Clone Name | rbasd13d22 |
---|---|
Clone Library Name | barley_pub |
>gb|AY107283.1| Zea mays PCO076711 mRNA sequence Length = 1604 Score = 430 bits (217), Expect = e-117 Identities = 367/417 (88%) Strand = Plus / Minus Query: 210 cgtccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgg 269 ||||||||||||||| ||| || ||||| |||||||| || ||||||||||||||||| | Sbjct: 1279 cgtccttctcgagcaacttcagaacctcgtcctggttattcagcttggcgacatcgatag 1220 Query: 270 gcgtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatcca 329 | |||||||| |||| ||||||||| || |||||||| ||||||||||| |||||||||| Sbjct: 1219 gtgtcttcccgtccaggttttggagcgttacagcagcaccgtgcttcaaaagaagatcca 1160 Query: 330 cacattctttccggccatagccagcagcgtaatgcagtggggtgttcttgttcttatcca 389 |||| || || ||||| ||||||||||||||||||| ||||||||||||||||| || | Sbjct: 1159 cacactccttgcggccgtagccagcagcgtaatgcaacggggtgttcttgttcttgtcaa 1100 Query: 390 tagcatctactgcagcaccagcctcaaggaggatttccgcacacttgaactcaccatatc 449 ||| || |||||||||||||| ||||| ||||| | |||||||| |||||||| || | Sbjct: 1099 gagcgtccactgcagcaccagcttcaagaaggatctgggcacacttcaactcaccgtacc 1040 Query: 450 cacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatccttgtctgctccac 509 |||||||||| || |||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 1039 cacatgcaaaatgtaaggcccttcttccctcagagtcttcttcatccttgtcggctccac 980 Query: 510 catctagagccttctttagaccctcaccatcaccaacactggcagtgtggtggacaatgg 569 ||||||| || ||||| |||||||| |||||||||||||||||||||| || || |||| Sbjct: 979 catctagtgctttcttgagaccctcttcatcaccaacactggcagtgtgatgaacgatgg 920 Query: 570 actcatcttcatcttcaccttcttcttcagtttcttcagtaccagaaggctcagcag 626 | ||||| ||||| |||||||||| ||||||||||||||||||||||| ||||||| Sbjct: 919 attcatcgtcatccccaccttcttcctcagtttcttcagtaccagaaggttcagcag 863
>gb|AF358770.1| Oryza sativa clone Osl81 apospory-associated protein mRNA, partial cds Length = 710 Score = 394 bits (199), Expect = e-106 Identities = 349/399 (87%) Strand = Plus / Minus Query: 210 cgtccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgg 269 ||||| ||||||||| |||||||||||||||||||||||| |||||||| || ||||||| Sbjct: 637 cgtccatctcgagcaccttgaggacctcatcctggttgttcagcttggccacctcgatgg 578 Query: 270 gcgtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatcca 329 | |||||||| |||| || ||| | |||||||||||||| ||||||| ||||||||||| Sbjct: 577 gggtcttcccgtccagattctggggcgtgacagcagcgccatgcttcagcagaagatcca 518 Query: 330 cacattctttccggccatagccagcagcgtaatgcagtggggtgttcttgttcttatcca 389 ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 517 cacattctttccgaccatatccagcagcgtaatgcagtggggtgttcttgttcttatcca 458 Query: 390 tagcatctactgcagcaccagcctcaaggaggatttccgcacacttgaactcaccatatc 449 || | ||| |||||||| ||||| || ||||| || || || || |||||||| || | Sbjct: 457 gtgcgtttacagcagcacctgcctccagaaggatctctgcgcatttcaactcaccgtaac 398 Query: 450 cacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatccttgtctgctccac 509 |||| ||||| || ||||||||||||||||||| ||||||||||||| ||||||||||| Sbjct: 397 cacacgcaaaatgtaaggcccttcttccctcagcgtcttcttcatccatgtctgctccat 338 Query: 510 catctagagccttctttagaccctcaccatcaccaacactggcagtgtggtggacaatgg 569 | |||| ||| ||||| |||||||| |||| |||||||||||||| || |||||||||| Sbjct: 337 cctctaaagctttcttcagaccctccgcatcgccaacactggcagtatgatggacaatgg 278 Query: 570 actcatcttcatcttcaccttcttcttcagtttcttcag 608 ||||||| |||||| |||| || |||||||||||||||| Sbjct: 277 actcatcatcatctccaccatcctcttcagtttcttcag 239
>dbj|AK121370.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023125M12, full insert sequence Length = 1529 Score = 394 bits (199), Expect = e-106 Identities = 349/399 (87%) Strand = Plus / Minus Query: 210 cgtccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgg 269 ||||| ||||||||| |||||||||||||||||||||||| |||||||| || ||||||| Sbjct: 1213 cgtccatctcgagcaccttgaggacctcatcctggttgttcagcttggccacctcgatgg 1154 Query: 270 gcgtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatcca 329 | |||||||| |||| || ||| | |||||||||||||| ||||||| ||||||||||| Sbjct: 1153 gggtcttcccgtccagattctggggcgtgacagcagcgccatgcttcagcagaagatcca 1094 Query: 330 cacattctttccggccatagccagcagcgtaatgcagtggggtgttcttgttcttatcca 389 ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 1093 cacattctttccgaccatatccagcagcgtaatgcagtggggtgttcttgttcttatcca 1034 Query: 390 tagcatctactgcagcaccagcctcaaggaggatttccgcacacttgaactcaccatatc 449 || | ||| |||||||| ||||| || ||||| || || || || |||||||| || | Sbjct: 1033 gtgcgtttacagcagcacctgcctccagaaggatctctgcgcatttcaactcaccgtaac 974 Query: 450 cacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatccttgtctgctccac 509 |||| ||||| || ||||||||||||||||||| ||||||||||||| ||||||||||| Sbjct: 973 cacacgcaaaatgtaaggcccttcttccctcagcgtcttcttcatccatgtctgctccat 914 Query: 510 catctagagccttctttagaccctcaccatcaccaacactggcagtgtggtggacaatgg 569 | |||| ||| ||||| |||||||| |||| |||||||||||||| || |||||||||| Sbjct: 913 cctctaaagctttcttcagaccctccgcatcgccaacactggcagtatgatggacaatgg 854 Query: 570 actcatcttcatcttcaccttcttcttcagtttcttcag 608 ||||||| |||||| |||| || |||||||||||||||| Sbjct: 853 actcatcatcatctccaccatcctcttcagtttcttcag 815
>dbj|AK098858.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000M21, full insert sequence Length = 1475 Score = 394 bits (199), Expect = e-106 Identities = 349/399 (87%) Strand = Plus / Minus Query: 210 cgtccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgg 269 ||||| ||||||||| |||||||||||||||||||||||| |||||||| || ||||||| Sbjct: 1213 cgtccatctcgagcaccttgaggacctcatcctggttgttcagcttggccacctcgatgg 1154 Query: 270 gcgtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatcca 329 | |||||||| |||| || ||| | |||||||||||||| ||||||| ||||||||||| Sbjct: 1153 gggtcttcccgtccagattctggggcgtgacagcagcgccatgcttcagcagaagatcca 1094 Query: 330 cacattctttccggccatagccagcagcgtaatgcagtggggtgttcttgttcttatcca 389 ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 1093 cacattctttccgaccatatccagcagcgtaatgcagtggggtgttcttgttcttatcca 1034 Query: 390 tagcatctactgcagcaccagcctcaaggaggatttccgcacacttgaactcaccatatc 449 || | ||| |||||||| ||||| || ||||| || || || || |||||||| || | Sbjct: 1033 gtgcgtttacagcagcacctgcctccagaaggatctctgcgcatttcaactcaccgtaac 974 Query: 450 cacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatccttgtctgctccac 509 |||| ||||| || ||||||||||||||||||| ||||||||||||| ||||||||||| Sbjct: 973 cacacgcaaaatgtaaggcccttcttccctcagcgtcttcttcatccatgtctgctccat 914 Query: 510 catctagagccttctttagaccctcaccatcaccaacactggcagtgtggtggacaatgg 569 | |||| ||| ||||| |||||||| |||| |||||||||||||| || |||||||||| Sbjct: 913 cctctaaagctttcttcagaccctccgcatcgccaacactggcagtatgatggacaatgg 854 Query: 570 actcatcttcatcttcaccttcttcttcagtttcttcag 608 ||||||| |||||| |||| || |||||||||||||||| Sbjct: 853 actcatcatcatctccaccatcctcttcagtttcttcag 815
>dbj|AK062078.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-044-F07, full insert sequence Length = 1418 Score = 394 bits (199), Expect = e-106 Identities = 349/399 (87%) Strand = Plus / Minus Query: 210 cgtccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgg 269 ||||| ||||||||| |||||||||||||||||||||||| |||||||| || ||||||| Sbjct: 1218 cgtccatctcgagcaccttgaggacctcatcctggttgttcagcttggccacctcgatgg 1159 Query: 270 gcgtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatcca 329 | |||||||| |||| || ||| | |||||||||||||| ||||||| ||||||||||| Sbjct: 1158 gggtcttcccgtccagattctggggcgtgacagcagcgccatgcttcagcagaagatcca 1099 Query: 330 cacattctttccggccatagccagcagcgtaatgcagtggggtgttcttgttcttatcca 389 ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 1098 cacattctttccgaccatatccagcagcgtaatgcagtggggtgttcttgttcttatcca 1039 Query: 390 tagcatctactgcagcaccagcctcaaggaggatttccgcacacttgaactcaccatatc 449 || | ||| |||||||| ||||| || ||||| || || || || |||||||| || | Sbjct: 1038 gtgcgtttacagcagcacctgcctccagaaggatctctgcgcatttcaactcaccgtaac 979 Query: 450 cacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatccttgtctgctccac 509 |||| ||||| || ||||||||||||||||||| ||||||||||||| ||||||||||| Sbjct: 978 cacacgcaaaatgtaaggcccttcttccctcagcgtcttcttcatccatgtctgctccat 919 Query: 510 catctagagccttctttagaccctcaccatcaccaacactggcagtgtggtggacaatgg 569 | |||| ||| ||||| |||||||| |||| |||||||||||||| || |||||||||| Sbjct: 918 cctctaaagctttcttcagaccctccgcatcgccaacactggcagtatgatggacaatgg 859 Query: 570 actcatcttcatcttcaccttcttcttcagtttcttcag 608 ||||||| |||||| |||| || |||||||||||||||| Sbjct: 858 actcatcatcatctccaccatcctcttcagtttcttcag 820
>ref|XM_483562.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1306 Score = 381 bits (192), Expect = e-102 Identities = 372/432 (86%) Strand = Plus / Minus Query: 194 gcgatttacaggaacacgtccttctcgagcagcttgaggacctcatcctggttgttgagc 253 ||||| |||||||| | ||||| || |||| | |||| ||||| ||||||||||||||| Sbjct: 1054 gcgatctacaggaaggcatccttttccagcaacctgagaacctcgtcctggttgttgagc 995 Query: 254 ttggcgacatcgatgggcgtcttcccatccatgttttggagagtgacagcagcgccgtgc 313 || || || || |||| |||||| ||||||||||||| ||| |||||||| || |||| | Sbjct: 994 ttcgcaacgtcaatggccgtcttgccatccatgttttcgagggtgacagcggctccgttc 935 Query: 314 ttcaacagaagatccacacattctttccggccatagccagcagcgtaatgcagtggggtg 373 |||| |||||||||||| || | ||| ||||||||||| ||||||||||| || ||| Sbjct: 934 ttcagcagaagatccacgcaccccttcataccatagccagcggcgtaatgcagcggagtg 875 Query: 374 ttcttgttcttatccatagcatctactgcagcaccagcctcaaggaggatttccgcacac 433 ||||||||||| |||| |||||| ||||||||||| |||||||| || | || |||||| Sbjct: 874 ttcttgttcttgtccaaagcatccactgcagcacccgcctcaagaagtacttgggcacac 815 Query: 434 ttgaactcaccatatccacatgcaaagtgcaaggcccttcttccctcagagtcttcttca 493 || ||||| ||||| |||||||||||||| ||||||||||| ||||| || |||||||| Sbjct: 814 ttcaactccccatacccacatgcaaagtgtaaggcccttctgccctctgaatcttcttcg 755 Query: 494 tccttgtctgctccaccatctagagccttctttagaccctcaccatcaccaacactggca 553 || ||||||||||||||||||| ||||||||| ||||||||| ||||||||||||||||| Sbjct: 754 tctttgtctgctccaccatctaaagccttcttcagaccctcatcatcaccaacactggca 695 Query: 554 gtgtggtggacaatggactcatcttcatcttcaccttcttcttcagtttcttcagtacca 613 ||||| ||||||||||| |||||||||| |||||||||||| |||||| ||||||| ||| Sbjct: 694 gtgtgatggacaatggattcatcttcatattcaccttcttcctcagttccttcagttcca 635 Query: 614 gaaggctcagca 625 ||||| |||||| Sbjct: 634 gaaggttcagca 623
>dbj|D37939.1|PENPSB31AB Pennisetum ciliare apomixis-associated mRNA, clone:psb3-1a Length = 876 Score = 379 bits (191), Expect = e-102 Identities = 347/399 (86%) Strand = Plus / Minus Query: 210 cgtccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgg 269 |||||||||| |||| |||||| ||||||||||| ||||||||| |||| || ||||||| Sbjct: 622 cgtccttctccagcaacttgagaacctcatcctgattgttgagcctggcaacttcgatgg 563 Query: 270 gcgtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatcca 329 | ||||||||||||| || |||| ||||||||||| || ||||| ||||||||||||| Sbjct: 562 gggtcttcccatccagattctggaccgtgacagcagcaccatgctttaacagaagatcca 503 Query: 330 cacattctttccggccatagccagcagcgtaatgcagtggggtgttcttgttcttatcca 389 ||||||| ||||||||||| |||||||| |||||||| || ||||| ||||||||||||| Sbjct: 502 cacattccttccggccatacccagcagcataatgcagcggagtgtttttgttcttatcca 443 Query: 390 tagcatctactgcagcaccagcctcaaggaggatttccgcacacttgaactcaccatatc 449 ||| || ||||||||||||||||| || |||||||||||||| || ||||| ||||| | Sbjct: 442 gagcgtcaactgcagcaccagcctccagaaggatttccgcacatttcaactcgccatagc 383 Query: 450 cacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatccttgtctgctccac 509 |||||||||| |||||||||||||||||||| | || |||||||| |||||||| |||| Sbjct: 382 cacatgcaaaatgcaaggcccttcttccctctgcatcctcttcatctttgtctgccccac 323 Query: 510 catctagagccttctttagaccctcaccatcaccaacactggcagtgtggtggacaatgg 569 |||||| ||| ||||| |||||||| |||||||||||||||||||||| || ||||||| Sbjct: 322 catctaaagctttcttcagaccctctgcatcaccaacactggcagtgtgatgaacaatgg 263 Query: 570 actcatcttcatcttcaccttcttcttcagtttcttcag 608 ||||||| || | | |||||||| ||||||||||||| Sbjct: 262 actcatcgtcgtacccgccttcttcctcagtttcttcag 224
>gb|U13149.1|PCU13149 Pennisetum ciliare possible apospory-associated mRNA clone pSUB 3-1a, partial cds Length = 876 Score = 379 bits (191), Expect = e-102 Identities = 347/399 (86%) Strand = Plus / Minus Query: 210 cgtccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgg 269 |||||||||| |||| |||||| ||||||||||| ||||||||| |||| || ||||||| Sbjct: 622 cgtccttctccagcaacttgagaacctcatcctgattgttgagcctggcaacttcgatgg 563 Query: 270 gcgtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatcca 329 | ||||||||||||| || |||| ||||||||||| || ||||| ||||||||||||| Sbjct: 562 gggtcttcccatccagattctggaccgtgacagcagcaccatgctttaacagaagatcca 503 Query: 330 cacattctttccggccatagccagcagcgtaatgcagtggggtgttcttgttcttatcca 389 ||||||| ||||||||||| |||||||| |||||||| || ||||| ||||||||||||| Sbjct: 502 cacattccttccggccatacccagcagcataatgcagcggagtgtttttgttcttatcca 443 Query: 390 tagcatctactgcagcaccagcctcaaggaggatttccgcacacttgaactcaccatatc 449 ||| || ||||||||||||||||| || |||||||||||||| || ||||| ||||| | Sbjct: 442 gagcgtcaactgcagcaccagcctccagaaggatttccgcacatttcaactcgccatagc 383 Query: 450 cacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatccttgtctgctccac 509 |||||||||| |||||||||||||||||||| | || |||||||| |||||||| |||| Sbjct: 382 cacatgcaaaatgcaaggcccttcttccctctgcatcctcttcatctttgtctgccccac 323 Query: 510 catctagagccttctttagaccctcaccatcaccaacactggcagtgtggtggacaatgg 569 |||||| ||| ||||| |||||||| |||||||||||||||||||||| || ||||||| Sbjct: 322 catctaaagctttcttcagaccctctgcatcaccaacactggcagtgtgatgaacaatgg 263 Query: 570 actcatcttcatcttcaccttcttcttcagtttcttcag 608 ||||||| || | | |||||||| ||||||||||||| Sbjct: 262 actcatcgtcgtacccgccttcttcctcagtttcttcag 224
>emb|Z36546.1|PCAPOSPA3 P.ciliare (Higgins) apospory associated mRNA, 876bp Length = 876 Score = 379 bits (191), Expect = e-102 Identities = 347/399 (86%) Strand = Plus / Minus Query: 210 cgtccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgg 269 |||||||||| |||| |||||| ||||||||||| ||||||||| |||| || ||||||| Sbjct: 622 cgtccttctccagcaacttgagaacctcatcctgattgttgagcctggcaacttcgatgg 563 Query: 270 gcgtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatcca 329 | ||||||||||||| || |||| ||||||||||| || ||||| ||||||||||||| Sbjct: 562 gggtcttcccatccagattctggaccgtgacagcagcaccatgctttaacagaagatcca 503 Query: 330 cacattctttccggccatagccagcagcgtaatgcagtggggtgttcttgttcttatcca 389 ||||||| ||||||||||| |||||||| |||||||| || ||||| ||||||||||||| Sbjct: 502 cacattccttccggccatacccagcagcataatgcagcggagtgtttttgttcttatcca 443 Query: 390 tagcatctactgcagcaccagcctcaaggaggatttccgcacacttgaactcaccatatc 449 ||| || ||||||||||||||||| || |||||||||||||| || ||||| ||||| | Sbjct: 442 gagcgtcaactgcagcaccagcctccagaaggatttccgcacatttcaactcgccatagc 383 Query: 450 cacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatccttgtctgctccac 509 |||||||||| |||||||||||||||||||| | || |||||||| |||||||| |||| Sbjct: 382 cacatgcaaaatgcaaggcccttcttccctctgcatcctcttcatctttgtctgccccac 323 Query: 510 catctagagccttctttagaccctcaccatcaccaacactggcagtgtggtggacaatgg 569 |||||| ||| ||||| |||||||| |||||||||||||||||||||| || ||||||| Sbjct: 322 catctaaagctttcttcagaccctctgcatcaccaacactggcagtgtgatgaacaatgg 263 Query: 570 actcatcttcatcttcaccttcttcttcagtttcttcag 608 ||||||| || | | |||||||| ||||||||||||| Sbjct: 262 actcatcgtcgtacccgccttcttcctcagtttcttcag 224
>gb|AF475105.1| Triticum aestivum apomixis-associated protein mRNA, partial cds Length = 435 Score = 363 bits (183), Expect = 5e-97 Identities = 348/403 (86%) Strand = Plus / Minus Query: 203 aggaacacgtccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgaca 262 ||||||||||||| ||| |||||||| | ||||| ||||| ||||||||||||| || Sbjct: 431 aggaacacgtcctgctcaagcagcttcaccacctcgccctggctgttgagcttggccacc 372 Query: 263 tcgatgggcgtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacaga 322 |||||||| ||||||||||||| |||||||| ||||||||||||||||||||||| ||| Sbjct: 371 tcgatgggggtcttcccatccagattttggagcgtgacagcagcgccgtgcttcaagaga 312 Query: 323 agatccacacattctttccggccatagccagcagcgtaatgcagtggggtgttcttgttc 382 |||||||| ||||| ||||| || || ||||| || || ||||| ||||||||||||||| Sbjct: 311 agatccacgcattccttccgaccgtatccagcggcatagtgcagcggggtgttcttgttc 252 Query: 383 ttatccatagcatctactgcagcaccagcctcaaggaggatttccgcacacttgaactca 442 ||||||| || || |||||||| || ||||| || |||||||| |||||||| ||||| Sbjct: 251 ttatccagtgcgtcaactgcagcgcctgcctccagaaggatttctgcacacttcaactcg 192 Query: 443 ccatatccacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatccttgtct 502 || |||||||||||||| |||||||||||||||||||| | |||||||||||||||| | Sbjct: 191 ccgtatccacatgcaaaatgcaaggcccttcttccctccaaatcttcttcatccttgttt 132 Query: 503 gctccaccatctagagccttctttagaccctcaccatcaccaacactggcagtgtggtgg 562 ||||||||||||| || ||||| |||||||| ||||||| |||||||| |||| ||| Sbjct: 131 gctccaccatctaatgctttcttcagaccctctgcatcaccgacactggcggtgttatgg 72 Query: 563 acaatggactcatcttcatcttcaccttcttcttcagtttctt 605 |||||||||||||| ||||| || |||||||| |||||||||| Sbjct: 71 acaatggactcatcatcatcctcgccttcttcatcagtttctt 29
>gb|AY106235.1| Zea mays PCO066039 mRNA sequence Length = 1360 Score = 299 bits (151), Expect = 6e-78 Identities = 337/399 (84%) Strand = Plus / Minus Query: 210 cgtccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgg 269 |||||||||| |||| |||||| |||||||| || ||||||| ||||| || ||||||| Sbjct: 1087 cgtccttctctagcaacttgagaacctcatcttgactgttgagtttggcaacctcgatgg 1028 Query: 270 gcgtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatcca 329 | || ||||| |||| || ||||| ||||||||||| || | ||||||||||||||||| Sbjct: 1027 gggttttcccgtccagattctggagcgtgacagcagcaccatacttcaacagaagatcca 968 Query: 330 cacattctttccggccatagccagcagcgtaatgcagtggggtgttcttgttcttatcca 389 ||||||| ||||| ||||| |||||||| || |||| || ||||||||||||||||| | Sbjct: 967 cacattccttccgaccatacccagcagcatagtgcaacggagtgttcttgttcttatcta 908 Query: 390 tagcatctactgcagcaccagcctcaaggaggatttccgcacacttgaactcaccatatc 449 ||||| ||||| || || ||||||||||| ||||| |||||||| ||||||||||| | Sbjct: 907 gggcatcaactgcggcccccgcctcaaggagaatttctgcacacttcaactcaccatagc 848 Query: 450 cacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatccttgtctgctccac 509 |||||||||| || || |||| ||||||||| | ||||||||||||||||||||||||| Sbjct: 847 cacatgcaaaatgtaaagcccgtcttccctcggcatcttcttcatccttgtctgctccac 788 Query: 510 catctagagccttctttagaccctcaccatcaccaacactggcagtgtggtggacaatgg 569 | |||| ||| ||||| | |||||| ||||||||||||| |||||||| || ||||||| Sbjct: 787 cttctaaagctttcttcaaaccctcttcatcaccaacacttgcagtgtgatgaacaatgg 728 Query: 570 actcatcttcatcttcaccttcttcttcagtttcttcag 608 ||||||| ||||| | ||||| || ||||| ||||||| Sbjct: 727 actcatcgtcatcccctccttcctcctcagtctcttcag 689
>dbj|AK108758.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-150-G03, full insert sequence Length = 1292 Score = 278 bits (140), Expect = 2e-71 Identities = 299/352 (84%) Strand = Plus / Minus Query: 194 gcgatttacaggaacacgtccttctcgagcagcttgaggacctcatcctggttgttgagc 253 ||||| |||||||| | ||||| || |||| | |||| ||||| ||||||||||||||| Sbjct: 1040 gcgatctacaggaaggcatccttttccagcaacctgagaacctcgtcctggttgttgagc 981 Query: 254 ttggcgacatcgatgggcgtcttcccatccatgttttggagagtgacagcagcgccgtgc 313 || || || || |||| |||||| ||||||||||||| ||| |||||||| || |||| | Sbjct: 980 ttcgcaacgtcaatggccgtcttgccatccatgttttcgagggtgacagcggctccgttc 921 Query: 314 ttcaacagaagatccacacattctttccggccatagccagcagcgtaatgcagtggggtg 373 |||| |||||||||||| || | ||| ||||||||||| ||||||||||| || ||| Sbjct: 920 ttcagcagaagatccacgcaccccttcataccatagccagcggcgtaatgcagcggagtg 861 Query: 374 ttcttgttcttatccatagcatctactgcagcaccagcctcaaggaggatttccgcacac 433 ||||||||||| |||| |||||| ||||||||||| |||||||| || | || |||||| Sbjct: 860 ttcttgttcttgtccaaagcatccactgcagcacccgcctcaagaagtacttgggcacac 801 Query: 434 ttgaactcaccatatccacatgcaaagtgcaaggcccttcttccctcagagtcttcttca 493 || ||||| ||||| |||||||||||||| ||||||||||| ||||| || |||||||| Sbjct: 800 ttcaactccccatacccacatgcaaagtgtaaggcccttctgccctctgaatcttcttcg 741 Query: 494 tccttgtctgctccaccatctagagccttctttagaccctcaccatcaccaa 545 || ||||||||||||||||||| ||||||||| ||||||||| ||||||||| Sbjct: 740 tctttgtctgctccaccatctaaagccttcttcagaccctcatcatcaccaa 689 Score = 75.8 bits (38), Expect = 2e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 560 tggacaatggactcatcttcatcttcaccttcttcttcagtttcttcagtaccagaaggc 619 ||||||||||| |||||| ||| |||||||||||| |||||| ||||||| |||||||| Sbjct: 688 tggacaatggattcatctccatattcaccttcttcctcagttccttcagttccagaaggt 629 Query: 620 tcagca 625 |||||| Sbjct: 628 tcagca 623
>gb|AC137594.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone OSJNBa0065A15, complete sequence Length = 168806 Score = 153 bits (77), Expect = 9e-34 Identities = 113/125 (90%) Strand = Plus / Minus Query: 299 acagcagcgccgtgcttcaacagaagatccacacattctttccggccatagccagcagcg 358 ||||||||||| ||||||| |||||||||||||||||||||||| ||||| ||||||||| Sbjct: 151736 acagcagcgccatgcttcagcagaagatccacacattctttccgaccatatccagcagcg 151677 Query: 359 taatgcagtggggtgttcttgttcttatccatagcatctactgcagcaccagcctcaagg 418 ||||||||||||||||||||||||||||||| || | ||| |||||||| ||||| || Sbjct: 151676 taatgcagtggggtgttcttgttcttatccagtgcgtttacagcagcacctgcctccaga 151617 Query: 419 aggat 423 ||||| Sbjct: 151616 aggat 151612 Score = 93.7 bits (47), Expect = 7e-16 Identities = 68/75 (90%) Strand = Plus / Minus Query: 210 cgtccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgg 269 ||||| ||||||||| |||||||||||||||||||||||| |||||||| || ||||||| Sbjct: 151915 cgtccatctcgagcaccttgaggacctcatcctggttgttcagcttggccacctcgatgg 151856 Query: 270 gcgtcttcccatcca 284 | |||||||| |||| Sbjct: 151855 gggtcttcccgtcca 151841 Score = 93.7 bits (47), Expect = 7e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 439 ctcaccatatccacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatcctt 498 |||||| || ||||| ||||| || ||||||||||||||||||| ||||||||||||| | Sbjct: 151490 ctcaccgtaaccacacgcaaaatgtaaggcccttcttccctcagcgtcttcttcatccat 151431 Query: 499 gtctgctccaccatctagagccttctttagaccct 533 |||||||||| | |||| ||| ||||| ||||||| Sbjct: 151430 gtctgctccatcctctaaagctttcttcagaccct 151396 Score = 87.7 bits (44), Expect = 4e-14 Identities = 65/72 (90%) Strand = Plus / Minus Query: 537 catcaccaacactggcagtgtggtggacaatggactcatcttcatcttcaccttcttctt 596 |||| |||||||||||||| || ||||||||||||||||| |||||| |||| || |||| Sbjct: 150829 catcgccaacactggcagtatgatggacaatggactcatcatcatctccaccatcctctt 150770 Query: 597 cagtttcttcag 608 |||||||||||| Sbjct: 150769 cagtttcttcag 150758
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 153 bits (77), Expect = 9e-34 Identities = 113/125 (90%) Strand = Plus / Minus Query: 299 acagcagcgccgtgcttcaacagaagatccacacattctttccggccatagccagcagcg 358 ||||||||||| ||||||| |||||||||||||||||||||||| ||||| ||||||||| Sbjct: 19668661 acagcagcgccatgcttcagcagaagatccacacattctttccgaccatatccagcagcg 19668602 Query: 359 taatgcagtggggtgttcttgttcttatccatagcatctactgcagcaccagcctcaagg 418 ||||||||||||||||||||||||||||||| || | ||| |||||||| ||||| || Sbjct: 19668601 taatgcagtggggtgttcttgttcttatccagtgcgtttacagcagcacctgcctccaga 19668542 Query: 419 aggat 423 ||||| Sbjct: 19668541 aggat 19668537 Score = 93.7 bits (47), Expect = 7e-16 Identities = 68/75 (90%) Strand = Plus / Minus Query: 210 cgtccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgg 269 ||||| ||||||||| |||||||||||||||||||||||| |||||||| || ||||||| Sbjct: 19668840 cgtccatctcgagcaccttgaggacctcatcctggttgttcagcttggccacctcgatgg 19668781 Query: 270 gcgtcttcccatcca 284 | |||||||| |||| Sbjct: 19668780 gggtcttcccgtcca 19668766 Score = 93.7 bits (47), Expect = 7e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 439 ctcaccatatccacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatcctt 498 |||||| || ||||| ||||| || ||||||||||||||||||| ||||||||||||| | Sbjct: 19668415 ctcaccgtaaccacacgcaaaatgtaaggcccttcttccctcagcgtcttcttcatccat 19668356 Query: 499 gtctgctccaccatctagagccttctttagaccct 533 |||||||||| | |||| ||| ||||| ||||||| Sbjct: 19668355 gtctgctccatcctctaaagctttcttcagaccct 19668321 Score = 87.7 bits (44), Expect = 4e-14 Identities = 65/72 (90%) Strand = Plus / Minus Query: 537 catcaccaacactggcagtgtggtggacaatggactcatcttcatcttcaccttcttctt 596 |||| |||||||||||||| || ||||||||||||||||| |||||| |||| || |||| Sbjct: 19667754 catcgccaacactggcagtatgatggacaatggactcatcatcatctccaccatcctctt 19667695 Query: 597 cagtttcttcag 608 |||||||||||| Sbjct: 19667694 cagtttcttcag 19667683 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 agcaccagcctcaaggagga 422 |||||||||||||||||||| Sbjct: 16862162 agcaccagcctcaaggagga 16862143
>dbj|AP006756.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0450E05 Length = 176553 Score = 153 bits (77), Expect = 9e-34 Identities = 113/125 (90%) Strand = Plus / Minus Query: 299 acagcagcgccgtgcttcaacagaagatccacacattctttccggccatagccagcagcg 358 ||||||||||| ||||||| |||||||||||||||||||||||| ||||| ||||||||| Sbjct: 14347 acagcagcgccatgcttcagcagaagatccacacattctttccgaccatatccagcagcg 14288 Query: 359 taatgcagtggggtgttcttgttcttatccatagcatctactgcagcaccagcctcaagg 418 ||||||||||||||||||||||||||||||| || | ||| |||||||| ||||| || Sbjct: 14287 taatgcagtggggtgttcttgttcttatccagtgcgtttacagcagcacctgcctccaga 14228 Query: 419 aggat 423 ||||| Sbjct: 14227 aggat 14223 Score = 93.7 bits (47), Expect = 7e-16 Identities = 68/75 (90%) Strand = Plus / Minus Query: 210 cgtccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgg 269 ||||| ||||||||| |||||||||||||||||||||||| |||||||| || ||||||| Sbjct: 14526 cgtccatctcgagcaccttgaggacctcatcctggttgttcagcttggccacctcgatgg 14467 Query: 270 gcgtcttcccatcca 284 | |||||||| |||| Sbjct: 14466 gggtcttcccgtcca 14452 Score = 93.7 bits (47), Expect = 7e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 439 ctcaccatatccacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatcctt 498 |||||| || ||||| ||||| || ||||||||||||||||||| ||||||||||||| | Sbjct: 14101 ctcaccgtaaccacacgcaaaatgtaaggcccttcttccctcagcgtcttcttcatccat 14042 Query: 499 gtctgctccaccatctagagccttctttagaccct 533 |||||||||| | |||| ||| ||||| ||||||| Sbjct: 14041 gtctgctccatcctctaaagctttcttcagaccct 14007 Score = 87.7 bits (44), Expect = 4e-14 Identities = 65/72 (90%) Strand = Plus / Minus Query: 537 catcaccaacactggcagtgtggtggacaatggactcatcttcatcttcaccttcttctt 596 |||| |||||||||||||| || ||||||||||||||||| |||||| |||| || |||| Sbjct: 13440 catcgccaacactggcagtatgatggacaatggactcatcatcatctccaccatcctctt 13381 Query: 597 cagtttcttcag 608 |||||||||||| Sbjct: 13380 cagtttcttcag 13369
>gb|AY395742.1| Vitis aestivalis putative ankyrin-repeat protein mRNA, complete cds Length = 1065 Score = 147 bits (74), Expect = 5e-32 Identities = 236/290 (81%) Strand = Plus / Minus Query: 212 tccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggc 271 |||||||| |||||||| || ||||||| ||||||||| || ||||| || ||||| || Sbjct: 1052 tccttctcaagcagcttcagtacctcatgctggttgttcagtttggccacgtcgatcggt 993 Query: 272 gtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatccaca 331 ||||| ||||||||||||||||||||||| ||||| || | || || |||||| | ||| Sbjct: 992 gtcttgccatccatgttttggagagtgactgcagcaccattctccagcagaagtgctaca 933 Query: 332 cattctttccggccatagccagcagcgtaatgcagtggggtgttcttgttcttatccata 391 || || |||| |||||| ||||| || ||||| || | ||||||||||||||||||| | Sbjct: 932 cactccttcctgccataaccagctgcataatgaagagcagtgttcttgttcttatccaaa 873 Query: 392 gcatctactgcagcaccagcctcaaggaggatttccgcacacttgaactcaccatatcca 451 ||||| || | || |||||||||| ||||| | |||||||| | ||||||||| ||| Sbjct: 872 gcatccaccgttgctccagcctcaacaaggatctgagcacacttcacctcaccataccca 813 Query: 452 catgcaaagtgcaaggcccttcttccctcagagtcttcttcatccttgtc 501 ||||| || |||| || | |||||||| || ||||||||||| ||||| Sbjct: 812 catgcgaaatgcagtgcagtccttccctctgaatcttcttcatctttgtc 763
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 125 bits (63), Expect = 2e-25 Identities = 87/95 (91%) Strand = Plus / Minus Query: 531 cctcaccatcaccaacactggcagtgtggtggacaatggactcatcttcatcttcacctt 590 ||||| |||||||||||||||||||||| ||||||||||| |||||||||| |||||||| Sbjct: 26977308 cctcatcatcaccaacactggcagtgtgatggacaatggattcatcttcatattcacctt 26977249 Query: 591 cttcttcagtttcttcagtaccagaaggctcagca 625 |||| |||||| ||||||| |||||||| |||||| Sbjct: 26977248 cttcctcagttccttcagttccagaaggttcagca 26977214 Score = 109 bits (55), Expect = 1e-20 Identities = 82/91 (90%) Strand = Plus / Minus Query: 443 ccatatccacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatccttgtct 502 ||||| |||||||||||||| ||||||||||| ||||| || |||||||| || |||||| Sbjct: 26977953 ccatacccacatgcaaagtgtaaggcccttctgccctctgaatcttcttcgtctttgtct 26977894 Query: 503 gctccaccatctagagccttctttagaccct 533 ||||||||||||| ||||||||| ||||||| Sbjct: 26977893 gctccaccatctaaagccttcttcagaccct 26977863 Score = 93.7 bits (47), Expect = 7e-16 Identities = 101/119 (84%) Strand = Plus / Minus Query: 299 acagcagcgccgtgcttcaacagaagatccacacattctttccggccatagccagcagcg 358 ||||| || |||| ||||| |||||||||||| || | ||| ||||||||||| ||| Sbjct: 26979004 acagcggctccgttcttcagcagaagatccacgcaccccttcataccatagccagcggcg 26978945 Query: 359 taatgcagtggggtgttcttgttcttatccatagcatctactgcagcaccagcctcaag 417 |||||||| || |||||||||||||| |||| |||||| ||||||||||| |||||||| Sbjct: 26978944 taatgcagcggagtgttcttgttcttgtccaaagcatccactgcagcacccgcctcaag 26978886 Score = 65.9 bits (33), Expect = 2e-07 Identities = 81/97 (83%) Strand = Plus / Minus Query: 194 gcgatttacaggaacacgtccttctcgagcagcttgaggacctcatcctggttgttgagc 253 ||||| |||||||| | ||||| || |||| | |||| ||||| ||||||||||||||| Sbjct: 26979197 gcgatctacaggaaggcatccttttccagcaacctgagaacctcgtcctggttgttgagc 26979138 Query: 254 ttggcgacatcgatgggcgtcttcccatccatgtttt 290 || || || || |||| |||||| ||||||||||||| Sbjct: 26979137 ttcgcaacgtcaatggccgtcttgccatccatgtttt 26979101 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttc 591 |||||||||||||||||||| Sbjct: 5403897 tcatcttcatcttcaccttc 5403916
>gb|AF510035.1| Nicotiana tabacum ankyrin domain protein (ANK1) mRNA, complete cds Length = 1053 Score = 125 bits (63), Expect = 2e-25 Identities = 93/103 (90%) Strand = Plus / Minus Query: 201 acaggaacacgtccttctcgagcagcttgaggacctcatcctggttgttgagcttggcga 260 |||| ||||| || |||||||||||||| |||||||| | |||||||||||| ||||| | Sbjct: 1051 acagaaacacatctttctcgagcagctttaggacctcctgctggttgttgagtttggcca 992 Query: 261 catcgatgggcgtcttcccatccatgttttggagagtgacagc 303 |||||||||||||||| |||||||||||||||||||| ||||| Sbjct: 991 catcgatgggcgtctttccatccatgttttggagagttacagc 949 Score = 42.1 bits (21), Expect = 2.3 Identities = 54/65 (83%) Strand = Plus / Minus Query: 428 gcacacttgaactcaccatatccacatgcaaagtgcaaggcccttcttccctcagagtct 487 |||||||| | ||| ||||||||||| ||||| ||||| || | ||||| || |||||| Sbjct: 824 gcacacttcacctcgccatatccacaagcaaaatgcaatgctgtccttccttctgagtct 765 Query: 488 tcttc 492 ||||| Sbjct: 764 tcttc 760
>dbj|AP004592.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0666G10 Length = 150761 Score = 125 bits (63), Expect = 2e-25 Identities = 87/95 (91%) Strand = Plus / Minus Query: 531 cctcaccatcaccaacactggcagtgtggtggacaatggactcatcttcatcttcacctt 590 ||||| |||||||||||||||||||||| ||||||||||| |||||||||| |||||||| Sbjct: 78708 cctcatcatcaccaacactggcagtgtgatggacaatggattcatcttcatattcacctt 78649 Query: 591 cttcttcagtttcttcagtaccagaaggctcagca 625 |||| |||||| ||||||| |||||||| |||||| Sbjct: 78648 cttcctcagttccttcagttccagaaggttcagca 78614 Score = 109 bits (55), Expect = 1e-20 Identities = 82/91 (90%) Strand = Plus / Minus Query: 443 ccatatccacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatccttgtct 502 ||||| |||||||||||||| ||||||||||| ||||| || |||||||| || |||||| Sbjct: 79353 ccatacccacatgcaaagtgtaaggcccttctgccctctgaatcttcttcgtctttgtct 79294 Query: 503 gctccaccatctagagccttctttagaccct 533 ||||||||||||| ||||||||| ||||||| Sbjct: 79293 gctccaccatctaaagccttcttcagaccct 79263 Score = 93.7 bits (47), Expect = 7e-16 Identities = 101/119 (84%) Strand = Plus / Minus Query: 299 acagcagcgccgtgcttcaacagaagatccacacattctttccggccatagccagcagcg 358 ||||| || |||| ||||| |||||||||||| || | ||| ||||||||||| ||| Sbjct: 80404 acagcggctccgttcttcagcagaagatccacgcaccccttcataccatagccagcggcg 80345 Query: 359 taatgcagtggggtgttcttgttcttatccatagcatctactgcagcaccagcctcaag 417 |||||||| || |||||||||||||| |||| |||||| ||||||||||| |||||||| Sbjct: 80344 taatgcagcggagtgttcttgttcttgtccaaagcatccactgcagcacccgcctcaag 80286 Score = 65.9 bits (33), Expect = 2e-07 Identities = 81/97 (83%) Strand = Plus / Minus Query: 194 gcgatttacaggaacacgtccttctcgagcagcttgaggacctcatcctggttgttgagc 253 ||||| |||||||| | ||||| || |||| | |||| ||||| ||||||||||||||| Sbjct: 80597 gcgatctacaggaaggcatccttttccagcaacctgagaacctcgtcctggttgttgagc 80538 Query: 254 ttggcgacatcgatgggcgtcttcccatccatgtttt 290 || || || || |||| |||||| ||||||||||||| Sbjct: 80537 ttcgcaacgtcaatggccgtcttgccatccatgtttt 80501
>gb|AF352797.1|AF352797 Nicotiana tabacum ankyrin-repeat protein HBP1 mRNA, complete cds Length = 1331 Score = 101 bits (51), Expect = 3e-18 Identities = 90/103 (87%) Strand = Plus / Minus Query: 201 acaggaacacgtccttctcgagcagcttgaggacctcatcctggttgttgagcttggcga 260 |||| ||||| || |||||||||||||| |||||||| | |||||||||||| ||||| | Sbjct: 1140 acagaaacacatctttctcgagcagcttcaggacctcctgctggttgttgagtttggcca 1081 Query: 261 catcgatgggcgtcttcccatccatgttttggagagtgacagc 303 ||||||| || ||||| ||||||| |||||||||||| ||||| Sbjct: 1080 catcgatcggtgtcttaccatccaagttttggagagttacagc 1038 Score = 50.1 bits (25), Expect = 0.009 Identities = 55/65 (84%) Strand = Plus / Minus Query: 428 gcacacttgaactcaccatatccacatgcaaagtgcaaggcccttcttccctcagagtct 487 |||||||| | ||| ||||||||||| ||||| ||||| ||| | ||||| || |||||| Sbjct: 913 gcacacttcacctcgccatatccacaagcaaaatgcaatgccgtccttccttctgagtct 854 Query: 488 tcttc 492 ||||| Sbjct: 853 tcttc 849
>gb|AY107770.1| Zea mays PCO087426 mRNA sequence Length = 1494 Score = 101 bits (51), Expect = 3e-18 Identities = 66/71 (92%) Strand = Plus / Minus Query: 214 cttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggcgt 273 |||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||||| Sbjct: 1139 cttctccagcagcttgaggacgtcatcctggttgttgagcttggccacgtcgatgggcgt 1080 Query: 274 cttcccatcca 284 |||||| |||| Sbjct: 1079 cttcccgtcca 1069 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 542 ccaacactggcagtgtggtggacaatggactc 573 ||||| ||||| ||||||||||| |||||||| Sbjct: 811 ccaacgctggcggtgtggtggacgatggactc 780
>gb|AY258007.1| Nicotiana tabacum TGB12K interacting protein 2 (TIP2) mRNA, complete cds Length = 1050 Score = 93.7 bits (47), Expect = 7e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 212 tccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggc 271 ||||||||||||||||| |||||||| | |||||| ||||| ||||| ||||| || || Sbjct: 1037 tccttctcgagcagctttaggacctcgttctggttattgagtttggcaacatctattggt 978 Query: 272 gtcttcccatccatgttttggagagtgacagcagc 306 ||||||||||||| |||||| ||||| |||||||| Sbjct: 977 gtcttcccatccaagttttgaagagtaacagcagc 943 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Minus Query: 443 ccatatccacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatc 495 ||||||||||||||||| ||||| || | ||||| || || ||||||||||| Sbjct: 806 ccatatccacatgcaaaatgcaatgctgtccttccttctgaatcttcttcatc 754
>gb|AY258008.1| Nicotiana tabacum TGB12K interacting protein 3 (TIP3) mRNA, complete cds Length = 1047 Score = 85.7 bits (43), Expect = 2e-13 Identities = 82/95 (86%) Strand = Plus / Minus Query: 212 tccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggc 271 ||||||||||||||||| |||||||| | |||||| ||||| ||||| ||||| || || Sbjct: 1034 tccttctcgagcagctttaggacctcgttctggttattgagtttggcaacatctattggt 975 Query: 272 gtcttcccatccatgttttggagagtgacagcagc 306 ||||||||||||| |||||| | ||| |||||||| Sbjct: 974 gtcttcccatccaagttttgaacagttacagcagc 940 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 443 ccatatccacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatc 495 ||||||||||||||||| ||||| || | ||||| || |||||||||||||| Sbjct: 803 ccatatccacatgcaaaatgcaatgctgtccttccttctgagtcttcttcatc 751
>ref|XM_470424.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1369 Score = 77.8 bits (39), Expect = 4e-11 Identities = 63/71 (88%) Strand = Plus / Minus Query: 214 cttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggcgt 273 ||||||||||||||||||||| || |||||||||||||| || || || ||||||| ||| Sbjct: 1038 cttctcgagcagcttgaggacttcctcctggttgttgagtttcgccacgtcgatggccgt 979 Query: 274 cttcccatcca 284 |||||| |||| Sbjct: 978 cttcccgtcca 968
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 77.8 bits (39), Expect = 4e-11 Identities = 63/71 (88%) Strand = Plus / Minus Query: 214 cttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggcgt 273 ||||||||||||||||||||| || |||||||||||||| || || || ||||||| ||| Sbjct: 35559918 cttctcgagcagcttgaggacttcctcctggttgttgagtttcgccacgtcgatggccgt 35559859 Query: 274 cttcccatcca 284 |||||| |||| Sbjct: 35559858 cttcccgtcca 35559848
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 77.8 bits (39), Expect = 4e-11 Identities = 63/71 (88%) Strand = Plus / Minus Query: 214 cttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggcgt 273 ||||||||||||||||||||| || |||||||||||||| || || || ||||||| ||| Sbjct: 35649990 cttctcgagcagcttgaggacttcctcctggttgttgagtttcgccacgtcgatggccgt 35649931 Query: 274 cttcccatcca 284 |||||| |||| Sbjct: 35649930 cttcccgtcca 35649920
>gb|AC096688.4| Oryza sativa chromosome 3 BAC OSJNBa0015N08 genomic sequence, complete sequence Length = 145290 Score = 77.8 bits (39), Expect = 4e-11 Identities = 63/71 (88%) Strand = Plus / Minus Query: 214 cttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggcgt 273 ||||||||||||||||||||| || |||||||||||||| || || || ||||||| ||| Sbjct: 92881 cttctcgagcagcttgaggacttcctcctggttgttgagtttcgccacgtcgatggccgt 92822 Query: 274 cttcccatcca 284 |||||| |||| Sbjct: 92821 cttcccgtcca 92811
>dbj|AK068082.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013130D01, full insert sequence Length = 1360 Score = 77.8 bits (39), Expect = 4e-11 Identities = 63/71 (88%) Strand = Plus / Minus Query: 214 cttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggcgt 273 ||||||||||||||||||||| || |||||||||||||| || || || ||||||| ||| Sbjct: 1077 cttctcgagcagcttgaggacttcctcctggttgttgagtttcgccacgtcgatggccgt 1018 Query: 274 cttcccatcca 284 |||||| |||| Sbjct: 1017 cttcccgtcca 1007
>gb|BT013193.1| Lycopersicon esculentum clone 134344R, mRNA sequence Length = 1379 Score = 71.9 bits (36), Expect = 3e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 212 tccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggc 271 |||||||| |||||||| ||||| || | |||||||||||| ||||| ||||| || ||| Sbjct: 1133 tccttctcaagcagctttaggacatcctgctggttgttgagtttggcaacatcaattggc 1074 Query: 272 gtcttcccatccatgttttggagagtgacagc 303 ||||| || |||| |||||| ||||| ||||| Sbjct: 1073 gtctttccgtccaagttttgaagagttacagc 1042
>emb|AJ234569.1|HVU234569 Hordeum vulgare genomic DNA fragment; clone MWG0813.rev Length = 107 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 214 cttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggcgt 273 |||||| ||||||||||| ||||| |||||| |||||||| | || || ||||||| ||| Sbjct: 75 cttctccagcagcttgagcacctcctcctggctgttgagcctcgccacgtcgatggccgt 16 Query: 274 cttcccatcca 284 |||||| |||| Sbjct: 15 cttcccgtcca 5
>ref|NM_179168.1| Arabidopsis thaliana AKR2 (ANKYRIN REPEAT-CONTAINING PROTEIN 2); protein binding AT4G35450 (AKR2) transcript variant AT4G35450.4 mRNA, complete cds Length = 1377 Score = 58.0 bits (29), Expect = 4e-05 Identities = 58/67 (86%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 529 accctcaccatcaccaacactggcagtgtggtggacaatggactcatcttcatcttcacc 588 ||||||| ||||||||| ||||||||| ||||| ||||| ||||| ||||| |||||| Sbjct: 729 accctcaacatcaccaagactggcagtttggtgaacaatagactcttcttc---ttcacc 673 Query: 589 ttcttct 595 ||||||| Sbjct: 672 ttcttct 666 Score = 52.0 bits (26), Expect = 0.002 Identities = 134/170 (78%) Strand = Plus / Minus Query: 212 tccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggc 271 |||||||| |||||||| | ||||| |||| |||||||||| || ||||| || ||| Sbjct: 1046 tccttctcaagcagcttcaccacctccagctggctgttgagcttcgctacatcaattggc 987 Query: 272 gtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatccaca 331 |||||| | || | |||||| |||||||| ||||| || | || || ||||| ||| Sbjct: 986 gtcttctcgtctaggttttgcagagtgactgcagcaccattctccaggagaaggcttaca 927 Query: 332 cattctttccggccatagccagcagcgtaatgcagtggggtgttcttgtt 381 || ||||||| || || |||||||| |||||||| || ||||||||||| Sbjct: 926 cactctttcctcccgtaaccagcagcataatgcagaggtgtgttcttgtt 877 Score = 42.1 bits (21), Expect = 2.3 Identities = 60/73 (82%) Strand = Plus / Minus Query: 428 gcacacttgaactcaccatatccacatgcaaagtgcaaggcccttcttccctcagagtct 487 ||||| || ||||| || |||||||| ||||| ||||| || | ||||| ||||| ||| Sbjct: 830 gcacatttcaactcgccgtatccacaagcaaaatgcaatgctgtccttccttcagaatct 771 Query: 488 tcttcatccttgt 500 |||||||| |||| Sbjct: 770 tcttcatctttgt 758
>ref|NM_179166.1| Arabidopsis thaliana AKR2 (ANKYRIN REPEAT-CONTAINING PROTEIN 2); protein binding AT4G35450 (AKR2) transcript variant AT4G35450.2 mRNA, complete cds Length = 1522 Score = 58.0 bits (29), Expect = 4e-05 Identities = 58/67 (86%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 529 accctcaccatcaccaacactggcagtgtggtggacaatggactcatcttcatcttcacc 588 ||||||| ||||||||| ||||||||| ||||| ||||| ||||| ||||| |||||| Sbjct: 874 accctcaacatcaccaagactggcagtttggtgaacaatagactcttcttc---ttcacc 818 Query: 589 ttcttct 595 ||||||| Sbjct: 817 ttcttct 811 Score = 52.0 bits (26), Expect = 0.002 Identities = 134/170 (78%) Strand = Plus / Minus Query: 212 tccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggc 271 |||||||| |||||||| | ||||| |||| |||||||||| || ||||| || ||| Sbjct: 1191 tccttctcaagcagcttcaccacctccagctggctgttgagcttcgctacatcaattggc 1132 Query: 272 gtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatccaca 331 |||||| | || | |||||| |||||||| ||||| || | || || ||||| ||| Sbjct: 1131 gtcttctcgtctaggttttgcagagtgactgcagcaccattctccaggagaaggcttaca 1072 Query: 332 cattctttccggccatagccagcagcgtaatgcagtggggtgttcttgtt 381 || ||||||| || || |||||||| |||||||| || ||||||||||| Sbjct: 1071 cactctttcctcccgtaaccagcagcataatgcagaggtgtgttcttgtt 1022 Score = 42.1 bits (21), Expect = 2.3 Identities = 60/73 (82%) Strand = Plus / Minus Query: 428 gcacacttgaactcaccatatccacatgcaaagtgcaaggcccttcttccctcagagtct 487 ||||| || ||||| || |||||||| ||||| ||||| || | ||||| ||||| ||| Sbjct: 975 gcacatttcaactcgccgtatccacaagcaaaatgcaatgctgtccttccttcagaatct 916 Query: 488 tcttcatccttgt 500 |||||||| |||| Sbjct: 915 tcttcatctttgt 903
>ref|NM_179167.1| Arabidopsis thaliana AKR2 (ANKYRIN REPEAT-CONTAINING PROTEIN 2); protein binding AT4G35450 (AKR2) transcript variant AT4G35450.3 mRNA, complete cds Length = 1442 Score = 58.0 bits (29), Expect = 4e-05 Identities = 58/67 (86%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 529 accctcaccatcaccaacactggcagtgtggtggacaatggactcatcttcatcttcacc 588 ||||||| ||||||||| ||||||||| ||||| ||||| ||||| ||||| |||||| Sbjct: 794 accctcaacatcaccaagactggcagtttggtgaacaatagactcttcttc---ttcacc 738 Query: 589 ttcttct 595 ||||||| Sbjct: 737 ttcttct 731 Score = 52.0 bits (26), Expect = 0.002 Identities = 134/170 (78%) Strand = Plus / Minus Query: 212 tccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggc 271 |||||||| |||||||| | ||||| |||| |||||||||| || ||||| || ||| Sbjct: 1111 tccttctcaagcagcttcaccacctccagctggctgttgagcttcgctacatcaattggc 1052 Query: 272 gtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatccaca 331 |||||| | || | |||||| |||||||| ||||| || | || || ||||| ||| Sbjct: 1051 gtcttctcgtctaggttttgcagagtgactgcagcaccattctccaggagaaggcttaca 992 Query: 332 cattctttccggccatagccagcagcgtaatgcagtggggtgttcttgtt 381 || ||||||| || || |||||||| |||||||| || ||||||||||| Sbjct: 991 cactctttcctcccgtaaccagcagcataatgcagaggtgtgttcttgtt 942 Score = 42.1 bits (21), Expect = 2.3 Identities = 60/73 (82%) Strand = Plus / Minus Query: 428 gcacacttgaactcaccatatccacatgcaaagtgcaaggcccttcttccctcagagtct 487 ||||| || ||||| || |||||||| ||||| ||||| || | ||||| ||||| ||| Sbjct: 895 gcacatttcaactcgccgtatccacaagcaaaatgcaatgctgtccttccttcagaatct 836 Query: 488 tcttcatccttgt 500 |||||||| |||| Sbjct: 835 tcttcatctttgt 823
>ref|NM_119710.3| Arabidopsis thaliana AKR2 (ANKYRIN REPEAT-CONTAINING PROTEIN 2); protein binding AT4G35450 (AKR2) transcript variant AT4G35450.1 mRNA, complete cds Length = 1513 Score = 58.0 bits (29), Expect = 4e-05 Identities = 58/67 (86%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 529 accctcaccatcaccaacactggcagtgtggtggacaatggactcatcttcatcttcacc 588 ||||||| ||||||||| ||||||||| ||||| ||||| ||||| ||||| |||||| Sbjct: 865 accctcaacatcaccaagactggcagtttggtgaacaatagactcttcttc---ttcacc 809 Query: 589 ttcttct 595 ||||||| Sbjct: 808 ttcttct 802 Score = 52.0 bits (26), Expect = 0.002 Identities = 134/170 (78%) Strand = Plus / Minus Query: 212 tccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggc 271 |||||||| |||||||| | ||||| |||| |||||||||| || ||||| || ||| Sbjct: 1182 tccttctcaagcagcttcaccacctccagctggctgttgagcttcgctacatcaattggc 1123 Query: 272 gtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatccaca 331 |||||| | || | |||||| |||||||| ||||| || | || || ||||| ||| Sbjct: 1122 gtcttctcgtctaggttttgcagagtgactgcagcaccattctccaggagaaggcttaca 1063 Query: 332 cattctttccggccatagccagcagcgtaatgcagtggggtgttcttgtt 381 || ||||||| || || |||||||| |||||||| || ||||||||||| Sbjct: 1062 cactctttcctcccgtaaccagcagcataatgcagaggtgtgttcttgtt 1013 Score = 42.1 bits (21), Expect = 2.3 Identities = 60/73 (82%) Strand = Plus / Minus Query: 428 gcacacttgaactcaccatatccacatgcaaagtgcaaggcccttcttccctcagagtct 487 ||||| || ||||| || |||||||| ||||| ||||| || | ||||| ||||| ||| Sbjct: 966 gcacatttcaactcgccgtatccacaagcaaaatgcaatgctgtccttccttcagaatct 907 Query: 488 tcttcatccttgt 500 |||||||| |||| Sbjct: 906 tcttcatctttgt 894
>gb|AY081477.1| Arabidopsis thaliana ankyrin repeat-containing protein 2 (At4g35450) mRNA, complete cds Length = 1100 Score = 58.0 bits (29), Expect = 4e-05 Identities = 58/67 (86%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 529 accctcaccatcaccaacactggcagtgtggtggacaatggactcatcttcatcttcacc 588 ||||||| ||||||||| ||||||||| ||||| ||||| ||||| ||||| |||||| Sbjct: 699 accctcaacatcaccaagactggcagtttggtgaacaatagactcttcttc---ttcacc 643 Query: 589 ttcttct 595 ||||||| Sbjct: 642 ttcttct 636 Score = 52.0 bits (26), Expect = 0.002 Identities = 134/170 (78%) Strand = Plus / Minus Query: 212 tccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggc 271 |||||||| |||||||| | ||||| |||| |||||||||| || ||||| || ||| Sbjct: 1016 tccttctcaagcagcttcaccacctccagctggctgttgagcttcgctacatcaattggc 957 Query: 272 gtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatccaca 331 |||||| | || | |||||| |||||||| ||||| || | || || ||||| ||| Sbjct: 956 gtcttctcgtctaggttttgcagagtgactgcagcaccattctccaggagaaggcttaca 897 Query: 332 cattctttccggccatagccagcagcgtaatgcagtggggtgttcttgtt 381 || ||||||| || || |||||||| |||||||| || ||||||||||| Sbjct: 896 cactctttcctcccgtaaccagcagcataatgcagaggtgtgttcttgtt 847 Score = 42.1 bits (21), Expect = 2.3 Identities = 60/73 (82%) Strand = Plus / Minus Query: 428 gcacacttgaactcaccatatccacatgcaaagtgcaaggcccttcttccctcagagtct 487 ||||| || ||||| || |||||||| ||||| ||||| || | ||||| ||||| ||| Sbjct: 800 gcacatttcaactcgccgtatccacaagcaaaatgcaatgctgtccttccttcagaatct 741 Query: 488 tcttcatccttgt 500 |||||||| |||| Sbjct: 740 tcttcatctttgt 728
>gb|AF386982.1|AF386982 Arabidopsis thaliana ankyrin repeat-containing protein 2 (F15J1.20) mRNA, complete cds Length = 1389 Score = 58.0 bits (29), Expect = 4e-05 Identities = 58/67 (86%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 529 accctcaccatcaccaacactggcagtgtggtggacaatggactcatcttcatcttcacc 588 ||||||| ||||||||| ||||||||| ||||| ||||| ||||| ||||| |||||| Sbjct: 874 accctcaacatcaccaagactggcagtttggtgaacaatagactcttcttc---ttcacc 818 Query: 589 ttcttct 595 ||||||| Sbjct: 817 ttcttct 811 Score = 52.0 bits (26), Expect = 0.002 Identities = 134/170 (78%) Strand = Plus / Minus Query: 212 tccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggc 271 |||||||| |||||||| | ||||| |||| |||||||||| || ||||| || ||| Sbjct: 1191 tccttctcaagcagcttcaccacctccagctggctgttgagcttcgctacatcaattggc 1132 Query: 272 gtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatccaca 331 |||||| | || | |||||| |||||||| ||||| || | || || ||||| ||| Sbjct: 1131 gtcttctcgtctaggttttgcagagtgactgcagcaccattctccaggagaaggcttaca 1072 Query: 332 cattctttccggccatagccagcagcgtaatgcagtggggtgttcttgtt 381 || ||||||| || || |||||||| |||||||| || ||||||||||| Sbjct: 1071 cactctttcctcccgtaaccagcagcataatgcagaggtgtgttcttgtt 1022 Score = 42.1 bits (21), Expect = 2.3 Identities = 60/73 (82%) Strand = Plus / Minus Query: 428 gcacacttgaactcaccatatccacatgcaaagtgcaaggcccttcttccctcagagtct 487 ||||| || ||||| || |||||||| ||||| ||||| || | ||||| ||||| ||| Sbjct: 975 gcacatttcaactcgccgtatccacaagcaaaatgcaatgctgtccttccttcagaatct 916 Query: 488 tcttcatccttgt 500 |||||||| |||| Sbjct: 915 tcttcatctttgt 903
>emb|BX826711.1|CNS0A38X Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB56ZH12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1333 Score = 58.0 bits (29), Expect = 4e-05 Identities = 58/67 (86%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 529 accctcaccatcaccaacactggcagtgtggtggacaatggactcatcttcatcttcacc 588 ||||||| ||||||||| ||||||||| ||||| ||||| ||||| ||||| |||||| Sbjct: 749 accctcaacatcaccaagactggcagtttggtgaacaatagactcttcttc---ttcacc 693 Query: 589 ttcttct 595 ||||||| Sbjct: 692 ttcttct 686 Score = 52.0 bits (26), Expect = 0.002 Identities = 134/170 (78%) Strand = Plus / Minus Query: 212 tccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggc 271 |||||||| |||||||| | ||||| |||| |||||||||| || ||||| || ||| Sbjct: 1066 tccttctcaagcagcttcaccacctccagctggctgttgagcttcgctacatcaattggc 1007 Query: 272 gtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatccaca 331 |||||| | || | |||||| |||||||| ||||| || | || || ||||| ||| Sbjct: 1006 gtcttctcgtctaggttttgcagagtgactgcagcaccattctccaggagaaggcttaca 947 Query: 332 cattctttccggccatagccagcagcgtaatgcagtggggtgttcttgtt 381 || ||||||| || || |||||||| |||||||| || ||||||||||| Sbjct: 946 cactctttcctcccgtaaccagcagcataatgcagaggtgtgttcttgtt 897 Score = 42.1 bits (21), Expect = 2.3 Identities = 60/73 (82%) Strand = Plus / Minus Query: 428 gcacacttgaactcaccatatccacatgcaaagtgcaaggcccttcttccctcagagtct 487 ||||| || ||||| || |||||||| ||||| ||||| || | ||||| ||||| ||| Sbjct: 850 gcacatttcaactcgccgtatccacaagcaaaatgcaatgctgtccttccttcagaatct 791 Query: 488 tcttcatccttgt 500 |||||||| |||| Sbjct: 790 tcttcatctttgt 778
>gb|AY087377.1| Arabidopsis thaliana clone 34698 mRNA, complete sequence Length = 1344 Score = 58.0 bits (29), Expect = 4e-05 Identities = 58/67 (86%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 529 accctcaccatcaccaacactggcagtgtggtggacaatggactcatcttcatcttcacc 588 ||||||| ||||||||| ||||||||| ||||| ||||| ||||| ||||| |||||| Sbjct: 829 accctcaacatcaccaagactggcagtttggtgaacaatagactcttcttc---ttcacc 773 Query: 589 ttcttct 595 ||||||| Sbjct: 772 ttcttct 766 Score = 52.0 bits (26), Expect = 0.002 Identities = 134/170 (78%) Strand = Plus / Minus Query: 212 tccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggc 271 |||||||| |||||||| | ||||| |||| |||||||||| || ||||| || ||| Sbjct: 1146 tccttctcaagcagcttcaccacctccagctggctgttgagcttcgctacatcaattggc 1087 Query: 272 gtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatccaca 331 |||||| | || | |||||| |||||||| ||||| || | || || ||||| ||| Sbjct: 1086 gtcttctcgtctaggttttgcagagtgactgcagcaccattctccaggagaaggcttaca 1027 Query: 332 cattctttccggccatagccagcagcgtaatgcagtggggtgttcttgtt 381 || ||||||| || || |||||||| |||||||| || ||||||||||| Sbjct: 1026 cactctttcctcccgtaaccagcagcataatgcagaggtgtgttcttgtt 977 Score = 42.1 bits (21), Expect = 2.3 Identities = 60/73 (82%) Strand = Plus / Minus Query: 428 gcacacttgaactcaccatatccacatgcaaagtgcaaggcccttcttccctcagagtct 487 ||||| || ||||| || |||||||| ||||| ||||| || | ||||| ||||| ||| Sbjct: 930 gcacatttcaactcgccgtatccacaagcaaaatgcaatgctgtccttccttcagaatct 871 Query: 488 tcttcatccttgt 500 |||||||| |||| Sbjct: 870 tcttcatctttgt 858
>gb|U70425.1|ATU70425 Arabidopsis thaliana ankyrin repeat-containing protein 2 (AKR2) mRNA, complete cds Length = 1598 Score = 58.0 bits (29), Expect = 4e-05 Identities = 58/67 (86%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 529 accctcaccatcaccaacactggcagtgtggtggacaatggactcatcttcatcttcacc 588 ||||||| ||||||||| ||||||||| ||||| ||||| ||||| ||||| |||||| Sbjct: 955 accctcaacatcaccaagactggcagtttggtgaacaatagactcttcttc---ttcacc 899 Query: 589 ttcttct 595 ||||||| Sbjct: 898 ttcttct 892 Score = 44.1 bits (22), Expect = 0.58 Identities = 133/170 (78%) Strand = Plus / Minus Query: 212 tccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggc 271 |||||||| |||||||| | ||||| |||| |||||||||| || ||||| || ||| Sbjct: 1272 tccttctcaagcagcttcaccacctccagctggctgttgagcttcgctacatcaattggc 1213 Query: 272 gtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatccaca 331 |||||| | || | |||||| |||||||| ||||| || | || || ||||| ||| Sbjct: 1212 gtcttctcgtctaggttttgcagagtgactgcagcaccattctccaggagaaggcttaca 1153 Query: 332 cattctttccggccatagccagcagcgtaatgcagtggggtgttcttgtt 381 | ||||||| || || |||||||| |||||||| || ||||||||||| Sbjct: 1152 ctctctttcctcccgtaaccagcagcataatgcagaggtgtgttcttgtt 1103 Score = 42.1 bits (21), Expect = 2.3 Identities = 60/73 (82%) Strand = Plus / Minus Query: 428 gcacacttgaactcaccatatccacatgcaaagtgcaaggcccttcttccctcagagtct 487 ||||| || ||||| || |||||||| ||||| ||||| || | ||||| ||||| ||| Sbjct: 1056 gcacatttcaactcgccgtatccacaagcaaaatgcaatgctgtccttccttcagaatct 997 Query: 488 tcttcatccttgt 500 |||||||| |||| Sbjct: 996 tcttcatctttgt 984
>gb|AF034387.1|AF034387 Arabidopsis thaliana AFT protein (AFT) mRNA, complete cds Length = 1315 Score = 58.0 bits (29), Expect = 4e-05 Identities = 58/67 (86%), Gaps = 3/67 (4%) Strand = Plus / Minus Query: 529 accctcaccatcaccaacactggcagtgtggtggacaatggactcatcttcatcttcacc 588 ||||||| ||||||||| ||||||||| ||||| ||||| ||||| ||||| |||||| Sbjct: 778 accctcaacatcaccaagactggcagtttggtgaacaatagactcttcttc---ttcacc 722 Query: 589 ttcttct 595 ||||||| Sbjct: 721 ttcttct 715 Score = 52.0 bits (26), Expect = 0.002 Identities = 134/170 (78%) Strand = Plus / Minus Query: 212 tccttctcgagcagcttgaggacctcatcctggttgttgagcttggcgacatcgatgggc 271 |||||||| |||||||| | ||||| |||| |||||||||| || ||||| || ||| Sbjct: 1095 tccttctcaagcagcttcaccacctccagctggctgttgagcttcgctacatcaattggc 1036 Query: 272 gtcttcccatccatgttttggagagtgacagcagcgccgtgcttcaacagaagatccaca 331 |||||| | || | |||||| |||||||| ||||| || | || || ||||| ||| Sbjct: 1035 gtcttctcgtctaggttttgcagagtgactgcagcaccattctccaggagaaggcttaca 976 Query: 332 cattctttccggccatagccagcagcgtaatgcagtggggtgttcttgtt 381 || ||||||| || || |||||||| |||||||| || ||||||||||| Sbjct: 975 cactctttcctcccgtaaccagcagcataatgcagaggtgtgttcttgtt 926 Score = 40.1 bits (20), Expect = 9.1 Identities = 56/68 (82%) Strand = Plus / Minus Query: 428 gcacacttgaactcaccatatccacatgcaaagtgcaaggcccttcttccctcagagtct 487 ||||| || ||||| || |||||||| ||||| ||||| || | ||||| ||||| ||| Sbjct: 879 gcacatttcaactcgccgtatccacaagcaaaatgcaatgctgtccttccttcagaatct 820 Query: 488 tcttcatc 495 |||||||| Sbjct: 819 tcttcatc 812
>ref|NM_127294.3| Arabidopsis thaliana protein binding / transcription regulator AT2G17390 mRNA, complete cds Length = 1427 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 446 tatccacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatccttgt 500 |||||||||||||| ||||| || | ||||| ||||||||||||||||| |||| Sbjct: 885 tatccacatgcaaaatgcaaagcagtccttccttcagagtcttcttcatctttgt 831 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Minus Query: 329 acacattctttccggccatagccagcagcgtaatgcagtggggtgttcttgtt 381 ||||| ||||||| ||||| |||||||| || |||| ||| ||||||||||| Sbjct: 1002 acacactctttccttccataaccagcagcatagtgcaatggtgtgttcttgtt 950
>gb|AY142547.1| Arabidopsis thaliana clone RAFL08-16-B13 (R11303) mRNA sequence Length = 1683 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 446 tatccacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatccttgt 500 |||||||||||||| ||||| || | ||||| ||||||||||||||||| |||| Sbjct: 1125 tatccacatgcaaaatgcaaagcagtccttccttcagagtcttcttcatctttgt 1071 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Minus Query: 329 acacattctttccggccatagccagcagcgtaatgcagtggggtgttcttgtt 381 ||||| ||||||| ||||| |||||||| || |||| ||| ||||||||||| Sbjct: 1242 acacactctttccttccataaccagcagcatagtgcaatggtgtgttcttgtt 1190
>emb|AL161587.2|ATCHRIV83 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 83 Length = 197859 Score = 54.0 bits (27), Expect = 6e-04 Identities = 56/65 (86%), Gaps = 3/65 (4%) Strand = Plus / Minus Query: 531 cctcaccatcaccaacactggcagtgtggtggacaatggactcatcttcatcttcacctt 590 ||||| ||||||||| ||||||||| ||||| ||||| ||||| ||||| |||||||| Sbjct: 105536 cctcaacatcaccaagactggcagtttggtgaacaatagactcttcttc---ttcacctt 105480 Query: 591 cttct 595 ||||| Sbjct: 105479 cttct 105475 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Minus Query: 329 acacattctttccggccatagccagcagcgtaatgcagtggggtgttcttgtt 381 ||||| ||||||| || || |||||||| |||||||| || ||||||||||| Sbjct: 106148 acacactctttcctcccgtaaccagcagcataatgcagaggtgtgttcttgtt 106096
>emb|AL117188.1|ATF15J1 Arabidopsis thaliana DNA chromosome 4, BAC clone F15J1, partial sequence (ESSA project) Length = 27408 Score = 54.0 bits (27), Expect = 6e-04 Identities = 56/65 (86%), Gaps = 3/65 (4%) Strand = Plus / Minus Query: 531 cctcaccatcaccaacactggcagtgtggtggacaatggactcatcttcatcttcacctt 590 ||||| ||||||||| ||||||||| ||||| ||||| ||||| ||||| |||||||| Sbjct: 7185 cctcaacatcaccaagactggcagtttggtgaacaatagactcttcttc---ttcacctt 7129 Query: 591 cttct 595 ||||| Sbjct: 7128 cttct 7124 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Minus Query: 329 acacattctttccggccatagccagcagcgtaatgcagtggggtgttcttgtt 381 ||||| ||||||| || || |||||||| |||||||| || ||||||||||| Sbjct: 7797 acacactctttcctcccgtaaccagcagcataatgcagaggtgtgttcttgtt 7745
>gb|BT024730.1| Arabidopsis thaliana At2g17390 mRNA, complete cds Length = 1035 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 446 tatccacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatccttgt 500 |||||||||||||| ||||| || | ||||| ||||||||||||||||| |||| Sbjct: 788 tatccacatgcaaaatgcaaagcagtccttccttcagagtcttcttcatctttgt 734 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Minus Query: 329 acacattctttccggccatagccagcagcgtaatgcagtggggtgttcttgtt 381 ||||| ||||||| ||||| |||||||| || |||| ||| ||||||||||| Sbjct: 905 acacactctttccttccataaccagcagcatagtgcaatggtgtgttcttgtt 853
>emb|BX819895.1|CNS0A8GO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS44ZF02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1415 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 446 tatccacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatccttgt 500 |||||||||||||| ||||| || | ||||| ||||||||||||||||| |||| Sbjct: 885 tatccacatgcaaaatgcaaagcagtccttccttcagagtcttcttcatctttgt 831 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Minus Query: 329 acacattctttccggccatagccagcagcgtaatgcagtggggtgttcttgtt 381 ||||| ||||||| ||||| |||||||| || |||| ||| ||||||||||| Sbjct: 1002 acacactctttccttccataaccagcagcatagtgcaatggtgtgttcttgtt 950
>gb|AC002329.2|AC002329 Arabidopsis thaliana chromosome II section 100 of 255 of the complete sequence. Sequence from clones T23A1, F5J6, MJB20 Length = 76170 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 446 tatccacatgcaaagtgcaaggcccttcttccctcagagtcttcttcatccttgt 500 |||||||||||||| ||||| || | ||||| ||||||||||||||||| |||| Sbjct: 57938 tatccacatgcaaaatgcaaagcagtccttccttcagagtcttcttcatctttgt 57884 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Minus Query: 329 acacattctttccggccatagccagcagcgtaatgcagtggggtgttcttgtt 381 ||||| ||||||| ||||| |||||||| || |||| ||| ||||||||||| Sbjct: 58332 acacactctttccttccataaccagcagcatagtgcaatggtgtgttcttgtt 58280
>emb|Z81068.1|CEF25H5 Caenorhabditis elegans Cosmid F25H5, complete sequence Length = 38692 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttcttcagtttcttcag 608 |||||||| |||||||||||||||| |||||||| Sbjct: 6405 tcttcatcatcaccttcttcttcagcttcttcag 6438
>ref|NM_060055.2| Caenorhabditis elegans F25H5.5 (F25H5.5) mRNA, complete cds Length = 2329 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 575 tcttcatcttcaccttcttcttcagtttcttcag 608 |||||||| |||||||||||||||| |||||||| Sbjct: 1292 tcttcatcatcaccttcttcttcagcttcttcag 1259
>emb|AL808109.6| Mouse DNA sequence from clone RP23-435P19 on chromosome 4, complete sequence Length = 51860 Score = 48.1 bits (24), Expect = 0.037 Identities = 33/36 (91%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttcttcttcagtttcttca 607 |||||||||||||||||||| |||||| ||||||| Sbjct: 17508 tcatcttcatcttcaccttcatcttcatcttcttca 17543
>gb|BC108538.1| Xenopus laevis cDNA clone MGC:130994 IMAGE:7977926, complete cds Length = 3443 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 575 tcttcatcttcaccttcttcttc 597 ||||||||||||||||||||||| Sbjct: 618 tcttcatcttcaccttcttcttc 596
>ref|XM_632320.1| Dictyostelium discoideum hypothetical protein (DDB0220649), partial mRNA Length = 1053 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttca 598 |||||||| |||||||||||||||||| Sbjct: 821 tcatcttcttcttcaccttcttcttca 795
>ref|XM_642221.1| Dictyostelium discoideum hypothetical protein (DDB0189551), partial mRNA Length = 2778 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 573 catcttcatcttcaccttcttcttcag 599 |||||||||||||| |||||||||||| Sbjct: 1858 catcttcatcttcatcttcttcttcag 1832
>ref|XM_641752.1| Dictyostelium discoideum hypothetical protein (DDB0202279), partial mRNA Length = 5319 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttca 598 |||||||||||||||||||| |||||| Sbjct: 1169 tcatcttcatcttcaccttcatcttca 1143
>ref|XM_636000.1| Dictyostelium discoideum hypothetical protein (DDB0206086), partial mRNA Length = 1059 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttca 598 |||||||||||||| |||||||||||| Sbjct: 467 tcatcttcatcttctccttcttcttca 441
>gb|AE014827.1| Plasmodium falciparum 3D7 chromosome 14 section 12 of 13 of the complete sequence Length = 254436 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttcttc 597 ||||||||||||||||||||||| Sbjct: 23523 tcttcatcttcaccttcttcttc 23545
>gb|AC122000.3| Mus musculus BAC clone RP24-328N20 from chromosome 16, complete sequence Length = 188993 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttca 598 |||||||||||||||||||| |||||| Sbjct: 83321 tcatcttcatcttcaccttcatcttca 83295
>ref|XM_505782.1| Yarrowia lipolytica CLIB122, YALI0F23287g predicted mRNA Length = 3336 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttca 598 |||||||||||||||||||| |||||| Sbjct: 875 tcatcttcatcttcaccttcatcttca 849
>emb|X94183.1|STPLC2 S.tuberosum mRNA for phosphoinositide-specific phospholipase C Length = 1940 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttca 598 ||||||||||||||| ||||||||||| Sbjct: 978 tcatcttcatcttcatcttcttcttca 952
>gb|AC109486.2| Homo sapiens chromosome 5 clone RP11-546M4, complete sequence Length = 202405 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttca 598 |||||||||||||||||||| |||||| Sbjct: 33921 tcatcttcatcttcaccttcatcttca 33895
>gb|AC091922.2| Homo sapiens chromosome 5 clone RP11-263N7, complete sequence Length = 150989 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttcttcttca 598 |||||||||||||||||||| |||||| Sbjct: 102551 tcatcttcatcttcaccttcatcttca 102577
>gb|AC008818.7| Homo sapiens chromosome 5 clone CTD-2124H11, complete sequence Length = 152685 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttca 598 |||||||||||||||||||| |||||| Sbjct: 54862 tcatcttcatcttcaccttcatcttca 54836
>gb|AC016607.6|AC016607 Homo sapiens chromosome 5 clone CTD-2165C24, complete sequence Length = 112390 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttcttcttca 598 |||||||||||||||||||| |||||| Sbjct: 50347 tcatcttcatcttcaccttcatcttca 50373
>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica Length = 4003362 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttca 598 |||||||||||||||||||| |||||| Sbjct: 3053767 tcatcttcatcttcaccttcatcttca 3053741
>gb|AC145078.2| Mus musculus chromosome 1, clone RP24-439O10, complete sequence Length = 162864 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Minus Query: 485 tcttcttcatccttgtctgctc 506 |||||||||||||||||||||| Sbjct: 146519 tcttcttcatccttgtctgctc 146498
>ref|NM_126152.3| Arabidopsis thaliana ATP binding / kinase/ transferase, transferring phosphorus-containing groups AT5G67520 mRNA, complete cds Length = 1220 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttcttcttc 597 |||||||||||||||||||| ||||| Sbjct: 991 tcatcttcatcttcaccttcatcttc 1016
>ref|NM_100707.2| Arabidopsis thaliana Rac GTPase activator AT1G08340 mRNA, complete cds Length = 1236 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttc 597 ||||||||||||||| |||||||||| Sbjct: 1055 tcatcttcatcttcatcttcttcttc 1030
>ref|XM_633471.1| Dictyostelium discoideum hypothetical protein (DDB0186073), partial mRNA Length = 2997 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttc 597 ||||||||||||||| |||||||||| Sbjct: 1061 tcatcttcatcttcatcttcttcttc 1036
>gb|BT014961.1| Arabidopsis thaliana At1g08340 gene, complete cds Length = 996 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttc 597 ||||||||||||||| |||||||||| Sbjct: 815 tcatcttcatcttcatcttcttcttc 790
>gb|BT012608.1| Arabidopsis thaliana At1g08340 gene, complete cds Length = 1329 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttc 597 ||||||||||||||| |||||||||| Sbjct: 1001 tcatcttcatcttcatcttcttcttc 976
>ref|XM_756758.1| Ustilago maydis 521 hypothetical protein (UM05704.1) partial mRNA Length = 1092 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttcttcttc 597 ||||||||||||||| |||||||||| Sbjct: 274 tcatcttcatcttcatcttcttcttc 299
>ref|XM_949018.1| Theileria annulata strain Ankara hypothetical protein (TA02845) partial mRNA Length = 8538 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Minus Query: 589 ttcttcttcagtttcttcagta 610 |||||||||||||||||||||| Sbjct: 2088 ttcttcttcagtttcttcagta 2067
>ref|XM_660228.1| Cryptosporidium hominis TU502 OSK4 (Chro.60086) partial mRNA Length = 2208 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttcttcagt 600 |||||||||||| ||||||||||||| Sbjct: 1708 tcttcatcttcatcttcttcttcagt 1733
>ref|XM_971081.1| PREDICTED: Tribolium castaneum hypothetical protein LOC656192 (LOC656192), mRNA Length = 558 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttc 597 ||||||||||||||| |||||||||| Sbjct: 188 tcatcttcatcttcatcttcttcttc 163
>emb|X64346.1|HSGEND Saimiriine herpesvirus 2 complete genome Length = 112930 Score = 44.1 bits (22), Expect = 0.58 Identities = 31/34 (91%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttcttcagtttcttcag 608 ||||| |||||| |||||||||||| |||||||| Sbjct: 106869 tcttcttcttcagcttcttcttcagcttcttcag 106902 Score = 44.1 bits (22), Expect = 0.58 Identities = 31/34 (91%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttcttcagtttcttcag 608 ||||| |||||| |||||||||||| |||||||| Sbjct: 106749 tcttcttcttcagcttcttcttcagcttcttcag 106782 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Plus Query: 576 cttcatcttcaccttcttcttcagtttcttcag 608 |||| |||||| |||||||||||| |||||||| Sbjct: 106681 cttcttcttcagcttcttcttcagcttcttcag 106713 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 581 tcttcaccttcttcttcagtttcttcag 608 |||||| |||||||||||| |||||||| Sbjct: 106626 tcttcagcttcttcttcagcttcttcag 106653 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 581 tcttcaccttcttcttcagtttcttcag 608 |||||| |||||||||||| |||||||| Sbjct: 106605 tcttcagcttcttcttcagcttcttcag 106632 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 581 tcttcaccttcttcttcagtttcttcag 608 |||||| |||||||||||| |||||||| Sbjct: 106584 tcttcagcttcttcttcagcttcttcag 106611 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 581 tcttcaccttcttcttcagtttcttcag 608 |||||| |||||||||||| |||||||| Sbjct: 106536 tcttcagcttcttcttcagcttcttcag 106563
>dbj|AB048278.1| Mus musculus DNA, repeat sequences and enhancer for lens cell specific expression of filensin promoter Length = 7030 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Minus Query: 576 cttcatcttcaccttcttcttc 597 |||||||||||||||||||||| Sbjct: 6313 cttcatcttcaccttcttcttc 6292
>gb|S76368.1| ORF 5' of ECLF2...ECRF3=G protein-coupled receptor homolog [herpesvirus saimiri HVS, host-squirrel monkey, Genomic, 4 genes, 3720 nt] Length = 3720 Score = 44.1 bits (22), Expect = 0.58 Identities = 31/34 (91%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttcttcagtttcttcag 608 ||||| |||||| |||||||||||| |||||||| Sbjct: 1863 tcttcttcttcagcttcttcttcagcttcttcag 1896 Score = 44.1 bits (22), Expect = 0.58 Identities = 31/34 (91%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttcttcagtttcttcag 608 ||||| |||||| |||||||||||| |||||||| Sbjct: 1743 tcttcttcttcagcttcttcttcagcttcttcag 1776 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Plus Query: 576 cttcatcttcaccttcttcttcagtttcttcag 608 |||| |||||| |||||||||||| |||||||| Sbjct: 1675 cttcttcttcagcttcttcttcagcttcttcag 1707 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 581 tcttcaccttcttcttcagtttcttcag 608 |||||| |||||||||||| |||||||| Sbjct: 1620 tcttcagcttcttcttcagcttcttcag 1647 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 581 tcttcaccttcttcttcagtttcttcag 608 |||||| |||||||||||| |||||||| Sbjct: 1599 tcttcagcttcttcttcagcttcttcag 1626 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 581 tcttcaccttcttcttcagtttcttcag 608 |||||| |||||||||||| |||||||| Sbjct: 1578 tcttcagcttcttcttcagcttcttcag 1605 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 581 tcttcaccttcttcttcagtttcttcag 608 |||||| |||||||||||| |||||||| Sbjct: 1530 tcttcagcttcttcttcagcttcttcag 1557
>gb|AY181250.1| Kluyveromyces delphensis SCY1 (SCY1), GUP1 (GUP1), YGL085w (YGL085w), MAD1 (MAD1), MMS2 (MMS2), and mating pheromone alpha2 (MFalpha2) genes, complete cds Length = 12391 Score = 44.1 bits (22), Expect = 0.58 Identities = 31/34 (91%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttcttcttcagtttctt 605 ||||||||||||||| |||| |||||| |||||| Sbjct: 106 tcatcttcatcttcatcttcatcttcattttctt 139 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 571 ctcatcttcatcttcaccttcttcttca 598 |||||||||||||||| |||| |||||| Sbjct: 75 ctcatcttcatcttcatcttcatcttca 102
>emb|BX832567.1|CNS09ZLM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH80ZH11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1158 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttcttcttc 597 |||||||||||||||||||| ||||| Sbjct: 951 tcatcttcatcttcaccttcatcttc 976
>emb|BX834099.1|CNS09YZG Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL95ZH03 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1163 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttcttcttc 597 |||||||||||||||||||| ||||| Sbjct: 991 tcatcttcatcttcaccttcatcttc 1016
>gb|BT005193.1| Arabidopsis thaliana clone U20575 putative adenylylsulfate kinase (At5g67520) mRNA, complete cds Length = 964 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttcttcttc 597 |||||||||||||||||||| ||||| Sbjct: 808 tcatcttcatcttcaccttcatcttc 833
>gb|AC011438.3|AC011438 Genomic sequence for Arabidopsis thaliana BAC T23G18 from chromosome I, complete sequence Length = 91470 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttc 597 ||||||||||||||| |||||||||| Sbjct: 90406 tcatcttcatcttcatcttcttcttc 90381
>gb|AC006932.8|AC006932 Genomic sequence for Arabidopsis thaliana BAC T27G7 from chromosome I, complete sequence Length = 89479 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttc 597 ||||||||||||||| |||||||||| Sbjct: 13322 tcatcttcatcttcatcttcttcttc 13297
>gb|BT003977.1| Arabidopsis thaliana clone RAFL15-08-C12 (R20575) putative adenylylsulfate kinase (At5g67520) mRNA, complete cds Length = 1143 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttcttcttc 597 |||||||||||||||||||| ||||| Sbjct: 908 tcatcttcatcttcaccttcatcttc 933
>gb|AY085031.1| Arabidopsis thaliana clone 125039 mRNA, complete sequence Length = 1133 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttcttcttc 597 |||||||||||||||||||| ||||| Sbjct: 903 tcatcttcatcttcaccttcatcttc 928
>gb|AC173997.2| Mus musculus BAC clone RP24-190A13 from chromosome y, complete sequence Length = 156779 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttc 597 ||||||||||||||| |||||||||| Sbjct: 83426 tcatcttcatcttcatcttcttcttc 83401
>dbj|AB013390.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K9I9 Length = 51860 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttcttcttc 597 |||||||||||||||||||| ||||| Sbjct: 19883 tcatcttcatcttcaccttcatcttc 19908
>gb|AC145736.4| Mus musculus BAC clone RP24-296K18 from 9, complete sequence Length = 177964 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttcttcttc 597 |||||||| ||||||||||||||||| Sbjct: 104623 tcatcttcttcttcaccttcttcttc 104648
>gb|M86409.1|HSV3PRGEN Herpesvirus saimiri the most three prime end of the genome Length = 43658 Score = 44.1 bits (22), Expect = 0.58 Identities = 31/34 (91%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttcttcagtttcttcag 608 ||||| |||||| |||||||||||| |||||||| Sbjct: 37562 tcttcttcttcagcttcttcttcagcttcttcag 37595 Score = 44.1 bits (22), Expect = 0.58 Identities = 31/34 (91%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttcttcagtttcttcag 608 ||||| |||||| |||||||||||| |||||||| Sbjct: 37442 tcttcttcttcagcttcttcttcagcttcttcag 37475 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Plus Query: 576 cttcatcttcaccttcttcttcagtttcttcag 608 |||| |||||| |||||||||||| |||||||| Sbjct: 37374 cttcttcttcagcttcttcttcagcttcttcag 37406 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 581 tcttcaccttcttcttcagtttcttcag 608 |||||| |||||||||||| |||||||| Sbjct: 37319 tcttcagcttcttcttcagcttcttcag 37346 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 581 tcttcaccttcttcttcagtttcttcag 608 |||||| |||||||||||| |||||||| Sbjct: 37298 tcttcagcttcttcttcagcttcttcag 37325 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 581 tcttcaccttcttcttcagtttcttcag 608 |||||| |||||||||||| |||||||| Sbjct: 37277 tcttcagcttcttcttcagcttcttcag 37304 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 581 tcttcaccttcttcttcagtttcttcag 608 |||||| |||||||||||| |||||||| Sbjct: 37229 tcttcagcttcttcttcagcttcttcag 37256
>ref|XM_416432.1| PREDICTED: Gallus gallus similar to glycogen synthase 2 (liver) (LOC418201), mRNA Length = 2514 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 571 ctcatcttcatcttcaccttc 591 ||||||||||||||||||||| Sbjct: 2394 ctcatcttcatcttcaccttc 2374
>emb|X55014.1|VFLEA2 Vicia faba mRNA for Legumin A2 pre-pro-polypeptide Length = 1666 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttctt 596 ||||||||||||||| ||||||||| Sbjct: 859 tcatcttcatcttcatcttcttctt 835
>emb|X55013.1|VFLEA1 Vicia faba mRNA for Legumin A1 pre-pro-polypeptide Length = 1585 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttctt 596 ||||||||||||||| ||||||||| Sbjct: 811 tcatcttcatcttcatcttcttctt 787
>ref|XM_385493.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG05317.1) partial mRNA Length = 5460 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 571 ctcatcttcatcttcaccttc 591 ||||||||||||||||||||| Sbjct: 414 ctcatcttcatcttcaccttc 394
>ref|XM_448481.1| Candida glabrata CBS138, CAGL0K05863g partial mRNA Length = 1599 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 595 ttcagtttcttcagtaccaga 615 ||||||||||||||||||||| Sbjct: 1356 ttcagtttcttcagtaccaga 1336
>emb|CR954197.2| Medicago truncatula chromosome 5 clone mte1-80m7, COMPLETE SEQUENCE Length = 138067 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 570 actcatcttcatcttcaccttcttcttca 598 ||||||||||||||||| |||| |||||| Sbjct: 136510 actcatcttcatcttcatcttcatcttca 136538
>emb|CR385024.10| Zebrafish DNA sequence from clone CH211-202G4 in linkage group 8, complete sequence Length = 207510 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 577 ttcatcttcaccttcttcttc 597 ||||||||||||||||||||| Sbjct: 150324 ttcatcttcaccttcttcttc 150344
>gb|BC049177.1| Xenopus laevis hypothetical protein MGC53293, mRNA (cDNA clone MGC:53293 IMAGE:5570306), complete cds Length = 3884 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 576 cttcatcttcaccttcttctt 596 ||||||||||||||||||||| Sbjct: 990 cttcatcttcaccttcttctt 970
>ref|XM_718924.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY00398) partial mRNA Length = 1344 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 575 tcttcatcttcaccttcttcttcagtttcttca 607 |||||||||||| ||||||||||| ||||||| Sbjct: 239 tcttcatcttcatcttcttcttcatcttcttca 207
>ref|XM_663191.1| Cryptosporidium hominis TU502 U4/U6-associated RNA splicing factor-related (Chro.80603) partial mRNA Length = 6513 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 486 cttcttcatccttgtctgctccaccatct 514 ||||||||||||| ||| ||||||||||| Sbjct: 2419 cttcttcatccttatctcctccaccatct 2391
>gb|AY196927.1| Meriones unguiculatus MRGB4 (MrgB4) gene, partial cds Length = 403 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 612 cagaaggctcagcagtagaga 632 ||||||||||||||||||||| Sbjct: 73 cagaaggctcagcagtagaga 53
>emb|AL117329.8|HSBA191L9 Human DNA sequence from clone RP11-191L9 on chromosome 22, complete sequence Length = 146438 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 574 atcttcatcttcaccttcttc 594 ||||||||||||||||||||| Sbjct: 37981 atcttcatcttcaccttcttc 38001
>emb|CR380957.1| Candida glabrata strain CBS138 chromosome K complete sequence Length = 1302002 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 595 ttcagtttcttcagtaccaga 615 ||||||||||||||||||||| Sbjct: 576784 ttcagtttcttcagtaccaga 576804
>gb|AC135160.22| Medicago truncatula clone mth2-20m5, complete sequence Length = 120202 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttct 595 ||||||||||||||||||||| Sbjct: 12461 tcttcatcttcaccttcttct 12481
>dbj|AB219854.1| Xenopus laevis mRNA for Xnr6b, complete cds Length = 1542 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 560 tggacaatggactcatcttca 580 ||||||||||||||||||||| Sbjct: 1112 tggacaatggactcatcttca 1092
>ref|NM_142829.1| Drosophila melanogaster CG4907-RA (CG4907), mRNA Length = 2920 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 514 tagagccttctttagaccctc 534 ||||||||||||||||||||| Sbjct: 1699 tagagccttctttagaccctc 1719
>gb|AY094627.1| Drosophila melanogaster AT01413 full insert cDNA Length = 2720 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 514 tagagccttctttagaccctc 534 ||||||||||||||||||||| Sbjct: 1479 tagagccttctttagaccctc 1499
>gb|AC149134.2| Medicago truncatula, complete sequence Length = 133336 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 573 catcttcatcttcaccttcttcttc 597 |||||||||||||| |||||||||| Sbjct: 40458 catcttcatcttcatcttcttcttc 40434
>gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome Length = 5751492 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 582 cttcaccttcttcttcagtttcttc 606 |||||||||||||||||| |||||| Sbjct: 3722338 cttcaccttcttcttcagcttcttc 3722314
>gb|AC008197.3|AC008197 Drosophila melanogaster, chromosome 3R, region 94B-94C, BAC clone BACR02L12, complete sequence Length = 178931 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 514 tagagccttctttagaccctc 534 ||||||||||||||||||||| Sbjct: 154429 tagagccttctttagaccctc 154409
>gb|AC009846.9|AC009846 Drosophila melanogaster, chromosome 3R, region 94C-94D, BAC clone BACR23F10, complete sequence Length = 164038 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 514 tagagccttctttagaccctc 534 ||||||||||||||||||||| Sbjct: 76492 tagagccttctttagaccctc 76472
>gb|AC096772.3| Homo sapiens BAC clone RP11-801F7 from 2, complete sequence Length = 177733 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttct 592 ||||||||||||||||||||| Sbjct: 134168 tcatcttcatcttcaccttct 134188
>emb|BX571687.17| Zebrafish DNA sequence from clone DKEYP-77F7 in linkage group 8, complete sequence Length = 173448 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 577 ttcatcttcaccttcttcttc 597 ||||||||||||||||||||| Sbjct: 103082 ttcatcttcaccttcttcttc 103102
>gb|AE003740.3| Drosophila melanogaster chromosome 3R, section 78 of 118 of the complete sequence Length = 234378 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 514 tagagccttctttagaccctc 534 ||||||||||||||||||||| Sbjct: 63143 tagagccttctttagaccctc 63123
>emb|AL132987.4|CNS01DTV Human chromosome 14 DNA sequence BAC R-188I13 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 169505 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 456 caaagtgcaaggcccttcttccctc 480 |||||||||||||||||||| |||| Sbjct: 105517 caaagtgcaaggcccttctttcctc 105541
>gb|BT001286.1| Drosophila melanogaster AT09001 full insert cDNA Length = 2935 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 514 tagagccttctttagaccctc 534 ||||||||||||||||||||| Sbjct: 1698 tagagccttctttagaccctc 1718
>dbj|AP007299.1| Lotus japonicus genomic DNA, clone:LjT30I08, TM0492, complete sequence Length = 106844 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 578 tcatcttcaccttcttcttca 598 ||||||||||||||||||||| Sbjct: 68691 tcatcttcaccttcttcttca 68711
>gb|BC001195.1| Homo sapiens transmembrane protein 38A, mRNA (cDNA clone MGC:3169 IMAGE:3355479), complete cds Length = 1559 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 571 ctcatcttcatcttcacctt 590 |||||||||||||||||||| Sbjct: 641 ctcatcttcatcttcacctt 660
>gb|BC085153.1| Mus musculus expressed sequence AI480556, mRNA (cDNA clone MGC:109685 IMAGE:6837651), complete cds Length = 4195 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 573 catcttcatcttcaccttct 592 |||||||||||||||||||| Sbjct: 781 catcttcatcttcaccttct 800
>gb|BC108726.1| Homo sapiens cDNA clone MGC:131940 IMAGE:5194296, complete cds Length = 1684 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 541 tcatcttcaccttcttcttc 522
>ref|NM_103628.3| Arabidopsis thaliana unknown protein AT1G47340 mRNA, complete cds Length = 2067 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 574 atcttcatcttcaccttcttcttc 597 ||||||||||||| |||||||||| Sbjct: 1386 atcttcatcttcatcttcttcttc 1363
>ref|NM_113918.1| Arabidopsis thaliana unknown protein AT3G30190 mRNA, complete cds Length = 792 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttcttcagtttcttc 606 ||||| |||||| ||||||||||| ||||||| Sbjct: 172 tcttcttcttcatcttcttcttcattttcttc 203
>ref|NM_103627.3| Arabidopsis thaliana unknown protein AT1G47330 mRNA, complete cds Length = 2237 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 574 atcttcatcttcaccttcttcttc 597 ||||||||||||| |||||||||| Sbjct: 2100 atcttcatcttcatcttcttcttc 2123
>ref|NM_116248.2| Arabidopsis thaliana transcription regulator AT4G00270 mRNA, complete cds Length = 1307 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 575 tcttcatcttcaccttcttcttca 598 |||||||||||| ||||||||||| Sbjct: 233 tcttcatcttcatcttcttcttca 210
>gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete genome Length = 2201561 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttcag 599 ||||||||||||||| |||| ||||||| Sbjct: 1740930 tcatcttcatcttcatcttcatcttcag 1740903
>ref|XM_633172.1| Dictyostelium discoideum hypothetical protein (DDB0186469), partial mRNA Length = 1095 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 575 tcttcatcttcaccttcttc 594 |||||||||||||||||||| Sbjct: 350 tcttcatcttcaccttcttc 331
>ref|XM_632878.1| Dictyostelium discoideum hypothetical protein (DDB0186717), partial mRNA Length = 2679 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttcagtttc 603 ||||||||||||||| |||||| |||||||| Sbjct: 953 tcatcttcatcttcatattcttcatcagtttc 922
>gb|AC160552.13| Mus musculus chromosome 3, clone RP23-326D6, complete sequence Length = 210051 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttcttcagttt 602 ||||| ||||| |||||||||||||||| Sbjct: 126406 tcttcttcttctccttcttcttcagttt 126433
>gb|BC086457.1| Mus musculus Sp2 transcription factor, mRNA (cDNA clone MGC:99966 IMAGE:6490946), complete cds Length = 2919 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 533 tcaccatcaccaacactggc 552 |||||||||||||||||||| Sbjct: 1379 tcaccatcaccaacactggc 1398
>ref|XM_641046.1| Dictyostelium discoideum hypothetical protein (DDB0190424), partial mRNA Length = 930 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 581 tcttcaccttcttcttcagtttcttcag 608 |||||||||||||||||| |||| |||| Sbjct: 635 tcttcaccttcttcttcattttcatcag 608
>gb|AC120841.7| Mus musculus chromosome 8, clone RP24-553L18, complete sequence Length = 143963 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 588 cttcttcttcagtttcttca 607 |||||||||||||||||||| Sbjct: 127452 cttcttcttcagtttcttca 127433
>ref|XM_637440.1| Dictyostelium discoideum putative basic-leucine zipper transcription factor (DDB0220095), partial mRNA Length = 1530 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 579 catcttcaccttcttcttca 598 |||||||||||||||||||| Sbjct: 1298 catcttcaccttcttcttca 1317
>ref|XM_525388.1| PREDICTED: Pan troglodytes similar to BTB/POZ domain containing protein 4 (Zinc finger protein 340) (LOC470004), mRNA Length = 1416 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 482 gagtcttcttcatccttgtc 501 |||||||||||||||||||| Sbjct: 1358 gagtcttcttcatccttgtc 1339
>gb|AC165074.2| Mus musculus BAC clone RP24-501F1 from chromosome 12, complete sequence Length = 166016 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 472 tcttccctcagagtcttctt 491 |||||||||||||||||||| Sbjct: 6355 tcttccctcagagtcttctt 6336
>ref|XM_510500.1| PREDICTED: Pan troglodytes similar to serologically defined breast cancer antigen NY-BR-20 (LOC453534), mRNA Length = 2253 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttc 594 |||||||||||||||||||| Sbjct: 959 tcttcatcttcaccttcttc 978
>ref|NM_001011888.1| Canis familiaris ceroid-lipofuscinosis, neuronal 6, late infantile, variant (CLN6), mRNA Length = 2352 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttc 594 |||||||||||||||||||| Sbjct: 760 tcttcatcttcaccttcttc 779
>ref|XM_518168.1| PREDICTED: Pan troglodytes similar to Calpain inhibitor (Calpastatin) (Sperm BS-17 component) (LOC462348), mRNA Length = 1290 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 ttcttcttcagtttcttcag 608 |||||||||||||||||||| Sbjct: 510 ttcttcttcagtttcttcag 491
>ref|XM_524732.1| PREDICTED: Pan troglodytes similar to mesoderm induction early response 1 (LOC469347), mRNA Length = 2172 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 926 tcatcttcaccttcttcttc 907
>gb|AY753013.1| Penaeus monodon clone t1903 microsatellite sequence Length = 586 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttc 591 |||||||||||||||||||| Sbjct: 367 tcatcttcatcttcaccttc 386
>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome Length = 6438405 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 6436062 tcatcttcaccttcttcttc 6436043
>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete genome Length = 3397754 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 145 cgatgtaaaacatgatgacg 164 |||||||||||||||||||| Sbjct: 3013429 cgatgtaaaacatgatgacg 3013410
>gb|AC166156.4| Mus musculus BAC clone RP24-274H19 from chromosome 3, complete sequence Length = 176294 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 612 cagaaggctcagcagtagagacag 635 |||||||| ||||||||||||||| Sbjct: 123402 cagaaggcccagcagtagagacag 123425
>gb|AC093198.3| Drosophila melanogaster clone BACR03G24, complete sequence Length = 182901 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttc 591 |||||||||||||||||||| Sbjct: 23372 tcatcttcatcttcaccttc 23353
>gb|BC078149.1| Homo sapiens calpastatin, mRNA (cDNA clone IMAGE:6070772), partial cds Length = 2612 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 ttcttcttcagtttcttcag 608 |||||||||||||||||||| Sbjct: 293 ttcttcttcagtttcttcag 274
>ref|XM_418835.1| PREDICTED: Gallus gallus similar to acyloxyacyl hydrolase (LOC420737), mRNA Length = 1995 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttcttcttcag 599 |||||||||||||| |||||||||||| Sbjct: 677 tcatcttcatcttctgcttcttcttcag 704
>ref|XM_460891.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0F13211g) partial mRNA Length = 2349 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 571 ctcatcttcatcttcaccttcttc 594 |||||||||||||||| ||||||| Sbjct: 213 ctcatcttcatcttcatcttcttc 190
>ref|XM_462591.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0G25564g) partial mRNA Length = 318 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 581 tcttcaccttcttcttcagtttcttcag 608 |||||| |||||||||||| |||||||| Sbjct: 281 tcttcagcttcttcttcagcttcttcag 254
>ref|NM_008539.3| Mus musculus MAD homolog 1 (Drosophila) (Smad1), mRNA Length = 3133 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 588 cttcttcttcagtttcttca 607 |||||||||||||||||||| Sbjct: 529 cttcttcttcagtttcttca 510
>gb|BC058693.1| Mus musculus MAD homolog 1 (Drosophila), mRNA (cDNA clone MGC:61354 IMAGE:6811514), complete cds Length = 3133 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 588 cttcttcttcagtttcttca 607 |||||||||||||||||||| Sbjct: 529 cttcttcttcagtttcttca 510
>gb|AC186003.3| Pan troglodytes BAC clone CH251-72E16 from chromosome 5, complete sequence Length = 191785 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 589 ttcttcttcagtttcttcag 608 |||||||||||||||||||| Sbjct: 9572 ttcttcttcagtttcttcag 9591
>gb|BC013130.1| Homo sapiens ceroid-lipofuscinosis, neuronal 6, late infantile, variant, mRNA (cDNA clone MGC:21605 IMAGE:4517748), complete cds Length = 2123 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttc 594 |||||||||||||||||||| Sbjct: 707 tcttcatcttcaccttcttc 726
>gb|BC010849.1| Homo sapiens ceroid-lipofuscinosis, neuronal 6, late infantile, variant, mRNA (cDNA clone MGC:8851 IMAGE:3878776), complete cds Length = 2169 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttc 594 |||||||||||||||||||| Sbjct: 770 tcttcatcttcaccttcttc 789
>ref|NM_001033175.1| Mus musculus ceroid-lipofuscinosis, neuronal 6 (Cln6), mRNA Length = 2137 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttc 594 |||||||||||||||||||| Sbjct: 784 tcttcatcttcaccttcttc 803
>gb|AY809332.1| Schistosoma japonicum SJCHGC06359 protein mRNA, partial cds Length = 1805 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 569 gactcatcttcatcttcaccttct 592 |||||||| ||||||||||||||| Sbjct: 681 gactcatcatcatcttcaccttct 704
>ref|XM_710735.1| Candida albicans SC5314 hypothetical protein (CaO19_10365), mRNA Length = 414 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 579 catcttcaccttcttcttca 598 |||||||||||||||||||| Sbjct: 391 catcttcaccttcttcttca 372
>ref|XM_710684.1| Candida albicans SC5314 hypothetical protein (CaO19_2846), mRNA Length = 414 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 579 catcttcaccttcttcttca 598 |||||||||||||||||||| Sbjct: 391 catcttcaccttcttcttca 372
>ref|XM_676086.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN7909.2), mRNA Length = 6312 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 289 ttggagagtgacagcagcgccgtg 312 ||||||||||||||||||| |||| Sbjct: 4425 ttggagagtgacagcagcgtcgtg 4402
>gb|AC129330.4| Mus musculus BAC clone RP23-61B8 from chromosome 8, complete sequence Length = 218698 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 agcaccagcctcaaggagga 422 |||||||||||||||||||| Sbjct: 113205 agcaccagcctcaaggagga 113186
>ref|XM_454778.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E18414g predicted mRNA Length = 1632 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 571 ctcatcttcatcttcaccttcttcttca 598 |||||||||||||||| |||| |||||| Sbjct: 1548 ctcatcttcatcttcatcttcatcttca 1521
>ref|NM_024074.1| Homo sapiens transmembrane protein 38A (TMEM38A), mRNA Length = 1639 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 571 ctcatcttcatcttcacctt 590 |||||||||||||||||||| Sbjct: 725 ctcatcttcatcttcacctt 744
>gb|AC164958.3| Mus musculus BAC clone RP23-359G24 from chromosome 3, complete sequence Length = 230133 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 612 cagaaggctcagcagtagagacag 635 |||||||| ||||||||||||||| Sbjct: 207463 cagaaggcccagcagtagagacag 207486
>gb|AC024843.1| Caenorhabditis elegans cosmid Y61A9LA, complete sequence Length = 80606 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 571 ctcatcttcatcttcaccttcttcttca 598 |||||| ||||||||| ||||||||||| Sbjct: 76895 ctcatcctcatcttcatcttcttcttca 76922
>gb|U40839.3|OAU40839 Ovine adenovirus 7, complete genome Length = 29576 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttcttca 598 |||||||||||| ||||||||||| Sbjct: 17970 tcttcatcttcatcttcttcttca 17993
>gb|BC021759.1| Mus musculus Sp2 transcription factor, mRNA (cDNA clone MGC:30376 IMAGE:5151210), complete cds Length = 2946 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 533 tcaccatcaccaacactggc 552 |||||||||||||||||||| Sbjct: 1380 tcaccatcaccaacactggc 1399
>gb|AC135016.3| Mus musculus BAC clone RP24-244B4 from chromosome 18, complete sequence Length = 177193 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 365 agtggggtgttcttgttctt 384 |||||||||||||||||||| Sbjct: 139925 agtggggtgttcttgttctt 139944
>emb|CR974571.9| Mouse DNA sequence from clone RP23-145P19 on chromosome 12, complete sequence Length = 219782 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 571 ctcatcttcatcttcaccttcttcttca 598 |||||||||||||||| |||| |||||| Sbjct: 204190 ctcatcttcatcttcatcttcatcttca 204163
>emb|BX890591.12| Zebrafish DNA sequence from clone DKEY-184J23 in linkage group 19, complete sequence Length = 171079 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttcttcagtttcttc 606 |||||||||||| ||||||||| |||||||| Sbjct: 81120 tcttcatcttcattttcttcttctgtttcttc 81151
>ref|XM_748346.1| Aspergillus fumigatus Af293 hypothetical protein (Afu5g12120) partial mRNA Length = 519 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 280 atccatgttttggagagtga 299 |||||||||||||||||||| Sbjct: 340 atccatgttttggagagtga 359
>gb|AY274934.1| Saimiriine herpesvirus 2 latency associated nuclear antigen gene, complete cds Length = 1506 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 575 tcttcatcttcaccttcttcttcagtttcttc 606 ||||| |||||| |||||||||||| |||||| Sbjct: 857 tcttcttcttcagcttcttcttcagcttcttc 826
>ref|XM_449005.1| Candida glabrata CBS138, CAGL0L05302g partial mRNA Length = 1635 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 571 ctcatcttcatcttcaccttcttcttca 598 |||||||||||||||| |||| |||||| Sbjct: 1461 ctcatcttcatcttcatcttcatcttca 1434
>ref|XM_449262.1| Candida glabrata CBS138, CAGL0L11352g partial mRNA Length = 1632 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttc 591 |||||||||||||||||||| Sbjct: 1583 tcatcttcatcttcaccttc 1564
>gb|BC016066.1| Homo sapiens calpastatin, mRNA (cDNA clone IMAGE:4861420), containing frame-shift errors Length = 1335 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 ttcttcttcagtttcttcag 608 |||||||||||||||||||| Sbjct: 922 ttcttcttcagtttcttcag 903
>gb|BC043138.1| Mus musculus expressed sequence AI480556, mRNA (cDNA clone IMAGE:6821344), containing frame-shift errors Length = 4233 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 573 catcttcatcttcaccttct 592 |||||||||||||||||||| Sbjct: 811 catcttcatcttcaccttct 830
>gb|AC126256.4| Mus musculus BAC clone RP24-235B15 from chromosome 7, complete sequence Length = 188677 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 573 catcttcatcttcaccttct 592 |||||||||||||||||||| Sbjct: 53022 catcttcatcttcaccttct 53003
>gb|AC122385.2| Mus musculus BAC clone RP24-72B22 from chromosome 1, complete sequence Length = 178821 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 571 ctcatcttcatcttcaccttcttcttca 598 |||||||||||||||| |||| |||||| Sbjct: 10718 ctcatcttcatcttcatcttcatcttca 10691
>gb|AC124201.4| Mus musculus BAC clone RP23-329B24 from chromosome 8, complete sequence Length = 234158 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 588 cttcttcttcagtttcttca 607 |||||||||||||||||||| Sbjct: 173944 cttcttcttcagtttcttca 173963
>gb|AC122195.4| Mus musculus BAC clone RP23-49D1 from 8, complete sequence Length = 204335 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 438 actcaccatatccacatgca 457 |||||||||||||||||||| Sbjct: 22043 actcaccatatccacatgca 22062
>gb|BC057741.1| Xenopus laevis hypothetical protein MGC69016, mRNA (cDNA clone MGC:69016 IMAGE:4964017), complete cds Length = 3812 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 588 cttcttcttcagtttcttca 607 |||||||||||||||||||| Sbjct: 473 cttcttcttcagtttcttca 454
>ref|XM_648948.1| Entamoeba histolytica HM-1:IMSS RNA-binding protein (64.t00007) partial mRNA Length = 1245 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttcagtttc 603 |||||||| |||||| ||||||||||| |||| Sbjct: 278 tcatcttcttcttcatcttcttcttcattttc 247
>ref|XM_762871.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_228_26673_25900) partial mRNA Length = 774 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 571 ctcatcttcatcttcaccttcttcttca 598 |||||||||||||||| |||| |||||| Sbjct: 342 ctcatcttcatcttcatcttcatcttca 369
>ref|XM_846977.1| PREDICTED: Canis familiaris similar to mesoderm induction early response 1, transcript variant 2 (LOC479536), mRNA Length = 2485 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 517 tcatcttcaccttcttcttc 498
>ref|XM_859837.1| PREDICTED: Canis familiaris similar to mesoderm induction early response 1, transcript variant 6 (LOC479536), mRNA Length = 2559 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 591 tcatcttcaccttcttcttc 572
>ref|XM_859816.1| PREDICTED: Canis familiaris similar to mesoderm induction early response 1, transcript variant 5 (LOC479536), mRNA Length = 1795 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 501 tcatcttcaccttcttcttc 482
>ref|XM_859756.1| PREDICTED: Canis familiaris similar to mesoderm induction early response 1, transcript variant 3 (LOC479536), mRNA Length = 2469 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 501 tcatcttcaccttcttcttc 482
>ref|XM_720944.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY05565) partial mRNA Length = 8258 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttcagtttc 603 ||||||||||||||| |||| |||||| |||| Sbjct: 7414 tcatcttcatcttcatcttcatcttcattttc 7383
>ref|XM_723988.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY01343) partial mRNA Length = 1491 Score = 40.1 bits (20), Expect = 9.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttcagtttcttca 607 |||||||| |||||| ||||||||||| ||||||| Sbjct: 674 tcatcttcttcttcatcttcttcttcatcttcttca 639 Score = 40.1 bits (20), Expect = 9.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttcagtttcttca 607 |||||||| |||||| ||||||||||| ||||||| Sbjct: 641 tcatcttcttcttcatcttcttcttcatcttcttca 606
>ref|XM_725227.1| Plasmodium yoelii yoelii str. 17XNL acidic phosphoprotein precursor (PY02439) partial mRNA Length = 942 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttcagtttc 603 ||||||||||||||| |||| |||||| |||| Sbjct: 887 tcatcttcatcttcatcttcatcttcattttc 856
>ref|XM_950448.1| Theileria annulata strain Ankara hypothetical protein (TA05580) partial mRNA Length = 1104 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 575 tcttcatcttcaccttcttcttca 598 |||||||||||| ||||||||||| Sbjct: 359 tcttcatcttcatcttcttcttca 336
>gb|BC013579.1| Homo sapiens calpastatin, mRNA (cDNA clone MGC:9402 IMAGE:3878564), complete cds Length = 2680 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 ttcttcttcagtttcttcag 608 |||||||||||||||||||| Sbjct: 614 ttcttcttcagtttcttcag 595
>ref|XM_660103.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.60041) partial mRNA Length = 1146 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 575 tcttcatcttcaccttcttcttca 598 |||||||||||| ||||||||||| Sbjct: 554 tcttcatcttcatcttcttcttca 531
>ref|XM_660565.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.20378) partial mRNA Length = 1665 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttcttct 595 ||||||||||||||| |||||||| Sbjct: 172 tcatcttcatcttcatcttcttct 195
>ref|XM_662913.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.10339) partial mRNA Length = 540 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 571 ctcatcttcatcttcaccttcttcttca 598 |||||||||||||||| |||| |||||| Sbjct: 66 ctcatcttcatcttcatcttcatcttca 93
>gb|U41108.1| Caenorhabditis elegans cosmid C08D8, complete sequence Length = 19576 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttcttca 598 ||||||||||| |||||||||||| Sbjct: 12709 tcttcatcttctccttcttcttca 12732
>gb|BC054818.1| Mus musculus expressed sequence AI480556, mRNA (cDNA clone IMAGE:4527847), partial cds Length = 6474 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 573 catcttcatcttcaccttct 592 |||||||||||||||||||| Sbjct: 3061 catcttcatcttcaccttct 3080
>gb|AC148360.10| Medicago truncatula clone mth2-27i5, complete sequence Length = 113746 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 571 ctcatcttcatcttcaccttcttcttca 598 |||||||||||||||| |||| |||||| Sbjct: 45092 ctcatcttcatcttcatcttcatcttca 45119
>gb|AC147499.5| Medicago truncatula clone mth2-22h5, complete sequence Length = 128625 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttct 595 |||||||| ||||||||||||||| Sbjct: 37086 tcatcttcttcttcaccttcttct 37063
>ref|NM_001007478.1| Xenopus tropicalis smad5 protein (smad5), mRNA Length = 3386 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 588 cttcttcttcagtttcttca 607 |||||||||||||||||||| Sbjct: 338 cttcttcttcagtttcttca 319
>gb|BC075389.1| Xenopus tropicalis smad5 protein, mRNA (cDNA clone MGC:89119 IMAGE:7006830), complete cds Length = 3386 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 588 cttcttcttcagtttcttca 607 |||||||||||||||||||| Sbjct: 338 cttcttcttcagtttcttca 319
>emb|AL671884.3| Human DNA sequence from clone RP13-44L19 on chromosome 6 Contains the gene for mandaselin (FLJ12838) and a CpG island, complete sequence Length = 105273 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 570 actcatcttcatcttcaccttctt 593 ||||||||||||||||| |||||| Sbjct: 42425 actcatcttcatcttcagcttctt 42448
>ref|XM_501418.1| Yarrowia lipolytica CLIB122, YALI0C03894g predicted mRNA Length = 1839 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 571 ctcatcttcatcttcaccttcttcttca 598 |||||||||||||||| |||| |||||| Sbjct: 657 ctcatcttcatcttcatcttcatcttca 684
>gb|AC138435.2| Artibeus jamaicensis clone 21H16, complete sequence Length = 95559 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 590 tcttcttcagtttcttcagt 609 |||||||||||||||||||| Sbjct: 92433 tcttcttcagtttcttcagt 92452
>gb|AF158101.6| Enterobacteria phage T4, complete genome Length = 168903 Score = 40.1 bits (20), Expect = 9.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttcttcagtttcttca 607 ||||||||||||||| | || ||||||| ||||||| Sbjct: 102956 tcatcttcatcttcatcctcgtcttcaggttcttca 102921
>ref|NM_001750.4| Homo sapiens calpastatin (CAST), transcript variant 1, mRNA Length = 2438 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 ttcttcttcagtttcttcag 608 |||||||||||||||||||| Sbjct: 632 ttcttcttcagtttcttcag 613
>ref|NM_173060.1| Homo sapiens calpastatin (CAST), transcript variant 2, mRNA Length = 4296 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 ttcttcttcagtttcttcag 608 |||||||||||||||||||| Sbjct: 607 ttcttcttcagtttcttcag 588
>ref|NM_173062.1| Homo sapiens calpastatin (CAST), transcript variant 4, mRNA Length = 2272 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 ttcttcttcagtttcttcag 608 |||||||||||||||||||| Sbjct: 500 ttcttcttcagtttcttcag 481
>gb|BT009783.1| Homo sapiens calpastatin mRNA, complete cds Length = 2004 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 ttcttcttcagtttcttcag 608 |||||||||||||||||||| Sbjct: 396 ttcttcttcagtttcttcag 377
>gb|AC026231.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-114F4, complete sequence Length = 208199 Score = 40.1 bits (20), Expect = 9.1 Identities = 32/36 (88%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttcttcttcagtttcttca 607 |||||||||||||| ||||||||||| ||||||| Sbjct: 131964 tcatcttcatcttcctcttcttcttcatcttcttca 131999
>emb|AL162504.12| Human DNA sequence from clone RP11-199O14 on chromosome 20 Contains part of a novel gene, complete sequence Length = 105757 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 576 cttcatcttcaccttcttct 595 |||||||||||||||||||| Sbjct: 51869 cttcatcttcaccttcttct 51888
>emb|AL139216.14| Human DNA sequence from clone RP5-1017J17 on chromosome 1p31.2-32.2 Contains the 5' end of the gene for a novel protein (FLJ23129) and the 5' end of the gene for mesoderm induction early response 1 (MI-ER1), complete sequence Length = 112515 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 102761 tcatcttcaccttcttcttc 102742
>emb|AL035541.15|HS718J7 Human DNA sequence from clone RP4-718J7 on chromosome 20q13.31-13.33 Contains the PCK1 gene for soluble phosphoenolpyruvate carboxykinase 1, the ZBP1 gene for Z-DNA binding protein 1, the 3' end of the TMEPAI gene for transmembrane prostate androgen induced mRNA, two putative novel genes, the 5' end of the CTCFL gene for CCCTC-binding factor (zinc finger)-like and a CpG island, complete sequence Length = 130435 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 461 tgcaaggcccttcttccctc 480 |||||||||||||||||||| Sbjct: 2683 tgcaaggcccttcttccctc 2664
>gb|AF411550.1| Medicago sativa hypothetical protein mRNA, complete cds Length = 1268 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 641 tcatcttcaccttcttcttc 660 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 501 tcatcttcaccttcttcttc 520
>emb|X62540.1|PPORIGS P.putida genes rpmH, rnpA, 9k, 60k, 50k, gidA, gidB, uncI and uncB Length = 9850 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 2357 tcatcttcaccttcttcttc 2376
>gb|AF515448.1| Homo sapiens mesoderm induction early response 1 N1-beta mRNA, complete cds, alternatively spliced Length = 4972 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 598 tcatcttcaccttcttcttc 579
>gb|AF515447.1| Homo sapiens mesoderm induction early response 1 N2-beta mRNA, complete cds, alternatively spliced Length = 4897 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 523 tcatcttcaccttcttcttc 504
>gb|AF515446.1| Homo sapiens mesoderm induction early response 1 N3-beta mRNA, complete cds, alternatively spliced Length = 4816 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 442 tcatcttcaccttcttcttc 423
>gb|AY124194.1| Homo sapiens mesoderm induction early response 1 N3-beta-ii (MIER1) mRNA, complete cds; alternatively spliced Length = 3455 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 442 tcatcttcaccttcttcttc 423
>gb|AY124193.1| Homo sapiens mesoderm induction early response 1 N2-beta-ii (MIER1) mRNA, complete cds; alternatively spliced Length = 3536 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 523 tcatcttcaccttcttcttc 504
>gb|AY124192.1| Homo sapiens mesoderm induction early response 1 N1-beta-ii (MIER1) mRNA, complete cds; alternatively spliced Length = 3611 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 598 tcatcttcaccttcttcttc 579
>gb|AY124191.1| Homo sapiens mesoderm induction early response 1 N3-beta-i (MIER1) mRNA, complete cds; alternatively spliced Length = 2473 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 442 tcatcttcaccttcttcttc 423
>gb|AY124190.1| Homo sapiens mesoderm induction early response 1 N2-beta-i (MIER1) mRNA, complete cds; alternatively spliced Length = 2554 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 523 tcatcttcaccttcttcttc 504
>gb|AY124189.1| Homo sapiens mesoderm induction early response 1 N1-beta-i (MIER1) mRNA, complete cds; alternatively spliced Length = 2629 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 598 tcatcttcaccttcttcttc 579
>gb|AY124188.1| Homo sapiens mesoderm induction early response 1 N3-alpha (MIER1) mRNA, complete cds; alternatively spliced Length = 1648 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 442 tcatcttcaccttcttcttc 423
>gb|AY124187.1| Homo sapiens mesoderm induction early response 1 N2-alpha (MIER1) mRNA, complete cds; alternatively spliced Length = 1729 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 523 tcatcttcaccttcttcttc 504
>gb|AY124186.1| Homo sapiens mesoderm induction early response 1 N1-alpha (MIER1) mRNA, complete cds; alternatively spliced Length = 1804 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 598 tcatcttcaccttcttcttc 579
>emb|CR628337.1| Legionella pneumophila str. Lens complete genome Length = 3345687 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 145 cgatgtaaaacatgatgacg 164 |||||||||||||||||||| Sbjct: 2960248 cgatgtaaaacatgatgacg 2960229
>emb|CR628336.1| Legionella pneumophila str. Paris complete genome Length = 3503610 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 145 cgatgtaaaacatgatgacg 164 |||||||||||||||||||| Sbjct: 3100509 cgatgtaaaacatgatgacg 3100490
>emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii Length = 2336804 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 571 ctcatcttcatcttcaccttcttc 594 |||||||||||||||| ||||||| Sbjct: 1049474 ctcatcttcatcttcatcttcttc 1049451
>emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS767 of Debaryomyces hansenii Length = 2051428 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 581 tcttcaccttcttcttcagtttcttcag 608 |||||| |||||||||||| |||||||| Sbjct: 1948125 tcttcagcttcttcttcagcttcttcag 1948098
>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y-1140 of Kluyveromyces lactis Length = 2234072 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 571 ctcatcttcatcttcaccttcttcttca 598 |||||||||||||||| |||| |||||| Sbjct: 1634514 ctcatcttcatcttcatcttcatcttca 1634487
>emb|CR380958.1| Candida glabrata strain CBS138 chromosome L complete sequence Length = 1440588 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 572 tcatcttcatcttcaccttc 591 |||||||||||||||||||| Sbjct: 1206453 tcatcttcatcttcaccttc 1206472 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 571 ctcatcttcatcttcaccttcttcttca 598 |||||||||||||||| |||| |||||| Sbjct: 588355 ctcatcttcatcttcatcttcatcttca 588382
>gb|AC164614.3| Mus musculus BAC clone RP23-337L12 from chromosome 9, complete sequence Length = 215002 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 575 tcttcatcttcaccttcttc 594 |||||||||||||||||||| Sbjct: 56705 tcttcatcttcaccttcttc 56686
>gb|AC159634.2| Mus musculus BAC clone RP24-127K13 from chromosome 12, complete sequence Length = 146684 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 571 ctcatcttcatcttcaccttcttcttca 598 |||||||||||||||| |||| |||||| Sbjct: 47577 ctcatcttcatcttcatcttcatcttca 47550
>emb|AL445985.10| Human DNA sequence from clone RP11-45B20 on chromosome 13, complete sequence Length = 178531 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttcagtttctt 605 |||||||||||||| |||||| |||||| Sbjct: 78537 tcatcttcaccttcatcttcactttctt 78510
>emb|AL161471.2|ATCHRIV1 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 1 Length = 197119 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttcttca 598 |||||||||||| ||||||||||| Sbjct: 117309 tcttcatcttcatcttcttcttca 117332
>emb|AL110247.1|HSM800908 Homo sapiens mRNA; cDNA DKFZp434N101 (from clone DKFZp434N101) Length = 2419 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 555 tgtggtggacaatggactca 574 |||||||||||||||||||| Sbjct: 1245 tgtggtggacaatggactca 1264
>emb|AJ875418.1| Canis familiaris mRNA for ceroid-lipofuscinosis, neuronal 6 (cln6 gene) Length = 2352 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttc 594 |||||||||||||||||||| Sbjct: 760 tcttcatcttcaccttcttc 779
>emb|AJ410493.1|SHE410493 Saimiriine herpesvirus 2 complete L-DNA sequence, strain C488 Length = 113027 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Plus Query: 575 tcttcatcttcaccttcttcttcagtttcttc 606 ||||| |||||| |||||||||||| |||||| Sbjct: 106458 tcttcttcttcagcttcttcttcagcttcttc 106489
>gb|BC017423.1| Homo sapiens mesoderm induction early response 1 homolog (Xenopus laevis), mRNA (cDNA clone IMAGE:4692746), complete cds Length = 754 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 419 tcatcttcaccttcttcttc 400
>emb|AJ438615.1|NTA438615 Nicotiana tabacum mRNA for nucleosome assembly protein 1 - like protein 3 Length = 1566 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 571 ctcatcttcatcttcaccttcttcttca 598 |||||||||||||||| | ||||||||| Sbjct: 1096 ctcatcttcatcttcatcatcttcttca 1069
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome Length = 7074893 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 7072070 tcatcttcaccttcttcttc 7072051
>emb|CR860493.1| Pongo pygmaeus mRNA; cDNA DKFZp469E0716 (from clone DKFZp469E0716) Length = 4278 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 ttcttcttcagtttcttcag 608 |||||||||||||||||||| Sbjct: 589 ttcttcttcagtttcttcag 570
>emb|CR858124.1| Pongo pygmaeus mRNA; cDNA DKFZp468M2312 (from clone DKFZp468M2312) Length = 3289 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 589 ttcttcttcagtttcttcag 608 |||||||||||||||||||| Sbjct: 712 ttcttcttcagtttcttcag 693
>emb|CR857588.1| Pongo pygmaeus mRNA; cDNA DKFZp459P1430 (from clone DKFZp459P1430) Length = 4326 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 302 tcatcttcaccttcttcttc 283
>gb|AC107871.10| Homo sapiens chromosome 15, clone RP11-315D16, complete sequence Length = 171605 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 575 tcttcatcttcaccttcttc 594 |||||||||||||||||||| Sbjct: 97017 tcttcatcttcaccttcttc 96998
>emb|CR627441.1| Homo sapiens mRNA; cDNA DKFZp781G0451 (from clone DKFZp781G0451) Length = 4527 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 497 tcatcttcaccttcttcttc 478
>gb|AC008737.11| Homo sapiens chromosome 19 clone CTD-2538G9, complete sequence Length = 248281 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 571 ctcatcttcatcttcacctt 590 |||||||||||||||||||| Sbjct: 2102 ctcatcttcatcttcacctt 2121
>gb|AC165446.16| Medicago truncatula clone mth2-61p21, complete sequence Length = 135557 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 52768 tcatcttcaccttcttcttc 52749
>gb|AC149578.15| Medicago truncatula clone mth2-94f23, complete sequence Length = 119657 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 578 tcatcttcaccttcttcttc 597 |||||||||||||||||||| Sbjct: 27405 tcatcttcaccttcttcttc 27424
>dbj|AK126720.1| Homo sapiens cDNA FLJ44766 fis, clone BRACE3032537 Length = 4247 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 482 gagtcttcttcatccttgtc 501 |||||||||||||||||||| Sbjct: 930 gagtcttcttcatccttgtc 911
>gb|AC148756.2| Medicago truncatula clone mth2-22d18, complete sequence Length = 107160 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 587 ccttcttcttcagtttcttc 606 |||||||||||||||||||| Sbjct: 20922 ccttcttcttcagtttcttc 20941
>gb|AC137080.13| Medicago truncatula clone mth2-9a7, complete sequence Length = 129121 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 572 tcatcttcatcttcaccttcttct 595 |||||||| ||||||||||||||| Sbjct: 115000 tcatcttcttcttcaccttcttct 114977 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,580,174 Number of Sequences: 3902068 Number of extensions: 6580174 Number of successful extensions: 159419 Number of sequences better than 10.0: 377 Number of HSP's better than 10.0 without gapping: 378 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 157680 Number of HSP's gapped (non-prelim): 1671 length of query: 666 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 643 effective length of database: 17,143,297,704 effective search space: 11023140423672 effective search space used: 11023140423672 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)