL gene fo...	165	3e-38
17	emb|AJ784827.1| Phalaris arundinacea chloroplast partial rbcL ge...	165	3e-38
18	gb|AY328025.1| Triticum aestivum ribulose-1,5-bisphosphate carbo...	165	3e-38
19	emb|Z49846.1|PSPCHRBPC P.spicata chloroplast rbcL gene for ribul...	165	3e-38
20	emb|Z49845.1|PSCHRBPCX P.sanctum chloroplast rbcL gene for ribul...	165	3e-38
21	emb|Z49843.1|LCCHRBPCX L.chinensis chloroplast rbcL gene for rib...	165	3e-38
22	emb|Z49841.1|HJCHRBPCX H.jubatum chloroplast rbcL gene for ribul...	165	3e-38
23	emb|Z49840.1|EECHRBPCX E.erianthum chloroplast rbcL gene for rib...	165	3e-38
24	emb|Z49839.1|ETCHRBPCX E.trachycaulus chloroplast rbcL gene for ...	165	3e-38
25	emb|Z49838.1|EPCHRBPCX E.patagonicus chloroplast rbcL gene for r...	165	3e-38
26	emb|Z49837.1|EGCHRBPCX E.glaucescens chloroplast rbcL gene for r...	165	3e-38
27	emb|X62119.1|CHASHSRA A.squarrosa chloroplast genes rbcL, psaI, ...	165	3e-38
28	emb|X62118.1|CHACHSRG A.crassa chloroplast genes rbcL, psaI, ORF...	165	3e-38
29	emb|X62117.1|CHTAHSRA T.aestivum chloroplast genes rbcL, psaI, O...	165	3e-38
30	emb|X00630.1|CHHV02 Barley chloroplast genes rbcL and atpB	165	3e-38
31	gb|AY137462.1| Psathyrostachys stoloniformis ribulose-1,5-bispho...	165	3e-38
32	gb|AY137461.1| Psathyrostachys fragilis subsp. villosus ribulose...	165	3e-38
33	gb|AY137460.1| Psathyrostachys fragilis subsp. fragilis ribulose...	165	3e-38
34	gb|AY137459.1| Hordeum roshevitzii ribulose-1,5-bisphosphate car...	165	3e-38
35	gb|AY137458.1| Hordeum cordobense ribulose-1,5-bisphosphate carb...	165	3e-38
36	gb|AY137457.1| Hordeum patagonicum subsp. magellanicum ribulose-...	165	3e-38
37	gb|AY137456.1| Hordeum vulgare subsp. vulgare ribulose-1,5-bisph...	165	3e-38
38	gb|AY137455.1| Hordeum bogdanii ribulose-1,5-bisphosphate carbox...	165	3e-38
39	gb|AY137454.1| Hordeum bulbosum ribulose-1,5-bisphosphate carbox...	165	3e-38
40	gb|AY137453.1| Hordeum vulgare subsp. spontaneum ribulose-1,5-bi...	165	3e-38
41	gb|AY137452.1| Hordeum pusillum ribulose-1,5-bisphosphate carbox...	165	3e-38
42	gb|AY137451.1| Hordeum brachyantherum subsp. californicum ribulo...	165	3e-38
43	gb|AY137450.1| Hordeum intercedens ribulose-1,5-bisphosphate car...	165	3e-38
44	gb|AY137449.1| Hordeum chilense ribulose-1,5-bisphosphate carbox...	165	3e-38
45	gb|AY137448.1| Hordeum stenostachys ribulose-1,5-bisphosphate ca...	165	3e-38
46	gb|AY137447.1| Hordeum patagonicum subsp. santacrucense ribulose...	165	3e-38
47	gb|AY137445.1| Hordeum patagonicum subsp. setifolium ribulose-1,...	165	3e-38
48	gb|AY137444.1| Hordeum patagonicum subsp. patagonicum ribulose-1...	165	3e-38
49	gb|AY137443.1| Hordeum pubiflorum ribulose-1,5-bisphosphate carb...	165	3e-38
50	gb|AY137442.1| Hordeum euclaston ribulose-1,5-bisphosphate carbo...	165	3e-38
51	gb|AY137441.1| Hordeum comosum ribulose-1,5-bisphosphate carboxy...	165	3e-38
52	gb|AY137440.1| Hordeum erectifolium ribulose-1,5-bisphosphate ca...	165	3e-38
53	gb|AY137439.1| Hordeum flexuosum ribulose-1,5-bisphosphate carbo...	165	3e-38
54	gb|AY137438.1| Hordeum muticum ribulose-1,5-bisphosphate carboxy...	165	3e-38
55	gb|AY137437.1| Hordeum murinum subsp. glaucum ribulose-1,5-bisph...	165	3e-38
56	gb|AY137436.1| Hordeum marinum subsp. marinum ribulose-1,5-bisph...	165	3e-38
57	gb|AY137435.1| Hordeum brevisubulatum subsp. violaceum ribulose-...	165	3e-38
58	gb|AY137434.1| Hordeum marinum subsp. gussoneanum ribulose-1,5-b...	165	3e-38
59	gb|AY137433.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	165	3e-38
60	gb|AY137432.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	165	3e-38
61	gb|AY137431.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	165	3e-38
62	gb|AY137430.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	165	3e-38
63	gb|AY137429.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	165	3e-38
64	gb|AY137428.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	165	3e-38
65	gb|AY137427.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	165	3e-38
66	gb|AY137426.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	165	3e-38
67	gb|AY137425.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	165	3e-38
68	gb|AY137424.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	165	3e-38
69	gb|AY137423.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	165	3e-38
70	gb|AY137422.1| Hordeum marinum subsp. marinum specimen-voucher H...	165	3e-38
71	gb|AY137421.1| Hordeum marinum subsp. marinum specimen-voucher H...	165	3e-38
72	gb|AY137420.1| Hordeum marinum subsp. marinum specimen-voucher H...	165	3e-38
73	gb|AY137419.1| Hordeum marinum subsp. marinum specimen-voucher H...	165	3e-38
74	gb|AY137418.1| Hordeum marinum subsp. marinum specimen-voucher H...	165	3e-38
75	gb|AY137417.1| Hordeum marinum subsp. marinum specimen-voucher H...	165	3e-38
76	emb|AJ746301.1| Poa trivialis chloroplast partial rbcL gene for ...	165	3e-38
77	emb|AJ746298.1| Phleum pratense chloroplast partial rbcL gene fo...	165	3e-38
78	emb|AJ746293.1| Lolium perenne subsp. perenne chloroplast partia...	165	3e-38
79	emb|AJ746292.1| Hordeum secalinum chloroplast partial rbcL gene ...	165	3e-38
80	emb|AJ746290.1| Glyceria fluitans chloroplast partial rbcL gene ...	165	3e-38
81	emb|AJ746287.1| Bromus commutatus chloroplast partial rbcL gene ...	165	3e-38
82	emb|AJ746286.1| Bromus erectus chloroplast partial rbcL gene for...	165	3e-38
83	gb|AY601671.1| Hordeum capense ribulose-1,5-bisphosphate carboxy...	165	3e-38
84	gb|AY607060.1| Psathyrostachys caduca voucher H6702 ribulose-1,5...	165	3e-38
85	gb|AY607059.1| Psathyrostachys rupestris subsp. rupestris vouche...	165	3e-38
86	gb|AY607057.1| Psathyrostachys huashanica voucher H3087 ribulose...	165	3e-38
87	gb|AY607056.1| Psathyrostachys fragilis subsp. villosus voucher ...	165	3e-38
88	gb|AY607055.1| Psathyrostachys fragilis subsp. villosus voucher ...	165	3e-38
89	gb|AY607053.1| Psathyrostachys lanuginosa isolate C voucher H880...	165	3e-38
90	gb|AY607052.1| Psathyrostachys lanuginosa isolate B voucher H880...	165	3e-38
91	gb|AY607051.1| Psathyrostachys lanuginosa isolate A voucher H880...	165	3e-38
92	gb|AY607050.1| Psathyrostachys juncea voucher H7544 ribulose-1,5...	165	3e-38
93	gb|AY622890.1| Diarrhena obovata ribulose-1,5-bisphosphate carbo...	165	3e-38
94	gb|AY836185.1| Thinopyrum bessarabicum ribulose-1,5-bisphosphate...	165	3e-38
95	gb|AY836184.1| Taeniatherum caput-medusae ribulose-1,5-bisphosph...	165	3e-38
96	gb|AY836183.1| Aegilops speltoides ribulose-1,5-bisphosphate car...	165	3e-38
97	gb|AY836182.1| Pseudoroegneria spicata ribulose-1,5-bisphosphate...	165	3e-38
98	gb|AY836181.1| Secale strictum ribulose-1,5-bisphosphate carboxy...	165	3e-38
99	gb|AY836180.1| Psathyrostachys stoloniformis ribulose-1,5-bispho...	165	3e-38
100	gb|AY836179.1| Psathyrostachys fragilis subsp. villosus ribulose...	165	3e-38
101	gb|AY836178.1| Psathyrostachys fragilis subsp. fragilis ribulose...	165	3e-38
102	gb|AY836177.1| Crithopsis delileana ribulose-1,5-bisphosphate ca...	165	3e-38
103	gb|AY836176.1| Peridictyon sanctum ribulose-1,5-bisphosphate car...	165	3e-38
104	gb|AY836175.1| Aegilops tauschii ribulose-1,5-bisphosphate carbo...	165	3e-38
105	gb|AY836174.1| Thinopyrum elongatum ribulose-1,5-bisphosphate ca...	165	3e-38
106	gb|AY836173.1| Hordeum vulgare subsp. spontaneum ribulose-1,5-bi...	165	3e-38
107	gb|AY836172.1| Hordeum murinum subsp. glaucum ribulose-1,5-bisph...	165	3e-38
108	gb|AY836171.1| Hordeum marinum subsp. gussoneanum ribulose-1,5-b...	165	3e-38
109	gb|AY836170.1| Hordeum erectifolium ribulose-1,5-bisphosphate ca...	165	3e-38
110	gb|AY836169.1| Hordeum brachyantherum subsp. californicum ribulo...	165	3e-38
111	gb|AY836167.1| Henrardia persica ribulose-1,5-bisphosphate carbo...	165	3e-38
112	gb|AY836166.1| Festucopsis serpentini ribulose-1,5-bisphosphate ...	165	3e-38
113	gb|AY836165.1| Eremopyrum triticeum ribulose-1,5-bisphosphate ca...	165	3e-38
114	gb|AY836164.1| Eremopyrum distans ribulose-1,5-bisphosphate carb...	165	3e-38
115	gb|AY836163.1| Haynaldia villosa ribulose-1,5-bisphosphate carbo...	165	3e-38
116	gb|AY836162.1| Triticum monococcum ribulose-1,5-bisphosphate car...	165	3e-38
117	gb|AY836161.1| Aegilops comosa ribulose-1,5-bisphosphate carboxy...	165	3e-38
118	gb|AY836160.1| Australopyrum velutinum ribulose-1,5-bisphosphate...	165	3e-38
119	gb|AY836159.1| Australopyrum retrofractum ribulose-1,5-bisphosph...	165	3e-38
120	gb|AY836158.1| Australopyrum pectinatum ribulose-1,5-bisphosphat...	165	3e-38
121	gb|AY836157.1| Amblyopyrum muticum ribulose-1,5-bisphosphate car...	165	3e-38
122	gb|AY836156.1| Agropyron cristatum ribulose-1,5-bisphosphate car...	165	3e-38
123	gb|AY836155.1| Bromus sterilis ribulose-1,5-bisphosphate carboxy...	165	3e-38
124	gb|AY836154.1| Bromus arvensis ribulose-1,5-bisphosphate carboxy...	165	3e-38
125	dbj|AB042240.3| Triticum aestivum chloroplast DNA, complete genome	165	3e-38
126	emb|Z49844.1|HBCHRBPCX H.brachyantherum chloroplast rbcL gene fo...	165	3e-38
127	emb|Z49842.1|HLCHRBPCX H.lechleri chloroplast rbcL gene for ribu...	165	3e-38
128	dbj|D00206.1|WHTCPRBCL Triticum aestivum chloroplast gene for ri...	165	3e-38
129	gb|AY607054.1| Psathyrostachys fragilis subsp. secaliformis vouc...	161	5e-37
130	gb|AY607058.1| Psathyrostachys rupestris subsp. daghestanica vou...	159	2e-36
131	gb|AY632370.1| Phaenosperma globosa ribulose-1,5-bisphosphate ca...	157	7e-36
132	gb|AY632361.1| Brachypodium pinnatum ribulose-1,5-bisphosphate c...	157	7e-36
133	gb|AY691646.1| Trisetum youngii ribulose-1,5-bisphosphate carbox...	157	7e-36
134	gb|AY691645.1| Koeleria aff. novozelandica AK28214 ribulose-1,5-...	157	7e-36
135	gb|AY691642.1| Elymus solanderi ribulose-1,5-bisphosphate carbox...	157	7e-36
136	gb|AY691634.1| Hierochloe brunonis ribulose-1,5-bisphosphate car...	157	7e-36
137	gb|AY691631.1| Amphibromus fluitans ribulose-1,5-bisphosphate ca...	157	7e-36
138	gb|AY395565.1| Trisetum flavescens ribulose-1,5-bisphosphate car...	157	7e-36
139	gb|AY395536.1| Schedonorus pratensis ribulose-1,5-bisphosphate c...	157	7e-36
140	gb|AY395529.1| Arrhenatherum elatius ribulose-1,5-bisphosphate c...	157	7e-36
141	gb|AY395527.1| Agrostis capillaris ribulose-1,5-bisphosphate car...	157	7e-36
142	emb|AJ784835.1| Ammophila breviligulata chloroplast partial rbcL...	157	7e-36
143	emb|AJ784828.1| Hierochloe odorata chloroplast partial rbcL gene...	157	7e-36
144	emb|AJ784825.1| Koeleria pyramidata chloroplast partial rbcL gen...	157	7e-36
145	emb|AJ784824.1| Phaenosperma globosa chloroplast partial rbcL ge...	157	7e-36
146	emb|AJ784823.1| Arrhenatherum elatius chloroplast partial rbcL g...	157	7e-36
147	emb|AJ746281.1| Alopecurus geniculatus chloroplast partial rbcL ...	157	7e-36
148	emb|AJ746276.1| Trisetum flavescens chloroplast partial rbcL gen...	157	7e-36
149	emb|AJ746262.1| Koeleria cristata chloroplast partial rbcL gene ...	157	7e-36
150	emb|AJ746258.1| Brachypodium sylvaticum chloroplast partial rbcL...	157	7e-36
151	emb|AJ746172.1| Ampelodesmos mauritanica chloroplast partial rbc...	157	7e-36
152	gb|AY622886.1| Anisopogon avenaceus ribulose-1,5-bisphosphate ca...	157	7e-36
153	gb|AY622885.1| Ampelodesmos mauritanica ribulose-1,5-bisphosphat...	157	7e-36
154	emb|AJ746279.1| Holcus lanatus chloroplast partial rbcL gene for...	155	3e-35
155	gb|U88403.1|ASU88403 Amphipogon strictus ribulose-1,5-bisphospha...	155	3e-35
156	gb|U31380.1|TMU31380 Thysanolaena maxima ribulose-1,5-bisphospha...	155	3e-35
157	emb|Z49836.1|BICHRBPCX B.inermis chloroplast rbcL gene for ribul...	151	5e-34
158	gb|AY632364.1| Glyceria grandis ribulose-1,5-bisphosphate carbox...	149	2e-33
159	gb|AY691643.1| Puccinellia stricta ribulose-1,5-bisphosphate car...	149	2e-33
160	gb|AY691630.1| Agrostis magellanica ribulose-1,5-bisphosphate ca...	149	2e-33
161	emb|AJ784820.1| Calamagrostis epigejos chloroplast partial rbcL ...	149	2e-33
162	emb|AJ746294.1| Melica uniflora chloroplast partial rbcL gene fo...	149	2e-33
163	emb|AJ746285.1| Briza media chloroplast partial rbcL gene for ri...	149	2e-33
164	emb|AJ746282.1| Anthoxanthum odoratum chloroplast partial rbcL g...	149	2e-33
165	emb|AJ746257.1| Avena fatua chloroplast partial rbcL gene for ri...	149	2e-33
166	emb|AJ746256.1| Anthoxanthum odoratum chloroplast partial rbcL g...	149	2e-33
167	gb|AY836168.1| Heteranthelium piliferum ribulose-1,5-bisphosphat...	149	2e-33
168	gb|L15300.1|ASTCPRBCL Avena sativa ribulosbisphosphate dehydroge...	149	2e-33
169	gb|L14621.1|PUZRBCL Puccinellia distans chloroplast ribulose 1,5...	149	2e-33
170	gb|AY632374.1| Zeugites pittieri ribulose-1,5-bisphosphate carbo...	147	7e-33
171	gb|AY632368.1| Panicum virgatum ribulose-1,5-bisphosphate carbox...	147	7e-33
172	gb|AY632367.1| Molinia caerulea ribulose-1,5-bisphosphate carbox...	147	7e-33
173	ref|NM_195989.1| Oryza sativa (japonica cultivar-group) putative...	147	7e-33
174	gb|AY691637.1| Imperata cheesemanii ribulose-1,5-bisphosphate ca...	147	7e-33
175	gb|AY522330.1| Oryza sativa (japonica cultivar-group) cultivar N...	147	7e-33
176	gb|AY522331.1| Oryza sativa (japonica cultivar-group) isolate PA...	147	7e-33
177	gb|AY522329.1| Oryza sativa (indica cultivar-group) isolate 93-1...	147	7e-33
178	gb|AY395535.1| Dactylis glomerata ribulose-1,5-bisphosphate carb...	147	7e-33
179	emb|AJ784834.1| Lamarckia aurea chloroplast partial rbcL gene fo...	147	7e-33
180	emb|AJ784833.1| Spodiopogon sibiricus chloroplast partial rbcL g...	147	7e-33
181	emb|AJ784831.1| Dactylis marina chloroplast partial rbcL gene fo...	147	7e-33
182	emb|AJ784826.1| Imperata cylindrica chloroplast partial rbcL gen...	147	7e-33
183	emb|AJ784818.1| Andropogon gerardii chloroplast partial rbcL gen...	147	7e-33
184	gb|DQ167399.1| Oryza sativa (indica cultivar-group) isolate 93-1...	147	7e-33
185	gb|DQ167807.1| Oryza sativa (japonica cultivar-group) isolate PA...	147	7e-33
186	gb|DQ167400.1| Oryza sativa (japonica cultivar-group) cultivar N...	147	7e-33
187	emb|X55828.1|CHNMRBCL Neurachne munroi chloroplast rbcL gene for...	147	7e-33
188	emb|X55827.1|CHNTRBCL Neurachne tenuifolia chloroplast rbcL gene...	147	7e-33
189	emb|X15901.1|CHOSXX Oryza sativa (japonica cultivar-group) chlor...	147	7e-33
190	emb|AJ746299.1| Phragmites australis chloroplast partial rbcL ge...	147	7e-33
191	emb|AJ746297.1| Oryza sativa chloroplast partial rbcL gene for r...	147	7e-33
192	emb|AJ746295.1| Molinia caerulea chloroplast partial rbcL gene f...	147	7e-33
193	emb|AJ746291.1| Guaduella marantifolia chloroplast partial rbcL ...	147	7e-33
194	emb|AJ746289.1| Elytrophorus globularis chloroplast partial rbcL...	147	7e-33
195	emb|AJ746284.1| Arundo donax chloroplast partial rbcL gene for r...	147	7e-33
196	emb|AJ746275.1| Raddia brasiliensis chloroplast partial rbcL gen...	147	7e-33
197	emb|AJ746271.1| Otatea acuminata chloroplast partial rbcL gene f...	147	7e-33
198	emb|AJ746269.1| Olmeca recta chloroplast partial rbcL gene for r...	147	7e-33
199	emb|AJ746268.1| Dactylis glomerata chloroplast partial rbcL gene...	147	7e-33
200	emb|AJ746264.1| Digitaria sanguinalis chloroplast partial rbcL g...	147	7e-33
201	emb|AJ746171.1| Bambusa valida chloroplast partial rbcL gene for...	147	7e-33
202	gb|U29900.1| Phragmites australis ribulose-bisphosphate carboxyl...	147	7e-33
203	gb|AC122148.1| Oryza sativa (japonica cultivar-group) chromosome...	147	7e-33
204	gb|AE009947.2| Saccharum hybrid cultivar SP-80-3280 chloroplast,...	147	7e-33
205	gb|AF164778.1| Guaduella marantifolia ribulose 1,5 bisphosphate ...	147	7e-33
206	gb|AC092750.2| Oryza sativa (japonica cultivar-group) cultivar N...	147	7e-33
207	gb|U88405.1|EGU88405 Elytrophorus globularis ribulose-1,5-bispho...	147	7e-33
208	gb|U31360.1|ADU31360 Arundo donax ribulose-1,5-bisphosphate carb...	147	7e-33
209	gb|U13229.1|PAU13229 Phragmites australis ribulose-1,5-bisphosph...	147	7e-33
210	gb|U13226.1|ADU13226 Arundo donax ribulose-1,5-bisphosphate carb...	147	7e-33
211	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	147	7e-33
212	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	147	7e-33
213	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	147	7e-33
214	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	147	7e-33
215	gb|AY601672.1| Hordeum secalinum ribulose-1,5-bisphosphate carbo...	147	7e-33
216	gb|AY618663.1| Streptogyna americana ribulose 1,5-bisphosphate c...	147	7e-33
217	gb|AY618662.1| Isachne arundinacea ribulose 1,5-bisphosphate car...	147	7e-33
218	gb|AY618661.1| Danthoniopsis petiolata ribulose 1,5-bisphosphate...	147	7e-33
219	gb|AY622897.1| Olyra latifolia ribulose-1,5-bisphosphate carboxy...	147	7e-33
220	gb|U13228.1|LOU13228 Leersia oryzoides chloroplast ribulose-1,5-...	147	7e-33
221	dbj|AP003280.2| Oryza sativa (japonica cultivar-group) genomic D...	147	7e-33
222	dbj|AP004236.3| Oryza sativa (japonica cultivar-group) genomic D...	147	7e-33
223	dbj|AP003623.3| Oryza sativa (japonica cultivar-group) genomic D...	147	7e-33
224	dbj|AK105600.1| Oryza sativa (japonica cultivar-group) cDNA clon...	147	7e-33
225	dbj|AK062203.1| Oryza sativa (japonica cultivar-group) cDNA clon...	147	7e-33
226	dbj|AK058623.1| Oryza sativa (japonica cultivar-group) cDNA clon...	147	7e-33
227	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	147	7e-33
228	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	147	7e-33
229	emb|BX000560.1|CNS08CE6 Oryza sativa chromosome 12, . BAC OSJNBa...	147	7e-33
230	dbj|AP006714.1| Saccharum officinarum chloroplast DNA, complete ...	147	7e-33
231	dbj|AP006728.1| Oryza nivara chloroplast DNA, complete genome	147	7e-33
232	gb|U88406.1|SGU88406 Styppeiochloa gynoglossa ribulose-bisphosph...	147	7e-33
233	gb|M91626.1|BAMCPRBCL Bamboo chloroplast ribulosebisphosphate (r...	147	7e-33
234	gb|U31381.1|TBU31381 Tristachya biseriata ribulose-1,5-bisphosph...	147	7e-33
235	gb|U31442.1|SDU31442 Stipa dregeana var. dregeana ribulose-1,5-b...	147	7e-33
236	gb|U31438.1|MMU31438 Merxmuellera macowanii ribulose-1,5-bisphos...	147	7e-33
237	gb|U31439.1|MJU31439 Moliniopsis japonica ribulose-1,5-bisphosph...	147	7e-33
238	gb|U31105.1|GSU31105 Gynerium sagittatum ribulose-1,5-bisphospha...	147	7e-33
239	gb|U31101.1|CLU31101 Chasmanthium latifolium ribulose-1,5-bispho...	147	7e-33
240	gb|U31100.1|CGU31100 Centropodia glauca ribulose-1,5-bisphosphat...	147	7e-33
241	emb|X04789.1|CHOSRBCL Rice chloroplast DNA for ribulose-1,5-biph...	147	7e-33
242	gb|U13231.1|LHU13231 Lithachne humilis chloroplast ribulose-1,5-...	147	7e-33
243	gb|L14623.1|PENCARBOXL Pennisetum glaucum ribulosebiphosphate ca...	147	7e-33
244	gb|L14622.1|CEHRBCL Cenchrus setigerus chloroplast ribulose 1,5-...	147	7e-33
245	dbj|D00207.1|RICCPRBCL Oryza sativa chloroplast gene for ribulos...	147	7e-33
246	gb|AY632362.1| Buergersiochloa bambusoides ribulose-1,5-bisphosp...	143	1e-31
247	gb|AY618660.1| Arundinaria gigantea ribulose 1,5-bisphosphate ca...	143	1e-31
248	gb|L05043.2|ZIZCPRBCL Zizania texana ribulose 1,5-bisphosphate c...	143	1e-31
249	gb|AY632365.1| Melica cupanii ribulose-1,5-bisphosphate carboxyl...	141	4e-31
250	gb|AY691644.1| Zotovia thomsonii ribulose-1,5-bisphosphate carbo...	141	4e-31
251	gb|AY691633.1| Microlaena avenacea ribulose-1,5-bisphosphate car...	141	4e-31
252	emb|AJ784822.1| Festuca rubra subsp. juncea chloroplast partial ...	141	4e-31
253	emb|AJ746300.1| Puelia ciliata chloroplast partial rbcL gene for...	141	4e-31
254	emb|AJ746280.1| Agrostis stolonifera chloroplast partial rbcL ge...	141	4e-31
255	emb|AJ746263.1| Melica uniflora chloroplast partial rbcL gene fo...	141	4e-31
256	emb|AJ746261.1| Festuca rubra chloroplast partial rbcL gene for ...	141	4e-31
257	gb|AF164780.1| Puelia ciliata ribulose 1,5 bisphosphate carboxyl...	141	4e-31
258	gb|AY622898.1| Piptatherum miliaceum ribulose-1,5-bisphosphate c...	141	4e-31
259	gb|AY622896.1| Nassella viridula ribulose-1,5-bisphosphate carbo...	141	4e-31
260	gb|AY622891.1| Ehrharta calycina ribulose-1,5-bisphosphate carbo...	141	4e-31
261	dbj|BA000029.3| Oryza sativa (japonica cultivar-group) mitochond...	141	4e-31
262	gb|AY632375.1| Zoysia sp. JID-2004 ribulose-1,5-bisphosphate car...	139	2e-30
263	gb|AY632369.1| Pariana radiciflora ribulose-1,5-bisphosphate car...	139	2e-30
264	gb|AY632366.1| Micraira subulifolia ribulose-1,5-bisphosphate ca...	139	2e-30
265	gb|AY632363.1| Distichlis spicata ribulose-1,5-bisphosphate carb...	139	2e-30
266	gb|AY506529.1| Zea mays strain NB mitochondrion, complete genome	139	2e-30
267	gb|AY640153.1| Merxmuellera rangei ribulose-1,5-bisphosphate car...	139	2e-30
268	gb|AY626351.1| Eriachne triseta ribulose 1,5-bisphosphate carbox...	139	2e-30
269	gb|DQ490952.1| Zea mays subsp. mays genotype male-fertile NA mit...	139	2e-30
270	emb|AJ784836.1| Muhlenbergia racemosa chloroplast partial rbcL g...	139	2e-30
271	emb|AJ784829.1| Bouteloua gracilis chloroplast partial rbcL gene...	139	2e-30
272	emb|Z11973.1|CHZMRBCLG Z.mays chloroplast rbcL gene for ribulose...	139	2e-30
273	emb|X86563.2|ZMA86563 Zea mays complete chloroplast genome	139	2e-30
274	emb|AJ746288.1| Cyperochloa hirsuta chloroplast partial rbcL gen...	139	2e-30
275	emb|AJ746278.1| Sasa palmata chloroplast partial rbcL gene for r...	139	2e-30
276	emb|AJ746277.1| Yushania maling chloroplast partial rbcL gene fo...	139	2e-30
277	emb|AJ746273.1| Pseudosasa amabilis chloroplast partial rbcL gen...	139	2e-30
278	emb|AJ746272.1| Phyllostachys nigra chloroplast partial rbcL gen...	139	2e-30
279	emb|AJ746270.1| Oligostachyum oedogonatum chloroplast partial rb...	139	2e-30
280	emb|AJ746267.1| Hibanobambusa tranquillans chloroplast partial r...	139	2e-30
281	emb|AJ746266.1| Fargesia dracocephala chloroplast partial rbcL g...	139	2e-30
282	emb|AJ746265.1| Drepanostachyum falcatum chloroplast partial rbc...	139	2e-30
283	emb|AJ746259.1| Brachystachyum densiflorum chloroplast partial r...	139	2e-30
284	emb|AJ746179.1| Arundinaria tecta chloroplast partial rbcL gene ...	139	2e-30
285	gb|AF352580.1| Eriachne triodioides ribulose-1,5-bisphosphate ca...	139	2e-30
286	emb|AJ746178.1| Arundinaria oedogonata chloroplast partial rbcL ...	139	2e-30
287	emb|AJ746177.1| Indocalamus latifolius chloroplast partial rbcL ...	139	2e-30
288	emb|AJ746176.1| Chimonobambusa marmorea chloroplast partial rbcL...	139	2e-30
289	gb|U88404.1|CHU88404 Cyperochloa hirsuta ribulose-1,5-bisphospha...	139	2e-30
290	gb|AY622892.1| Eremitis sp. MRD-2004 ribulose-1,5-bisphosphate c...	139	2e-30
291	gb|AY928077.1| Zea mays cultivar B73 chloroplast, complete genome	139	2e-30
292	dbj|AB088833.1| Phyllostachys bambusoides chloroplast rbcL gene ...	139	2e-30
293	emb|AM110249.1| Fargesia sp. Asmussen 105 plastid partial rbcL g...	139	2e-30
294	gb|U31379.1|MPU31379 Monachather paradoxus ribulose-1,5-bisphosp...	139	2e-30
295	gb|U31436.1|HHU31436 Hyparrhenia hirta ribulose-1,5-bisphosphate...	139	2e-30
296	gb|U31104.1|ECU31104 Eragrostis capensis ribulose-1,5-bisphospha...	139	2e-30
297	emb|X79900.1|SILCRBCL S.italica L. chloroplast rbcL gene	139	2e-30
298	gb|U13230.1|PBU13230 Phyllostachys bambusoides chloroplast ribul...	139	2e-30
299	gb|AY137446.1| Hordeum patagonicum subsp. mustersii ribulose-1,5...	137	7e-30
300	emb|AJ746283.1| Aristida congesta subsp. barbicollis chloroplast...	133	1e-28
301	emb|AJ746254.1| Arthrostylidium sp. TH-53B chloroplast partial r...	133	1e-28
302	gb|U31359.1|ACU31359 Aristida congesta subsp. barbicollis ribulo...	133	1e-28
303	gb|U13227.1|CCU13227 Chusquea circinata chloroplast ribulose-1,5...	133	1e-28
304	gb|AY632373.1| Uniola paniculata ribulose-1,5-bisphosphate carbo...	131	4e-28
305	gb|DQ005609.1| Cortaderia selloana ribulose-1,5-bisphosphate car...	131	4e-28
306	gb|DQ490951.1| Zea mays subsp. mays genotype CMS-S mitochondrion...	131	4e-28
307	emb|AJ784830.1| Cortaderia richardii chloroplast partial rbcL ge...	131	4e-28
308	emb|AJ784819.1| Arthraxon sp. mvdb-G3 chloroplast partial rbcL g...	131	4e-28
309	emb|V00171.1|CHZM02 Zea mays chloroplast gene for the large subu...	131	4e-28
310	emb|AJ746274.1| Phragmites sp. TH-203 chloroplast partial rbcL g...	131	4e-28
311	emb|AJ746260.1| Cortaderia sp. TH-158 chloroplast partial rbcL g...	131	4e-28
312	emb|AJ746253.1| Arthraxon sp. TH-111 chloroplast partial rbcL ge...	131	4e-28
313	gb|AY622888.1| Brachyelytrum erectum ribulose-1,5-bisphosphate c...	131	4e-28
314	gb|U31378.1|SZU31378 Stipagrostis zeyheri subsp. zeyheri ribulos...	131	4e-28
315	gb|U31440.1|PPU31440 Plinthanthesis paradoxa ribulose-1,5-bispho...	131	4e-28
316	gb|U31103.1|ESU31103 Enneapogon scaber ribulose-1,5-bisphosphate...	131	4e-28
317	gb|U31102.1|DSU31102 Danthonia spicata ribulose-1,5-bisphosphate...	131	4e-28
318	gb|AY632372.1| Streptochaeta sodiroana ribulose-1,5-bisphosphate...	125	3e-26
319	gb|AY167975.1| Zea mays ribulose-1,5-bisphosphate carboxylase/ox...	125	3e-26
320	emb|AJ419949.1|SSP419949 Streptochaeta spicata chloroplast parti...	125	3e-26
321	gb|AY632371.1| Spartina pectinata ribulose-1,5-bisphosphate carb...	123	1e-25
322	gb|AY691638.1| Pyrrhanthera exigua ribulose-1,5-bisphosphate car...	123	1e-25
323	emb|AJ784821.1| Spartina pectinata chloroplast partial rbcL gene...	123	1e-25
324	gb|U31441.1|RNU31441 Rytidosperma nudiflorum ribulose-1,5-bispho...	123	1e-25
325	gb|U31437.1|KPU31437 Karroochloa purpurea ribulose-1,5-bisphosph...	123	1e-25
326	gb|AY357724.1| Pharus latifolius ribulose-1,5-bisphosphate carbo...	117	6e-24
327	emb|AJ746296.1| Nardus stricta chloroplast partial rbcL gene for...	117	6e-24
328	emb|AJ419950.1|PPA419950 Pharus parvifolius chloroplast partial ...	117	6e-24
329	gb|AY622895.1| Nardus stricta ribulose-1,5-bisphosphate carboxyl...	117	6e-24
330	gb|AY622894.1| Lygeum spartum ribulose-1,5-bisphosphate carboxyl...	117	6e-24
331	gb|AC134256.4| Oryza sativa (japonica cultivar-group), complete ...	115	3e-23
332	emb|AJ746255.1| Aira praecox chloroplast partial rbcL gene for r...	115	3e-23
333	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	115	3e-23
334	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	115	3e-23
335	gb|DQ490953.1| Zea mays subsp. mays genotype CMS-T mitochondrion...	109	2e-21
336	gb|AF148773.1| Ecdeiocolea monostachya ribulose-1,5-bisphosphate...	109	2e-21
337	emb|AJ286559.1|EMO286559 Ecdeiocolea monostachya chloroplast par...	109	2e-21
338	gb|AY123235.1| Ecdeiocolea monostachya ribulose-1,5-bisphosphate...	109	2e-21
339	gb|AF021875.1|AF021875 Anomochloa marantoidea ribulose 1,5-bisph...	109	2e-21
340	gb|L01471.1|JOICPRBCL Joinvillea plicata chloroplast ribulose-bi...	109	2e-21
341	gb|AY123237.1| Tonina fluviatilis ribulose-1,5-bisphosphate carb...	107	6e-21
342	gb|AF148772.1| Georgeantha hexandra ribulose-1,5-bisphosphate ca...	103	1e-19
343	gb|AF148766.1| Centrolepis strigosa ribulose-1,5-bisphosphate ca...	101	4e-19
344	emb|AJ286558.1|CST286558 Centrolepis strigosa chloroplast partia...	101	4e-19
345	gb|AY123239.1| Thurnia polycephala ribulose-1,5-bisphosphate car...	101	4e-19
346	gb|U49223.1|PSU49223 Prionium serratum ribulose-1,5-bisphosphate...	101	4e-19
347	gb|AY298835.1| Lachnocaulon anceps ribulose-1,5-bisphosphate car...	100	1e-18
348	gb|AY395543.1| Juncus articulatus ribulose-1,5-bisphosphate carb...	100	1e-18
349	emb|Y12947.1|STY12947 S.terrestris rbcL gene	100	1e-18
350	emb|AJ419947.1|RMA419947 Rostkovia magellanica chloroplast parti...	100	1e-18
351	emb|AJ419946.1|MGR419946 Marsippospermum grandiflorum chloroplas...	100	1e-18
352	emb|AJ419944.1|DAC419944 Distichia acicularis chloroplast partia...	100	1e-18
353	gb|AY216650.1| Luzula nivea ribulose-1,5-bisphosphate carboxylas...	100	1e-18
354	gb|AY216631.1| Juncus oxycarpus ribulose-1,5-bisphosphate carbox...	100	1e-18
355	gb|AY216630.1| Juncus subnodulosus ribulose-1,5-bisphosphate car...	100	1e-18
356	gb|AY216628.1| Juncus himalensis ribulose-1,5-bisphosphate carbo...	100	1e-18
357	gb|AY216627.1| Juncus repens ribulose-1,5-bisphosphate carboxyla...	100	1e-18
358	gb|AY216624.1| Juncus xiphioides ribulose-1,5-bisphosphate carbo...	100	1e-18
359	gb|AY216622.1| Juncus bulbosus ribulose-1,5-bisphosphate carboxy...	100	1e-18
360	gb|AY216621.1| Juncus oxymeris ribulose-1,5-bisphosphate carboxy...	100	1e-18
361	gb|AY216618.1| Juncus trifidus ribulose-1,5-bisphosphate carboxy...	100	1e-18
362	gb|AY216614.1| Juncus articulatus ribulose-1,5-bisphosphate carb...	100	1e-18
363	gb|AY216611.1| Juncus ensifolius ribulose-1,5-bisphosphate carbo...	100	1e-18
364	gb|AY216610.1| Juncus stygius ribulose-1,5-bisphosphate carboxyl...	100	1e-18
365	gb|AY216606.1| Juncus covillei ribulose-1,5-bisphosphate carboxy...	100	1e-18
366	gb|AY216605.1| Juncus triglumis ribulose-1,5-bisphosphate carbox...	100	1e-18
367	gb|AY660588.1| Oxychloe andina voucher Brooks 20583 (C1436) ribu...	100	1e-18
368	gb|AY660585.1| Oxychloe castellanosii voucher H319/2 ribulose-1,...	100	1e-18
369	gb|U49226.1|MGU49226 Marsippospermum grandiflorum ribulose-1,5-b...	100	1e-18
370	gb|AY614389.1| Bromelia plumieri MB-119 atpB-rbcL intergenic spa...	100	1e-18
371	gb|AY614385.1| Lindmania guianensis MB-112 atpB-rbcL intergenic ...	100	1e-18
372	gb|AY298829.1| Dimerocostus argenteus ribulose-1,5-bisphosphate ...	98	6e-18
373	gb|AY298826.1| Costus lateriflorus ribulose-1,5-bisphosphate car...	98	6e-18
374	gb|AF264167.1| Eulophia petersii ribulose-1,5-bisphosphate carbo...	98	6e-18
375	gb|L05447.1|CSACPRBCL Costus barbatus ribulose 1,5-bisphosphate ...	98	6e-18
376	gb|L05457.1|OCICPRBCLA Orchidantha sp. ribulose 1,5-bisphosphate...	98	6e-18
377	gb|AY012494.1| Drymophloeus beguinii ribulose bisphosphate carbo...	98	6e-18
378	gb|AY012493.1| Balaka seemannii ribulose bisphosphate carboxylas...	98	6e-18
379	gb|AF378771.1| Orchidantha siamensis ribulose bisphosphate carbo...	98	6e-18
380	gb|AF378764.1| Canna tuerckheimii ribulose bisphosphate carboxyl...	98	6e-18
381	gb|AF378763.1| Canna indica ribulose bisphosphate carboxylase la...	98	6e-18
382	gb|AF243510.1| Costus barbatus ribulose-bisphosphate carboxylase...	98	6e-18
383	gb|AF243841.1| Orchidantha fimbriata ribulose-bisphosphate carbo...	98	6e-18
384	gb|AF243839.1| Monocostus uniflorus ribulose-bisphosphate carbox...	98	6e-18
385	gb|AF243838.1| Dimerocostus strobilaceus ribulose-bisphosphate c...	98	6e-18
386	gb|AF378780.1|AF378780 Orchidantha maxillarioides ribulose bisph...	98	6e-18
387	gb|AF378776.1|AF378776 Costus pulverulentus ribulose bisphosphat...	98	6e-18
388	gb|AF378775.1|AF378775 Costus malortieanus ribulose bisphosphate...	98	6e-18
389	gb|AF378774.1|AF378774 Canna glauca ribulose bisphosphate carbox...	98	6e-18
390	gb|AF074170.1|AF074170 Eulophia nuda ribulose-1,5-bisphosphate c...	98	6e-18
391	gb|AF518028.1| Eulophia sp. Chase O-403 specimen-voucher MWC403 ...	98	6e-18
392	gb|AF036881.1|AF036881 Thurnia macrocephala ribulose 1,5-bisphos...	98	6e-18
393	emb|AM110252.1| Musa rosea plastid partial rbcL gene for ribulos...	98	6e-18
394	emb|AM110251.1| Canna indica plastid partial rbcL gene for ribul...	98	6e-18
395	emb|AM110235.1| Ptychosperma macarthurii plastid partial rbcL ge...	98	6e-18
396	gb|AY656132.1| Canna paniculata voucher Prince 95-211 NCU ribulo...	98	6e-18
397	gb|AY656131.1| Trachyphrynium braunianum voucher Kress 98-6269 U...	98	6e-18
398	gb|AY656120.1| Hypselodelphys sp. Harris 6670 ribulose-1,5-bisph...	98	6e-18
399	gb|M81812.1|DRYCPRBCL Drymopnlaeus subdisticha chloroplast ribul...	98	6e-18
400	emb|Z77281.1|SCZ77281 S.capensis chloroplast rbcL gene	98	6e-18
401	gb|AY368370.1| Scuticaria hadwenii ribulose-1,5-bisphosphate car...	96	2e-17
402	gb|AF148787.1| Lyginia barbata ribulose-1,5-bisphosphate carboxy...	96	2e-17
403	gb|AF148779.1| Lepidobolus chaetocephalus ribulose-1,5-bisphosph...	96	2e-17
404	gb|AF148777.1| Hopkinsia adscendens ribulose-1,5-bisphosphate ca...	96	2e-17
405	gb|AF148776.1| Harperia lateriflora ribulose-1,5-bisphosphate ca...	96	2e-17
406	gb|AF148761.1| Baloskion tetraphyllum ribulose-1,5-bisphosphate ...	96	2e-17
407	emb|AJ419942.1|PFA419942 Paepalanthus fasciculatus chloroplast p...	96	2e-17
408	emb|AJ286563.1|XCA286563 Xyris capensis chloroplast partial rbcL...	96	2e-17
409	gb|L05444.1|CTLCPRBCL Calathea loeseneri ribulose 1,5-bisphospha...	96	2e-17
410	gb|L05453.1|MROCPRBCL Marantochloa purpurea ribulose 1,5-bisphos...	96	2e-17
411	gb|AY216617.1| Juncus lomatophyllus ribulose-1,5-bisphosphate ca...	96	2e-17
412	gb|AY216616.1| Juncus capensis ribulose-1,5-bisphosphate carboxy...	96	2e-17
413	gb|AY034250.1| Wolffia borealis ribulose-1,5-biphosphate carboxy...	96	2e-17
414	gb|AY034248.1| Wolffia brasiliensis ribulose-1,5-biphosphate car...	96	2e-17
415	gb|AY034236.1| Lemna disperma ribulose-1,5-biphosphate carboxyla...	96	2e-17
416	gb|AY034232.1| Lemna obscura ribulose-1,5-biphosphate carboxylas...	96	2e-17
417	gb|AY034231.1| Lemna ecuadoriensis ribulose-1,5-biphosphate carb...	96	2e-17
418	gb|AY034230.1| Lemna turionifera ribulose-1,5-biphosphate carbox...	96	2e-17
419	gb|AY034227.1| Lemna tenera ribulose-1,5-biphosphate carboxylase...	96	2e-17
420	gb|M91633.1|SRMCPRBCL Bur-reed chloroplast ribulosebisphosphate ...	96	2e-17
421	gb|AF206834.1| Xyris sp. Chase 154 ribulose 1,5-bisphosphate car...	96	2e-17
422	gb|AY123233.1| Aphelia cyperoides ribulose-1,5-bisphosphate carb...	96	2e-17
423	dbj|D38296.1| Restio tetraphyllus chloroplast rbcL gene for ribu...	96	2e-17
424	gb|AY298845.1| Philydrella pygmaea ribulose-1,5-bisphosphate car...	94	9e-17
425	gb|AY298834.1| Helmholtzia glaberrima ribulose-1,5-bisphosphate ...	94	9e-17
426	gb|AC133248.4| Oryza sativa (japonica cultivar-group) chromosome...	94	9e-17
427	gb|AF148760.1| Anarthria polyphylla ribulose-1,5-bisphosphate ca...	94	9e-17
428	gb|AY216603.1| Juncus hallii ribulose-1,5-bisphosphate carboxyla...	94	9e-17
429	gb|AY216625.1| Juncus compressus ribulose-1,5-bisphosphate carbo...	94	9e-17
430	gb|AY216613.1| Juncus gerardii ribulose-1,5-bisphosphate carboxy...	94	9e-17
431	gb|AY216607.1| Juncus dichotomus ribulose-1,5-bisphosphate carbo...	94	9e-17
432	gb|AY216602.1| Juncus imbricatus ribulose-1,5-bisphosphate carbo...	94	9e-17
433	gb|AF243845.1| Phenakospermum guyannense ribulose-bisphosphate c...	94	9e-17
434	gb|AF243842.1| Calathea loeseneri ribulose-bisphosphate carboxyl...	94	9e-17
435	gb|AF243840.1| Tapeinochilos ananassae ribulose-bisphosphate car...	94	9e-17
436	gb|AF307485.1|AF307485 Burmannia coelestis ribulose-1,5-bisphosp...	94	9e-17
437	gb|AF206808.1| Philydrella pygmaea ribulose 1,5-bisphosphate car...	94	9e-17
438	gb|AF518073.1| Sophronitis harpophylla specimen-voucher MWC1249 ...	94	9e-17
439	gb|L05040.2|MAWCPRBCL Maranta leuconeura ribulose 1,5-bisphospha...	94	9e-17
440	emb|AM110192.1| Zombia antillarum plastid partial rbcL gene for ...	94	9e-17
441	emb|AJ315130.1|GSP315130 Grevea sp. Thulin et al. s.n. partial c...	94	9e-17
442	gb|AY656130.1| Thaumatococcus daniellii voucher Kress 98-6288 US...	94	9e-17
443	gb|AY656129.1| Thalia geniculata voucher Wurdack 261 NCU ribulos...	94	9e-17
444	gb|AY656128.1| Schumannianthus virgatus voucher Kress US ribulos...	94	9e-17
445	gb|AY656126.1| Sarcophrynium brachystachys voucher Kress US ribu...	94	9e-17
446	gb|AY656125.1| Saranthe sp. Kress 96-5737 ribulose-1,5-bisphosph...	94	9e-17
447	gb|AY656124.1| Stachyphrynium repens voucher Kress 99-6319 US ri...	94	9e-17
448	gb|AY656122.1| Monotagma laxum voucher Kress 99-6381 US ribulose...	94	9e-17
449	gb|AY656121.1| Ischnosiphon helenae voucher Kress US ribulose-1,...	94	9e-17
450	gb|AY656119.1| Haumania sp. Harris 6672 ribulose-1,5-bisphosphat...	94	9e-17
451	gb|AY656115.1| Calathea rufibarba voucher Kress US ribulose-1,5-...	94	9e-17
452	gb|AY656114.1| Calathea micans voucher Kress US ribulose-1,5-bis...	94	9e-17
453	gb|AY656113.1| Calathea metallica voucher Kress 99-6586 US ribul...	94	9e-17
454	gb|AY656112.1| Calathea crotalifera voucher Kress US ribulose-1,...	94	9e-17
455	gb|U49224.1|RMU49224 Rostkovia magellanica ribulose-1,5-bisphosp...	94	9e-17
456	gb|U49227.1|DMU49227 Distichia muscoides ribulose-1,5-bisphospha...	94	9e-17
457	gb|L12681.1|JUCCPRBCLA Juncus effusus chloroplast ribulosebispho...	94	9e-17
458	emb|AJ428898.1|GSP428898 Grevea sp. 'Thulin et al. s.n.' chlorop...	94	9e-17
459	gb|AY298820.1| Brocchinia reducta ribulose-1,5-bisphosphate carb...	92	4e-16
460	gb|DQ005608.1| Neoregelia schubertii ribulose-1,5-bisphosphate c...	92	4e-16
461	gb|AY794944.1| Mercurialis perennis ribulose-1,5-bisphosphate ca...	92	4e-16
462	gb|AY794934.1| Mallotus japonicus ribulose-1,5-bisphosphate carb...	92	4e-16
463	gb|AY395548.1| Luzula campestris ribulose-1,5-bisphosphate carbo...	92	4e-16
464	emb|Y12977.1|RNY12977 R.nervosa rbcL gene	92	4e-16
465	emb|Y12975.1|CAY12975 C.abyssinica rbcL gene	92	4e-16
466	emb|Y12968.1|SDY12968 S.distans rbcL gene	92	4e-16
467	emb|Y12950.1|CSY12950 Cladium sp. gene	92	4e-16
468	emb|AJ419945.1|LMU419945 Luzula multiflora chloroplast partial r...	92	4e-16
469	gb|AY788176.1| Spathiostemon javensis ribulose-1,5-bisphosphate ...	92	4e-16
470	gb|AF461418.1| Aratitiyopea lopezii ribulose-1,5-bisphosphate ca...	92	4e-16
471	gb|AY216655.1| Luzula canariensis ribulose-1,5-bisphosphate carb...	92	4e-16
472	gb|AY216654.1| Luzula purpureosplendens ribulose-1,5-bisphosphat...	92	4e-16
473	gb|AY216652.1| Luzula campestris ribulose-1,5-bisphosphate carbo...	92	4e-16
474	gb|AY216651.1| Luzula arcuata ribulose-1,5-bisphosphate carboxyl...	92	4e-16
475	gb|AY216649.1| Luzula wahlenbergii ribulose-1,5-bisphosphate car...	92	4e-16
476	gb|AY216647.1| Luzula sudetica ribulose-1,5-bisphosphate carboxy...	92	4e-16
477	gb|AY216646.1| Luzula divulgata ribulose-1,5-bisphosphate carbox...	92	4e-16
478	gb|AY216645.1| Luzula spicata ribulose-1,5-bisphosphate carboxyl...	92	4e-16
479	gb|AY216644.1| Luzula glabrata ribulose-1,5-bisphosphate carboxy...	92	4e-16
480	gb|AY216643.1| Luzula novaecambriae ribulose-1,5-bisphosphate ca...	92	4e-16
481	gb|AY216641.1| Luzula meridionalis ribulose-1,5-bisphosphate car...	92	4e-16
482	gb|AY216640.1| Luzula gigantea ribulose-1,5-bisphosphate carboxy...	92	4e-16
483	gb|AY216636.1| Luzula nodulosa ribulose-1,5-bisphosphate carboxy...	92	4e-16
484	gb|AY216635.1| Luzula traversii ribulose-1,5-bisphosphate carbox...	92	4e-16
485	gb|AY216634.1| Luzula johnstonii ribulose-1,5-bisphosphate carbo...	92	4e-16
486	gb|AY216633.1| Luzula kjellmanniana ribulose-1,5-bisphosphate ca...	92	4e-16
487	gb|AY216632.1| Luzula luzulina ribulose-1,5-bisphosphate carboxy...	92	4e-16
488	gb|AY216629.1| Juncus maritimus ribulose-1,5-bisphosphate carbox...	92	4e-16
489	gb|AY216623.1| Juncus castaneus ribulose-1,5-bisphosphate carbox...	92	4e-16
490	gb|AY216612.1| Juncus effusus ribulose-1,5-bisphosphate carboxyl...	92	4e-16
491	gb|AY216609.1| Juncus kraussii ribulose-1,5-bisphosphate carboxy...	92	4e-16
492	gb|AY216608.1| Juncus vaginatus ribulose-1,5-bisphosphate carbox...	92	4e-16
493	gb|AY216601.1| Juncus nevadensis ribulose-1,5-bisphosphate carbo...	92	4e-16
494	gb|AY033860.1| Ceuthostoma terminale ribulose-1,5-bisphosphate c...	92	4e-16
495	gb|AF206818.1| Rhynchospora nervosa ribulose 1,5-bisphosphate ca...	92	4e-16
496	gb|AF206814.1| Puya raimondii ribulose 1,5-bisphosphate carboxyl...	92	4e-16
497	gb|AF344490.1|AF344490 Lasiocarpus sp. KMC-2001 ribulose-1,5-bis...	92	4e-16
498	gb|AF036885.1|AF036885 Mayaca fluviatilis ribulose 1,5-bisphosph...	92	4e-16
499	gb|AY725955.1| Trilepis lhotzkiana ribulose-bisphosphate carboxy...	92	4e-16
500	gb|AY725954.1| Tricostularia pauciflora ribulose-bisphosphate ca...	92	4e-16

---

>gb|AY772669.1| Elymus sibiricus ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) mRNA, complete cds; chloroplast
          Length = 1510

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1236 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1177

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1176 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1136

---

>gb|AY691641.1| Simplicia laxa ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1173 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1114

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1113 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1073

---

>gb|AY691640.1| Stenostachys laevis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1173 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1114

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1113 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1073

---

>gb|AY691639.1| Stenostachys gracilis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1333

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1159 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1100

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1099 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1059

---

>gb|AY691636.1| Australopyrum calcis subsp. calcis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; chloroplast
          Length = 1347

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1173 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1114

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1113 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1073

---

>gb|AY691635.1| Deschampsia cespitosa ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1173 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1114

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1113 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1073

---

>gb|AY691632.1| Bromus arenarius ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1173 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1114

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1113 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1073

---

>gb|AY395555.1| Poa trivialis ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1287

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1128 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1069

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1068 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1028

---

>gb|AY395554.1| Phleum pratense ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1332

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1149 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1090

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1089 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1049

---

>gb|AY395547.1| Lolium perenne ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1296

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1144 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1085

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1084 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1044

---

>gb|AY395541.1| Hordeum secalinum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1299

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1147 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1088

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1087 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1047

---

>gb|AY395539.1| Glyceria fluitans ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1309

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1129 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1070

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1069 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1029

---

>gb|AY395531.1| Bromus hordeaceus ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1350

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1165 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1106

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1105 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1065

---

>gb|AY395528.1| Alopecurus pratensis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit-like protein (rbcL) gene, partial sequence;
            chloroplast
          Length = 1408

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1165 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1106

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1105 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1065

---

>emb|AJ784837.1| Alopecurus pratensis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1345

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1165 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1106

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1105 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1065

---

>emb|AJ784832.1| Phleum pratense chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1345

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1175 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1116

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1115 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1075

---

>emb|AJ784827.1| Phalaris arundinacea chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1363

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1183 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1124

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1123 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1083

---

>gb|AY328025.1| Triticum aestivum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcl) mRNA, complete cds; chloroplast gene
            for chloroplast product
          Length = 1519

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1244 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1185

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1184 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1144

---

>emb|Z49846.1|PSPCHRBPC P.spicata chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1185 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1126

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1125 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1085

---

>emb|Z49845.1|PSCHRBPCX P.sanctum chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1185 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1126

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1125 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1085

---

>emb|Z49843.1|LCCHRBPCX L.chinensis chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1185 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1126

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1125 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1085

---

>emb|Z49841.1|HJCHRBPCX H.jubatum chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1185 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1126

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1125 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1085

---

>emb|Z49840.1|EECHRBPCX E.erianthum chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1185 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1126

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1125 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1085

---

>emb|Z49839.1|ETCHRBPCX E.trachycaulus chloroplast rbcL gene for ribulosebiphosphate
            carboxylase
          Length = 1431

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1185 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1126

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1125 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1085

---

>emb|Z49838.1|EPCHRBPCX E.patagonicus chloroplast rbcL gene for ribulosebiphosphate
            carboxylase
          Length = 1431

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1185 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1126

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1125 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1085

---

>emb|Z49837.1|EGCHRBPCX E.glaucescens chloroplast rbcL gene for ribulosebiphosphate
            carboxylase
          Length = 1431

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1185 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1126

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1125 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1085

---

>emb|X62119.1|CHASHSRA A.squarrosa chloroplast genes rbcL, psaI, ORF 185 and ORF 230 for
            large subunit of ribulose 1,5 bisphosphate
            carboxylase/oxygenase and apoprotein I
          Length = 3830

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1022 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 963

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 962  tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 922

---

>emb|X62118.1|CHACHSRG A.crassa chloroplast genes rbcL, psaI, ORF 185 and ORF 230 for large
            subunit of ribulose 1,5 bisphosphate
            carboxylase/oxygenase and apoprotein I
          Length = 4811

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1022 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 963

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 962  tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 922

---

>emb|X62117.1|CHTAHSRA T.aestivum chloroplast genes rbcL, psaI, ORF 185 and ORF 230 for
            large subunit of ribulose 1,5 bisphosphate
            carboxylase/oxygenase and apoprotein I
          Length = 4075

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1022 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 963

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 962  tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 922

---

>emb|X00630.1|CHHV02 Barley chloroplast genes rbcL and atpB
          Length = 2174

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2080 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 2021

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 2020 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1980

---

>gb|AY137462.1| Psathyrostachys stoloniformis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; chloroplast gene for chloroplast product
          Length = 1477

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1161 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1102

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1101 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1061

---

>gb|AY137461.1| Psathyrostachys fragilis subsp. villosus ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1589

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1294 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1235

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1234 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1194

---

>gb|AY137460.1| Psathyrostachys fragilis subsp. fragilis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1589

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1294 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1235

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1234 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1194

---

>gb|AY137459.1| Hordeum roshevitzii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1612

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137458.1| Hordeum cordobense ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137457.1| Hordeum patagonicum subsp. magellanicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1615

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137456.1| Hordeum vulgare subsp. vulgare ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1589

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137455.1| Hordeum bogdanii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1612

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137454.1| Hordeum bulbosum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1589

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137453.1| Hordeum vulgare subsp. spontaneum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1589

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137452.1| Hordeum pusillum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137451.1| Hordeum brachyantherum subsp. californicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1616

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137450.1| Hordeum intercedens ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1610

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137449.1| Hordeum chilense ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1616

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137448.1| Hordeum stenostachys ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137447.1| Hordeum patagonicum subsp. santacrucense ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1614

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137445.1| Hordeum patagonicum subsp. setifolium ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1614

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137444.1| Hordeum patagonicum subsp. patagonicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1614

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137443.1| Hordeum pubiflorum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137442.1| Hordeum euclaston ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1606

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137441.1| Hordeum comosum ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1589

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137440.1| Hordeum erectifolium ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137439.1| Hordeum flexuosum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137438.1| Hordeum muticum ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1621

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137437.1| Hordeum murinum subsp. glaucum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1628

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137436.1| Hordeum marinum subsp. marinum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1619

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137435.1| Hordeum brevisubulatum subsp. violaceum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1619

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137434.1| Hordeum marinum subsp. gussoneanum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1617

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137433.1| Hordeum marinum subsp. gussoneanum specimen-voucher H28
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137432.1| Hordeum marinum subsp. gussoneanum specimen-voucher H161
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137431.1| Hordeum marinum subsp. gussoneanum specimen-voucher H837
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137430.1| Hordeum marinum subsp. gussoneanum specimen-voucher H832
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137429.1| Hordeum marinum subsp. gussoneanum specimen-voucher H828
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137428.1| Hordeum marinum subsp. gussoneanum specimen-voucher H826
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137427.1| Hordeum marinum subsp. gussoneanum specimen-voucher H824
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137426.1| Hordeum marinum subsp. gussoneanum specimen-voucher H823
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137425.1| Hordeum marinum subsp. gussoneanum specimen-voucher H820
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137424.1| Hordeum marinum subsp. gussoneanum specimen-voucher H81
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137423.1| Hordeum marinum subsp. gussoneanum specimen-voucher H64
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137422.1| Hordeum marinum subsp. marinum specimen-voucher H620
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137421.1| Hordeum marinum subsp. marinum specimen-voucher H607
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137420.1| Hordeum marinum subsp. marinum specimen-voucher H544
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137419.1| Hordeum marinum subsp. marinum specimen-voucher H522
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137418.1| Hordeum marinum subsp. marinum specimen-voucher H87
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY137417.1| Hordeum marinum subsp. marinum specimen-voucher H41
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>emb|AJ746301.1| Poa trivialis chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1287

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1128 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1069

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1068 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1028

---

>emb|AJ746298.1| Phleum pratense chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1332

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1149 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1090

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1089 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1049

---

>emb|AJ746293.1| Lolium perenne subsp. perenne chloroplast partial rbcL gene for
            ribulose bisphosphate carboxylase large chain
          Length = 1296

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1144 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1085

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1084 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1044

---

>emb|AJ746292.1| Hordeum secalinum chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1299

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1147 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1088

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1087 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1047

---

>emb|AJ746290.1| Glyceria fluitans chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1309

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1129 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1070

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1069 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1029

---

>emb|AJ746287.1| Bromus commutatus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1344

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1165 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1106

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1105 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1065

---

>emb|AJ746286.1| Bromus erectus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1350

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1165 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1106

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1105 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1065

---

>gb|AY601671.1| Hordeum capense ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1619

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY607060.1| Psathyrostachys caduca voucher H6702 ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast
          Length = 1617

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1294 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1235

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1234 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1194

---

>gb|AY607059.1| Psathyrostachys rupestris subsp. rupestris voucher H6701
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1611

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1294 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1235

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1234 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1194

---

>gb|AY607057.1| Psathyrostachys huashanica voucher H3087 ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast
          Length = 1594

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1294 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1235

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1234 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1194

---

>gb|AY607056.1| Psathyrostachys fragilis subsp. villosus voucher H4378
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1589

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1294 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1235

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1234 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1194

---

>gb|AY607055.1| Psathyrostachys fragilis subsp. villosus voucher H4375
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1589

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1294 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1235

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1234 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1194

---

>gb|AY607053.1| Psathyrostachys lanuginosa isolate C voucher H8803
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1614

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1298 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1239

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1238 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1198

---

>gb|AY607052.1| Psathyrostachys lanuginosa isolate B voucher H8803
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1614

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1298 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1239

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1238 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1198

---

>gb|AY607051.1| Psathyrostachys lanuginosa isolate A voucher H8803
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1614

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1298 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1239

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1238 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1198

---

>gb|AY607050.1| Psathyrostachys juncea voucher H7544 ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast
          Length = 1614

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1298 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1239

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1238 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1198

---

>gb|AY622890.1| Diarrhena obovata ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit gene, partial cds; chloroplast
          Length = 1342

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1155 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1096

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1095 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|AY836185.1| Thinopyrum bessarabicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3054

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1152 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1093

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1092 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1052

---

>gb|AY836184.1| Taeniatherum caput-medusae ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3179

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836183.1| Aegilops speltoides ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; and rbcL-psaI
            intergenic spacer, partial sequence; chloroplast
          Length = 2360

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836182.1| Pseudoroegneria spicata ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3138

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836181.1| Secale strictum ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; rbcL-psaI intergenic
            spacer, complete sequence; and photosystem I subunit VIII
            (psaI) gene, partial cds; chloroplast
          Length = 3155

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836180.1| Psathyrostachys stoloniformis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2309

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1161 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1102

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1101 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1061

---

>gb|AY836179.1| Psathyrostachys fragilis subsp. villosus ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            psaI gene, partial sequence; chloroplast
          Length = 3071

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836178.1| Psathyrostachys fragilis subsp. fragilis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3089

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836177.1| Crithopsis delileana ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2752

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836176.1| Peridictyon sanctum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3106

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836175.1| Aegilops tauschii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2136

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836174.1| Thinopyrum elongatum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3158

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836173.1| Hordeum vulgare subsp. spontaneum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3110

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836172.1| Hordeum murinum subsp. glaucum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3095

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836171.1| Hordeum marinum subsp. gussoneanum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3108

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836170.1| Hordeum erectifolium ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3102

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836169.1| Hordeum brachyantherum subsp. californicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3089

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836167.1| Henrardia persica ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2372

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836166.1| Festucopsis serpentini ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3166

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836165.1| Eremopyrum triticeum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2366

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836164.1| Eremopyrum distans ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2374

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836163.1| Haynaldia villosa ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3190

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836162.1| Triticum monococcum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3192

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836161.1| Aegilops comosa ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; rbcL-psaI intergenic
            spacer, complete sequence; and photosystem I subunit VIII
            (psaI) gene, partial cds; chloroplast
          Length = 3171

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836160.1| Australopyrum velutinum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2268

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1154 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1095

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1054

---

>gb|AY836159.1| Australopyrum retrofractum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2373

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836158.1| Australopyrum pectinatum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2365

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836157.1| Amblyopyrum muticum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3183

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836156.1| Agropyron cristatum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2360

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836155.1| Bromus sterilis ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; rbcL-psaI intergenic
            spacer, complete sequence; and photosystem I subunit VIII
            (psaI) gene, partial cds; chloroplast
          Length = 3234

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|AY836154.1| Bromus arvensis ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; rbcL-psaI intergenic
            spacer, complete sequence; and photosystem I subunit VIII
            (psaI) gene, partial cds; chloroplast
          Length = 3215

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>dbj|AB042240.3| Triticum aestivum chloroplast DNA, complete genome
          Length = 134545

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                         
Query: 3     cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
             |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 56094 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 56035

                                                        
Query: 63    tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
             ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 56034 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 55994

---

>emb|Z49844.1|HBCHRBPCX H.brachyantherum chloroplast rbcL gene for ribulosebiphosphate
            carboxylase
          Length = 1224

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1185 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1126

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1125 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1085

---

>emb|Z49842.1|HLCHRBPCX H.lechleri chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1185 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1126

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1125 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1085

---

>dbj|D00206.1|WHTCPRBCL Triticum aestivum chloroplast gene for ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (H-type), complete
            cds
          Length = 1755

 Score =  165 bits (83), Expect = 3e-38
 Identities = 100/103 (97%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1280 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1221

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1220 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1180

---

>gb|AY607054.1| Psathyrostachys fragilis subsp. secaliformis voucher H4348
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1589

 Score =  161 bits (81), Expect = 5e-37
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            ||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1294 cccaaagrtttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1235

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1234 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1194

---

>gb|AY607058.1| Psathyrostachys rupestris subsp. daghestanica voucher H6703
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1471

 Score =  159 bits (80), Expect = 2e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1154 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1095

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||||  |||||||||||||||| |||||||||||||||||
Sbjct: 1094 tataaca-nctggcatggataccca-gtcctgagtgaaaaaga 1054

---

>gb|AY632370.1| Phaenosperma globosa ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1143

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1141 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagccaccgg 1082

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1081 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1041

---

>gb|AY632361.1| Brachypodium pinnatum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1277

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1132 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctactgg 1073

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1072 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1032

---

>gb|AY691646.1| Trisetum youngii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1173 cccaaagatttcagtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1114

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1113 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1073

---

>gb|AY691645.1| Koeleria aff. novozelandica AK28214 ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; chloroplast
          Length = 1347

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1173 cccaaagatttcagtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1114

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1113 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1073

---

>gb|AY691642.1| Elymus solanderi ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1173 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1114

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| ||| |||||||||||||
Sbjct: 1113 tataaca-cctggcatggataccca-gtcttgagtgaaaaaga 1073

---

>gb|AY691634.1| Hierochloe brunonis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1173 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctactgg 1114

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1113 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1073

---

>gb|AY691631.1| Amphibromus fluitans ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1173 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1114

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 1113 tataaca-cctggcagggataccca-gtcctgagtgaaaaaga 1073

---

>gb|AY395565.1| Trisetum flavescens ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1323

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1146 cccaaagatttcagtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1087

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1086 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1046

---

>gb|AY395536.1| Schedonorus pratensis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1165 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1106

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| |||||||||||||||||  ||||||||||||||||
Sbjct: 1105 tataaca-cctggcatggataccca-atcctgagtgaaaaaga 1065

---

>gb|AY395529.1| Arrhenatherum elatius ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit-like protein (rbcL) gene, partial sequence;
            chloroplast
          Length = 1259

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1124 cccaaagatttcagtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1065

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1064 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1024

---

>gb|AY395527.1| Agrostis capillaris ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1408

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1165 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctactgg 1106

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1105 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1065

---

>emb|AJ784835.1| Ammophila breviligulata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1346

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1166 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctactgg 1107

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1106 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1066

---

>emb|AJ784828.1| Hierochloe odorata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1358

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1167 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctactgg 1108

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1107 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1067

---

>emb|AJ784825.1| Koeleria pyramidata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1349

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1169 cccaaagatttcagtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1110

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1109 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1069

---

>emb|AJ784824.1| Phaenosperma globosa chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1357

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1172 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagccaccgg 1113

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1112 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1072

---

>emb|AJ784823.1| Arrhenatherum elatius chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1360

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1170 cccaaagatttcagtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1111

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1110 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1070

---

>emb|AJ746281.1| Alopecurus geniculatus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1329

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1149 cccaaagatttcagtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1090

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1089 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1049

---

>emb|AJ746276.1| Trisetum flavescens chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1323

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1146 cccaaagatttcagtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1087

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1086 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1046

---

>emb|AJ746262.1| Koeleria cristata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1370

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1185 cccaaagatttcagtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1126

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1125 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1085

---

>emb|AJ746258.1| Brachypodium sylvaticum chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1397

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1175 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctactgg 1116

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1115 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1075

---

>emb|AJ746172.1| Ampelodesmos mauritanica chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1362

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1185 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagccaccgg 1126

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1125 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1085

---

>gb|AY622886.1| Anisopogon avenaceus ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit gene, partial cds; chloroplast
          Length = 1344

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1155 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagccaccgg 1096

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1095 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|AY622885.1| Ampelodesmos mauritanica ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit gene, partial cds;
            chloroplast
          Length = 1330

 Score =  157 bits (79), Expect = 7e-36
 Identities = 99/103 (96%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1155 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagccaccgg 1096

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1095 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>emb|AJ746279.1| Holcus lanatus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1301

 Score =  155 bits (78), Expect = 3e-35
 Identities = 98/102 (96%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1153 ccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 1094

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| ||| |||||||||||||
Sbjct: 1093 ataaca-cctggcatggataccca-gtcttgagtgaaaaaga 1054

---

>gb|U88403.1|ASU88403 Amphipogon strictus ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  155 bits (78), Expect = 3e-35
 Identities = 98/102 (96%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||| ||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgggtgaaaaaga 1055

---

>gb|U31380.1|TMU31380 Thysanolaena maxima ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  155 bits (78), Expect = 3e-35
 Identities = 98/102 (96%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>emb|Z49836.1|BICHRBPCX B.inermis chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1434

 Score =  151 bits (76), Expect = 5e-34
 Identities = 98/103 (95%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 1185 cccaaagatttcggtcagagctggcatatgncaaacatgaataccacctgaagctaccgg 1126

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||| ||||||||||
Sbjct: 1125 tataaca-cctggcatggataccca-gtcctgtgtgaaaaaga 1085

---

>gb|AY632364.1| Glyceria grandis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1267

 Score =  149 bits (75), Expect = 2e-33
 Identities = 98/103 (95%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1122 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagccaccgg 1063

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| |||||||||||||||||  ||||||||||||||||
Sbjct: 1062 tataaca-cctggcatggataccca-atcctgagtgaaaaaga 1022

---

>gb|AY691643.1| Puccinellia stricta ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  149 bits (75), Expect = 2e-33
 Identities = 98/103 (95%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1173 cccaaagatttctgtcagagccggcatatgccaaacatgaataccacctgaagctaccgg 1114

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1113 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1073

---

>gb|AY691630.1| Agrostis magellanica ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  149 bits (75), Expect = 2e-33
 Identities = 98/103 (95%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1173 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctactgg 1114

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 1113 tataaca-cctggcagggataccca-gtcctgagtgaaaaaga 1073

---

>emb|AJ784820.1| Calamagrostis epigejos chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1350

 Score =  149 bits (75), Expect = 2e-33
 Identities = 98/103 (95%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1166 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctactgg 1107

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 1106 tataaca-cctggcagggataccca-gtcctgagtgaaaaaga 1066

---

>emb|AJ746294.1| Melica uniflora chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1295

 Score =  149 bits (75), Expect = 2e-33
 Identities = 98/103 (95%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1143 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagccaccgg 1084

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| || |||||||||||||| |||||||||||||||||
Sbjct: 1083 tataaca-ccaggcatggataccca-gtcctgagtgaaaaaga 1043

---

>emb|AJ746285.1| Briza media chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1332

 Score =  149 bits (75), Expect = 2e-33
 Identities = 98/103 (95%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| | |||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1165 cccaaagatttcagtcagagctggcatatgccaaacatgaataccacctgaagctactgg 1106

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1105 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1065

---

>emb|AJ746282.1| Anthoxanthum odoratum chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1408

 Score =  149 bits (75), Expect = 2e-33
 Identities = 98/103 (95%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1165 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctactgg 1106

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 1105 tataaca-cctggcagggataccca-gtcctgagtgaaaaaga 1065

---

>emb|AJ746257.1| Avena fatua chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1428

 Score =  149 bits (75), Expect = 2e-33
 Identities = 98/103 (95%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1185 cccaaagatttcagtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1126

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||| ||||||||||
Sbjct: 1125 tataaca-cctggcatggataccca-gtcctgggtgaaaaaga 1085

---

>emb|AJ746256.1| Anthoxanthum odoratum chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1428

 Score =  149 bits (75), Expect = 2e-33
 Identities = 98/103 (95%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1185 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctactgg 1126

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 1125 tataaca-cctggcagggataccca-gtcctgagtgaaaaaga 1085

---

>gb|AY836168.1| Heteranthelium piliferum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2371

 Score =  149 bits (75), Expect = 2e-33
 Identities = 98/103 (95%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| | |||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 cccaaagatttcagtcaaagctggcatatgccaaacatgaataccacctgaagctaccgg 1174

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1173 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1133

---

>gb|L15300.1|ASTCPRBCL Avena sativa ribulosbisphosphate dehydrogenase (rbcL) gene, complete
            cds
          Length = 1623

 Score =  149 bits (75), Expect = 2e-33
 Identities = 98/103 (95%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1283 cccaaagatttcagtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1224

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||| ||||||||||
Sbjct: 1223 tataaca-cctggcatggataccca-gtcctgggtgaaaaaga 1183

---

>gb|L14621.1|PUZRBCL Puccinellia distans chloroplast ribulose 1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds
          Length = 1484

 Score =  149 bits (75), Expect = 2e-33
 Identities = 98/103 (95%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1185 cccaaagatttctgtcagagccggcatatgccaaacatgaataccacctgaagctaccgg 1126

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1125 tataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1085

---

>gb|AY632374.1| Zeugites pittieri ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1175

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaatacctcctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|AY632368.1| Panicum virgatum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1201

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|AY632367.1| Molinia caerulea ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1267

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1121 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1062

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1061 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1022

---

>ref|NM_195989.1| Oryza sativa (japonica cultivar-group) putative rbcL; RuBisCO large
            subunit from chromosome 10 chloroplast insertion
            (OSJNBb0075K12.39), mRNA
          Length = 1434

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1184 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1125

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1124 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1085

---

>gb|AY691637.1| Imperata cheesemanii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1172 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1113

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1112 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1073

---

>gb|AY522330.1| Oryza sativa (japonica cultivar-group) cultivar Nipponbare chloroplast,
             complete genome
          Length = 134551

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                         
Query: 4     ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
             ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 55286 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 55227

                                                       
Query: 64    ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
             |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 55226 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 55187

---

>gb|AY522331.1| Oryza sativa (japonica cultivar-group) isolate PA64S chloroplast,
             complete genome
          Length = 134551

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                         
Query: 4     ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
             ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 55286 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 55227

                                                       
Query: 64    ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
             |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 55226 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 55187

---

>gb|AY522329.1| Oryza sativa (indica cultivar-group) isolate 93-11 chloroplast,
             complete genome
          Length = 134496

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                         
Query: 4     ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
             ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 55234 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 55175

                                                       
Query: 64    ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
             |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 55174 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 55135

---

>gb|AY395535.1| Dactylis glomerata ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1349

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1164 ccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 1105

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||| ||| ||||| |||||||||||||||||
Sbjct: 1104 ataaca-cctggcaaggaaaccca-gtcctgagtgaaaaaga 1065

---

>emb|AJ784834.1| Lamarckia aurea chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1328

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1168 ccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 1109

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||| ||| ||||| |||||||||||||||||
Sbjct: 1108 ataaca-cctggcaaggaaaccca-gtcctgagtgaaaaaga 1069

---

>emb|AJ784833.1| Spodiopogon sibiricus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1359

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1169 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1110

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1109 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1070

---

>emb|AJ784831.1| Dactylis marina chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1353

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1182 ccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 1123

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||| ||| ||||| |||||||||||||||||
Sbjct: 1122 ataaca-cctggcaaggaaaccca-gtcctgagtgaaaaaga 1083

---

>emb|AJ784826.1| Imperata cylindrica chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1356

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1166 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1107

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1106 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1067

---

>emb|AJ784818.1| Andropogon gerardii chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1338

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1166 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1107

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1106 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1067

---

>gb|DQ167399.1| Oryza sativa (indica cultivar-group) isolate 93-11 mitochondrion,
              complete genome
          Length = 491515

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                          
Query: 4      ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
              ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 125575 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 125516

                                                        
Query: 64     ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
              |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 125515 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 125476



 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                         
Query: 4     ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
             ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 30515 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 30456

                                                       
Query: 64    ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
             |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 30455 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 30416

---

>gb|DQ167807.1| Oryza sativa (japonica cultivar-group) isolate PA64S mitochondrion,
              complete genome
          Length = 490673

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                          
Query: 4      ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
              ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 124602 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 124543

                                                        
Query: 64     ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
              |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 124542 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 124503



 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                         
Query: 4     ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
             ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 30021 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 29962

                                                       
Query: 64    ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
             |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 29961 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 29922

---

>gb|DQ167400.1| Oryza sativa (japonica cultivar-group) cultivar Nipponbare mitochondrion,
              complete genome
          Length = 490669

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                          
Query: 4      ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
              ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 124602 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 124543

                                                        
Query: 64     ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
              |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 124542 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 124503



 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                         
Query: 4     ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
             ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 30021 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 29962

                                                       
Query: 64    ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
             |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 29961 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 29922

---

>emb|X55828.1|CHNMRBCL Neurachne munroi chloroplast rbcL gene for the rubisco large subunit
            (EC 4.1.1.39)
          Length = 1990

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1601 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1542

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1541 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1502

---

>emb|X55827.1|CHNTRBCL Neurachne tenuifolia chloroplast rbcL gene for the rubisco large
            subunit (EC 4.1.1.39)
          Length = 2010

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1621 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1562

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1561 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1522

---

>emb|X15901.1|CHOSXX Oryza sativa (japonica cultivar-group) chloroplast genome
          Length = 134525

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                         
Query: 4     ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
             ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 55278 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 55219

                                                       
Query: 64    ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
             |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 55218 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 55179

---

>emb|AJ746299.1| Phragmites australis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1341

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1164 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1105

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1104 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1065

---

>emb|AJ746297.1| Oryza sativa chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1428

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1184 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1125

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1124 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1085

---

>emb|AJ746295.1| Molinia caerulea chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1309

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1164 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1105

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1104 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1065

---

>emb|AJ746291.1| Guaduella marantifolia chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1239

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1049 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 990

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 989  ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 950

---

>emb|AJ746289.1| Elytrophorus globularis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1344

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>emb|AJ746284.1| Arundo donax chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1344

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>emb|AJ746275.1| Raddia brasiliensis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1428

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1184 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1125

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1124 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1085

---

>emb|AJ746271.1| Otatea acuminata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1409

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1167 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1108

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1107 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1068

---

>emb|AJ746269.1| Olmeca recta chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1385

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1169 ccaaagatttcggtcagagctggcatatgccaaacatgaataccgcctgaagccaccggt 1110

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1109 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1070

---

>emb|AJ746268.1| Dactylis glomerata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1388

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1144 ccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 1085

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||| ||| ||||| |||||||||||||||||
Sbjct: 1084 ataaca-cctggcaaggaaaccca-gtcctgagtgaaaaaga 1045

---

>emb|AJ746264.1| Digitaria sanguinalis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1343

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 1099 ccaaagatttcggtcagagctggcatatgccaaacatgaatacccccagaagctaccggt 1040

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1039 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1000

---

>emb|AJ746171.1| Bambusa valida chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1339

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1167 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1108

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1107 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1068

---

>gb|U29900.1| Phragmites australis ribulose-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|AC122148.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
             OSJNAb0075K12, complete sequence
          Length = 125936

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                         
Query: 4     ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
             ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 53488 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 53429

                                                       
Query: 64    ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
             |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 53428 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 53389

---

>gb|AE009947.2| Saccharum hybrid cultivar SP-80-3280 chloroplast, complete genome
          Length = 141182

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                          
Query: 4      ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
              ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 120265 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 120206

                                                        
Query: 64     ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
              |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 120205 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 120166

---

>gb|AF164778.1| Guaduella marantifolia ribulose 1,5 bisphosphate carboxylase (rbcL)
            gene, partial cds; chloroplast gene for chloroplast
            product
          Length = 1239

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1049 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 990

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 989  ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 950

---

>gb|AC092750.2| Oryza sativa (japonica cultivar-group) cultivar Nipponbare from
              chromosome 10, complete sequence
          Length = 134933

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                          
Query: 4      ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
              ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 128421 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 128362

                                                        
Query: 64     ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
              |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 128361 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 128322

---

>gb|U88405.1|EGU88405 Elytrophorus globularis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene,
            chloroplast gene encoding chloroplast protein, partial
            cds
          Length = 1344

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|U31360.1|ADU31360 Arundo donax ribulose-1,5-bisphosphate carboxylase large subunit
            (rbcL) gene, partial cds; chloroplast gene for
            chloroplast product
          Length = 1344

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|U13229.1|PAU13229 Phragmites australis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast gene
            for chloroplast product
          Length = 1320

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|U13226.1|ADU13226 Arundo donax ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast gene for
            chloroplast product
          Length = 1398

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                           
Query: 4       ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
               ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 5614326 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 5614267

                                                         
Query: 64      ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
               |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 5614266 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 5614227



 Score = 60.0 bits (30), Expect = 1e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                              
Query: 17       tcagagctggcatatgccaaacatgaatac 46
                ||||||||||||||||||||||||||||||
Sbjct: 26145122 tcagagctggcatatgccaaacatgaatac 26145093



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 32/33 (96%), Gaps = 1/33 (3%)
 Strand = Plus / Minus

                                                 
Query: 73       tggcatggatacccaggtcctgagtgaaaaaga 105
                |||||||||||||||| ||||||||||||||||
Sbjct: 13437103 tggcatggatacccag-tcctgagtgaaaaaga 13437072



 Score = 44.1 bits (22), Expect = 0.076
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 15       ggtcagagctggcatatgccaa 36
                ||||||||||||||||||||||
Sbjct: 26138934 ggtcagagctggcatatgccaa 26138913

---

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                            
Query: 4        ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
                ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 10347096 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 10347037

                                                          
Query: 64       ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
                |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 10347036 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 10346997

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Plus

                                                                            
Query: 4        ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
                ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 23203809 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 23203868

                                                          
Query: 64       ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
                |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 23203869 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 23203908

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Plus

                                                                            
Query: 4        ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
                ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 33527386 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 33527445

                                                          
Query: 64       ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
                |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 33527446 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 33527485

---

>gb|AY601672.1| Hordeum secalinum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast
          Length = 1619

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/103 (94%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1295 cccaaagatttcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 1236

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| |   ||||||||||||| |||||||||||||||||
Sbjct: 1235 tataaca-cnnngcatggataccca-gtcctgagtgaaaaaga 1195

---

>gb|AY618663.1| Streptogyna americana ribulose 1,5-bisphosphate carboxylase large
            subunit gene, partial cds; chloroplast
          Length = 1304

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|AY618662.1| Isachne arundinacea ribulose 1,5-bisphosphate carboxylase large
            subunit gene, partial cds; chloroplast
          Length = 1285

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1135 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1076

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1075 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1036

---

>gb|AY618661.1| Danthoniopsis petiolata ribulose 1,5-bisphosphate carboxylase large
            subunit gene, partial cds; chloroplast
          Length = 1305

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|AY622897.1| Olyra latifolia ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit gene, partial cds; chloroplast
          Length = 1344

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|U13228.1|LOU13228 Leersia oryzoides chloroplast ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds
          Length = 1320

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>dbj|AP003280.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0557A01
          Length = 147201

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Plus

                                                                         
Query: 4     ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
             ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 72583 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 72642

                                                       
Query: 64    ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
             |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 72643 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 72682

---

>dbj|AP004236.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0417D05
          Length = 165752

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Plus

                                                                          
Query: 4      ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
              ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 154457 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 154516

                                                        
Query: 64     ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
              |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 154517 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 154556

---

>dbj|AP003623.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0642B07
          Length = 139297

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Plus

                                                                         
Query: 4     ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
             ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 38571 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 38630

                                                       
Query: 64    ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
             |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 38631 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 38670

---

>dbj|AK105600.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-200-A05, full
            insert sequence
          Length = 2485

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1239 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1180

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1179 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1140

---

>dbj|AK062203.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-G09, full
           insert sequence
          Length = 838

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                       
Query: 4   ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
           ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 244 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 185

                                                     
Query: 64  ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
           |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 184 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 145

---

>dbj|AK058623.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-018-B12, full
           insert sequence
          Length = 1243

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                       
Query: 4   ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
           ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 982 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 923

                                                     
Query: 64  ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
           |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 922 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 883

---

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                            
Query: 4        ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
                ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 10353135 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 10353076

                                                          
Query: 64       ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
                |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 10353075 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 10353036

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                           
Query: 4       ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
               ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 5614315 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 5614256

                                                         
Query: 64      ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
               |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 5614255 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 5614216



 Score = 60.0 bits (30), Expect = 1e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                              
Query: 17       tcagagctggcatatgccaaacatgaatac 46
                ||||||||||||||||||||||||||||||
Sbjct: 26073298 tcagagctggcatatgccaaacatgaatac 26073269



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 32/33 (96%), Gaps = 1/33 (3%)
 Strand = Plus / Minus

                                                 
Query: 73       tggcatggatacccaggtcctgagtgaaaaaga 105
                |||||||||||||||| ||||||||||||||||
Sbjct: 13391377 tggcatggatacccag-tcctgagtgaaaaaga 13391346



 Score = 44.1 bits (22), Expect = 0.076
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 15       ggtcagagctggcatatgccaa 36
                ||||||||||||||||||||||
Sbjct: 26067110 ggtcagagctggcatatgccaa 26067089

---

>emb|BX000560.1|CNS08CE6 Oryza sativa chromosome 12, . BAC OSJNBa0021D06 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 139684

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Plus

                                                                         
Query: 4     ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
             ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 38559 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 38618

                                                       
Query: 64    ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
             |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 38619 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 38658

---

>dbj|AP006714.1| Saccharum officinarum chloroplast DNA, complete genome
          Length = 141182

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                         
Query: 4     ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
             ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 58638 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 58579

                                                       
Query: 64    ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
             |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 58578 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 58539

---

>dbj|AP006728.1| Oryza nivara chloroplast DNA, complete genome
          Length = 134494

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                         
Query: 4     ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
             ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 55213 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 55154

                                                       
Query: 64    ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
             |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 55153 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 55114

---

>gb|U88406.1|SGU88406 Styppeiochloa gynoglossa ribulose-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|M91626.1|BAMCPRBCL Bamboo chloroplast ribulosebisphosphate (rbcL) gene, partial cds
          Length = 1324

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1153 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1094

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1093 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1054

---

>gb|U31381.1|TBU31381 Tristachya biseriata ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|U31442.1|SDU31442 Stipa dregeana var. dregeana ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene,
            chloroplast gene encoding chloroplast protein, partial
            cds
          Length = 1344

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|U31438.1|MMU31438 Merxmuellera macowanii ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene,
            chloroplast gene encoding chloroplast protein, partial
            cds
          Length = 1344

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|U31439.1|MJU31439 Moliniopsis japonica ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|U31105.1|GSU31105 Gynerium sagittatum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|U31101.1|CLU31101 Chasmanthium latifolium ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene,
            chloroplast gene encoding chloroplast protein, partial
            cds
          Length = 1344

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|U31100.1|CGU31100 Centropodia glauca ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>emb|X04789.1|CHOSRBCL Rice chloroplast DNA for ribulose-1,5-biphosphate carboxylase (clone
            pCT-1)
          Length = 1989

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1571 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1512

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1511 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1472

---

>gb|U13231.1|LHU13231 Lithachne humilis chloroplast ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds
          Length = 1320

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|L14623.1|PENCARBOXL Pennisetum glaucum ribulosebiphosphate carboxylase (rbcL) gene,
            complete cds
          Length = 1430

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1184 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1125

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1124 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1085

---

>gb|L14622.1|CEHRBCL Cenchrus setigerus chloroplast ribulose 1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds
          Length = 1510

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1184 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1125

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1124 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1085

---

>dbj|D00207.1|RICCPRBCL Oryza sativa chloroplast gene for ribulose 1,5-bisphosphate
            carboxylase large subunit, complete cds
          Length = 2062

 Score =  147 bits (74), Expect = 7e-33
 Identities = 97/102 (95%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1604 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1545

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1544 ataaca-cctggcatggataccca-gtcctgagtgaaaaaga 1505

---

>gb|AY632362.1| Buergersiochloa bambusoides ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; plastid
          Length = 1171

 Score =  143 bits (72), Expect = 1e-31
 Identities = 95/100 (95%), Gaps = 2/100 (2%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1154 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1095

                                                    
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaa 103
            |||||| ||||||||||||||||| |||||||||||||||
Sbjct: 1094 ataaca-cctggcatggataccca-gtcctgagtgaaaaa 1057

---

>gb|AY618660.1| Arundinaria gigantea ribulose 1,5-bisphosphate carboxylase large
            subunit gene, partial cds; chloroplast
          Length = 1286

 Score =  143 bits (72), Expect = 1e-31
 Identities = 96/102 (94%), Gaps = 2/102 (1%)
 Strand = Plus / Minus

                                                                        
Query: 4    ccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggt 63
            ||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 1135 ccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggt 1076

                                                      
Query: 64   ataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            |||||| |||||||| |||||||| |||||||||||||||||
Sbjct: 1075 ataaca-cctggcatrgataccca-gtcctgagtgaaaaaga 1036

---

>gb|L05043.2|ZIZCPRBCL Zizania texana ribulose 1,5-bisphosphate carboxylase large subunit
            (rbcL) gene, partial cds; chloroplast gene for
            chloroplast product
          Length = 1325

 Score =  143 bits (72), Expect = 1e-31
 Identities = 97/103 (94%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||||||||||||||||||||||||||||||||| |||||||| |||||
Sbjct: 1155 cccaaagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccgg 1096

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| || |||||||||||||| |||||||||||||||||
Sbjct: 1095 tataacaccc-ggcatggataccca-gtcctgagtgaaaaaga 1055

---

>gb|AY632365.1| Melica cupanii ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; plastid
          Length = 1267

 Score =  141 bits (71), Expect = 4e-31
 Identities = 97/103 (94%), Gaps = 2/103 (1%)
 Strand = Plus / Minus

                                                                        
Query: 3    cccaaagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccgg 62
            |||||||||| |||| |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1122 cccaaagatttcggtaagagctggcatatgccaaacatgaataccacctgaagccaccgg 1063

                                                       
Query: 63   tataacancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||||||| || |||||||||||||| |||||||||||||||||
Sbjct: 1062 tataaca-ccaggcatggataccca-gtcctgagtgaaaaaga 1022

---

>gb|AY691644.1| Zotovia thomsonii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  141 bits (71), Expect = 4e-31
 Identities = 94/99 (94%), Gaps = 2/99 (2%)
 Strand = Plus / Minus

                                                                        
Query: 7    aagattgcggtcagagctggcatatgccaaacatgaataccacctgaagctaccggtata 66
            |||||| |||||||||||||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 1169 aagatttcggtcagagctggcatatgccaaacatgaataccccctgaagccaccggtata 1110

                                                   
Query: 67   acancctggcatggatacccaggtcctgagtgaaaaaga 105
            ||| ||||||||||||||||| |||||||||||||||||
Sbjct: 1109 aca-cctggcatggataccca-gtcctgagtgaaaaaga 1073


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 772,752
Number of Sequences: 3902068
Number of extensions: 772752
Number of successful extensions: 50616
Number of sequences better than 10.0: 12693
Number of HSP's better than 10.0 without gapping: 12657
Number of HSP's successfully gapped in prelim test: 40
Number of HSP's that attempted gapping in prelim test: 36338
Number of HSP's gapped (non-prelim): 13244
length of query: 105
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 84
effective length of database: 17,151,101,840
effective search space: 1440692554560
effective search space used: 1440692554560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)

---