ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd13d09 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC097174.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1111_A10, complete sequence Length = 155106 Score = 361 bits (182), Expect = 2e-96 Identities = 296/334 (88%) Strand = Plus / Plus Query: 289 gtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgaccaagtcgtcggg 348 ||||| ||||||| ||||||||||||||||||||||||||||||||| | ||||||||| Sbjct: 152056 gtagcagcggtaggccggggtgtacatgcagctctcggcgtacttgacgaggtcgtcggg 152115 Query: 349 ccgcggcagccggctcgccaggcccaggtcataggcctttgcggccaccttggcggcgat 408 ||||| || ||||| || ||||| || || || ||||| ||||| |||||||||||||| Sbjct: 152116 gcgcgggaggcggctggcgaggccgagctcgtacgccttggcggcgaccttggcggcgat 152175 Query: 409 gttggccgagatcttgcggatgttggtgaagggcgggaagatgagccccttgtcgaagtt 468 || || |||||||||||||||||||||||||||||||||||||||||| || ||||||| Sbjct: 152176 gtgtgcggagatcttgcggatgttggtgaagggcgggaagatgagccccctggcgaagtt 152235 Query: 469 ctcctgggtcacctgctccgccagcgcctccgaggcggcgaggagcatgtcgtcgtggac 528 |||| | ||||||||||||||||||||||||| || || || ||||||||||||||||| Sbjct: 152236 gtcctcgctcacctgctccgccagcgcctccgacgccgccagcagcatgtcgtcgtggac 152295 Query: 529 gcggatggcgccggagatgacgacgccgagcccgaacccggggaacacgtaggcgttgtt 588 |||||||||||| ||||| || ||||| ||||||||||| ||||| | |||||||||||| Sbjct: 152296 gcggatggcgcccgagatcaccacgcccagcccgaaccccgggaagatgtaggcgttgtt 152355 Query: 589 ggactgcccgggcacgtacgtcttcccctcgtac 622 || ||||| |||||||||||||||||||||||| Sbjct: 152356 cgattgccccggcacgtacgtcttcccctcgtac 152389
>gb|AY435404.1| Oryza sativa (japonica cultivar-group) NADP malic enzyme mRNA, complete cds Length = 2117 Score = 361 bits (182), Expect = 2e-96 Identities = 296/334 (88%) Strand = Plus / Minus Query: 289 gtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgaccaagtcgtcggg 348 ||||| ||||||| ||||||||||||||||||||||||||||||||| | ||||||||| Sbjct: 1848 gtagcagcggtaggccggggtgtacatgcagctctcggcgtacttgacgaggtcgtcggg 1789 Query: 349 ccgcggcagccggctcgccaggcccaggtcataggcctttgcggccaccttggcggcgat 408 ||||| || ||||| || ||||| || || || ||||| ||||| |||||||||||||| Sbjct: 1788 gcgcgggaggcggctggcgaggccgagctcgtacgccttggcggcgaccttggcggcgat 1729 Query: 409 gttggccgagatcttgcggatgttggtgaagggcgggaagatgagccccttgtcgaagtt 468 || || |||||||||||||||||||||||||||||||||||||||||| || ||||||| Sbjct: 1728 gtgtgcggagatcttgcggatgttggtgaagggcgggaagatgagccccctggcgaagtt 1669 Query: 469 ctcctgggtcacctgctccgccagcgcctccgaggcggcgaggagcatgtcgtcgtggac 528 |||| | ||||||||||||||||||||||||| || || || ||||||||||||||||| Sbjct: 1668 gtcctcgctcacctgctccgccagcgcctccgacgccgccagcagcatgtcgtcgtggac 1609 Query: 529 gcggatggcgccggagatgacgacgccgagcccgaacccggggaacacgtaggcgttgtt 588 |||||||||||| ||||| || ||||| ||||||||||| ||||| | |||||||||||| Sbjct: 1608 gcggatggcgcccgagatcaccacgcccagcccgaaccccgggaagatgtaggcgttgtt 1549 Query: 589 ggactgcccgggcacgtacgtcttcccctcgtac 622 || ||||| |||||||||||||||||||||||| Sbjct: 1548 cgattgccccggcacgtacgtcttcccctcgtac 1515
>gb|AC093920.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1725_E07, complete sequence Length = 87244 Score = 361 bits (182), Expect = 2e-96 Identities = 296/334 (88%) Strand = Plus / Plus Query: 289 gtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgaccaagtcgtcggg 348 ||||| ||||||| ||||||||||||||||||||||||||||||||| | ||||||||| Sbjct: 52835 gtagcagcggtaggccggggtgtacatgcagctctcggcgtacttgacgaggtcgtcggg 52894 Query: 349 ccgcggcagccggctcgccaggcccaggtcataggcctttgcggccaccttggcggcgat 408 ||||| || ||||| || ||||| || || || ||||| ||||| |||||||||||||| Sbjct: 52895 gcgcgggaggcggctggcgaggccgagctcgtacgccttggcggcgaccttggcggcgat 52954 Query: 409 gttggccgagatcttgcggatgttggtgaagggcgggaagatgagccccttgtcgaagtt 468 || || |||||||||||||||||||||||||||||||||||||||||| || ||||||| Sbjct: 52955 gtgtgcggagatcttgcggatgttggtgaagggcgggaagatgagccccctggcgaagtt 53014 Query: 469 ctcctgggtcacctgctccgccagcgcctccgaggcggcgaggagcatgtcgtcgtggac 528 |||| | ||||||||||||||||||||||||| || || || ||||||||||||||||| Sbjct: 53015 gtcctcgctcacctgctccgccagcgcctccgacgccgccagcagcatgtcgtcgtggac 53074 Query: 529 gcggatggcgccggagatgacgacgccgagcccgaacccggggaacacgtaggcgttgtt 588 |||||||||||| ||||| || ||||| ||||||||||| ||||| | |||||||||||| Sbjct: 53075 gcggatggcgcccgagatcaccacgcccagcccgaaccccgggaagatgtaggcgttgtt 53134 Query: 589 ggactgcccgggcacgtacgtcttcccctcgtac 622 || ||||| |||||||||||||||||||||||| Sbjct: 53135 cgattgccccggcacgtacgtcttcccctcgtac 53168
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 361 bits (182), Expect = 2e-96 Identities = 296/334 (88%) Strand = Plus / Plus Query: 289 gtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgaccaagtcgtcggg 348 ||||| ||||||| ||||||||||||||||||||||||||||||||| | ||||||||| Sbjct: 5237553 gtagcagcggtaggccggggtgtacatgcagctctcggcgtacttgacgaggtcgtcggg 5237612 Query: 349 ccgcggcagccggctcgccaggcccaggtcataggcctttgcggccaccttggcggcgat 408 ||||| || ||||| || ||||| || || || ||||| ||||| |||||||||||||| Sbjct: 5237613 gcgcgggaggcggctggcgaggccgagctcgtacgccttggcggcgaccttggcggcgat 5237672 Query: 409 gttggccgagatcttgcggatgttggtgaagggcgggaagatgagccccttgtcgaagtt 468 || || |||||||||||||||||||||||||||||||||||||||||| || ||||||| Sbjct: 5237673 gtgtgcggagatcttgcggatgttggtgaagggcgggaagatgagccccctggcgaagtt 5237732 Query: 469 ctcctgggtcacctgctccgccagcgcctccgaggcggcgaggagcatgtcgtcgtggac 528 |||| | ||||||||||||||||||||||||| || || || ||||||||||||||||| Sbjct: 5237733 gtcctcgctcacctgctccgccagcgcctccgacgccgccagcagcatgtcgtcgtggac 5237792 Query: 529 gcggatggcgccggagatgacgacgccgagcccgaacccggggaacacgtaggcgttgtt 588 |||||||||||| ||||| || ||||| ||||||||||| ||||| | |||||||||||| Sbjct: 5237793 gcggatggcgcccgagatcaccacgcccagcccgaaccccgggaagatgtaggcgttgtt 5237852 Query: 589 ggactgcccgggcacgtacgtcttcccctcgtac 622 || ||||| |||||||||||||||||||||||| Sbjct: 5237853 cgattgccccggcacgtacgtcttcccctcgtac 5237886
>dbj|AK099249.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013127E04, full insert sequence Length = 2167 Score = 361 bits (182), Expect = 2e-96 Identities = 296/334 (88%) Strand = Plus / Minus Query: 289 gtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgaccaagtcgtcggg 348 ||||| ||||||| ||||||||||||||||||||||||||||||||| | ||||||||| Sbjct: 1854 gtagcagcggtaggccggggtgtacatgcagctctcggcgtacttgacgaggtcgtcggg 1795 Query: 349 ccgcggcagccggctcgccaggcccaggtcataggcctttgcggccaccttggcggcgat 408 ||||| || ||||| || ||||| || || || ||||| ||||| |||||||||||||| Sbjct: 1794 gcgcgggaggcggctggcgaggccgagctcgtacgccttggcggcgaccttggcggcgat 1735 Query: 409 gttggccgagatcttgcggatgttggtgaagggcgggaagatgagccccttgtcgaagtt 468 || || |||||||||||||||||||||||||||||||||||||||||| || ||||||| Sbjct: 1734 gtgtgcggagatcttgcggatgttggtgaagggcgggaagatgagccccctggcgaagtt 1675 Query: 469 ctcctgggtcacctgctccgccagcgcctccgaggcggcgaggagcatgtcgtcgtggac 528 |||| | ||||||||||||||||||||||||| || || || ||||||||||||||||| Sbjct: 1674 gtcctcgctcacctgctccgccagcgcctccgacgccgccagcagcatgtcgtcgtggac 1615 Query: 529 gcggatggcgccggagatgacgacgccgagcccgaacccggggaacacgtaggcgttgtt 588 |||||||||||| ||||| || ||||| ||||||||||| ||||| | |||||||||||| Sbjct: 1614 gcggatggcgcccgagatcaccacgcccagcccgaaccccgggaagatgtaggcgttgtt 1555 Query: 589 ggactgcccgggcacgtacgtcttcccctcgtac 622 || ||||| |||||||||||||||||||||||| Sbjct: 1554 cgattgccccggcacgtacgtcttcccctcgtac 1521
>dbj|AK070360.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023048G01, full insert sequence Length = 2241 Score = 361 bits (182), Expect = 2e-96 Identities = 296/334 (88%) Strand = Plus / Minus Query: 289 gtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgaccaagtcgtcggg 348 ||||| ||||||| ||||||||||||||||||||||||||||||||| | ||||||||| Sbjct: 1859 gtagcagcggtaggccggggtgtacatgcagctctcggcgtacttgacgaggtcgtcggg 1800 Query: 349 ccgcggcagccggctcgccaggcccaggtcataggcctttgcggccaccttggcggcgat 408 ||||| || ||||| || ||||| || || || ||||| ||||| |||||||||||||| Sbjct: 1799 gcgcgggaggcggctggcgaggccgagctcgtacgccttggcggcgaccttggcggcgat 1740 Query: 409 gttggccgagatcttgcggatgttggtgaagggcgggaagatgagccccttgtcgaagtt 468 || || |||||||||||||||||||||||||||||||||||||||||| || ||||||| Sbjct: 1739 gtgtgcggagatcttgcggatgttggtgaagggcgggaagatgagccccctggcgaagtt 1680 Query: 469 ctcctgggtcacctgctccgccagcgcctccgaggcggcgaggagcatgtcgtcgtggac 528 |||| | ||||||||||||||||||||||||| || || || ||||||||||||||||| Sbjct: 1679 gtcctcgctcacctgctccgccagcgcctccgacgccgccagcagcatgtcgtcgtggac 1620 Query: 529 gcggatggcgccggagatgacgacgccgagcccgaacccggggaacacgtaggcgttgtt 588 |||||||||||| ||||| || ||||| ||||||||||| ||||| | |||||||||||| Sbjct: 1619 gcggatggcgcccgagatcaccacgcccagcccgaaccccgggaagatgtaggcgttgtt 1560 Query: 589 ggactgcccgggcacgtacgtcttcccctcgtac 622 || ||||| |||||||||||||||||||||||| Sbjct: 1559 cgattgccccggcacgtacgtcttcccctcgtac 1526
>gb|AY594687.1| Hydrilla verticillata NADP-dependent malic enzyme 1 mRNA, complete cds Length = 2591 Score = 113 bits (57), Expect = 7e-22 Identities = 162/197 (82%) Strand = Plus / Minus Query: 377 tcataggcctttgcggccaccttggcggcgatgttggccgagatcttgcggatgttggtg 436 ||||| ||||| ||||| ||||| || || |||||||| || ||||| | |||||||||| Sbjct: 2026 tcatatgccttcgcggcaaccttcgcagcaatgttggcagatatctttctgatgttggtg 1967 Query: 437 aagggcgggaagatgagccccttgtcgaagttctcctgggtcacctgctccgccagcgcc 496 ||||| ||| |||| || ||||| ||||||||||||| |||||||||||||||| || Sbjct: 1966 aagggagggtagataaggcccttctcgaagttctcctccgtcacctgctccgccaatgct 1907 Query: 497 tccgaggcggcgaggagcatgtcgtcgtggacgcggatggcgccggagatgacgacgccg 556 ||||| || || || ||||||||||| ||||| ||||| || || || ||||| | ||| Sbjct: 1906 tccgaagctgcaagtagcatgtcgtcatggacacggatcgccccagacatgacaaggcca 1847 Query: 557 agcccgaacccggggaa 573 || ||||| |||||||| Sbjct: 1846 agaccgaatccggggaa 1830 Score = 60.0 bits (30), Expect = 9e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 285 acctgtagctgcggtagagcggggtgtacatgcagctctcggcgta 330 |||||||||||||||||| |||| ||||||| |||||||| ||||| Sbjct: 2118 acctgtagctgcggtagaccgggctgtacatacagctctctgcgta 2073
>gb|AY315822.1| Zea mays non-photosynthetic NADP-malic enzyme mRNA, complete cds Length = 1935 Score = 101 bits (51), Expect = 3e-18 Identities = 138/167 (82%) Strand = Plus / Minus Query: 428 atgttggtgaagggcgggaagatgagccccttgtcgaagttctcctgggtcacctgctcc 487 ||||||||||||||||||||||| |||||||||||||||||||| || |||| | Sbjct: 1790 atgttggtgaagggcgggaagattgatcccttgtcgaagttctcctgtgtggcctgagca 1731 Query: 488 gccagcgcctccgaggcggcgaggagcatgtcgtcgtggacgcggatggcgccggagatg 547 || || || ||||||||||| || |||||||| |||||||| |||||||| || ||||| Sbjct: 1730 gctagtgcttccgaggcggcaagaagcatgtcctcgtggacacggatggctccagagata 1671 Query: 548 acgacgccgagcccgaacccggggaacacgtaggcgttgttggactg 594 || | ||||| ||||| || ||||| | |||||||||||| ||||| Sbjct: 1670 acaagaccgaggccgaatccagggaaaatgtaggcgttgttcgactg 1624
>gb|BT018781.1| Zea mays clone EL01N0526F09.d mRNA sequence Length = 2283 Score = 93.7 bits (47), Expect = 7e-16 Identities = 137/167 (82%) Strand = Plus / Minus Query: 428 atgttggtgaagggcgggaagatgagccccttgtcgaagttctcctgggtcacctgctcc 487 ||||||||||||||||||||||| |||||||||||||||||||| || |||| | Sbjct: 1897 atgttggtgaagggcgggaagattgatcccttgtcgaagttctcctgtgtggcctgagca 1838 Query: 488 gccagcgcctccgaggcggcgaggagcatgtcgtcgtggacgcggatggcgccggagatg 547 || || || ||||||||||| || |||||||| |||||||| |||||||| || ||||| Sbjct: 1837 gctagtgcttccgaggcggcaagaagcatgtcctcgtggacacggatggctccagagata 1778 Query: 548 acgacgccgagcccgaacccggggaacacgtaggcgttgttggactg 594 || | ||||| || || || ||||| | |||||||||||| ||||| Sbjct: 1777 acaagaccgaggccaaatccagggaaaatgtaggcgttgttcgactg 1731
>gb|BT016807.1| Zea mays clone Contig640 mRNA sequence Length = 1925 Score = 93.7 bits (47), Expect = 7e-16 Identities = 137/167 (82%) Strand = Plus / Minus Query: 428 atgttggtgaagggcgggaagatgagccccttgtcgaagttctcctgggtcacctgctcc 487 ||||||||||||||||||||||| |||||||||||||||||||| || |||| | Sbjct: 1536 atgttggtgaagggcgggaagattgatcccttgtcgaagttctcctgtgtggcctgagca 1477 Query: 488 gccagcgcctccgaggcggcgaggagcatgtcgtcgtggacgcggatggcgccggagatg 547 || || || ||||||||||| || |||||||| |||||||| |||||||| || ||||| Sbjct: 1476 gctagtgcttccgaggcggcaagaagcatgtcctcgtggacacggatggctccagagata 1417 Query: 548 acgacgccgagcccgaacccggggaacacgtaggcgttgttggactg 594 || | ||||| || || || ||||| | |||||||||||| ||||| Sbjct: 1416 acaagaccgaggccaaatccagggaaaatgtaggcgttgttcgactg 1370
>gb|AY040616.1| Zea mays NADP-dependent malic enzyme mRNA, complete cds; nuclear gene for plastid product Length = 2225 Score = 93.7 bits (47), Expect = 7e-16 Identities = 137/167 (82%) Strand = Plus / Minus Query: 428 atgttggtgaagggcgggaagatgagccccttgtcgaagttctcctgggtcacctgctcc 487 ||||||||||||||||||||||| |||||||||||||||||||| || |||| | Sbjct: 1846 atgttggtgaagggcgggaagattgatcccttgtcgaagttctcctgtgtggcctgagca 1787 Query: 488 gccagcgcctccgaggcggcgaggagcatgtcgtcgtggacgcggatggcgccggagatg 547 || || || ||||||||||| || |||||||| |||||||| |||||||| || ||||| Sbjct: 1786 gctagtgcttccgaggcggcaagaagcatgtcctcgtggacacggatggctccagagata 1727 Query: 548 acgacgccgagcccgaacccggggaacacgtaggcgttgttggactg 594 || | ||||| || || || ||||| | |||||||||||| ||||| Sbjct: 1726 acaagaccgaggccaaatccagggaaaatgtaggcgttgttcgactg 1680
>gb|AY271262.1| Zea mays NADP-malic enzyme mRNA, complete cds; nuclear gene for chloroplast product Length = 1954 Score = 93.7 bits (47), Expect = 7e-16 Identities = 248/315 (78%) Strand = Plus / Minus Query: 289 gtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgaccaagtcgtcggg 348 |||| ||||||||| || |||||||||||| |||| || || || |||| |||| ||| Sbjct: 1911 gtagttgcggtagacgggagtgtacatgcagttctctgcatatttcaccaggtcgctggg 1852 Query: 349 ccgcggcagccggctcgccaggcccaggtcataggcctttgcggccaccttggcggcgat 408 | ||||| ||| ||||||| || || || ||||| ||||| ||||| || ||||| Sbjct: 1851 gggaggcagacgggtcgccagaccgagctcgtaggcttttgcagccacggctgcagcgat 1792 Query: 409 gttggccgagatcttgcggatgttggtgaagggcgggaagatgagccccttgtcgaagtt 468 || || |||||||| | |||| |||||||||| ||||||||| ||||| |||||||| Sbjct: 1791 gtgcgcagagatctttctgatgctggtgaagggtgggaagatggagcccttctcgaagtt 1732 Query: 469 ctcctgggtcacctgctccgccagcgcctccgaggcggcgaggagcatgtcgtcgtggac 528 ||||| || |||| || || ||||| | |||||||||||| |||||||| |||||||| Sbjct: 1731 gtcctgtgtggcctgatcagctagcgctttcgaggcggcgagaagcatgtcctcgtggac 1672 Query: 529 gcggatggcgccggagatgacgacgccgagcccgaacccggggaacacgtaggcgttgtt 588 |||| ||| || ||||| || | ||||| |||| || ||||| | |||||| ||||| Sbjct: 1671 acggacggctccagagatcacaagaccgaggccgagtccagggaaaatgtaggcattgtt 1612 Query: 589 ggactgcccgggcac 603 |||||||| ||||| Sbjct: 1611 cgactgcccaggcac 1597
>gb|AY103594.1| Zea mays PCO068859 mRNA sequence Length = 2404 Score = 93.7 bits (47), Expect = 7e-16 Identities = 137/167 (82%) Strand = Plus / Minus Query: 428 atgttggtgaagggcgggaagatgagccccttgtcgaagttctcctgggtcacctgctcc 487 ||||||||||||||||||||||| |||||||||||||||||||| || |||| | Sbjct: 1904 atgttggtgaagggcgggaagattgatcccttgtcgaagttctcctgtgtggcctgagca 1845 Query: 488 gccagcgcctccgaggcggcgaggagcatgtcgtcgtggacgcggatggcgccggagatg 547 || || || ||||||||||| || |||||||| |||||||| |||||||| || ||||| Sbjct: 1844 gctagtgcttccgaggcggcaagaagcatgtcctcgtggacacggatggctccagagata 1785 Query: 548 acgacgccgagcccgaacccggggaacacgtaggcgttgttggactg 594 || | ||||| || || || ||||| | |||||||||||| ||||| Sbjct: 1784 acaagaccgaggccaaatccagggaaaatgtaggcgttgttcgactg 1738
>gb|J05130.1|MZENDMEX Maize NADP-dependent malic enzyme (Me1) mRNA, complete cds Length = 2184 Score = 87.7 bits (44), Expect = 4e-14 Identities = 152/188 (80%) Strand = Plus / Minus Query: 416 gagatcttgcggatgttggtgaagggcgggaagatgagccccttgtcgaagttctcctgg 475 |||||||| | |||| |||||||||| ||||||||| ||||| |||||||| ||||| Sbjct: 1892 gagatctttctgatgctggtgaagggtgggaagatggagcccttctcgaagttgtcctgt 1833 Query: 476 gtcacctgctccgccagcgcctccgaggcggcgaggagcatgtcgtcgtggacgcggatg 535 || |||| || || ||||| | |||||||||||| |||||||| |||||||| |||| | Sbjct: 1832 gtggcctgatcagctagcgctttcgaggcggcgagaagcatgtcctcgtggacacggacg 1773 Query: 536 gcgccggagatgacgacgccgagcccgaacccggggaacacgtaggcgttgttggactgc 595 || || ||||| || | ||||| |||| || ||||| | |||||| ||||| |||||| Sbjct: 1772 gctccagagatcacaagaccgaggccgagtccagggaaaatgtaggcattgttcgactgc 1713 Query: 596 ccgggcac 603 || ||||| Sbjct: 1712 ccaggcac 1705
>gb|U39958.1|ZMU39958 Zea mays NADP-malic enzyme root isoform mRNA, complete cds Length = 2310 Score = 85.7 bits (43), Expect = 2e-13 Identities = 136/167 (81%) Strand = Plus / Minus Query: 428 atgttggtgaagggcgggaagatgagccccttgtcgaagttctcctgggtcacctgctcc 487 |||||||||||||| |||||||| |||||||||||||||||||| || |||| | Sbjct: 1933 atgttggtgaagggtgggaagattgatcccttgtcgaagttctcctgtgtggcctgagca 1874 Query: 488 gccagcgcctccgaggcggcgaggagcatgtcgtcgtggacgcggatggcgccggagatg 547 || || || ||||||||||| || |||||||| |||||||| |||||||| || ||||| Sbjct: 1873 gctagtgcttccgaggcggcaagaagcatgtcctcgtggacacggatggctccagagata 1814 Query: 548 acgacgccgagcccgaacccggggaacacgtaggcgttgttggactg 594 || | ||||| || || || ||||| | |||||||||||| ||||| Sbjct: 1813 acaagaccgaggccaaatccagggaaaatgtaggcgttgttcgactg 1767
>ref|NM_189644.1| Oryza sativa (japonica cultivar-group), Ozsa8072 predicted mRNA Length = 1920 Score = 69.9 bits (35), Expect = 9e-09 Identities = 245/315 (77%) Strand = Plus / Minus Query: 289 gtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgaccaagtcgtcggg 348 |||||||||||| | |||||||||||||||||||| ||||| || ||| || ||| Sbjct: 1914 gtagctgcggtatacgggggtgtacatgcagctctctgcgtatttctccagatccctggg 1855 Query: 349 ccgcggcagccggctcgccaggcccaggtcataggcctttgcggccaccttggcggcgat 408 | ||||||||| ||||||| || || |||||||| ||||| ||||| | ||||| || Sbjct: 1854 ttgaggcagccgggtcgccagtccaagttcataggcttttgcagccacgcttgcggcaat 1795 Query: 409 gttggccgagatcttgcggatgttggtgaagggcgggaagatgagccccttgtcgaagtt 468 | || || ||||| | |||||| ||||||||||||||||| ||||| || ||||| Sbjct: 1794 gcgagcagaaatctttctgatgtttgtgaagggcgggaagatcgatcccttctcaaagtt 1735 Query: 469 ctcctgggtcacctgctccgccagcgcctccgaggcggcgaggagcatgtcgtcgtggac 528 |||||| || |||| || || || | |||||||| || || ||||| || ||||| || Sbjct: 1734 ctcctgagtggcctgatcagctagtgtttccgaggcagctagaagcatatcctcgtgaac 1675 Query: 529 gcggatggcgccggagatgacgacgccgagcccgaacccggggaacacgtaggcgttgtt 588 |||| || || ||||| ||||| ||||| ||||| || ||||| | |||||| ||||| Sbjct: 1674 acggacagctccagagattacgacaccgaggccgaatccagggaaaatgtaggcattgtt 1615 Query: 589 ggactgcccgggcac 603 ||||| || ||||| Sbjct: 1614 cgactggcctggcac 1600
>dbj|AK121770.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033092D06, full insert sequence Length = 2253 Score = 69.9 bits (35), Expect = 9e-09 Identities = 245/315 (77%) Strand = Plus / Minus Query: 289 gtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgaccaagtcgtcggg 348 |||||||||||| | |||||||||||||||||||| ||||| || ||| || ||| Sbjct: 2006 gtagctgcggtatacgggggtgtacatgcagctctctgcgtatttctccagatccctggg 1947 Query: 349 ccgcggcagccggctcgccaggcccaggtcataggcctttgcggccaccttggcggcgat 408 | ||||||||| ||||||| || || |||||||| ||||| ||||| | ||||| || Sbjct: 1946 ttgaggcagccgggtcgccagtccaagttcataggcttttgcagccacgcttgcggcaat 1887 Query: 409 gttggccgagatcttgcggatgttggtgaagggcgggaagatgagccccttgtcgaagtt 468 | || || ||||| | |||||| ||||||||||||||||| ||||| || ||||| Sbjct: 1886 gcgagcagaaatctttctgatgtttgtgaagggcgggaagatcgatcccttctcaaagtt 1827 Query: 469 ctcctgggtcacctgctccgccagcgcctccgaggcggcgaggagcatgtcgtcgtggac 528 |||||| || |||| || || || | |||||||| || || ||||| || ||||| || Sbjct: 1826 ctcctgagtggcctgatcagctagtgtttccgaggcagctagaagcatatcctcgtgaac 1767 Query: 529 gcggatggcgccggagatgacgacgccgagcccgaacccggggaacacgtaggcgttgtt 588 |||| || || ||||| ||||| ||||| ||||| || ||||| | |||||| ||||| Sbjct: 1766 acggacagctccagagattacgacaccgaggccgaatccagggaaaatgtaggcattgtt 1707 Query: 589 ggactgcccgggcac 603 ||||| || ||||| Sbjct: 1706 cgactggcctggcac 1692
>dbj|AK072842.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023143B07, full insert sequence Length = 2259 Score = 69.9 bits (35), Expect = 9e-09 Identities = 245/315 (77%) Strand = Plus / Minus Query: 289 gtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgaccaagtcgtcggg 348 |||||||||||| | |||||||||||||||||||| ||||| || ||| || ||| Sbjct: 2004 gtagctgcggtatacgggggtgtacatgcagctctctgcgtatttctccagatccctggg 1945 Query: 349 ccgcggcagccggctcgccaggcccaggtcataggcctttgcggccaccttggcggcgat 408 | ||||||||| ||||||| || || |||||||| ||||| ||||| | ||||| || Sbjct: 1944 ttgaggcagccgggtcgccagtccaagttcataggcttttgcagccacgcttgcggcaat 1885 Query: 409 gttggccgagatcttgcggatgttggtgaagggcgggaagatgagccccttgtcgaagtt 468 | || || ||||| | |||||| ||||||||||||||||| ||||| || ||||| Sbjct: 1884 gcgagcagaaatctttctgatgtttgtgaagggcgggaagatcgatcccttctcaaagtt 1825 Query: 469 ctcctgggtcacctgctccgccagcgcctccgaggcggcgaggagcatgtcgtcgtggac 528 |||||| || |||| || || || | |||||||| || || ||||| || ||||| || Sbjct: 1824 ctcctgagtggcctgatcagctagtgtttccgaggcagctagaagcatatcctcgtgaac 1765 Query: 529 gcggatggcgccggagatgacgacgccgagcccgaacccggggaacacgtaggcgttgtt 588 |||| || || ||||| ||||| ||||| ||||| || ||||| | |||||| ||||| Sbjct: 1764 acggacagctccagagattacgacaccgaggccgaatccagggaaaatgtaggcattgtt 1705 Query: 589 ggactgcccgggcac 603 ||||| || ||||| Sbjct: 1704 cgactggcctggcac 1690
>dbj|AK060358.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-H04, full insert sequence Length = 1288 Score = 69.9 bits (35), Expect = 9e-09 Identities = 245/315 (77%) Strand = Plus / Minus Query: 289 gtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgaccaagtcgtcggg 348 |||||||||||| | |||||||||||||||||||| ||||| || ||| || ||| Sbjct: 1039 gtagctgcggtatacgggggtgtacatgcagctctctgcgtatttctccagatccctggg 980 Query: 349 ccgcggcagccggctcgccaggcccaggtcataggcctttgcggccaccttggcggcgat 408 | ||||||||| ||||||| || || |||||||| ||||| ||||| | ||||| || Sbjct: 979 ttgaggcagccgggtcgccagtccaagttcataggcttttgcagccacgcttgcggcaat 920 Query: 409 gttggccgagatcttgcggatgttggtgaagggcgggaagatgagccccttgtcgaagtt 468 | || || ||||| | |||||| ||||||||||||||||| ||||| || ||||| Sbjct: 919 gcgagcagaaatctttctgatgtttgtgaagggcgggaagatcgatcccttctcaaagtt 860 Query: 469 ctcctgggtcacctgctccgccagcgcctccgaggcggcgaggagcatgtcgtcgtggac 528 |||||| || |||| || || || | |||||||| || || ||||| || ||||| || Sbjct: 859 ctcctgagtggcctgatcagctagtgtttccgaggcagctagaagcatatcctcgtgaac 800 Query: 529 gcggatggcgccggagatgacgacgccgagcccgaacccggggaacacgtaggcgttgtt 588 |||| || || ||||| ||||| ||||| ||||| || ||||| | |||||| ||||| Sbjct: 799 acggacagctccagagattacgacaccgaggccgaatccagggaaaatgtaggcattgtt 740 Query: 589 ggactgcccgggcac 603 ||||| || ||||| Sbjct: 739 cgactggcctggcac 725
>dbj|D16499.1|RICME6 Rice mRNA for NADP dependent malic enzyme, complete cds Length = 2352 Score = 69.9 bits (35), Expect = 9e-09 Identities = 245/315 (77%) Strand = Plus / Minus Query: 289 gtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgaccaagtcgtcggg 348 |||||||||||| | |||||||||||||||||||| ||||| || ||| || ||| Sbjct: 2104 gtagctgcggtatacgggggtgtacatgcagctctctgcgtatttctccagatccctggg 2045 Query: 349 ccgcggcagccggctcgccaggcccaggtcataggcctttgcggccaccttggcggcgat 408 | ||||||||| ||||||| || || |||||||| ||||| ||||| | ||||| || Sbjct: 2044 ttgaggcagccgggtcgccagtccaagttcataggcttttgcagccacggttgcggcaat 1985 Query: 409 gttggccgagatcttgcggatgttggtgaagggcgggaagatgagccccttgtcgaagtt 468 | || || ||||| | |||||| ||||||||||||||||| ||||| || ||||| Sbjct: 1984 gcgagcagaaatctttctgatgtttgtgaagggcgggaagatcgatcccttctcaaagtt 1925 Query: 469 ctcctgggtcacctgctccgccagcgcctccgaggcggcgaggagcatgtcgtcgtggac 528 |||||| || |||| || || || | |||||||| || || ||||| || ||||| || Sbjct: 1924 ctcctgagtggcctgatcagctagtgtttccgaggcagctagaagcatatcctcgtgaac 1865 Query: 529 gcggatggcgccggagatgacgacgccgagcccgaacccggggaacacgtaggcgttgtt 588 |||| || || ||||| ||||| ||||| ||||| || ||||| | |||||| ||||| Sbjct: 1864 acggacagctccagagattacgacaccgaggccgaatccagggaaaatgtaggcattgtt 1805 Query: 589 ggactgcccgggcac 603 ||||| || ||||| Sbjct: 1804 cgactggcctggcac 1790
>ref|NM_191824.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1782 Score = 63.9 bits (32), Expect = 6e-07 Identities = 251/324 (77%) Strand = Plus / Minus Query: 283 tcacctgtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgaccaagtc 342 ||||| |||| ||||||| || ||| |||||||||||||||| || ||||| |||| ||| Sbjct: 1782 tcaccggtagttgcggtaaagtgggctgtacatgcagctctctgcatacttaaccaggtc 1723 Query: 343 gtcgggccgcggcagccggctcgccaggcccaggtcataggcctttgcggccaccttggc 402 | ||||| || ||| ||| |||| || || ||||| |||||||| || || ||||| Sbjct: 1722 ctttggccgagggcgcctgcttgccaaaccaagttcatatgcctttgctgcaacgttggc 1663 Query: 403 ggcgatgttggccgagatcttgcggatgttggtgaagggcgggaagatgagccccttgtc 462 || |||| ||| |||||||| | |||||| | |||||| || | | || |||||||| Sbjct: 1662 tgcaatgtgggcagagatctttctgatgtttgagaagggaggataagtaaggcccttgtc 1603 Query: 463 gaagttctcctgggtcacctgctccgccagcgcctccgaggcggcgaggagcatgtcgtc 522 ||| ||||| || || ||||||| ||||| || ||||| || || || |||||||| || Sbjct: 1602 gaaattctcttgtgtgacctgctgagccagtgcttccgaagctgcaagaagcatgtcatc 1543 Query: 523 gtggacgcggatggcgccggagatgacgacgccgagcccgaacccggggaacacgtaggc 582 || || ||||| || || || || || || || || || ||||| ||||| | |||||| Sbjct: 1542 atgaacacggattgcaccagacatcaccacaccaaggccaaaccctgggaagatgtaggc 1483 Query: 583 gttgttggactgcccgggcacgta 606 |||||| | ||| || |||||||| Sbjct: 1482 gttgtttgcctggccaggcacgta 1459
>dbj|AB053295.2| Oryza sativa (japonica cultivar-group) NADP-ME2 mRNA for NADP dependent malic enzyme, complete cds Length = 2217 Score = 63.9 bits (32), Expect = 6e-07 Identities = 251/324 (77%) Strand = Plus / Minus Query: 283 tcacctgtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgaccaagtc 342 ||||| |||| ||||||| || ||| |||||||||||||||| || ||||| |||| ||| Sbjct: 1862 tcaccggtagttgcggtaaagtgggctgtacatgcagctctctgcatacttaaccaggtc 1803 Query: 343 gtcgggccgcggcagccggctcgccaggcccaggtcataggcctttgcggccaccttggc 402 | ||||| || ||| ||| |||| || || ||||| |||||||| || || ||||| Sbjct: 1802 ctttggccgagggcgcctgcttgccaaaccaagttcatatgcctttgctgcaacgttggc 1743 Query: 403 ggcgatgttggccgagatcttgcggatgttggtgaagggcgggaagatgagccccttgtc 462 || |||| ||| |||||||| | |||||| | |||||| || | | || |||||||| Sbjct: 1742 tgcaatgtgggcagagatctttctgatgtttgagaagggaggataagtaaggcccttgtc 1683 Query: 463 gaagttctcctgggtcacctgctccgccagcgcctccgaggcggcgaggagcatgtcgtc 522 ||| ||||| || || ||||||| ||||| || ||||| || || || |||||||| || Sbjct: 1682 gaaattctcttgtgtgacctgctgagccagtgcttccgaagctgcaagaagcatgtcatc 1623 Query: 523 gtggacgcggatggcgccggagatgacgacgccgagcccgaacccggggaacacgtaggc 582 || || ||||| || || || || || || || || || ||||| ||||| | |||||| Sbjct: 1622 atgaacacggattgcaccagacatcaccacaccaaggccaaaccctgggaagatgtaggc 1563 Query: 583 gttgttggactgcccgggcacgta 606 |||||| | ||| || |||||||| Sbjct: 1562 gttgtttgcctggccaggcacgta 1539
>dbj|AK099646.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013064K20, full insert sequence Length = 2091 Score = 63.9 bits (32), Expect = 6e-07 Identities = 251/324 (77%) Strand = Plus / Minus Query: 283 tcacctgtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgaccaagtc 342 ||||| |||| ||||||| || ||| |||||||||||||||| || ||||| |||| ||| Sbjct: 1780 tcaccggtagttgcggtaaagtgggctgtacatgcagctctctgcatacttaaccaggtc 1721 Query: 343 gtcgggccgcggcagccggctcgccaggcccaggtcataggcctttgcggccaccttggc 402 | ||||| || ||| ||| |||| || || ||||| |||||||| || || ||||| Sbjct: 1720 ctttggccgagggcgcctgcttgccaaaccaagttcatatgcctttgctgcaacgttggc 1661 Query: 403 ggcgatgttggccgagatcttgcggatgttggtgaagggcgggaagatgagccccttgtc 462 || |||| ||| |||||||| | |||||| | |||||| || | | || |||||||| Sbjct: 1660 tgcaatgtgggcagagatctttctgatgtttgagaagggaggataagtaaggcccttgtc 1601 Query: 463 gaagttctcctgggtcacctgctccgccagcgcctccgaggcggcgaggagcatgtcgtc 522 ||| ||||| || || ||||||| ||||| || ||||| || || || |||||||| || Sbjct: 1600 gaaattctcttgtgtgacctgctgagccagtgcttccgaagctgcaagaagcatgtcatc 1541 Query: 523 gtggacgcggatggcgccggagatgacgacgccgagcccgaacccggggaacacgtaggc 582 || || ||||| || || || || || || || || || ||||| ||||| | |||||| Sbjct: 1540 atgaacacggattgcaccagacatcaccacaccaaggccaaaccctgggaagatgtaggc 1481 Query: 583 gttgttggactgcccgggcacgta 606 |||||| | ||| || |||||||| Sbjct: 1480 gttgtttgcctggccaggcacgta 1457
>dbj|AK068110.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013131P11, full insert sequence Length = 1723 Score = 63.9 bits (32), Expect = 6e-07 Identities = 251/324 (77%) Strand = Plus / Minus Query: 283 tcacctgtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgaccaagtc 342 ||||| |||| ||||||| || ||| |||||||||||||||| || ||||| |||| ||| Sbjct: 1412 tcaccggtagttgcggtaaagtgggctgtacatgcagctctctgcatacttaaccaggtc 1353 Query: 343 gtcgggccgcggcagccggctcgccaggcccaggtcataggcctttgcggccaccttggc 402 | ||||| || ||| ||| |||| || || ||||| |||||||| || || ||||| Sbjct: 1352 ctttggccgagggcgcctgcttgccaaaccaagttcatatgcctttgctgcaacgttggc 1293 Query: 403 ggcgatgttggccgagatcttgcggatgttggtgaagggcgggaagatgagccccttgtc 462 || |||| ||| |||||||| | |||||| | |||||| || | | || |||||||| Sbjct: 1292 tgcaatgtgggcagagatctttctgatgtttgagaagggaggataagtaaggcccttgtc 1233 Query: 463 gaagttctcctgggtcacctgctccgccagcgcctccgaggcggcgaggagcatgtcgtc 522 ||| ||||| || || ||||||| ||||| || ||||| || || || |||||||| || Sbjct: 1232 gaaattctcttgtgtgacctgctgagccagtgcttccgaagctgcaagaagcatgtcatc 1173 Query: 523 gtggacgcggatggcgccggagatgacgacgccgagcccgaacccggggaacacgtaggc 582 || || ||||| || || || || || || || || || ||||| ||||| | |||||| Sbjct: 1172 atgaacacggattgcaccagacatcaccacaccaaggccaaaccctgggaagatgtaggc 1113 Query: 583 gttgttggactgcccgggcacgta 606 |||||| | ||| || |||||||| Sbjct: 1112 gttgtttgcctggccaggcacgta 1089
>dbj|AK065560.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013033N12, full insert sequence Length = 2252 Score = 63.9 bits (32), Expect = 6e-07 Identities = 251/324 (77%) Strand = Plus / Minus Query: 283 tcacctgtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgaccaagtc 342 ||||| |||| ||||||| || ||| |||||||||||||||| || ||||| |||| ||| Sbjct: 1958 tcaccggtagttgcggtaaagtgggctgtacatgcagctctctgcatacttaaccaggtc 1899 Query: 343 gtcgggccgcggcagccggctcgccaggcccaggtcataggcctttgcggccaccttggc 402 | ||||| || ||| ||| |||| || || ||||| |||||||| || || ||||| Sbjct: 1898 ctttggccgagggcgcctgcttgccaaaccaagttcatatgcctttgctgcaacgttggc 1839 Query: 403 ggcgatgttggccgagatcttgcggatgttggtgaagggcgggaagatgagccccttgtc 462 || |||| ||| |||||||| | |||||| | |||||| || | | || |||||||| Sbjct: 1838 tgcaatgtgggcagagatctttctgatgtttgagaagggaggataagtaaggcccttgtc 1779 Query: 463 gaagttctcctgggtcacctgctccgccagcgcctccgaggcggcgaggagcatgtcgtc 522 ||| ||||| || || ||||||| ||||| || ||||| || || || |||||||| || Sbjct: 1778 gaaattctcttgtgtgacctgctgagccagtgcttccgaagctgcaagaagcatgtcatc 1719 Query: 523 gtggacgcggatggcgccggagatgacgacgccgagcccgaacccggggaacacgtaggc 582 || || ||||| || || || || || || || || || ||||| ||||| | |||||| Sbjct: 1718 atgaacacggattgcaccagacatcaccacaccaaggccaaaccctgggaagatgtaggc 1659 Query: 583 gttgttggactgcccgggcacgta 606 |||||| | ||| || |||||||| Sbjct: 1658 gttgtttgcctggccaggcacgta 1635
>gb|AF262997.1| Ricinus communis NADP-dependent malic protein mRNA, complete cds; nuclear gene for leucoplast product Length = 2362 Score = 58.0 bits (29), Expect = 4e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 427 gatgttggtgaagggcgggaagatgagccccttgtcgaagttctcctgggtcacctg 483 |||||| ||||| || ||| | |||||||||||||| ||||| |||||||||||||| Sbjct: 1854 gatgtttgtgaatggtgggtaaatgagccccttgtcaaagttttcctgggtcacctg 1798
>ref|NM_191165.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1614 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 309 tgtacatgcagctctcggcgtacttgaccaagtc 342 |||||||||||||||| |||||||| |||||||| Sbjct: 1588 tgtacatgcagctctcagcgtacttcaccaagtc 1555
>gb|AY444338.1| Oryza sativa (indica cultivar-group) cytosolic NADP malic enzyme mRNA, complete cds Length = 1980 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 309 tgtacatgcagctctcggcgtacttgaccaagtc 342 |||||||||||||||| |||||||| |||||||| Sbjct: 1809 tgtacatgcagctctcagcgtacttcaccaagtc 1776
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 309 tgtacatgcagctctcggcgtacttgaccaagtc 342 |||||||||||||||| |||||||| |||||||| Sbjct: 31074297 tgtacatgcagctctcagcgtacttcaccaagtc 31074264 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 289 gtagctgcggtagagcggggtgtacatgcagctctcggcgta 330 |||||||||||| | |||||||||||||||||||| ||||| Sbjct: 4738525 gtagctgcggtatacgggggtgtacatgcagctctctgcgta 4738566 Score = 48.1 bits (24), Expect = 0.035 Identities = 48/56 (85%) Strand = Plus / Minus Query: 283 tcacctgtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgacca 338 ||||| |||| ||||||| || ||| |||||||||||||||| || ||||| |||| Sbjct: 30164589 tcaccggtagttgcggtaaagtgggctgtacatgcagctctctgcatacttaacca 30164534 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 427 gatgttggtgaagggcgggaagat 450 |||||| ||||||||||||||||| Sbjct: 4738755 gatgtttgtgaagggcgggaagat 4738778
>dbj|AP003768.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0439E07 Length = 176486 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 309 tgtacatgcagctctcggcgtacttgaccaagtc 342 |||||||||||||||| |||||||| |||||||| Sbjct: 131276 tgtacatgcagctctcagcgtacttcaccaagtc 131243
>dbj|AP003376.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0014K08 Length = 177263 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 309 tgtacatgcagctctcggcgtacttgaccaagtc 342 |||||||||||||||| |||||||| |||||||| Sbjct: 642 tgtacatgcagctctcagcgtacttcaccaagtc 609
>dbj|AP002836.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0512G09 Length = 146921 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 289 gtagctgcggtagagcggggtgtacatgcagctctcggcgta 330 |||||||||||| | |||||||||||||||||||| ||||| Sbjct: 98770 gtagctgcggtatacgggggtgtacatgcagctctctgcgta 98811 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 427 gatgttggtgaagggcgggaagat 450 |||||| ||||||||||||||||| Sbjct: 99000 gatgtttgtgaagggcgggaagat 99023
>dbj|AP002816.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0695A04 Length = 158133 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 289 gtagctgcggtagagcggggtgtacatgcagctctcggcgta 330 |||||||||||| | |||||||||||||||||||| ||||| Sbjct: 145741 gtagctgcggtatacgggggtgtacatgcagctctctgcgta 145782 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 427 gatgttggtgaagggcgggaagat 450 |||||| ||||||||||||||||| Sbjct: 145971 gatgtttgtgaagggcgggaagat 145994
>dbj|AK073858.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033072B12, full insert sequence Length = 2058 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 309 tgtacatgcagctctcggcgtacttgaccaagtc 342 |||||||||||||||| |||||||| |||||||| Sbjct: 1845 tgtacatgcagctctcagcgtacttcaccaagtc 1812
>emb|X78069.1|FPMODA F.pringlei modA mRNA Length = 2213 Score = 50.1 bits (25), Expect = 0.009 Identities = 91/113 (80%) Strand = Plus / Minus Query: 392 gccaccttggcggcgatgttggccgagatcttgcggatgttggtgaagggcgggaagatg 451 ||||||||||| || |||| || || |||||||||||||||||||| || ||| | || Sbjct: 1884 gccaccttggctgcaatgtgagcagaaatcttgcggatgttggtgaatggtgggtatatt 1825 Query: 452 agccccttgtcgaagttctcctgggtcacctgctccgccagcgcctccgaggc 504 ||||| ||||| || | |||||| || || || || ||||| ||||| ||||| Sbjct: 1824 agcccgttgtcaaaatgctcctgtgtgacttgttcggccagagcctcagaggc 1772
>ref|XM_604169.2| PREDICTED: Bos taurus similar to malic enzyme 3, NADP(+)-dependent, mitochondrial (LOC525813), mRNA Length = 1695 Score = 48.1 bits (24), Expect = 0.035 Identities = 24/24 (100%) Strand = Plus / Minus Query: 566 ccggggaacacgtaggcgttgttg 589 |||||||||||||||||||||||| Sbjct: 1277 ccggggaacacgtaggcgttgttg 1254
>dbj|AP003229.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0022F10 Length = 150498 Score = 48.1 bits (24), Expect = 0.035 Identities = 48/56 (85%) Strand = Plus / Minus Query: 283 tcacctgtagctgcggtagagcggggtgtacatgcagctctcggcgtacttgacca 338 ||||| |||| ||||||| || ||| |||||||||||||||| || ||||| |||| Sbjct: 69411 tcaccggtagttgcggtaaagtgggctgtacatgcagctctctgcatacttaacca 69356
>gb|AC099720.7| Mus musculus chromosome 10, clone RP23-415H15, complete sequence Length = 212928 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 162 cagaagaaaacaagcctatgttt 184 ||||||||||||||||||||||| Sbjct: 148197 cagaagaaaacaagcctatgttt 148219
>emb|AJ224847.1|ZMA224847 Zea mays me gene, exons 1 to 19 Length = 5523 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 296 cggtagagcggggtgtacatgcagctctcggcgtacttgacca 338 ||||||| ||| |||||||||||||||| |||||||| |||| Sbjct: 4669 cggtagacggggctgtacatgcagctctcagcgtacttcacca 4627
>gb|AY274836.1| Sorghum bicolor NADP-dependent malic enzyme mRNA, complete cds; nuclear gene for chloroplast product Length = 2139 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 416 gagatcttgcggatgttggtgaagggcgggaagat 450 |||||||| | ||||||||||||||| |||||||| Sbjct: 1796 gagatctttctgatgttggtgaagggtgggaagat 1762
>gb|AY056819.1| Flaveria brownii NADP-dependent malic enzyme mRNA, partial cds Length = 1056 Score = 46.1 bits (23), Expect = 0.14 Identities = 41/47 (87%) Strand = Plus / Minus Query: 392 gccaccttggcggcgatgttggccgagatcttgcggatgttggtgaa 438 |||||||||||||| || | || || |||||||||||||||||||| Sbjct: 942 gccaccttggcggcaatatgagcagaaatcttgcggatgttggtgaa 896
>gb|AC153840.6| Mus musculus 10 BAC RP23-271A22 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 210217 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 162 cagaagaaaacaagcctatgttt 184 ||||||||||||||||||||||| Sbjct: 130078 cagaagaaaacaagcctatgttt 130056
>gb|AY104511.1| Zea mays PCO117256 mRNA sequence Length = 2259 Score = 46.1 bits (23), Expect = 0.14 Identities = 77/95 (81%) Strand = Plus / Minus Query: 479 acctgctccgccagcgcctccgaggcggcgaggagcatgtcgtcgtggacgcggatggcg 538 ||||||| ||||| |||||||| || || || ||||||||||| || |||||||| || Sbjct: 1873 acctgctgggccagagcctccgatgctgccagaagcatgtcgtcatgaacgcggatagct 1814 Query: 539 ccggagatgacgacgccgagcccgaacccggggaa 573 || || || || |||||||| || ||||| ||||| Sbjct: 1813 ccagacatcaccacgccgaggccaaaccctgggaa 1779
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome Length = 4829781 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 398 ttggcggcgatgttggccgagat 420 ||||||||||||||||||||||| Sbjct: 3907815 ttggcggcgatgttggccgagat 3907793
>gb|AY864063.1| Zea mays NADP-dependent malic enzyme mRNA, complete cds Length = 1959 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 296 cggtagagcggggtgtacatgcagctctcggcgtacttgacca 338 ||||||| ||| |||||||||||||||| |||||||| |||| Sbjct: 1946 cggtagacggggctgtacatgcagctctcagcgtacttcacca 1904
>gb|U67426.1|VVU67426 Vitis vinifera malate dehydrogenase (VVME2) mRNA, complete cds Length = 2186 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 455 cccttgtcgaagttctcctgggt 477 ||||||||||||||||||||||| Sbjct: 1907 cccttgtcgaagttctcctgggt 1885
>emb|AJ294477.1|MSM294477 Mycobacterium smegmatis ppm2 gene and ppm1 gene for putative polyprenol phosphate mannosyl transferase 2 and 1 Length = 2592 Score = 44.1 bits (22), Expect = 0.54 Identities = 22/22 (100%) Strand = Plus / Plus Query: 547 gacgacgccgagcccgaacccg 568 |||||||||||||||||||||| Sbjct: 70 gacgacgccgagcccgaacccg 91
>gb|M59416.1|FTRMRSEQB Flaveria trinervia NADP-malic enzyme mRNA, partial cds Length = 762 Score = 44.1 bits (22), Expect = 0.54 Identities = 70/86 (81%) Strand = Plus / Minus Query: 419 atcttgcggatgttggtgaagggcgggaagatgagccccttgtcgaagttctcctgggtc 478 |||||||||||| ||||||| || ||||| || ||||| ||||| || | ||||| ||| Sbjct: 452 atcttgcggatgctggtgaatggtgggaatattagccctttgtcaaaatgttcctgtgtc 393 Query: 479 acctgctccgccagcgcctccgaggc 504 ||||| || || || ||||| ||||| Sbjct: 392 acctgttcagctagagcctcggaggc 367
>dbj|AB005808.1| Aloe arborescens mRNA for NADP-malic enzyme, complete cds Length = 2453 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Minus Query: 305 ggggtgtacatgcagctctcggcgta 330 |||||||||||||||||||| ||||| Sbjct: 2064 ggggtgtacatgcagctctctgcgta 2039
>gb|AY594689.1| Hydrilla verticillata NADP-dependent malic enzyme 3 mRNA, complete cds Length = 2169 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 309 tgtacatgcagctctcggcgtactt 333 |||||||||| |||||||||||||| Sbjct: 1807 tgtacatgcaactctcggcgtactt 1783 Score = 42.1 bits (21), Expect = 2.1 Identities = 78/97 (80%) Strand = Plus / Minus Query: 377 tcataggcctttgcggccaccttggcggcgatgttggccgagatcttgcggatgttggtg 436 |||||||||||||| || || || || || |||||||| || ||||| | |||||| | | Sbjct: 1739 tcataggcctttgcagcaacgttagcagcaatgttggcagaaatctttctgatgttcgag 1680 Query: 437 aagggcgggaagatgagccccttgtcgaagttctcct 473 || || || |||| |||||||| || |||||||||| Sbjct: 1679 aatggtggatagataagccccttctcaaagttctcct 1643
>emb|BX040168.1|CNS0935O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC10DC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 796 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 tgaagggcgggaagatgagcc 455 ||||||||||||||||||||| Sbjct: 398 tgaagggcgggaagatgagcc 378
>emb|X57142.1|FTNADPME Flaveria trinervia mRNA for NADP-dependent malic enzyme (NADP-ME) Length = 2258 Score = 42.1 bits (21), Expect = 2.1 Identities = 54/65 (83%) Strand = Plus / Minus Query: 419 atcttgcggatgttggtgaagggcgggaagatgagccccttgtcgaagttctcctgggtc 478 |||||||||||| ||||||| || ||||| || ||||| ||||| || | ||||| ||| Sbjct: 1850 atcttgcggatgctggtgaatggtgggaatattagccctttgtcaaaatgttcctgtgtc 1791 Query: 479 acctg 483 ||||| Sbjct: 1790 acctg 1786
>gb|AC010110.7| Drosophila melanogaster 3L BAC RP98-9N2 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 172372 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 166 agaaaacaagcctatgtttta 186 ||||||||||||||||||||| Sbjct: 150951 agaaaacaagcctatgtttta 150971
>ref|XM_551401.1| Anopheles gambiae str. PEST ENSANGP00000027278 (ENSANGG00000023349), mRNA Length = 1338 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 tgaagggcgggaagatgagcc 455 ||||||||||||||||||||| Sbjct: 943 tgaagggcgggaagatgagcc 963
>gb|AE003476.3| Drosophila melanogaster chromosome 3L, section 10 of 83 of the complete sequence Length = 304419 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 166 agaaaacaagcctatgtttta 186 ||||||||||||||||||||| Sbjct: 36257 agaaaacaagcctatgtttta 36277
>gb|M59415.1|FTRMRSEQ Flaveria linearis NADP-malic enzyme mRNA, partial cds Length = 2117 Score = 42.1 bits (21), Expect = 2.1 Identities = 90/113 (79%) Strand = Plus / Minus Query: 392 gccaccttggcggcgatgttggccgagatcttgcggatgttggtgaagggcgggaagatg 451 ||||||||||| || |||| || || |||||||||||||| ||||| || ||| | || Sbjct: 1867 gccaccttggctgcaatgtgagcagaaatcttgcggatgttagtgaatggtgggtatatt 1808 Query: 452 agccccttgtcgaagttctcctgggtcacctgctccgccagcgcctccgaggc 504 ||||| ||||| || | |||||| || || || || ||||| ||||| ||||| Sbjct: 1807 agcccgttgtcaaaatgctcctgtgtgacttgttcggccagagcctcagaggc 1755
>gb|AY863144.1| Flaveria bidentis chloroplast NADP-dependent malic enzyme precursor (MeA) mRNA, complete cds; nuclear gene for chloroplast product Length = 2150 Score = 42.1 bits (21), Expect = 2.1 Identities = 54/65 (83%) Strand = Plus / Minus Query: 419 atcttgcggatgttggtgaagggcgggaagatgagccccttgtcgaagttctcctgggtc 478 |||||||||||| ||||||| || ||||| || ||||| ||||| || | ||||| ||| Sbjct: 1896 atcttgcggatgctggtgaatggtgggaatattagccctttgtcaaaatgttcctgtgtc 1837 Query: 479 acctg 483 ||||| Sbjct: 1836 acctg 1832
>ref|NM_205244.1| Gallus gallus cyclin A2 (CCNA2), mRNA Length = 1922 Score = 40.1 bits (20), Expect = 8.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 466 gttctcctgggtcacctgctccgccagc 493 |||||||||| || |||||||||||||| Sbjct: 55 gttctcctggttctcctgctccgccagc 28
>ref|XM_469484.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1420 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 508 gaggagcatgtcgtcgtgga 527 |||||||||||||||||||| Sbjct: 39 gaggagcatgtcgtcgtgga 20
>gb|AC116409.9| Mus musculus chromosome 3, clone RP24-337P23, complete sequence Length = 162232 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 229 tttgattttattggttggct 248 |||||||||||||||||||| Sbjct: 93881 tttgattttattggttggct 93862
>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome Length = 6438405 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 480 cctgctccgccagcgcctcc 499 |||||||||||||||||||| Sbjct: 4242417 cctgctccgccagcgcctcc 4242436
>gb|AC146605.3| Mus musculus BAC clone RP23-304J7 from chromosome 14, complete sequence Length = 225868 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 158 gacacagaagaaaacaagcc 177 |||||||||||||||||||| Sbjct: 98273 gacacagaagaaaacaagcc 98254
>gb|BT013560.1| Lycopersicon esculentum clone 132297R, mRNA sequence Length = 2128 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 290 tagctgcggtagagcggggtgtacatgcagctctcggcgtactt 333 |||||||||||||| || |||||||| ||||||| || ||||| Sbjct: 1860 tagctgcggtagagtggagtgtacatatagctctcagcatactt 1817
>gb|AY334273.1| Sphingomonas paucimobilis hypothetical TonB-dependent receptor gene, partial cds; LinR (linR), hydroquinone meta-cleavage dioxygenase (linE), b-ketoadipate-enol-lactone hydrolase, carboxylesterase, conserved hypothetical protein, and 2,5-dichlorohydroquinone reductive dechlorinase (linD) genes, complete cds; and insertion sequence IS6100 TnpA4 (tnpA4) gene, complete cds Length = 7808 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 350 cgcggcagccggctcgccag 369 |||||||||||||||||||| Sbjct: 821 cgcggcagccggctcgccag 802
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 508 gaggagcatgtcgtcgtgga 527 |||||||||||||||||||| Sbjct: 28261949 gaggagcatgtcgtcgtgga 28261930
>gb|AC122056.4| Mus musculus BAC clone RP24-466A3 from chromosome 14, complete sequence Length = 179685 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 158 gacacagaagaaaacaagcc 177 |||||||||||||||||||| Sbjct: 66674 gacacagaagaaaacaagcc 66693
>emb|X72892.1|GGCYCA G.gallus cycA mRNA Length = 1922 Score = 40.1 bits (20), Expect = 8.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 466 gttctcctgggtcacctgctccgccagc 493 |||||||||| || |||||||||||||| Sbjct: 55 gttctcctggttctcctgctccgccagc 28
>emb|AL353786.16| Human DNA sequence from clone RP5-1175B15 on chromosome X Contains the gene for a protein similar to rat fertility related protein WMP1, the 3' end of the PTPN21 gene for protein tyrosine phosphatase non-receptor type 21 and CpG islands, complete sequence Length = 139565 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 gaatttgattttattggttg 245 |||||||||||||||||||| Sbjct: 100658 gaatttgattttattggttg 100639
>emb|AL035358.1|FR009I14 Fugu rubripes cosmid 009I14 genomic DNA fragment, top1beta gene Length = 11989 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 ctcctgggtcacctgctccg 488 |||||||||||||||||||| Sbjct: 2416 ctcctgggtcacctgctccg 2397
>gb|AF217651.1| Drosophila melanogaster c11.1 gene, partial cds; lozenge (lz) and c12.1 genes, complete cds; and c12.2 gene, partial cds Length = 45142 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 318 agctctcggcgtacttgaccaagt 341 ||||||||||||| |||||||||| Sbjct: 40129 agctctcggcgtaattgaccaagt 40152
>gb|AC105350.2| Drosophila melanogaster X BAC RP98-30C13 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 184334 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 318 agctctcggcgtacttgaccaagt 341 ||||||||||||| |||||||||| Sbjct: 55365 agctctcggcgtaattgaccaagt 55342
>emb|CR593033.1| full-length cDNA clone CS0DC027YO07 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1802 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 gaatttgattttattggttg 245 |||||||||||||||||||| Sbjct: 264 gaatttgattttattggttg 283
>gb|AC087710.8| Homo sapiens chromosome 8, clone RP11-11A18, complete sequence Length = 167139 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 actaaaatctgacaaaagaa 39 |||||||||||||||||||| Sbjct: 26320 actaaaatctgacaaaagaa 26301
>gb|U60315.1|MCU60315 Molluscum contagiosum virus subtype 1, complete genome Length = 190289 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 547 gacgacgccgagcccgaacccggg 570 ||||||||||||||||| |||||| Sbjct: 33346 gacgacgccgagcccgagcccggg 33323
>gb|AF288919.1| Flaveria trinervia C4 chloroplastic NADP-malic enzyme (ChlMe1) gene, 3' region; nuclear gene for chloroplast product Length = 579 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 305 ggggtgtacatgcagctctc 324 |||||||||||||||||||| Sbjct: 20 ggggtgtacatgcagctctc 1
>gb|AC024996.6| Homo sapiens chromosome 8, clone RP11-697C18, complete sequence Length = 177864 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 20 actaaaatctgacaaaagaa 39 |||||||||||||||||||| Sbjct: 54642 actaaaatctgacaaaagaa 54661
>gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome Length = 2628784 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 363 tcgccaggcccaggtcataggcct 386 |||||||| ||||||||||||||| Sbjct: 2136572 tcgccagggccaggtcataggcct 2136595
>gb|AC087797.5| Oryza sativa chromosome 3 BAC OSJNBb0022E02 genomic sequence, complete sequence Length = 122497 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 508 gaggagcatgtcgtcgtgga 527 |||||||||||||||||||| Sbjct: 113090 gaggagcatgtcgtcgtgga 113071
>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome Length = 2909809 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 515 atgtcgtcgtggacgcggat 534 |||||||||||||||||||| Sbjct: 795685 atgtcgtcgtggacgcggat 795666
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 508 gaggagcatgtcgtcgtgga 527 |||||||||||||||||||| Sbjct: 28353273 gaggagcatgtcgtcgtgga 28353254
>gb|AC024153.22| Homo sapiens 12 BAC RP13-359K18 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 178905 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 20 actaaaatctgacaaaagaa 39 |||||||||||||||||||| Sbjct: 123935 actaaaatctgacaaaagaa 123954
>emb|AL953869.12| Zebrafish DNA sequence from clone CH211-261J13 in linkage group 7, complete sequence Length = 171417 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 20 actaaaatctgacaaaagaa 39 |||||||||||||||||||| Sbjct: 83619 actaaaatctgacaaaagaa 83638
>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome Length = 2702173 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 262 accgcaaggctgccgccacg 281 |||||||||||||||||||| Sbjct: 377103 accgcaaggctgccgccacg 377122
>emb|AL162171.4|CNS01RHP Human chromosome 14 DNA sequence BAC R-507K2 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 197550 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 gaatttgattttattggttg 245 |||||||||||||||||||| Sbjct: 180439 gaatttgattttattggttg 180458
>emb|AL049834.3|CNS0000I Human chromosome 14 DNA sequence BAC R-556K1 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 173394 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 gaatttgattttattggttg 245 |||||||||||||||||||| Sbjct: 172086 gaatttgattttattggttg 172067
>gb|AE003446.4| Drosophila melanogaster chromosome X, section 30 of 74 of the complete sequence Length = 290970 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 318 agctctcggcgtacttgaccaagt 341 ||||||||||||| |||||||||| Sbjct: 268356 agctctcggcgtaattgaccaagt 268379
>dbj|AP003168.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-263C24, complete sequence Length = 122001 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 222 aggggaatttgattttattggttg 245 |||||||||| ||||||||||||| Sbjct: 90523 aggggaatttcattttattggttg 90546
>emb|AL928904.16| Mouse DNA sequence from clone RP23-463M17 on chromosome 2, complete sequence Length = 142294 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 468 tctcctgggtcacctgctccgcca 491 |||||||||||||||||| ||||| Sbjct: 129830 tctcctgggtcacctgcttcgcca 129807
>gb|U16828.1|GDU16828 Gelidium divaricatum Tokawa, Choshi, Chiba, Japan chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds Length = 1144 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 283 tcacctgtagctgcggtagagcgg 306 |||||||||||||| ||||||||| Sbjct: 560 tcacctgtagctgcagtagagcgg 537 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,913,675 Number of Sequences: 3902068 Number of extensions: 3913675 Number of successful extensions: 81120 Number of sequences better than 10.0: 89 Number of HSP's better than 10.0 without gapping: 90 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 80426 Number of HSP's gapped (non-prelim): 671 length of query: 622 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 599 effective length of database: 17,143,297,704 effective search space: 10268835324696 effective search space used: 10268835324696 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
