ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd13e02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY110158.1| Zea mays CL11825_1 mRNA sequence 70 1e-08
2emb|AL662952.6|OSJN00151 Oryza sativa genomic DNA, chromosome 4,... 62 3e-06
3dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 62 3e-06
4dbj|AK073937.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 3e-06
5dbj|AK059702.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 3e-06
6ref|NM_001016186.2| Xenopus tropicalis hypothetical protein LOC5... 56 2e-04
7emb|CR761821.2| Xenopus tropicalis finished cDNA, clone TGas045b14 56 2e-04
8gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 46 0.15
9ref|XM_387202.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 46 0.15
10ref|XM_815553.1| Trypanosoma cruzi strain CL Brener mucin-associ... 46 0.15
11gb|AC137992.2| Oryza sativa chromosome 3 BAC OSJNBb0056B16 genom... 46 0.15
12dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.15
13emb|CT573074.1| Kuenenia stuttgartiensis genome fragment KUST_B ... 46 0.15
14gb|AY591612.1| Mus musculus clone IgK19-13 immunoglobulin kappa-... 44 0.61
15gb|AC118681.6| Mus musculus chromosome 16, clone RP23-473M11, co... 44 0.61
16gb|AC153928.5| Mus musculus 6 BAC RP23-66O20 (Roswell Park Cance... 44 0.61
17gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome 44 0.61
18gb|AC156284.8| Mus musculus 6 BAC RP24-392D13 (Roswell Park Canc... 44 0.61
19gb|AC153855.4| Mus musculus 6 BAC RP23-175B24 (Roswell Park Canc... 44 0.61
20gb|AC110821.5| Mus musculus BAC clone RP23-418H19 from chromosom... 44 0.61
21gb|AC116501.7| Mus musculus chromosome 5, clone RP24-300D7, comp... 42 2.4
22gb|AC140921.2| Mus musculus BAC clone RP24-472I23 from chromosom... 42 2.4
23gb|AC117547.19| Mus musculus chromosome 1, clone RP23-221M20, co... 42 2.4
24gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, comple... 42 2.4
25gb|AC113483.7| Mus musculus chromosome 1, clone RP23-343E12, com... 42 2.4
26ref|XM_809956.1| Trypanosoma cruzi strain CL Brener phosphatidyl... 42 2.4
27ref|XM_814533.1| Trypanosoma cruzi strain CL Brener phosphatidyl... 42 2.4
28emb|BX957325.16| Zebrafish DNA sequence from clone CH211-117O2 i... 42 2.4
29emb|AL512635.8| Human DNA sequence from clone RP11-15P13 on chro... 42 2.4
30emb|AL390719.47| Human DNA sequence from clone RP11-465B22 on ch... 42 2.4
31emb|AL359983.7| Human DNA sequence from clone RP11-139L21 on chr... 42 2.4
32emb|AL158035.14| Human DNA sequence from clone RP1-97J1 on chrom... 42 2.4
33gb|AC130388.6| Drosophila melanogaster X BAC CH221-14P20 (Childr... 42 2.4
34emb|CR381635.11| Zebrafish DNA sequence from clone DKEY-171C9 in... 42 2.4
35dbj|AK125828.1| Homo sapiens cDNA FLJ43840 fis, clone TESTI4006112 42 2.4
36gb|AC096677.2| Homo sapiens chromosome 1 clone RP11-134G8, compl... 42 2.4
37gb|AC093153.2| Homo sapiens chromosome 1 clone RP11-477C23, comp... 42 2.4
38gb|AC162174.4| Mus musculus chromosome 1, clone RP23-306P24, com... 42 2.4
39gb|AC135206.3| Oryza sativa (japonica cultivar-group) chromosome... 42 2.4
40gb|AC152832.3| Ornithorhynchus anatinus BAC clone OABb-104A1 fro... 42 2.4
41dbj|AK104530.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.4
42dbj|AK099322.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.4
43dbj|AK099159.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.4
44dbj|AK061109.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.4
45gb|AE003429.4| Drosophila melanogaster chromosome X, section 13 ... 42 2.4
46emb|AL935053.6| Zebrafish DNA sequence from clone CH211-162M14, ... 42 2.4
47gb|AC123673.7| Mus musculus chromosome 1, clone RP23-258D13, com... 40 9.5
48gb|BC108439.1| Xenopus laevis cDNA clone MGC:130663 IMAGE:776867... 40 9.5
49ref|NM_128678.3| Arabidopsis thaliana DNA binding / transcriptio... 40 9.5
50gb|AC159998.6| Mus musculus BAC clone RP24-576J22 from chromosom... 40 9.5
51gb|AC118688.10| Mus musculus chromosome 5, clone RP23-302F24, co... 40 9.5
52ref|XM_469979.1| Oryza sativa (japonica cultivar-group), mRNA 40 9.5
53gb|AC007579.5| Drosophila melanogaster clone BACR07M03, complete... 40 9.5
54ref|XM_424497.1| PREDICTED: Gallus gallus similar to hypothetica... 40 9.5
55gb|AC120553.9| Mus musculus chromosome 15, clone RP24-338L24, co... 40 9.5
56gb|AY750704.1| Tetranychus hydrangeae internal transcribed space... 40 9.5
57gb|AC134458.2| Mus musculus BAC clone RP23-358B17 from chromosom... 40 9.5
58gb|AF313041.4| Homo sapiens chromosome 8 clone RP11-158K1 map q2... 40 9.5
59gb|AC113056.26| Mus musculus chromosome 1, clone RP23-252F11, co... 40 9.5
60gb|AC125152.5| Mus musculus BAC clone RP24-366J2 from chromosome... 40 9.5
61gb|AC124603.5| Mus musculus BAC clone RP23-52H14 from chromosome... 40 9.5
62ref|XM_800780.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 9.5
63ref|XM_760485.1| Theileria parva strain Muguga chromosome 1 hypo... 40 9.5
64gb|AC004887.2| Homo sapiens PAC clone RP4-789I5 from 7, complete... 40 9.5
65gb|AC123714.6| Mus musculus chromosome 9, clone RP23-393E20, com... 40 9.5
66gb|AC157984.17| Medicago truncatula clone mth2-142a1, complete s... 40 9.5
67gb|AC106461.6| Rattus norvegicus 1 BAC CH230-208N10 (Children's ... 40 9.5
68emb|Z46894.1|DMFKBP39 D.melanogaster mRNA for FKBP39 40 9.5
69emb|X70876.1|HVMYB2 H.vulgare myb2 mRNA 40 9.5
70gb|AC159819.2| Mus musculus BAC clone RP23-180C14 from chromosom... 40 9.5
71emb|AL731611.2|OSJN00253 Oryza sativa genomic DNA, chromosome 4,... 40 9.5
72emb|AL645966.30| Mouse DNA sequence from clone DN-144H19 on chro... 40 9.5
73emb|AL606998.3|OSJN00125 Oryza sativa genomic DNA, chromosome 4,... 40 9.5
74gb|BT008608.1| Arabidopsis thaliana clone U50165 putative bHLH p... 40 9.5
75emb|CR450720.5| Zebrafish DNA sequence from clone DKEYP-51F11 in... 40 9.5
76gb|AC090198.7| Homo sapiens chromosome 8, clone RP11-158K1, comp... 40 9.5
77gb|AC015813.12| Homo sapiens, clone RP11-159D12, complete sequence 40 9.5
78emb|BX511018.18| Zebrafish DNA sequence from clone DKEY-241H1 in... 40 9.5
79emb|BX649331.16| Zebrafish DNA sequence from clone DKEY-12N3 in ... 40 9.5
80emb|AL928657.21| Zebrafish DNA sequence from clone CH211-194I10 ... 40 9.5
81gb|AC112250.4| Homo sapiens BAC clone RP11-710E1 from 4, complet... 40 9.5
82ref|NM_206123.1| Drosophila melanogaster CG33464-PA (CG33464) mR... 40 9.5
83gb|AC093270.3| Homo sapiens chromosome 5 clone RP11-342F17, comp... 40 9.5
84gb|AC006593.5| Arabidopsis thaliana chromosome 2 clone F16D14 ma... 40 9.5
85gb|AY094814.1| Drosophila melanogaster LD30817 full insert cDNA 40 9.5
86ref|NM_079640.2| Drosophila melanogaster FK506-binding protein 1... 40 9.5
87gb|AE010227.1| Pyrococcus furiosus DSM 3638, section 102 of 173 ... 40 9.5
88gb|AF251695.1|AF251695 Arabidopsis thaliana putative transcripti... 40 9.5
89gb|AC099024.1| Drosophila melanogaster, chromosome 2R, region 52... 40 9.5
90gb|AC121357.14| Mus musculus chromosome 15, clone RP23-56D7, com... 40 9.5
91dbj|AK088542.1| Mus musculus 2 days neonate thymus thymic cells ... 40 9.5
92gb|AC007648.6|AC007648 Drosophila melanogaster, chromosome 3R, r... 40 9.5
93gb|AC090416.1|AC090416 Caenorhabditis briggsae cosmid CB042D07, ... 40 9.5
94gb|AC110801.3| Homo sapiens BAC clone RP11-711M9 from 2, complet... 40 9.5
95gb|AY625483.1| Aspergillus niger manganese superoxide dismutase ... 40 9.5
96gb|AC108906.9| Oryza sativa chromosome 3 BAC OSJNBa0087C10 genom... 40 9.5
97gb|AC160516.1| Medicago truncatula chromosome 7 BAC clone mth2-6... 40 9.5
98gb|AC005297.1| Homo sapiens X BAC GS1-466O4 (Roswell Park Cancer... 40 9.5
99gb|AF190074.1|AF190074 Canella winterana phytochrome A (PHYA) ge... 40 9.5
100gb|BT005711.1| Arabidopsis thaliana clone RAFL15-38-K03 (R50165)... 40 9.5
101gb|AC084658.1|CBRG46L07 Caenorhabditis briggsae cosmid G46L07, c... 40 9.5
102gb|AC084613.1|CBRG44E08 Caenorhabditis briggsae cosmid G44E08, c... 40 9.5
103gb|AC004757.2| Homo sapiens chromosome 17, clone CTB-117K16, com... 40 9.5
104gb|AC079833.4| Homo sapiens BAC clone CTD-2170K17 from 2, comple... 40 9.5
105emb|BX294661.14| Zebrafish DNA sequence from clone CH211-199I18 ... 40 9.5
106emb|AJ000478.1|HTCYP81L Helianthus tuberosus mRNA for cytochrome... 40 9.5
107gb|AY111165.1| Zea mays CL24291_1 mRNA sequence 40 9.5
108gb|AC135251.2| Homo sapiens 12 BAC RP11-167E10 (Roswell Park Can... 40 9.5
109emb|AL627350.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 40 9.5
110emb|Z36108.1|SCYBR239C S.cerevisiae chromosome II reading frame ... 40 9.5
111emb|Z36107.1|SCYBR238C S.cerevisiae chromosome II reading frame ... 40 9.5
112gb|AE003708.3| Drosophila melanogaster chromosome 3R, section 46... 40 9.5
113gb|AE003809.3| Drosophila melanogaster chromosome 2R, section 41... 40 9.5
114emb|CT010518.7| M.truncatula DNA sequence from clone MTH2-78A9 o... 40 9.5
115gb|BC087500.1| Xenopus laevis hypothetical LOC496082, mRNA (cDNA... 40 9.5
116gb|AC005962.1|AC005962 Homo sapiens chromosome 17, clone hRPK.50... 40 9.5
117emb|CT573501.1| Medicago truncatula chromosome 5 clone mth2-60o2... 40 9.5
118gb|AC005556.1|AC005556 Drosophila melanogaster DNA sequence (P1s... 40 9.5
119emb|CT476826.2| Pan troglodytes chromosome X BAC RP43-034A07, co... 40 9.5
120gb|AC147720.1| Gallus gallus BAC clone CH261-46I14 from chromoso... 40 9.5
121gb|AC141892.4| Mus musculus BAC clone RP23-388J12 from 13, compl... 40 9.5
122emb|AJ812006.1| Aspergillus niger sodB gene for putative mangane... 40 9.5
123emb|AL929001.7| Mouse DNA sequence from clone RP23-324H1 on chro... 40 9.5
124gb|AC155902.1| Loxodonta africana, clone Loxodonta africana-6767... 40 9.5
125gb|AC171726.1| Lycopersicon esculentum chromosome 01 clone C01HB... 40 9.5
126emb|AL662823.12| Mouse DNA sequence from clone RP23-243E17 on ch... 40 9.5
127emb|AL591763.14| Mouse DNA sequence from clone RP23-480D17 on ch... 40 9.5

>gb|AY110158.1| Zea mays CL11825_1 mRNA sequence
          Length = 692

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                       
Query: 608 atcttctctgaagcagctgattcctttgcctgcaagtcctcattctcctcttgtatgttc 667
           |||||||| |||||||| ||| |||||||||||| ||| |||||||||| || |||||||
Sbjct: 619 atcttctcagaagcagccgatacctttgcctgcaggtcgtcattctcctgttttatgttc 678

              
Query: 668 tgc 670
           |||
Sbjct: 679 tgc 681



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 68/83 (81%)
 Strand = Plus / Plus

                                                                       
Query: 440 tcgttctccttctccttggacgaatcgtagtctgtgaccttgctgttctcccacatcttg 499
           |||||||||||  |||| || ||||||||||| |  |  |||||||||||||| |  |||
Sbjct: 439 tcgttctccttaaccttagatgaatcgtagtcagcaaagttgctgttctcccatactttg 498

                                  
Query: 500 gcgaccaccacaactggttcgtc 522
           || || |||||||| ||||||||
Sbjct: 499 gcaactaccacaacaggttcgtc 521



to top

>emb|AL662952.6|OSJN00151 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0009P12,
             complete sequence
          Length = 179644

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 79/95 (83%)
 Strand = Plus / Minus

                                                                         
Query: 595   ggagagcttctttatcttctctgaagcagctgattcctttgcctgcaagtcctcattctc 654
             |||||||| |||||||||||| |||||| |   ||||||||| ||||| || || |||||
Sbjct: 77449 ggagagctcctttatcttctcagaagcaacaagttcctttgcttgcaaatcatcgttctc 77390

                                                
Query: 655   ctcttgtatgttctgcaattcgttctctttgtcta 689
              | || |||||||||||| || || ||||||||||
Sbjct: 77389 ttgttttatgttctgcaactcattttctttgtcta 77355



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 476   accttgctgttctcccacatctt 498
             |||||||||||||||||||||||
Sbjct: 77574 accttgctgttctcccacatctt 77552



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 79/95 (83%)
 Strand = Plus / Minus

                                                                            
Query: 595      ggagagcttctttatcttctctgaagcagctgattcctttgcctgcaagtcctcattctc 654
                |||||||| |||||||||||| |||||| |   ||||||||| ||||| || || |||||
Sbjct: 29940697 ggagagctcctttatcttctcagaagcaacaagttcctttgcttgcaaatcatcgttctc 29940638

                                                   
Query: 655      ctcttgtatgttctgcaattcgttctctttgtcta 689
                 | || |||||||||||| || || ||||||||||
Sbjct: 29940637 ttgttttatgttctgcaactcattttctttgtcta 29940603



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 476      accttgctgttctcccacatctt 498
                |||||||||||||||||||||||
Sbjct: 29940822 accttgctgttctcccacatctt 29940800



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 310      tttcttcttcttttgctgctgctg 333
                |||||| |||||||||||||||||
Sbjct: 24277668 tttctttttcttttgctgctgctg 24277645



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 314      ttcttcttttgctgctgctg 333
                ||||||||||||||||||||
Sbjct: 11129492 ttcttcttttgctgctgctg 11129511



to top

>dbj|AK073937.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033075G21, full
            insert sequence
          Length = 2570

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 79/95 (83%)
 Strand = Plus / Minus

                                                                        
Query: 595  ggagagcttctttatcttctctgaagcagctgattcctttgcctgcaagtcctcattctc 654
            |||||||| |||||||||||| |||||| |   ||||||||| ||||| || || |||||
Sbjct: 2089 ggagagctcctttatcttctcagaagcaacaagttcctttgcttgcaaatcatcgttctc 2030

                                               
Query: 655  ctcttgtatgttctgcaattcgttctctttgtcta 689
             | || |||||||||||| || || ||||||||||
Sbjct: 2029 ttgttttatgttctgcaactcattttctttgtcta 1995



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                
Query: 313  cttcttcttttgctgctgctgtttggttggcgatgcgatgccgttgttcgcc 364
            ||||||||||||| ||||||| ||||  || |||||| |||| ||| |||||
Sbjct: 2377 cttcttcttttgcggctgctgcttgggcggtgatgcgttgccattgctcgcc 2326



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 479  ttgctgttctcccacatctt 498
            ||||||||||||||||||||
Sbjct: 2211 ttgctgttctcccacatctt 2192



to top

>dbj|AK059702.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-D01, full
           insert sequence
          Length = 1547

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 79/95 (83%)
 Strand = Plus / Minus

                                                                       
Query: 595 ggagagcttctttatcttctctgaagcagctgattcctttgcctgcaagtcctcattctc 654
           |||||||| |||||||||||| |||||| |   ||||||||| ||||| || || |||||
Sbjct: 913 ggagagctcctttatcttctcagaagcaacaagttcctttgcttgcaaatcatcgttctc 854

                                              
Query: 655 ctcttgtatgttctgcaattcgttctctttgtcta 689
            | || |||||||||||| || || ||||||||||
Sbjct: 853 ttgttttatgttctgcaactcattttctttgtcta 819



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 476  accttgctgttctcccacatctt 498
            |||||||||||||||||||||||
Sbjct: 1038 accttgctgttctcccacatctt 1016



to top

>ref|NM_001016186.2| Xenopus tropicalis hypothetical protein LOC548940 (LOC548940), mRNA
          Length = 929

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 310 tttcttcttcttttgctgctgctgtttg 337
           ||||||||||||||||||||||||||||
Sbjct: 765 tttcttcttcttttgctgctgctgtttg 738



to top

>emb|CR761821.2| Xenopus tropicalis finished cDNA, clone TGas045b14
          Length = 929

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 310 tttcttcttcttttgctgctgctgtttg 337
           ||||||||||||||||||||||||||||
Sbjct: 765 tttcttcttcttttgctgctgctgtttg 738



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 311      ttcttcttcttttgctgctgctg 333
                |||||||||||||||||||||||
Sbjct: 17148940 ttcttcttcttttgctgctgctg 17148962



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 311     ttcttcttcttttgctgctgctgtt 335
               ||||||||||| |||||||||||||
Sbjct: 8596612 ttcttcttcttctgctgctgctgtt 8596588



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 119      cttttgtattctctgaaaca 138
                ||||||||||||||||||||
Sbjct: 33163271 cttttgtattctctgaaaca 33163290



to top

>ref|XM_387202.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG07026.1)
           partial mRNA
          Length = 204

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 313 cttcttcttttgctgctgctgtt 335
           |||||||||||||||||||||||
Sbjct: 198 cttcttcttttgctgctgctgtt 176



to top

>ref|XM_815553.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053506599.330) partial mRNA
          Length = 1281

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 313 cttcttcttttgctgctgctgtt 335
           |||||||||||||||||||||||
Sbjct: 880 cttcttcttttgctgctgctgtt 858



to top

>gb|AC137992.2| Oryza sativa chromosome 3 BAC OSJNBb0056B16 genomic sequence, complete
             sequence
          Length = 153247

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 311   ttcttcttcttttgctgctgctg 333
             |||||||||||||||||||||||
Sbjct: 40333 ttcttcttcttttgctgctgctg 40355



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 311      ttcttcttcttttgctgctgctg 333
                |||||||||||||||||||||||
Sbjct: 17142509 ttcttcttcttttgctgctgctg 17142531



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 311     ttcttcttcttttgctgctgctgtt 335
               ||||||||||| |||||||||||||
Sbjct: 8594447 ttcttcttcttctgctgctgctgtt 8594423



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 119      cttttgtattctctgaaaca 138
                ||||||||||||||||||||
Sbjct: 33253781 cttttgtattctctgaaaca 33253800



to top

>emb|CT573074.1| Kuenenia stuttgartiensis genome fragment KUST_B (2 of 5)
          Length = 132284

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 311    ttcttcttcttttgctgctgctg 333
              |||||||||||||||||||||||
Sbjct: 112169 ttcttcttcttttgctgctgctg 112147



to top

>gb|AY591612.1| Mus musculus clone IgK19-13 immunoglobulin kappa-like gene, partial
           sequence
          Length = 3001

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 314 ttcttcttttgctgctgctgtt 335
           ||||||||||||||||||||||
Sbjct: 218 ttcttcttttgctgctgctgtt 239



to top

>gb|AC118681.6| Mus musculus chromosome 16, clone RP23-473M11, complete sequence
          Length = 279112

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 312    tcttcttcttttgctgctgctg 333
              ||||||||||||||||||||||
Sbjct: 212526 tcttcttcttttgctgctgctg 212547



to top

>gb|AC153928.5| Mus musculus 6 BAC RP23-66O20 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 241211

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 314    ttcttcttttgctgctgctgtt 335
              ||||||||||||||||||||||
Sbjct: 220192 ttcttcttttgctgctgctgtt 220213



to top

>gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome
          Length = 2679306

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 311     ttcttcttcttttgctgctgctgttt 336
               ||||||||||| ||||||||||||||
Sbjct: 1785986 ttcttcttcttctgctgctgctgttt 1785961



to top

>gb|AC156284.8| Mus musculus 6 BAC RP24-392D13 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 182146

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 314    ttcttcttttgctgctgctgtt 335
              ||||||||||||||||||||||
Sbjct: 106965 ttcttcttttgctgctgctgtt 106944



to top

>gb|AC153855.4| Mus musculus 6 BAC RP23-175B24 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 183070

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 314   ttcttcttttgctgctgctgtt 335
             ||||||||||||||||||||||
Sbjct: 96213 ttcttcttttgctgctgctgtt 96192



to top

>gb|AC110821.5| Mus musculus BAC clone RP23-418H19 from chromosome 15, complete sequence
          Length = 213726

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 163    aggaagagagactcaggaaact 184
              ||||||||||||||||||||||
Sbjct: 138284 aggaagagagactcaggaaact 138305



to top

>gb|AC116501.7| Mus musculus chromosome 5, clone RP24-300D7, complete sequence
          Length = 174365

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 322   ttgctgctgctgtttggttgg 342
             |||||||||||||||||||||
Sbjct: 53221 ttgctgctgctgtttggttgg 53241



to top

>gb|AC140921.2| Mus musculus BAC clone RP24-472I23 from chromosome 5, complete sequence
          Length = 181004

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 322   ttgctgctgctgtttggttgg 342
             |||||||||||||||||||||
Sbjct: 45294 ttgctgctgctgtttggttgg 45274



to top

>gb|AC117547.19| Mus musculus chromosome 1, clone RP23-221M20, complete sequence
          Length = 195598

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 263    ttgtgctaatttgagctcttt 283
              |||||||||||||||||||||
Sbjct: 139970 ttgtgctaatttgagctcttt 139950



to top

>gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, complete sequence
          Length = 6365727

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 320    ttttgctgctgctgtttggtt 340
              |||||||||||||||||||||
Sbjct: 411623 ttttgctgctgctgtttggtt 411603



to top

>gb|AC113483.7| Mus musculus chromosome 1, clone RP23-343E12, complete sequence
          Length = 207188

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 608    atcttctctgaagcagctgat 628
              |||||||||||||||||||||
Sbjct: 160112 atcttctctgaagcagctgat 160092



to top

>ref|XM_809956.1| Trypanosoma cruzi strain CL Brener phosphatidylinositol-4-phosphate
            5-kinase-like (Tc00.1047053506957.140) partial mRNA
          Length = 3042

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 311  ttcttcttcttttgctgctgctgtt 335
            ||||||||||| |||||||||||||
Sbjct: 1584 ttcttcttcttctgctgctgctgtt 1608



to top

>ref|XM_814533.1| Trypanosoma cruzi strain CL Brener phosphatidylinositol-4-phosphate
            5-kinase-like (Tc00.1047053511001.70) partial mRNA
          Length = 3045

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 311  ttcttcttcttttgctgctgctgtt 335
            ||||||||||| |||||||||||||
Sbjct: 1587 ttcttcttcttctgctgctgctgtt 1611



to top

>emb|BX957325.16| Zebrafish DNA sequence from clone CH211-117O2 in linkage group 7,
              complete sequence
          Length = 166088

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 62     tcaacttacacaaatgcaaga 82
              |||||||||||||||||||||
Sbjct: 135453 tcaacttacacaaatgcaaga 135473



to top

>emb|AL512635.8| Human DNA sequence from clone RP11-15P13 on chromosome 9 Contains a
             survival of motor neuron 1, telomeric (SMN1) pseudogene
             and the 3' end of the MLLT3 gene for myeloid/lymphoid or
             mixed-lineage leukemia (trithorax homolog, Drosophila);
             translocated to, 3 (AF9), complete sequence
          Length = 178631

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 308   aatttcttcttcttttgctgctgct 332
             |||||||||||||| ||||||||||
Sbjct: 21260 aatttcttcttcttctgctgctgct 21236



to top

>emb|AL390719.47| Human DNA sequence from clone RP11-465B22 on chromosome 1 Contains a
              novel gene, a novel gene, a protein tyrosine phosphatase
              family pseudogene, a novel gene (FLJ20584), a novel gene, a
              novel gene, a novel gene (FLJ36119) and five CpG islands,
              complete sequence
          Length = 130979

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 113    ccggctcttttgtattctctg 133
              |||||||||||||||||||||
Sbjct: 115952 ccggctcttttgtattctctg 115972



to top

>emb|AL359983.7| Human DNA sequence from clone RP11-139L21 on chromosome 1 Contains part
              of a novel gene (FLJ10157), complete sequence
          Length = 166254

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 299    ctaaacttaaatttcttcttctttt 323
              ||||||||| |||||||||||||||
Sbjct: 158480 ctaaacttacatttcttcttctttt 158456



to top

>emb|AL158035.14| Human DNA sequence from clone RP1-97J1 on chromosome 6 Contains the 5'
              end of the FYN gene for the FYN oncogene related to SRC,
              FGR, YES and a CpG island, complete sequence
          Length = 218548

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 592    agaggagagcttctttatctt 612
              |||||||||||||||||||||
Sbjct: 189779 agaggagagcttctttatctt 189799



to top

>gb|AC130388.6| Drosophila melanogaster X BAC CH221-14P20 (Children's Hospital Oakland
             Research Institute Drosophila melanogaster sheared DNA BAC
             Library) complete sequence
          Length = 117795

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 311   ttcttcttcttttgctgctgc 331
             |||||||||||||||||||||
Sbjct: 36743 ttcttcttcttttgctgctgc 36723



to top

>emb|CR381635.11| Zebrafish DNA sequence from clone DKEY-171C9 in linkage group 7,
             complete sequence
          Length = 173058

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 62    tcaacttacacaaatgcaaga 82
             |||||||||||||||||||||
Sbjct: 23827 tcaacttacacaaatgcaaga 23847



to top

>dbj|AK125828.1| Homo sapiens cDNA FLJ43840 fis, clone TESTI4006112
          Length = 4156

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 113 ccggctcttttgtattctctg 133
           |||||||||||||||||||||
Sbjct: 351 ccggctcttttgtattctctg 331



to top

>gb|AC096677.2| Homo sapiens chromosome 1 clone RP11-134G8, complete sequence
          Length = 223735

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 310   tttcttcttcttttgctgctgctgt 334
             |||||||| ||||||||||||||||
Sbjct: 99661 tttcttctccttttgctgctgctgt 99637



to top

>gb|AC093153.2| Homo sapiens chromosome 1 clone RP11-477C23, complete sequence
          Length = 194427

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 299   ctaaacttaaatttcttcttctttt 323
             ||||||||| |||||||||||||||
Sbjct: 88750 ctaaacttacatttcttcttctttt 88726



to top

>gb|AC162174.4| Mus musculus chromosome 1, clone RP23-306P24, complete sequence
          Length = 211734

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 263    ttgtgctaatttgagctcttt 283
              |||||||||||||||||||||
Sbjct: 188743 ttgtgctaatttgagctcttt 188763



to top

>gb|AC135206.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1041F02,
             complete sequence
          Length = 137327

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 311   ttcttcttcttttgctgctgctgtt 335
             ||||||||||| |||||||||||||
Sbjct: 77584 ttcttcttcttctgctgctgctgtt 77560



to top

>gb|AC152832.3| Ornithorhynchus anatinus BAC clone OABb-104A1 from chromosome
            unknown, complete sequence
          Length = 161382

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 303  acttaaatttcttcttctttt 323
            |||||||||||||||||||||
Sbjct: 8699 acttaaatttcttcttctttt 8679



to top

>dbj|AK104530.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-A05, full
           insert sequence
          Length = 1071

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 311 ttcttcttcttttgctgctgctgtt 335
           ||||||||||| |||||||||||||
Sbjct: 873 ttcttcttcttctgctgctgctgtt 849



to top

>dbj|AK099322.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033014L15, full
           insert sequence
          Length = 1096

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 311 ttcttcttcttttgctgctgctgtt 335
           ||||||||||| |||||||||||||
Sbjct: 886 ttcttcttcttctgctgctgctgtt 862



to top

>dbj|AK099159.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023074F15, full
           insert sequence
          Length = 1126

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 311 ttcttcttcttttgctgctgctgtt 335
           ||||||||||| |||||||||||||
Sbjct: 916 ttcttcttcttctgctgctgctgtt 892



to top

>dbj|AK061109.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-207-C07, full
           insert sequence
          Length = 1134

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 311 ttcttcttcttttgctgctgctgtt 335
           ||||||||||| |||||||||||||
Sbjct: 918 ttcttcttcttctgctgctgctgtt 894



to top

>gb|AE003429.4| Drosophila melanogaster chromosome X, section 13 of 74 of the complete
             sequence
          Length = 326403

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 311   ttcttcttcttttgctgctgc 331
             |||||||||||||||||||||
Sbjct: 13045 ttcttcttcttttgctgctgc 13025



to top

>emb|AL935053.6| Zebrafish DNA sequence from clone CH211-162M14, complete sequence
          Length = 138341

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 310   tttcttcttcttttgctgctg 330
             |||||||||||||||||||||
Sbjct: 23879 tttcttcttcttttgctgctg 23899



to top

>gb|AC123673.7| Mus musculus chromosome 1, clone RP23-258D13, complete sequence
          Length = 191401

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 316    cttcttttgctgctgctgtt 335
              ||||||||||||||||||||
Sbjct: 126033 cttcttttgctgctgctgtt 126014



to top

>gb|BC108439.1| Xenopus laevis cDNA clone MGC:130663 IMAGE:7768676, complete cds
          Length = 1070

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 314 ttcttcttttgctgctgctgtttg 337
           |||||||| |||||||||||||||
Sbjct: 817 ttcttcttctgctgctgctgtttg 794



to top

>ref|NM_128678.3| Arabidopsis thaliana DNA binding / transcription factor AT2G31220
           mRNA, complete cds
          Length = 1695

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 312 tcttcttcttttgctgctgctgtt 335
           |||||||||| |||||||||||||
Sbjct: 594 tcttcttcttctgctgctgctgtt 617



to top

>gb|AC159998.6| Mus musculus BAC clone RP24-576J22 from chromosome 10, complete
             sequence
          Length = 166313

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 161   tgaggaagagagactcagga 180
             ||||||||||||||||||||
Sbjct: 35718 tgaggaagagagactcagga 35737



to top

>gb|AC118688.10| Mus musculus chromosome 5, clone RP23-302F24, complete sequence
          Length = 176001

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 323    tgctgctgctgtttggttgg 342
              ||||||||||||||||||||
Sbjct: 109873 tgctgctgctgtttggttgg 109892



to top

>ref|XM_469979.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1596

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 119 cttttgtattctctgaaaca 138
           ||||||||||||||||||||
Sbjct: 884 cttttgtattctctgaaaca 903



to top

>gb|AC007579.5| Drosophila melanogaster clone BACR07M03, complete sequence
          Length = 193262

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 316    cttcttttgctgctgctgtt 335
              ||||||||||||||||||||
Sbjct: 122153 cttcttttgctgctgctgtt 122134



to top

>ref|XM_424497.1| PREDICTED: Gallus gallus similar to hypothetical protein
           (LOC426891), mRNA
          Length = 970

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 612 tctctgaagcagctgattcctttg 635
           ||||||||| ||||||||||||||
Sbjct: 766 tctctgaagaagctgattcctttg 789



to top

>gb|AC120553.9| Mus musculus chromosome 15, clone RP24-338L24, complete sequence
          Length = 152510

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    cacaaatgcaagaaaacaaa 89
             ||||||||||||||||||||
Sbjct: 83888 cacaaatgcaagaaaacaaa 83869



to top

>gb|AY750704.1| Tetranychus hydrangeae internal transcribed spacer 2, partial
           sequence
          Length = 646

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 232 acaacaaaggaacaacataa 251
           ||||||||||||||||||||
Sbjct: 549 acaacaaaggaacaacataa 530



to top

>gb|AC134458.2| Mus musculus BAC clone RP23-358B17 from chromosome 18, complete
             sequence
          Length = 179314

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 273   ttgagctctttttcttcagt 292
             ||||||||||||||||||||
Sbjct: 55544 ttgagctctttttcttcagt 55563



to top

>gb|AF313041.4| Homo sapiens chromosome 8 clone RP11-158K1 map q24.13, complete sequence
          Length = 193882

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 320    ttttgctgctgctgtttggt 339
              ||||||||||||||||||||
Sbjct: 127037 ttttgctgctgctgtttggt 127056



to top

>gb|AC113056.26| Mus musculus chromosome 1, clone RP23-252F11, complete sequence
          Length = 180229

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 312    tcttcttcttttgctgctgctgtt 335
              ||||||||||||||||||| ||||
Sbjct: 128475 tcttcttcttttgctgctgttgtt 128452



to top

>gb|AC125152.5| Mus musculus BAC clone RP24-366J2 from chromosome 14, complete sequence
          Length = 134122

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 310   tttcttcttcttttgctgctgctg 333
             |||||||||||| |||||||||||
Sbjct: 46484 tttcttcttcttctgctgctgctg 46507



to top

>gb|AC124603.5| Mus musculus BAC clone RP23-52H14 from chromosome 14, complete sequence
          Length = 179891

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 310    tttcttcttcttttgctgctgctg 333
              |||||||||||| |||||||||||
Sbjct: 170952 tttcttcttcttctgctgctgctg 170975



to top

>ref|XM_800780.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053506715.40) partial mRNA
          Length = 1143

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 310 tttcttcttcttttgctgctgctg 333
           |||||||||||| |||||||||||
Sbjct: 416 tttcttcttcttctgctgctgctg 439



to top

>ref|XM_760485.1| Theileria parva strain Muguga chromosome 1 hypothetical protein
            (TP01_0051) partial mRNA
          Length = 1884

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 79   aagaaaacaaacgcatggct 98
            ||||||||||||||||||||
Sbjct: 1774 aagaaaacaaacgcatggct 1793



to top

>gb|AC004887.2| Homo sapiens PAC clone RP4-789I5 from 7, complete sequence
          Length = 176929

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 644    tcctcattctcctcttgtat 663
              ||||||||||||||||||||
Sbjct: 130633 tcctcattctcctcttgtat 130614



to top

>gb|AC123714.6| Mus musculus chromosome 9, clone RP23-393E20, complete sequence
          Length = 217860

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 316    cttcttttgctgctgctgtt 335
              ||||||||||||||||||||
Sbjct: 133767 cttcttttgctgctgctgtt 133786



to top

>gb|AC157984.17| Medicago truncatula clone mth2-142a1, complete sequence
          Length = 122915

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 301   aaacttaaatttcttcttcttttg 324
             |||||| |||||||||||||||||
Sbjct: 26778 aaacttcaatttcttcttcttttg 26755



to top

>gb|AC106461.6| Rattus norvegicus 1 BAC CH230-208N10 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 212829

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 547   gtcttcttccttgttgccaccatt 570
             ||||||||||||||||||| ||||
Sbjct: 21128 gtcttcttccttgttgccaacatt 21151



to top

>emb|Z46894.1|DMFKBP39 D.melanogaster mRNA for FKBP39
          Length = 1265

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 313 cttcttcttttgctgctgct 332
           ||||||||||||||||||||
Sbjct: 736 cttcttcttttgctgctgct 717



to top

>emb|X70876.1|HVMYB2 H.vulgare myb2 mRNA
          Length = 1102

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 324 gctgctgctgtttggttggc 343
           ||||||||||||||||||||
Sbjct: 536 gctgctgctgtttggttggc 517



to top

>gb|AC159819.2| Mus musculus BAC clone RP23-180C14 from chromosome 9, complete sequence
          Length = 211119

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 316   cttcttttgctgctgctgtt 335
             ||||||||||||||||||||
Sbjct: 37888 cttcttttgctgctgctgtt 37907



to top

>emb|AL731611.2|OSJN00253 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072D08,
              complete sequence
          Length = 142814

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 314    ttcttcttttgctgctgctg 333
              ||||||||||||||||||||
Sbjct: 138147 ttcttcttttgctgctgctg 138166



to top

>emb|AL645966.30| Mouse DNA sequence from clone DN-144H19 on chromosome 3 Contains the 3'
             end of the Il21 gene for interleukin 21, a novel
             pseudogene (D530049N12RIK), a novel gene (C030047M16RIK),
             the Il2 gene for interleukin 2, the Tenr gene for testis
             nuclear RNA binding protein, a NADH dehydrogenase subunit
             5 (ND5) pseudogene and a putative S1 RNA binding domain
             protein (PS1D) (2810055E05RIK) pseudogene, complete
             sequence
          Length = 161393

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 305   ttaaatttcttcttcttttg 324
             ||||||||||||||||||||
Sbjct: 27109 ttaaatttcttcttcttttg 27128



to top

>emb|AL606998.3|OSJN00125 Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ000223_09, complete
              sequence
          Length = 120583

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 310    tttcttcttcttttgctgctgctg 333
              |||||| |||||||||||||||||
Sbjct: 100080 tttctttttcttttgctgctgctg 100057



to top

>gb|BT008608.1| Arabidopsis thaliana clone U50165 putative bHLH protein (At2g31220)
           mRNA, complete cds
          Length = 1408

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 312 tcttcttcttttgctgctgctgtt 335
           |||||||||| |||||||||||||
Sbjct: 484 tcttcttcttctgctgctgctgtt 507



to top

>emb|CR450720.5| Zebrafish DNA sequence from clone DKEYP-51F11 in linkage group 2,
              complete sequence
          Length = 200950

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 53     catcatcactcaacttacac 72
              ||||||||||||||||||||
Sbjct: 170443 catcatcactcaacttacac 170462



to top

>gb|AC090198.7| Homo sapiens chromosome 8, clone RP11-158K1, complete sequence
          Length = 156094

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 320    ttttgctgctgctgtttggt 339
              ||||||||||||||||||||
Sbjct: 127040 ttttgctgctgctgtttggt 127059



to top

>gb|AC015813.12| Homo sapiens, clone RP11-159D12, complete sequence
          Length = 181494

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 304    cttaaatttcttcttctttt 323
              ||||||||||||||||||||
Sbjct: 172084 cttaaatttcttcttctttt 172103



to top

>emb|BX511018.18| Zebrafish DNA sequence from clone DKEY-241H1 in linkage group 4
             Contains eight novel genes and three CpG islands, complete
             sequence
          Length = 95944

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 70    cacaaatgcaagaaaacaaa 89
             ||||||||||||||||||||
Sbjct: 43516 cacaaatgcaagaaaacaaa 43535



to top

>emb|BX649331.16| Zebrafish DNA sequence from clone DKEY-12N3 in linkage group 11, complete
              sequence
          Length = 252675

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 70     cacaaatgcaagaaaacaaa 89
              ||||||||||||||||||||
Sbjct: 173775 cacaaatgcaagaaaacaaa 173794



to top

>emb|AL928657.21| Zebrafish DNA sequence from clone CH211-194I10 in linkage group 3,
             complete sequence
          Length = 187734

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 39    actacattatgaatcatcat 58
             ||||||||||||||||||||
Sbjct: 50145 actacattatgaatcatcat 50126



to top

>gb|AC112250.4| Homo sapiens BAC clone RP11-710E1 from 4, complete sequence
          Length = 79475

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 158   tgatgaggaagagagactca 177
             ||||||||||||||||||||
Sbjct: 59010 tgatgaggaagagagactca 58991



to top

>ref|NM_206123.1| Drosophila melanogaster CG33464-PA (CG33464) mRNA, complete cds
          Length = 1576

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 316 cttcttttgctgctgctgtt 335
           ||||||||||||||||||||
Sbjct: 525 cttcttttgctgctgctgtt 506



to top

>gb|AC093270.3| Homo sapiens chromosome 5 clone RP11-342F17, complete sequence
          Length = 184585

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 299   ctaaacttaaatttcttctt 318
             ||||||||||||||||||||
Sbjct: 97502 ctaaacttaaatttcttctt 97483



to top

>gb|AC006593.5| Arabidopsis thaliana chromosome 2 clone F16D14 map nga361, complete
             sequence
          Length = 84872

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 312   tcttcttcttttgctgctgctgtt 335
             |||||||||| |||||||||||||
Sbjct: 22382 tcttcttcttctgctgctgctgtt 22405



to top

>gb|AY094814.1| Drosophila melanogaster LD30817 full insert cDNA
          Length = 1332

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 313 cttcttcttttgctgctgct 332
           ||||||||||||||||||||
Sbjct: 768 cttcttcttttgctgctgct 749



to top

>ref|NM_079640.2| Drosophila melanogaster FK506-binding protein 1 CG6226-RA
           (FK506-bp1), mRNA
          Length = 1308

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 313 cttcttcttttgctgctgct 332
           ||||||||||||||||||||
Sbjct: 777 cttcttcttttgctgctgct 758



to top

>gb|AE010227.1| Pyrococcus furiosus DSM 3638, section 102 of 173 of the complete
            genome
          Length = 10042

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 121  tttgtattctctgaaacacc 140
            ||||||||||||||||||||
Sbjct: 9998 tttgtattctctgaaacacc 9979



to top

>gb|AF251695.1|AF251695 Arabidopsis thaliana putative transcription factor BHLH10 mRNA,
           complete cds
          Length = 1344

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 312 tcttcttcttttgctgctgctgtt 335
           |||||||||| |||||||||||||
Sbjct: 451 tcttcttcttctgctgctgctgtt 474



to top

>gb|AC099024.1| Drosophila melanogaster, chromosome 2R, region 52X-53A, BAC clone
              BACR04J01, complete sequence
          Length = 182560

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 316    cttcttttgctgctgctgtt 335
              ||||||||||||||||||||
Sbjct: 180637 cttcttttgctgctgctgtt 180656



to top

>gb|AC121357.14| Mus musculus chromosome 15, clone RP23-56D7, complete sequence
          Length = 177867

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 70    cacaaatgcaagaaaacaaa 89
             ||||||||||||||||||||
Sbjct: 11450 cacaaatgcaagaaaacaaa 11469



to top

>dbj|AK088542.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430019N24
           product:high mobility group 20A, full insert sequence
          Length = 4173

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 cttcttttgctgctgctgtt 335
           ||||||||||||||||||||
Sbjct: 185 cttcttttgctgctgctgtt 204



to top

>gb|AC007648.6|AC007648 Drosophila melanogaster, chromosome 3R, region 88E-88F, BAC clone
             BACR13A02, complete sequence
          Length = 166141

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 313   cttcttcttttgctgctgct 332
             ||||||||||||||||||||
Sbjct: 91172 cttcttcttttgctgctgct 91191



to top

>gb|AC090416.1|AC090416 Caenorhabditis briggsae cosmid CB042D07, complete sequence
          Length = 99298

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                         
Query: 308   aatttcttcttcttttgctgctgctgtt 335
             ||||||||||| ||||||||||||||||
Sbjct: 76642 aatttcttctt-ttttgctgctgctgtt 76668



to top

>gb|AC110801.3| Homo sapiens BAC clone RP11-711M9 from 2, complete sequence
          Length = 81952

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 310  tttcttcttcttttgctgctgctg 333
            ||||||||||| ||||||||||||
Sbjct: 6970 tttcttcttctgttgctgctgctg 6993



to top

>gb|AY625483.1| Aspergillus niger manganese superoxide dismutase (MnSOD) gene,
           partial cds
          Length = 404

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 381 cgttgctgtcgagagcggag 400
           ||||||||||||||||||||
Sbjct: 70  cgttgctgtcgagagcggag 51



to top

>gb|AC108906.9| Oryza sativa chromosome 3 BAC OSJNBa0087C10 genomic sequence, complete
             sequence
          Length = 144487

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 119   cttttgtattctctgaaaca 138
             ||||||||||||||||||||
Sbjct: 81284 cttttgtattctctgaaaca 81265



to top

>gb|AC160516.1| Medicago truncatula chromosome 7 BAC clone mth2-66d22, complete
             sequence
          Length = 116154

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 301   aaacttaaatttcttcttcttttg 324
             |||||| |||||||||||||||||
Sbjct: 97550 aaacttcaatttcttcttcttttg 97527



to top

>gb|AC005297.1| Homo sapiens X BAC GS1-466O4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 177503

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    atatgtatgaataaatacaa 31
             ||||||||||||||||||||
Sbjct: 88596 atatgtatgaataaatacaa 88577



to top

>gb|AF190074.1|AF190074 Canella winterana phytochrome A (PHYA) gene, partial cds
          Length = 1047

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 312 tcttcttcttttgctgctgctgtt 335
           |||||||||| |||||||||||||
Sbjct: 556 tcttcttcttctgctgctgctgtt 533



to top

>gb|BT005711.1| Arabidopsis thaliana clone RAFL15-38-K03 (R50165) putative bHLH
           protein (At2g31220) mRNA, complete cds
          Length = 1718

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 312 tcttcttcttttgctgctgctgtt 335
           |||||||||| |||||||||||||
Sbjct: 597 tcttcttcttctgctgctgctgtt 620



to top

>gb|AC084658.1|CBRG46L07 Caenorhabditis briggsae cosmid G46L07, complete sequence
          Length = 35227

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 154   accatgatgaggaagagaga 173
             ||||||||||||||||||||
Sbjct: 19805 accatgatgaggaagagaga 19824



to top

>gb|AC084613.1|CBRG44E08 Caenorhabditis briggsae cosmid G44E08, complete sequence
          Length = 41830

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 314   ttcttcttttgctgctgctg 333
             ||||||||||||||||||||
Sbjct: 37052 ttcttcttttgctgctgctg 37071



to top

>gb|AC004757.2| Homo sapiens chromosome 17, clone CTB-117K16, complete sequence
          Length = 107156

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 304   cttaaatttcttcttctttt 323
             ||||||||||||||||||||
Sbjct: 41967 cttaaatttcttcttctttt 41948



to top

>gb|AC079833.4| Homo sapiens BAC clone CTD-2170K17 from 2, complete sequence
          Length = 73264

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 315  tcttcttttgctgctgctgt 334
            ||||||||||||||||||||
Sbjct: 9948 tcttcttttgctgctgctgt 9967



to top

>emb|BX294661.14| Zebrafish DNA sequence from clone CH211-199I18 in linkage group 20,
              complete sequence
          Length = 197237

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 310    tttcttcttcttttgctgctgctg 333
              |||||||||||| |||||||||||
Sbjct: 159868 tttcttcttcttctgctgctgctg 159891



to top

>emb|AJ000478.1|HTCYP81L Helianthus tuberosus mRNA for cytochrome P450, CYP81B1l
          Length = 1719

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 432 actcaccgtcgttctccttctcct 455
           |||||||||||||||||| |||||
Sbjct: 31  actcaccgtcgttctcctcctcct 54



to top

>gb|AY111165.1| Zea mays CL24291_1 mRNA sequence
          Length = 601

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 478 cttgctgttctcccacatcttggc 501
           |||||||||||||||||| |||||
Sbjct: 486 cttgctgttctcccacattttggc 509



to top

>gb|AC135251.2| Homo sapiens 12 BAC RP11-167E10 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 70387

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 129   ctctgaaacacccaacacttgctt 152
             ||||||||||| ||||||||||||
Sbjct: 39184 ctctgaaacactcaacacttgctt 39207



to top

>emb|AL627350.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0302E05, complete
            sequence
          Length = 61795

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 310  tttcttcttcttttgctgctgctg 333
            |||||| |||||||||||||||||
Sbjct: 6042 tttctttttcttttgctgctgctg 6019



to top

>emb|Z36108.1|SCYBR239C S.cerevisiae chromosome II reading frame ORF YBR239c
          Length = 3190

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 304 cttaaatttcttcttctttt 323
           ||||||||||||||||||||
Sbjct: 773 cttaaatttcttcttctttt 754



to top

>emb|Z36107.1|SCYBR238C S.cerevisiae chromosome II reading frame ORF YBR238c
          Length = 3841

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 304  cttaaatttcttcttctttt 323
            ||||||||||||||||||||
Sbjct: 3560 cttaaatttcttcttctttt 3541



to top

>gb|AE003708.3| Drosophila melanogaster chromosome 3R, section 46 of 118 of the complete
              sequence
          Length = 236375

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 313    cttcttcttttgctgctgct 332
              ||||||||||||||||||||
Sbjct: 135604 cttcttcttttgctgctgct 135623



to top

>gb|AE003809.3| Drosophila melanogaster chromosome 2R, section 41 of 73 of the complete
              sequence
          Length = 262533

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 316    cttcttttgctgctgctgtt 335
              ||||||||||||||||||||
Sbjct: 192205 cttcttttgctgctgctgtt 192224



to top

>emb|CT010518.7| M.truncatula DNA sequence from clone MTH2-78A9 on chromosome 3,
             complete sequence
          Length = 135014

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 301   aaacttaaatttcttcttcttttg 324
             |||||| |||||||||||||||||
Sbjct: 18801 aaacttcaatttcttcttcttttg 18778



to top

>gb|BC087500.1| Xenopus laevis hypothetical LOC496082, mRNA (cDNA clone
           IMAGE:7204363), partial cds
          Length = 926

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 314 ttcttcttttgctgctgctgtttg 337
           |||||||| |||||||||||||||
Sbjct: 742 ttcttcttctgctgctgctgtttg 719



to top

>gb|AC005962.1|AC005962 Homo sapiens chromosome 17, clone hRPK.506_H_21, complete sequence
          Length = 162083

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 304   cttaaatttcttcttctttt 323
             ||||||||||||||||||||
Sbjct: 25682 cttaaatttcttcttctttt 25701



to top

>emb|CT573501.1| Medicago truncatula chromosome 5 clone mth2-60o20, COMPLETE SEQUENCE
          Length = 114271

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 301   aaacttaaatttcttcttcttttg 324
             |||||| |||||||||||||||||
Sbjct: 57798 aaactttaatttcttcttcttttg 57821



to top

>gb|AC005556.1|AC005556 Drosophila melanogaster DNA sequence (P1s DS08658 (D196) and DS00960
             (D268)), complete sequence
          Length = 98695

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 316   cttcttttgctgctgctgtt 335
             ||||||||||||||||||||
Sbjct: 75161 cttcttttgctgctgctgtt 75142



to top

>emb|CT476826.2| Pan troglodytes chromosome X BAC RP43-034A07, complete sequence,
            whole genome shotgun sequence
          Length = 151456

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 12   atatgtatgaataaatacaa 31
            ||||||||||||||||||||
Sbjct: 7561 atatgtatgaataaatacaa 7580



to top

>gb|AC147720.1| Gallus gallus BAC clone CH261-46I14 from chromosome unknown, complete
             sequence
          Length = 204711

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 317   ttcttttgctgctgctgttt 336
             ||||||||||||||||||||
Sbjct: 86340 ttcttttgctgctgctgttt 86321



to top

>gb|AC141892.4| Mus musculus BAC clone RP23-388J12 from 13, complete sequence
          Length = 219862

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 323    tgctgctgctgtttggttgg 342
              ||||||||||||||||||||
Sbjct: 104598 tgctgctgctgtttggttgg 104579



to top

>emb|AJ812006.1| Aspergillus niger sodB gene for putative manganese-containing
            superoxide dismutase, exons 1-3
          Length = 1890

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 381  cgttgctgtcgagagcggag 400
            ||||||||||||||||||||
Sbjct: 1223 cgttgctgtcgagagcggag 1204



to top

>emb|AL929001.7| Mouse DNA sequence from clone RP23-324H1 on chromosome 2, complete
             sequence
          Length = 147727

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 310   tttcttcttcttttgctgctgctg 333
             |||||||||||| |||||||||||
Sbjct: 51468 tttcttcttcttctgctgctgctg 51445



to top

>gb|AC155902.1| Loxodonta africana, clone Loxodonta africana-6767875L18, complete
            sequence
          Length = 37635

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 546  tgtcttcttccttgttgcca 565
            ||||||||||||||||||||
Sbjct: 5250 tgtcttcttccttgttgcca 5231



to top

>gb|AC171726.1| Lycopersicon esculentum chromosome 01 clone C01HBa0088L02, complete
              sequence
          Length = 120525

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 310    tttcttcttcttttgctgct 329
              ||||||||||||||||||||
Sbjct: 107933 tttcttcttcttttgctgct 107952



to top

>emb|AL662823.12| Mouse DNA sequence from clone RP23-243E17 on chromosome 3, complete
             sequence
          Length = 215241

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 305   ttaaatttcttcttcttttg 324
             ||||||||||||||||||||
Sbjct: 58450 ttaaatttcttcttcttttg 58469



to top

>emb|AL591763.14| Mouse DNA sequence from clone RP23-480D17 on chromosome 2, complete
             sequence
          Length = 153847

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 220   gtcacatagcatacaacaaa 239
             ||||||||||||||||||||
Sbjct: 25469 gtcacatagcatacaacaaa 25488


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 9,360,396
Number of Sequences: 3902068
Number of extensions: 9360396
Number of successful extensions: 250864
Number of sequences better than 10.0: 127
Number of HSP's better than 10.0 without gapping: 132
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 249928
Number of HSP's gapped (non-prelim): 936
length of query: 691
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 668
effective length of database: 17,143,297,704
effective search space: 11451722866272
effective search space used: 11451722866272
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top