ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd13a19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY154787.1| Thlaspi perfoliatum isolate Mperf15ITS tRNA-Leu (... 46 0.17
2ref|XM_719798.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 44 0.67
3gb|AC008689.8| Homo sapiens chromosome 5 clone CTB-61G23, comple... 44 0.67
4gb|AC112916.3| Homo sapiens X BAC RP11-765I9 (Roswell Park Cance... 44 0.67
5gb|AC157661.2| Mus musculus BAC clone RP23-233F23 from chromosom... 44 0.67
6gb|AC122706.3| Homo sapiens chromosome 5 clone RP11-114I23, comp... 44 0.67
7gb|AC105109.10| Homo sapiens chromosome 15, clone CTD-2343P13, c... 44 0.67
8gb|AC104020.10| Homo sapiens chromosome 15, clone RP11-369K8, co... 44 0.67
9emb|CT476800.3| RP43-013D05, complete sequence 44 0.67
10gb|AC128704.4| Mus musculus BAC clone RP23-436H14 from 3, comple... 44 0.67
11ref|NM_114656.2| Arabidopsis thaliana binding AT3G47860 mRNA, co... 42 2.7
12emb|AL590378.5| Human DNA sequence from clone RP11-49L2 on chrom... 42 2.7
13emb|AL158827.27| Human DNA sequence from clone RP11-330M2 on chr... 42 2.7
14emb|AL607024.17| Mouse DNA sequence from clone RP23-194P5 on chr... 42 2.7
15emb|AL049746.1|ATT23J7 Arabidopsis thaliana DNA chromosome 3, BA... 42 2.7
16gb|U84245.1|RNU84245 Rattus norvegicus Y4 receptor gene, complet... 42 2.7
17gb|AC010859.5| Homo sapiens chromosome , clone RP11-3D19, comple... 42 2.7
18gb|AY044334.1| Arabidopsis thaliana putative protein (T23J7.190)... 42 2.7
19dbj|AK050863.1| Mus musculus 9 days embryo whole body cDNA, RIKE... 42 2.7
20ref|NM_031581.1| Rattus norvegicus pancreatic polypeptide recept... 42 2.7
21emb|CR381614.10| Zebrafish DNA sequence from clone DKEY-72G4 in ... 42 2.7
22emb|Z68180.1|RNPP1GN R.norvegicus pancreatic polypeptide recepto... 42 2.7
23dbj|AP006278.1| Homo sapiens genomic DNA, chromosome 8q22.1, clo... 42 2.7
24gb|U42388.1|RNU42388 Rattus norvegicus panceatic polypeptide rec... 42 2.7

>gb|AY154787.1| Thlaspi perfoliatum isolate Mperf15ITS tRNA-Leu (trnL) gene and
           trnL-trnF intergenic spacer, partial sequence;
           chloroplast
          Length = 736

 Score = 46.1 bits (23), Expect = 0.17
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 569 tagtaaatgaataaagtgttggaccgg 595
           ||||||||||| |||||||||||||||
Sbjct: 658 tagtaaatgaaaaaagtgttggaccgg 632



to top

>ref|XM_719798.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY04575)
           partial mRNA
          Length = 3591

 Score = 44.1 bits (22), Expect = 0.67
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 510 taattataatgcaaatgattttgtta 535
           |||||||||||||||||||| |||||
Sbjct: 144 taattataatgcaaatgattatgtta 169



to top

>gb|AC008689.8| Homo sapiens chromosome 5 clone CTB-61G23, complete sequence
          Length = 138824

 Score = 44.1 bits (22), Expect = 0.67
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 450   ttcagaatatcatacaaataaa 471
             ||||||||||||||||||||||
Sbjct: 26958 ttcagaatatcatacaaataaa 26937



to top

>gb|AC112916.3| Homo sapiens X BAC RP11-765I9 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 172457

 Score = 44.1 bits (22), Expect = 0.67
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 519    tgcaaatgattttgttatgttt 540
              ||||||||||||||||||||||
Sbjct: 142847 tgcaaatgattttgttatgttt 142826



to top

>gb|AC157661.2| Mus musculus BAC clone RP23-233F23 from chromosome 3, complete sequence
          Length = 195603

 Score = 44.1 bits (22), Expect = 0.67
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 632   gacagtttctctaatggtgtaa 653
             ||||||||||||||||||||||
Sbjct: 24705 gacagtttctctaatggtgtaa 24726



to top

>gb|AC122706.3| Homo sapiens chromosome 5 clone RP11-114I23, complete sequence
          Length = 118762

 Score = 44.1 bits (22), Expect = 0.67
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 450   ttcagaatatcatacaaataaa 471
             ||||||||||||||||||||||
Sbjct: 10303 ttcagaatatcatacaaataaa 10324



to top

>gb|AC105109.10| Homo sapiens chromosome 15, clone CTD-2343P13, complete sequence
          Length = 76158

 Score = 44.1 bits (22), Expect = 0.67
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 176   gaaagcattcaccaaacttccagaat 201
             ||||||||| ||||||||||||||||
Sbjct: 22245 gaaagcatttaccaaacttccagaat 22220



to top

>gb|AC104020.10| Homo sapiens chromosome 15, clone RP11-369K8, complete sequence
          Length = 171307

 Score = 44.1 bits (22), Expect = 0.67
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 176    gaaagcattcaccaaacttccagaat 201
              ||||||||| ||||||||||||||||
Sbjct: 149048 gaaagcatttaccaaacttccagaat 149023



to top

>emb|CT476800.3| RP43-013D05, complete sequence
          Length = 207013

 Score = 44.1 bits (22), Expect = 0.67
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 519    tgcaaatgattttgttatgttt 540
              ||||||||||||||||||||||
Sbjct: 202425 tgcaaatgattttgttatgttt 202404



to top

>gb|AC128704.4| Mus musculus BAC clone RP23-436H14 from 3, complete sequence
          Length = 212119

 Score = 44.1 bits (22), Expect = 0.67
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 632  gacagtttctctaatggtgtaa 653
            ||||||||||||||||||||||
Sbjct: 8828 gacagtttctctaatggtgtaa 8807



to top

>ref|NM_114656.2| Arabidopsis thaliana binding AT3G47860 mRNA, complete cds
          Length = 1162

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 192  cttccagaatcaaaacactct 212
            |||||||||||||||||||||
Sbjct: 1141 cttccagaatcaaaacactct 1161



to top

>emb|AL590378.5| Human DNA sequence from clone RP11-49L2 on chromosome 10 Contains a
             novel gene and a novel MAM domain containing protein,
             complete sequence
          Length = 150889

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 504   gcgatgtaattataatgcaaatgattttgttat 536
             ||||||||||||||| ||||||| ||| |||||
Sbjct: 98424 gcgatgtaattataaggcaaatggtttggttat 98392



to top

>emb|AL158827.27| Human DNA sequence from clone RP11-330M2 on chromosome 9 Contains a
             pseudogene similar to part of a zinc finger protein, two
             novel pseudogenes, a novel gene similar to DKFZP434I1117,
             a novel pseudogene (FLJ23476), two novel gene, a novel
             gene similar to MGC12954 and four CpG islands, complete
             sequence
          Length = 186108

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 272   gaggcttcatttgggtactaa 292
             |||||||||||||||||||||
Sbjct: 10135 gaggcttcatttgggtactaa 10115



to top

>emb|AL607024.17| Mouse DNA sequence from clone RP23-194P5 on chromosome 11 Contains a
             novel gene, the Pafah1b1 gene for platelet-activating
             factor acetylhydrolase isoform 1b beta1 subunit, the 5'
             end of a novel gene and two CpG islands, complete sequence
          Length = 137908

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 398   ttgtgaataataatatgaacc 418
             |||||||||||||||||||||
Sbjct: 72702 ttgtgaataataatatgaacc 72722



to top

>emb|AL049746.1|ATT23J7 Arabidopsis thaliana DNA chromosome 3, BAC clone T23J7
          Length = 92493

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 192   cttccagaatcaaaacactct 212
             |||||||||||||||||||||
Sbjct: 80883 cttccagaatcaaaacactct 80863



to top

>gb|U84245.1|RNU84245 Rattus norvegicus Y4 receptor gene, complete cds
          Length = 1128

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 355 aaatgaaccagatgaccacaa 375
           |||||||||||||||||||||
Sbjct: 499 aaatgaaccagatgaccacaa 479



to top

>gb|AC010859.5| Homo sapiens chromosome , clone RP11-3D19, complete sequence
          Length = 171301

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 652    aactactggattcaagcaatt 672
              |||||||||||||||||||||
Sbjct: 126140 aactactggattcaagcaatt 126160



to top

>gb|AY044334.1| Arabidopsis thaliana putative protein (T23J7.190) mRNA, complete cds
          Length = 1143

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 192  cttccagaatcaaaacactct 212
            |||||||||||||||||||||
Sbjct: 1122 cttccagaatcaaaacactct 1142



to top

>dbj|AK050863.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:D030026P09
            product:unclassifiable, full insert sequence
          Length = 3314

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 398  ttgtgaataataatatgaacc 418
            |||||||||||||||||||||
Sbjct: 2843 ttgtgaataataatatgaacc 2823



to top

>ref|NM_031581.1| Rattus norvegicus pancreatic polypeptide receptor 1 (Ppyr1), mRNA
          Length = 1259

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 355 aaatgaaccagatgaccacaa 375
           |||||||||||||||||||||
Sbjct: 562 aaatgaaccagatgaccacaa 542



to top

>emb|CR381614.10| Zebrafish DNA sequence from clone DKEY-72G4 in linkage group 20, complete
              sequence
          Length = 153083

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 2      attttggaatgaagatcccaa 22
              |||||||||||||||||||||
Sbjct: 148504 attttggaatgaagatcccaa 148524



to top

>emb|Z68180.1|RNPP1GN R.norvegicus pancreatic polypeptide receptor PP1 gene
          Length = 1209

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 355 aaatgaaccagatgaccacaa 375
           |||||||||||||||||||||
Sbjct: 535 aaatgaaccagatgaccacaa 515



to top

>dbj|AP006278.1| Homo sapiens genomic DNA, chromosome 8q22.1, clone: KB1573B4, complete
             sequence
          Length = 157927

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 652   aactactggattcaagcaatt 672
             |||||||||||||||||||||
Sbjct: 82397 aactactggattcaagcaatt 82417



to top

>gb|U42388.1|RNU42388 Rattus norvegicus panceatic polypeptide receptor mRNA, complete cds
          Length = 1259

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 355 aaatgaaccagatgaccacaa 375
           |||||||||||||||||||||
Sbjct: 562 aaatgaaccagatgaccacaa 542


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 8,554,136
Number of Sequences: 3902068
Number of extensions: 8554136
Number of successful extensions: 175502
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 175451
Number of HSP's gapped (non-prelim): 51
length of query: 764
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 741
effective length of database: 17,143,297,704
effective search space: 12703183598664
effective search space used: 12703183598664
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)
to top