Clone Name	rbasd13a01
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|BT016462.1| Zea mays clone Contig295 mRNA sequence	178	9e-42
2	gb|AY914601.1| Zea mays heat shock protein 70 mRNA, partial cds	178	9e-42
3	gb|AY109330.1| Zea mays CL45_1 mRNA sequence	178	9e-42
4	gb|AC134045.2| Oryza sativa (japonica cultivar-group) chromosome...	170	2e-39
5	emb|X67711.2|OSHSC70A O.sativa hsp70 gene for heat shock protein 70	170	2e-39
6	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	170	2e-39
7	dbj|AK119710.1| Oryza sativa (japonica cultivar-group) cDNA clon...	170	2e-39
8	dbj|AK119255.1| Oryza sativa (japonica cultivar-group) cDNA clon...	170	2e-39
9	dbj|AK065431.1| Oryza sativa (japonica cultivar-group) cDNA clon...	170	2e-39
10	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	170	2e-39
11	gb|BT016812.1| Zea mays clone Contig645 mRNA sequence	168	8e-39
12	ref|XM_470141.1| Oryza sativa (japonica cultivar-group), mRNA	167	3e-38
13	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	167	3e-38
14	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	167	3e-38
15	gb|AC104433.8| Oryza sativa chromosome 3 BAC OJ1754_E06 genomic ...	167	3e-38
16	dbj|AK102784.1| Oryza sativa (japonica cultivar-group) cDNA clon...	167	3e-38
17	dbj|AK069740.1| Oryza sativa (japonica cultivar-group) cDNA clon...	167	3e-38
18	emb|X78415.1|ZMHSP705 Z.mays (cv DH5xDH7) hsp70-5 mRNA for heat ...	163	5e-37
19	gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome...	153	5e-34
20	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	153	5e-34
21	ref|XM_475365.1| Oryza sativa (japonica cultivar-group), predic...	149	8e-33
22	gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str...	141	2e-30
23	gb|AC137698.1| Genomic sequence for Oryza sativa, Nipponbare str...	141	2e-30
24	dbj|AK109474.1| Oryza sativa (japonica cultivar-group) cDNA clon...	141	2e-30
25	dbj|AK099275.1| Oryza sativa (japonica cultivar-group) cDNA clon...	141	2e-30
26	dbj|AK072830.1| Oryza sativa (japonica cultivar-group) cDNA clon...	141	2e-30
27	ref|NM_190528.1| Oryza sativa (japonica cultivar-group), predic...	139	8e-30
28	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	139	8e-30
29	dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic D...	139	8e-30
30	dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic D...	139	8e-30
31	gb|U41653.1|SBU41653 Sorghum bicolor heat shock protein 70 (hsp7...	139	8e-30
32	emb|X78414.1|ZMHSP704 Z.mays (cv DH5xDH7) hsp70-4 mRNA for heat ...	137	3e-29
33	emb|X61491.1|SOSCE70 S.oleracea sce70 mRNA for 70 kDa heat shock...	129	7e-27
34	gb|AF479058.1| Sandersonia aurantiaca 70 kDa heat shock protein ...	129	7e-27
35	gb|AF034618.1|AF034618 Spinacia oleracea cytosolic heat shock 70...	129	7e-27
36	gb|L26243.1|SPIC70A Spinacia oleracea heat shock C70 protein mRN...	129	7e-27
37	emb|AJ249331.1|CSA249331 Cucumis sativus mRNA for heat shock pro...	127	3e-26
38	gb|BT018649.1| Zea mays clone EL01N0505F04.d mRNA sequence	125	1e-25
39	gb|AF005993.1|AF005993 Triticum aestivum 70 kDa heat shock prote...	121	2e-24
40	gb|AF527796.1| Cucurbita maxima cell-autonomous heat shock cogna...	115	1e-22
41	gb|AF161180.1|AF161180 Malus domestica high molecular weight hea...	115	1e-22
42	gb|BT016692.1| Zea mays clone Contig525 mRNA sequence	113	4e-22
43	gb|AF033852.1|AF033852 Spinacia oleracea cytosolic heat shock 70...	105	1e-19
44	gb|AF034617.1|AF034617 Spinacia oleracea cytosolic heat shock 70...	105	1e-19
45	gb|AF034616.1|AF034616 Spinacia oleracea cytosolic heat shock 70...	105	1e-19
46	emb|X03697.1|ZMHSP702 Maize gene for heat shock protein 70 exon ...	100	7e-18
47	gb|AF527794.1| Cucurbita maxima non-cell-autonomous heat shock c...	100	7e-18
48	dbj|AB112816.1| Nicotiana benthamiana Hsp70 mRNA for heat shock ...	100	7e-18
49	dbj|AB012716.1| Salix gilgiana Hsc70 mRNA for heat shock protein...	100	7e-18
50	gb|AY257488.1| Lycopersicon esculentum HSC2-like mRNA, partial s...	98	3e-17
51	dbj|AB112814.1| Nicotiana benthamiana Hsp70 mRNA for heat shock ...	98	3e-17
52	gb|AY104350.1| Zea mays PCO083553 mRNA sequence	98	3e-17
53	gb|AF002667.1|SCAF002667 Solanum commersonii heat shock cognate ...	98	3e-17
54	gb|AY694190.1| Camellia sinensis HSP70 (hsp70) mRNA, partial cds	96	1e-16
55	gb|AF527795.1| Cucurbita maxima non-cell-autonomous heat shock c...	96	1e-16
56	gb|AF509339.1| Saussurea medusa heat shock protein 70 (HSP70) mR...	92	2e-15
57	gb|AC150776.2| Medicago truncatula chromosome 7 BAC clone mte1-4...	92	2e-15
58	gb|AY372071.1| Nicotiana tabacum heat shock protein 70-3 (HSP70-...	90	6e-15
59	gb|AY253326.1| Nicotiana tabacum heat shock protein 70 (Hsp70) m...	90	6e-15
60	gb|AY836799.1| Saussurea medusa heat shock protein hsp70 gene, c...	88	2e-14
61	gb|AF509336.1| Saussurea medusa heat shock protein 70 (HSP70) mR...	88	2e-14
62	dbj|AB105430.2| Nicotiana benthamiana Hsp70 mRNA for heat shock ...	88	2e-14
63	gb|AY106152.1| Zea mays PCO094428 mRNA sequence	88	2e-14
64	gb|AY485986.1| Vigna radiata 70 kDa heat shock cognate protein 1...	84	4e-13
65	gb|AY261674.1| Citrus x paradisi HSP70 mRNA, partial cds	82	2e-12
66	gb|BT013586.1| Lycopersicon esculentum clone 132340F, mRNA sequence	82	2e-12
67	emb|X54029.1|LEHSC170 Lycopersicon esculentum hsc-1 mRNA for hea...	82	2e-12
68	gb|DQ124007.1| Coffea arabica x Coffea canephora clone HT-SSH4-F...	82	2e-12
69	gb|AY830127.1| Medicago sativa heat shock protein 70 (HSP70-1) m...	78	2e-11
70	gb|AC146757.19| Medicago truncatula clone mth2-16n21, complete s...	78	2e-11
71	gb|AC147536.12| Medicago truncatula clone mth2-9l3, complete seq...	78	2e-11
72	ref|NM_120328.2| Arabidopsis thaliana HSC70-1; ATP binding AT5G0...	74	4e-10
73	emb|X99197.1|MS70KDHSP M.sativa mRNA for 70 kD heat shock protein	74	4e-10
74	emb|X77199.1|ATHSC701 A.thaliana hsc70-1 gene	74	4e-10
75	emb|X74604.1|ATHSC70 A.thaliana hsc70 mRNA for heat shock cognat...	74	4e-10
76	gb|AY035123.1| Arabidopsis thaliana putative dnaK-type molecular...	74	4e-10
77	emb|AL162971.1|ATT22P11 Arabidopsis thaliana DNA chromosome 5, B...	74	4e-10
78	gb|AY120747.1| Arabidopsis thaliana DnaK-type molecular chaperon...	74	4e-10
79	gb|AY057481.1| Arabidopsis thaliana AT5g02500/T22P11_90 mRNA, co...	74	4e-10
80	emb|BX832460.1|CNS0A1Q8 Arabidopsis thaliana Full-length cDNA Co...	74	4e-10
81	gb|BT002754.1| Arabidopsis thaliana clone C104920 putative dnaK-...	74	4e-10
82	gb|AY929184.1| Latimeria chalumnae heat shock protein 70 (Hsp70)...	74	4e-10
83	emb|X54030.1|LEHSC270 Lycopersicon esculentum hsc-2 mRNA for hea...	72	1e-09
84	gb|DQ324856.1| Haliotis discus hannai heat shock protein 70 mRNA...	72	1e-09
85	gb|AF035414.1|AF035414 Brassica napus heat shock cognate protein...	72	1e-09
86	gb|S85730.1| hsc71=major heat-shock-protein-like gene [rainbow t...	68	2e-08
87	dbj|AB196460.1| Oncorhynchus mykiss HSC70A mRNA for heat shock 7...	68	2e-08
88	emb|X62799.1|GMHSP70 Glycine max hsp 70 gene	66	9e-08
89	gb|L41253.1|TOMHSC70A Lycopersicon esculentum Hsc70 gene, comple...	66	9e-08
90	ref|NM_120327.3| Arabidopsis thaliana ATP binding AT5G02490 mRNA...	64	4e-07
91	gb|BC077998.1| Xenopus laevis cDNA clone MGC:82390 IMAGE:4406669...	64	4e-07
92	gb|BT008411.1| Arabidopsis thaliana At5g02490 gene, complete cds	64	4e-07
93	gb|AY093152.1| Arabidopsis thaliana DnaK-type molecular chaperon...	64	4e-07
94	emb|Y08892.1|ATHSC70G8 A.thaliana mRNA for Hsc70-G8 protein, par...	64	4e-07
95	ref|NM_104519.1| Arabidopsis thaliana HSP70T-1; ATP binding AT1G...	60	6e-06
96	gb|AY485987.1| Vigna radiata 70 kDa heat shock cognate protein 2...	60	6e-06
97	gb|DQ446367.1| Arabidopsis thaliana clone pENTR221-At1g56410 hea...	60	6e-06
98	emb|Z32537.1|PSHSC71R P.sativum (little marvel) HSC71.0 mRNA	60	6e-06
99	emb|X51765.1|LPHSP70 L.polyphyllus mRNA for heat schock protein 70	60	6e-06
100	gb|AC058785.8|AC058785 Arabidopsis thaliana chromosome 1 BAC F13...	60	6e-06
101	emb|CR735051.2|CNS0GTY2 Tetraodon nigroviridis full-length cDNA	58	2e-05
102	emb|CR734665.2|CNS0GTNC Tetraodon nigroviridis full-length cDNA	58	2e-05
103	emb|CR732389.2|CNS0GS22 Tetraodon nigroviridis full-length cDNA	58	2e-05
104	emb|CR731254.2|CNS0GR6J Tetraodon nigroviridis full-length cDNA	58	2e-05
105	emb|CR730967.2|CNS0GQYK Tetraodon nigroviridis full-length cDNA	58	2e-05
106	emb|CR730283.2|CNS0GQFK Tetraodon nigroviridis full-length cDNA	58	2e-05
107	emb|CR729311.2|CNS0GPOL Tetraodon nigroviridis full-length cDNA	58	2e-05
108	emb|CR725754.2|CNS0GMXS Tetraodon nigroviridis full-length cDNA	58	2e-05
109	emb|CR724374.2|CNS0GLVG Tetraodon nigroviridis full-length cDNA	58	2e-05
110	emb|CR722706.2|CNS0GKL4 Tetraodon nigroviridis full-length cDNA	58	2e-05
111	emb|CR719367.2|CNS0GI0D Tetraodon nigroviridis full-length cDNA	58	2e-05
112	emb|CR716753.2|CNS0GFZU Tetraodon nigroviridis full-length cDNA	58	2e-05
113	emb|CR711358.2|CNS0GBU2 Tetraodon nigroviridis full-length cDNA	58	2e-05
114	emb|CR703631.2|CNS0G5VF Tetraodon nigroviridis full-length cDNA	58	2e-05
115	emb|CR699773.2|CNS0G2W9 Tetraodon nigroviridis full-length cDNA	58	2e-05
116	emb|CR700210.2|CNS0G38E Tetraodon nigroviridis full-length cDNA	58	2e-05
117	emb|CR699628.2|CNS0G2S8 Tetraodon nigroviridis full-length cDNA	58	2e-05
118	emb|CR699327.2|CNS0G2JV Tetraodon nigroviridis full-length cDNA	58	2e-05
119	emb|CR698441.2|CNS0G1V9 Tetraodon nigroviridis full-length cDNA	58	2e-05
120	emb|CR696974.2|CNS0G0QI Tetraodon nigroviridis full-length cDNA	58	2e-05
121	emb|CR696115.2|CNS0G02N Tetraodon nigroviridis full-length cDNA	58	2e-05
122	emb|CR694651.2|CNS0FYXZ Tetraodon nigroviridis full-length cDNA	58	2e-05
123	emb|CR693639.2|CNS0FY5V Tetraodon nigroviridis full-length cDNA	58	2e-05
124	emb|CR691059.2|CNS0FW67 Tetraodon nigroviridis full-length cDNA	58	2e-05
125	emb|CR688768.2|CNS0FUEK Tetraodon nigroviridis full-length cDNA	58	2e-05
126	emb|CR688743.2|CNS0FUDV Tetraodon nigroviridis full-length cDNA	58	2e-05
127	emb|CR688098.2|CNS0FTVY Tetraodon nigroviridis full-length cDNA	58	2e-05
128	emb|CR685229.2|CNS0FRO9 Tetraodon nigroviridis full-length cDNA	58	2e-05
129	emb|CR684600.2|CNS0FR6S Tetraodon nigroviridis full-length cDNA	58	2e-05
130	emb|CR682045.2|CNS0FP7T Tetraodon nigroviridis full-length cDNA	58	2e-05
131	emb|CR682007.2|CNS0FP6R Tetraodon nigroviridis full-length cDNA	58	2e-05
132	emb|CR681947.2|CNS0FP53 Tetraodon nigroviridis full-length cDNA	58	2e-05
133	emb|CR681557.2|CNS0FOU9 Tetraodon nigroviridis full-length cDNA	58	2e-05
134	emb|CR680840.2|CNS0FOAC Tetraodon nigroviridis full-length cDNA	58	2e-05
135	emb|CR680599.1|CNS0FO3N Tetraodon nigroviridis full-length cDNA	58	2e-05
136	emb|CR674390.2|CNS0FJBW Tetraodon nigroviridis full-length cDNA	58	2e-05
137	emb|CR673444.2|CNS0FILM Tetraodon nigroviridis full-length cDNA	58	2e-05
138	emb|CR668849.2|CNS0FF1Z Tetraodon nigroviridis full-length cDNA	58	2e-05
139	emb|CR668292.2|CNS0FEMI Tetraodon nigroviridis full-length cDNA	58	2e-05
140	emb|CR666588.2|CNS0FDB6 Tetraodon nigroviridis full-length cDNA	58	2e-05
141	emb|CR664947.2|CNS0FC1L Tetraodon nigroviridis full-length cDNA	58	2e-05
142	emb|CR664739.2|CNS0FBVT Tetraodon nigroviridis full-length cDNA	58	2e-05
143	emb|CR664071.2|CNS0FBD9 Tetraodon nigroviridis full-length cDNA	58	2e-05
144	emb|CR663097.2|CNS0FAM7 Tetraodon nigroviridis full-length cDNA	58	2e-05
145	emb|CR662148.2|CNS0F9VU Tetraodon nigroviridis full-length cDNA	58	2e-05
146	emb|CR657309.2|CNS0F65F Tetraodon nigroviridis full-length cDNA	58	2e-05
147	emb|CR656869.2|CNS0F5T7 Tetraodon nigroviridis full-length cDNA	58	2e-05
148	emb|CR655448.1|CNS0F4PQ Tetraodon nigroviridis full-length cDNA	58	2e-05
149	emb|CR656433.1|CNS0F5H3 Tetraodon nigroviridis full-length cDNA	58	2e-05
150	emb|CR656379.1|CNS0F5FL Tetraodon nigroviridis full-length cDNA	58	2e-05
151	emb|CR656173.1|CNS0F59V Tetraodon nigroviridis full-length cDNA	58	2e-05
152	emb|CR655567.2|CNS0F4T1 Tetraodon nigroviridis full-length cDNA	58	2e-05
153	emb|CR654938.1|CNS0F4BK Tetraodon nigroviridis full-length cDNA	58	2e-05
154	emb|CR654405.2|CNS0F3WR Tetraodon nigroviridis full-length cDNA	58	2e-05
155	emb|CR654109.2|CNS0F3OJ Tetraodon nigroviridis full-length cDNA	58	2e-05
156	emb|CR654231.1|CNS0F3RX Tetraodon nigroviridis full-length cDNA	58	2e-05
157	emb|CR651953.2|CNS0F20N Tetraodon nigroviridis full-length cDNA	58	2e-05
158	emb|CR651660.2|CNS0F1SI Tetraodon nigroviridis full-length cDNA	58	2e-05
159	emb|CR651251.2|CNS0F1H5 Tetraodon nigroviridis full-length cDNA	58	2e-05
160	emb|CR650378.1|CNS0F0SW Tetraodon nigroviridis full-length cDNA	58	2e-05
161	emb|CR649698.2|CNS0F0A0 Tetraodon nigroviridis full-length cDNA	58	2e-05
162	emb|CR648821.2|CNS0EZLN Tetraodon nigroviridis full-length cDNA	58	2e-05
163	emb|CR643803.1|CNS0EVQ9 Tetraodon nigroviridis full-length cDNA	58	2e-05
164	emb|CR641941.2|CNS0EUAJ Tetraodon nigroviridis full-length cDNA	58	2e-05
165	emb|CR638956.2|CNS0ERZM Tetraodon nigroviridis full-length cDNA	58	2e-05
166	emb|CR633864.2|CNS0EO26 Tetraodon nigroviridis full-length cDNA	58	2e-05
167	ref|XM_686300.1| PREDICTED: Danio rerio similar to heat shock co...	58	2e-05
168	dbj|AK222068.1| Arabidopsis thaliana mRNA for dnaK-type molecula...	58	2e-05
169	dbj|AB112815.1| Nicotiana benthamiana Hsp70 mRNA for heat shock ...	58	2e-05
170	gb|BC091445.1| Danio rerio cDNA clone IMAGE:7286763, containing ...	58	2e-05
171	emb|AJ249330.1|CSA249330 Cucumis sativus mRNA for heat shock pro...	56	9e-05
172	emb|CR734111.2|CNS0GT7Y Tetraodon nigroviridis full-length cDNA	56	9e-05
173	emb|CR728102.2|CNS0GOR0 Tetraodon nigroviridis full-length cDNA	56	9e-05
174	emb|CR703946.1|CNS0G646 Tetraodon nigroviridis full-length cDNA	56	9e-05
175	emb|CR683400.2|CNS0FQ9G Tetraodon nigroviridis full-length cDNA	56	9e-05
176	emb|CR656537.1|CNS0F5JZ Tetraodon nigroviridis full-length cDNA	56	9e-05
177	gb|DQ059998.1| Volvox carteri f. nagariensis heat-shock inducibl...	56	9e-05
178	gb|DQ059999.1| Volvox carteri f. nagariensis heat-shock inducibl...	56	9e-05
179	emb|X13301.1|PHHSP70R Petunia mRNA for heat shock protein hsp70	56	9e-05
180	emb|X06932.1|PHHSP70G Petunia hsp70 gene	56	9e-05
181	gb|U23504.1|TNU23504 Trichoplusia ni HSC70 mRNA, complete cds	56	9e-05
182	emb|CR626889.13| Zebrafish DNA sequence from clone DKEY-4P15 in ...	54	3e-04
183	gb|AY762969.1| Acanthopagrus schlegelii HSC70 (HSC70) mRNA, comp...	54	3e-04
184	gb|AY029210.1| Ambystoma mexicanum heat shock protein 70 (HSP70)...	54	3e-04
185	gb|AY436786.1| Rhabdosargus sarba heat shock cognate 70 (hsc70) ...	54	3e-04
186	gb|AY219845.1| Cyprinus carpio constitutive heat shock protein H...	52	0.001
187	dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c...	52	0.001
188	dbj|AB196461.1| Oncorhynchus mykiss HSC70B mRNA for heat shock 7...	52	0.001
189	gb|AF194819.1|AF194819 Manduca sexta heat shock cognate 70 prote...	52	0.001
190	dbj|AB092840.1| Carassius auratus HSC70 mRNA for heat shock cogn...	52	0.001
191	gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete...	52	0.001
192	gb|AY485988.1| Vigna radiata 70 kDa heat shock cognate protein 3...	50	0.005
193	gb|AY423868.1| Leishmania tarentolae 70 kDa heat shock protein (...	50	0.005
194	gb|M76725.2| Chlamydomonas reinhardtii 70 kDa heat shock protein...	50	0.005
195	emb|BX833094.1|CNS0A0GB Arabidopsis thaliana Full-length cDNA Co...	50	0.005
196	gb|U26448.1|EGU26448 Echinococcus granulosus heat shock 70 kDa p...	50	0.005
197	ref|XM_882866.1| PREDICTED: Bos taurus similar to Rab GTPase bin...	48	0.021
198	ref|XM_882853.1| PREDICTED: Bos taurus similar to Rab GTPase bin...	48	0.021
199	ref|XM_882846.1| PREDICTED: Bos taurus similar to Rab GTPase bin...	48	0.021
200	ref|XM_869715.1| PREDICTED: Bos taurus similar to Rab GTPase bin...	48	0.021
201	gb|AY524794.1| Thellungiella halophila heat shock cognate protei...	48	0.021
202	emb|CR723474.2|CNS0GL6G Tetraodon nigroviridis full-length cDNA	48	0.021
203	ref|XM_797036.1| PREDICTED: Strongylocentrotus purpuratus simila...	48	0.021
204	ref|XM_797035.1| PREDICTED: Strongylocentrotus purpuratus simila...	48	0.021
205	ref|XM_797034.1| PREDICTED: Strongylocentrotus purpuratus simila...	48	0.021
206	ref|XM_776060.1| PREDICTED: Strongylocentrotus purpuratus simila...	48	0.021
207	ref|XM_797027.1| PREDICTED: Strongylocentrotus purpuratus simila...	48	0.021
208	ref|XM_797023.1| PREDICTED: Strongylocentrotus purpuratus simila...	48	0.021
209	emb|AJ004940.1|GGAJ4940 Gallus gallus mRNA for heat shock cognat...	48	0.021
210	dbj|AB167744.1| Numida meleagris hspa8 mRNA for heat shock prote...	48	0.021
211	gb|L19533.1|CRUU14HS Cricetulus griseus heat resistant protein gene	48	0.021
212	emb|CR386963.1| Gallus gallus finished cDNA, clone ChEST104m7	48	0.021
213	ref|NM_205003.1| Gallus gallus heat shock cognate 70 (HSC70), mRNA	48	0.021
214	gb|M34561.1|CRUHSP70A Chinese hamster heat shock protein (cognat...	48	0.021
215	gb|AY651253.1| Rhynchobodo ATCC50359 heat shock protein 70 cytos...	46	0.084
216	gb|DQ025691.1| Oncorhynchus nerka clone One.hsc71.19.34 genomic ...	46	0.084
217	gb|DQ025620.1| Oncorhynchus keta clone Oke.hsc71.19.23 genomic s...	46	0.084
218	gb|DQ025546.1| Oncorhynchus tshawytscha clone Ots.hsc71.19.32 ge...	46	0.084
219	ref|XM_508938.1| PREDICTED: Pan troglodytes similar to heat shoc...	46	0.084
220	ref|XM_508830.1| PREDICTED: Pan troglodytes heat shock 70kDa pro...	46	0.084
221	ref|XM_518899.1| PREDICTED: Pan troglodytes similar to Heat shoc...	46	0.084
222	ref|NM_001003067.1| Canis familiaris heat shock protein 70 (HSP7...	46	0.084
223	ref|NM_174550.1| Bos taurus heat shock 70 kD protein 1 (HSPA1A),...	46	0.084
224	gb|AY662497.1| Bos taurus heat shock protein 70 kDa mRNA, comple...	46	0.084
225	gb|AF134726.1| Homo sapiens BAC clone 215O12 NG35, NG36, G9A, NG...	46	0.084
226	gb|BC063507.1| Homo sapiens heat shock 70kDa protein 1B, mRNA (c...	46	0.084
227	gb|BC016660.1| Homo sapiens heat shock 70kDa protein 8, transcri...	46	0.084
228	gb|BC016179.1| Homo sapiens heat shock 70kDa protein 8, transcri...	46	0.084
229	gb|BC019816.2| Homo sapiens heat shock 70kDa protein 8, transcri...	46	0.084
230	gb|BC007276.1| Homo sapiens heat shock 70kDa protein 8, mRNA (cD...	46	0.084
231	ref|NM_006597.3| Homo sapiens heat shock 70kDa protein 8 (HSPA8)...	46	0.084
232	gb|DQ440299.1| Aedes aegypti clone AET-381 heat shock cognate 70...	46	0.084
233	gb|AY559741.1| Homo sapiens sequence in region of NEU1 and HSPA1...	46	0.084
234	gb|AY456093.1| Phytophthora nicotianae heat shock protein 70 (Hs...	46	0.084
235	gb|AY466608.1| Sus scrofa heat shock protein 70.2 (hsp70.2) mRNA...	46	0.084
236	gb|BC008907.2| Homo sapiens heat shock 70kDa protein 8, mRNA (cD...	46	0.084
237	gb|BC009322.2| Homo sapiens heat shock 70kDa protein 1A, mRNA (c...	46	0.084
238	gb|BC002423.1| Homo sapiens ribosomal protein L8, mRNA (cDNA clo...	46	0.084
239	ref|XM_812644.1| Trypanosoma cruzi strain CL Brener heat shock p...	46	0.084
240	ref|XM_812645.1| Trypanosoma cruzi strain CL Brener heat shock p...	46	0.084
241	gb|BC018740.1| Homo sapiens heat shock 70kDa protein 1A, mRNA (c...	46	0.084
242	gb|BC112920.1| Homo sapiens cDNA clone IMAGE:7484542, **** WARNI...	46	0.084
243	emb|AL929592.8| Human DNA sequence from clone DAQB-147D11 on chr...	46	0.084
244	emb|AL671762.10| Human DNA sequence from clone XXbac-254B15 on c...	46	0.084
245	emb|AL662834.8| Human DNA sequence from clone XXbac-40G17 on chr...	46	0.084
246	gb|AY149619.1| Bos taurus heat-shock 70-kilodalton protein 1A (H...	46	0.084
247	gb|AY149618.1| Bos taurus heat-shock 70-kilodalton protein 1A (H...	46	0.084
248	emb|Y00371.1|HSHSC70 Human hsc70 gene for 71 kd heat shock cogna...	46	0.084
249	emb|X67716.1|TCHSPR70 T.cruzi mRNA for HSP70	46	0.084
250	emb|X58715.1|TCHSP70PA T.cruzi hsp70 mRNA for 70 kDa heat shock ...	46	0.084
251	emb|CR925990.1| Pongo pygmaeus mRNA; cDNA DKFZp459M2220 (from cl...	46	0.084
252	ref|NM_005345.4| Homo sapiens heat shock 70kDa protein 1A (HSPA1...	46	0.084
253	gb|DQ451402.1| Homo sapiens heat shock 70kDa protein 1A (HSPA1A)...	46	0.084
254	emb|AJ812563.1| Bubalus bubalis partial mRNA for putative heat s...	46	0.084
255	emb|CR937348.1| Single read from an extremity of a cDNA clone ma...	46	0.084
256	emb|CR937294.1| Single read from an extremity of a cDNA clone ma...	46	0.084
257	emb|CR759915.6| Human DNA sequence from clone DAAP-21F2 on chrom...	46	0.084
258	gb|BC057397.1| Homo sapiens heat shock 70kDa protein 1B, mRNA (c...	46	0.084
259	emb|CR861166.1| Pongo pygmaeus mRNA; cDNA DKFZp459P2416 (from cl...	46	0.084
260	emb|CR859344.1| Pongo pygmaeus mRNA; cDNA DKFZp469O0514 (from cl...	46	0.084
261	emb|CR860584.1| Pongo pygmaeus mRNA; cDNA DKFZp459L1519 (from cl...	46	0.084
262	emb|CR860185.1| Pongo pygmaeus mRNA; cDNA DKFZp469I011 (from clo...	46	0.084
263	emb|CR859135.1| Pongo pygmaeus mRNA; cDNA DKFZp459D1928 (from cl...	46	0.084
264	emb|CR388202.9| Human DNA sequence from clone DADB-333F21 on chr...	46	0.084
265	dbj|D87511.1| Trypanosoma cruzi mRNA for heat shock protein 70, ...	46	0.084
266	emb|CR626292.1| full-length cDNA clone CS0DF038YK05 of Fetal bra...	46	0.084
267	emb|CR625958.1| full-length cDNA clone CS0DF029YC09 of Fetal bra...	46	0.084
268	emb|CR624878.1| full-length cDNA clone CS0DF012YA23 of Fetal bra...	46	0.084
269	emb|CR623327.1| full-length cDNA clone CL0BB012ZA08 of Neuroblas...	46	0.084
270	emb|CR621778.1| full-length cDNA clone CS0DE003YF16 of Placenta ...	46	0.084
271	emb|CR620700.1| full-length cDNA clone CS0DM001YK04 of Fetal liv...	46	0.084
272	emb|CR618855.1| full-length cDNA clone CS0DA004YH14 of Neuroblas...	46	0.084
273	dbj|AK096100.1| Homo sapiens cDNA FLJ38781 fis, clone LIVER20002...	46	0.084
274	emb|CR619085.1| full-length cDNA clone CS0DF008YL15 of Fetal bra...	46	0.084
275	emb|CR618761.1| full-length cDNA clone CS0DN003YF07 of Adult bra...	46	0.084
276	dbj|AK096017.1| Homo sapiens cDNA FLJ38698 fis, clone KIDNE20020...	46	0.084
277	emb|CR618452.1| full-length cDNA clone CS0DA004YF21 of Neuroblas...	46	0.084
278	emb|CR617847.1| full-length cDNA clone CS0DN003YP05 of Adult bra...	46	0.084
279	emb|CR614382.1| full-length cDNA clone CS0CAP006YL11 of Thymus o...	46	0.084
280	emb|CR612907.1| full-length cDNA clone CS0DF036YM23 of Fetal bra...	46	0.084
281	dbj|AK097113.1| Homo sapiens cDNA FLJ39794 fis, clone SPLEN20039...	46	0.084
282	emb|CR609237.1| full-length cDNA clone CL0BA012ZA08 of Placenta ...	46	0.084
283	emb|CR609187.1| full-length cDNA clone CS0DF023YF04 of Fetal bra...	46	0.084
284	emb|CR609094.1| full-length cDNA clone CS0DF023YO18 of Fetal bra...	46	0.084
285	emb|CR608110.1| full-length cDNA clone CS0DJ004YG01 of T cells (...	46	0.084
286	emb|CR606872.1| full-length cDNA clone CS0DF021YI09 of Fetal bra...	46	0.084
287	emb|CR606370.1| full-length cDNA clone CS0DI037YG01 of Placenta ...	46	0.084
288	emb|CR605894.1| full-length cDNA clone CS0DA003YN07 of Neuroblas...	46	0.084
289	emb|CR605852.1| full-length cDNA clone CS0DA010YP23 of Neuroblas...	46	0.084
290	emb|CR605652.1| full-length cDNA clone CS0DF033YK03 of Fetal bra...	46	0.084
291	emb|CR603812.1| full-length cDNA clone CS0DF020YJ02 of Fetal bra...	46	0.084
292	emb|CR602771.1| full-length cDNA clone CS0DF004YF23 of Fetal bra...	46	0.084
293	emb|CR600856.1| full-length cDNA clone CS0DJ009YJ18 of T cells (...	46	0.084
294	emb|CR599778.1| full-length cDNA clone CS0DE006YC12 of Placenta ...	46	0.084
295	emb|CR599258.1| full-length cDNA clone CS0DF007YE19 of Fetal bra...	46	0.084
296	emb|CR598680.1| full-length cDNA clone CS0DC028YM15 of Neuroblas...	46	0.084
297	emb|CR598455.1| full-length cDNA clone CS0DA003YC01 of Neuroblas...	46	0.084
298	emb|CR598352.1| full-length cDNA clone CS0DF006YL22 of Fetal bra...	46	0.084
299	emb|CR597390.1| full-length cDNA clone CS0DF009YO17 of Fetal bra...	46	0.084
300	emb|CR595673.1| full-length cDNA clone CS0DE002YK13 of Placenta ...	46	0.084
301	emb|CR593858.1| full-length cDNA clone CS0DF022YI19 of Fetal bra...	46	0.084
302	gb|AE012421.1| Xanthomonas campestris pv. campestris str. ATCC 3...	46	0.084
303	emb|CR591386.1| full-length cDNA clone CS0DI003YO22 of Placenta ...	46	0.084
304	dbj|AB073886.1| Homo sapiens primary neuroblastoma cDNA, clone:N...	46	0.084
305	ref|XM_694544.1| PREDICTED: Danio rerio similar to Splicing fact...	46	0.084
306	ref|XM_694630.1| PREDICTED: Danio rerio similar to heat shock pr...	46	0.084
307	gb|DQ388429.1| Homo sapiens heat shock 70kDa protein 1B (HSPA1B)...	46	0.084
308	ref|NM_005346.3| Homo sapiens heat shock 70kDa protein 1B (HSPA1...	46	0.084
309	ref|XM_691025.1| PREDICTED: Danio rerio similar to Splicing fact...	46	0.084
310	gb|BC015699.1|BC015699 Homo sapiens, clone IMAGE:3906958, mRNA, ...	46	0.084
311	gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ...	46	0.084
312	gb|BC103083.1| Bos taurus heat shock 70 kD protein 2, mRNA (cDNA...	46	0.084
313	gb|AF217511.1|AF217511 Homo sapiens uncharacterized bone marrow ...	46	0.084
314	gb|AC148662.1| Macaca mulatta Major Histocompatibility Complex B...	46	0.084
315	gb|DQ022675.1| Bos grunniens heat shock protein 70.2 (hsp70.2) m...	46	0.084
316	gb|AF352832.1|AF352832 Homo sapiens constitutive heat shock prot...	46	0.084
317	dbj|AK222785.1| Homo sapiens mRNA for heat shock 70kDa protein 8...	46	0.084
318	dbj|AB072749.1| Macaca fascicularis testis cDNA clone:QtsA-16150...	46	0.084
319	gb|AY974355.1| Culex pipiens heat shock protein 70 mRNA, complet...	46	0.084
320	ref|NM_213766.1| Sus scrofa heat shock protein 70.2 (HSP70.2), mRNA	46	0.084
321	gb|AC007207.22| Homo sapiens 12 BAC RP11-320N7 (Roswell Park Can...	46	0.084
322	dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA...	46	0.084
323	gb|AF142571.1|AF142571 Saguinus oedipus intracellular vitamin D ...	46	0.084
324	gb|AY891855.1| Synthetic construct Homo sapiens clone FLH116883....	46	0.084
325	gb|AY889368.1| Synthetic construct Homo sapiens clone FLH116887....	46	0.084
326	dbj|AK000571.1| Homo sapiens cDNA FLJ20564 fis, clone KAT12033	46	0.084
327	dbj|AK129885.1| Homo sapiens cDNA FLJ26375 fis, clone HRT06292, ...	46	0.084
328	dbj|AB114672.1| Canis familiaris hsp70 mRNA for heat shock prote...	46	0.084
329	gb|AY423555.2| Dicentrarchus labrax HSP70 (HSP70) mRNA, complete...	46	0.084
330	gb|BC002453.2| Homo sapiens heat shock 70kDa protein 1A, mRNA (c...	46	0.084
331	dbj|AB114675.1| Canis familiaris hsp70 mRNA for heat shock prote...	46	0.084
332	dbj|AB114674.1| Canis familiaris hsp70 mRNA for heat shock prote...	46	0.084
333	dbj|AB114673.1| Canis familiaris hsp70 mRNA for heat shock prote...	46	0.084
334	dbj|AP000926.6| Homo sapiens genomic DNA, chromosome 11 clone:RP...	46	0.084
335	dbj|AB209818.1| Homo sapiens mRNA for heat shock 70kDa protein 1...	46	0.084
336	ref|NM_203322.2| Bos taurus heat shock 70 kD protein 2 (HSPA1B),...	46	0.084
337	emb|AL773559.16| Pig DNA sequence from clone XX-711D2, complete ...	46	0.084
338	gb|U09861.1|BTU09861 Bos taurus 70 kDA heat-shock protein (hsp70...	46	0.084
339	gb|M59830.1|HUMMHHSP2 Human MHC class III HSP70-2 gene (HLA), co...	46	0.084
340	gb|M59828.1|HUMMHHSP Human MHC class III HSP70-1 gene (HLA), com...	46	0.084
341	emb|X73685.1|CAHSP C.aethiops hsp70 mRNA	46	0.084
342	gb|M11717.1|HUMHSP70D Human heat shock protein (hsp 70) gene, co...	46	0.084
343	emb|AL360193.1|HST000239 Homo sapiens mRNA full length insert cD...	46	0.084
344	gb|M69100.1|PIGHSP70G Pig hsp70 gene, complete cds	46	0.084
345	gb|M26595.1|TRBHSP70AB T.cruzi heat shock protein (HSP70) gene, ...	46	0.084
346	gb|U02892.1|BTU02892 Bos taurus Angus 70 kda heat shock protein-...	46	0.084
347	gb|U02891.1|BTU02891 Bos taurus Angus 70 kda heat shock protein-...	46	0.084
348	dbj|AB075027.1| Canis familiaris hsp70 mRNA for heat shock prote...	46	0.084
349	emb|AL773527.8| Pig DNA sequence from clone XX-707F1, complete s...	46	0.084
350	gb|AY422994.1| Danio rerio heat shock 70kDa protein 8 (HSPA8) mR...	44	0.33
351	gb|AY748350.1| Fenneropenaeus chinensis heat shock protein 70 co...	44	0.33
352	gb|AY538777.1| Pimephales promelas heat shock cognate 70 kDa pro...	44	0.33
353	emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ...	44	0.33
354	gb|AY288515.1| Trypanoplasma borreli heat shock protein 70 gene,...	44	0.33
355	gb|AY078499.4| Dunaliella salina heat shock protein 70a (HSP70) ...	44	0.33
356	emb|CR635883.2|CNS0EPM9 Tetraodon nigroviridis full-length cDNA	44	0.33
357	ref|XM_797014.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.33
358	ref|XM_775743.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.33
359	ref|XM_797002.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.33
360	ref|XM_796989.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.33
361	ref|XM_796976.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.33
362	ref|XM_796964.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.33
363	ref|XM_796945.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.33
364	emb|Y11413.1|DRHSC70 D.rerio hsc70 mRNA	44	0.33
365	emb|X52314.1|LDHSP70 Leishmania hsp70 gene for heat shock protei...	44	0.33
366	gb|AY072815.1| Chlorella zofingiensis heat shock protein 70 mRNA...	44	0.33
367	ref|XM_687844.1| PREDICTED: Danio rerio similar to Heat shock pr...	44	0.33
368	gb|AF227986.1|AF227986 Rivulus marmoratus HSC71 gene, complete cds	44	0.33
369	gb|AY233001.1| Kryptolebias marmoratus heat shock cognate 71 (Hs...	44	0.33
370	emb|BX276087.14| Zebrafish DNA sequence from clone CH211-270M20 ...	44	0.33
371	dbj|AB013075.1| Canis familiaris gene for heat shock protein 70,...	44	0.33
372	gb|BC063228.1| Danio rerio heat shock protein 8, mRNA (cDNA clon...	44	0.33
373	gb|BC045841.1| Danio rerio heat shock protein 8, mRNA (cDNA clon...	44	0.33
374	ref|NM_131401.1| Danio rerio heat shock protein 8 (hspa8), mRNA	44	0.33
375	dbj|AB006814.1| Paralichthys olivaceus mRNA for hsc71, complete cds	44	0.33
376	emb|Z30176.1|TRMHSP70 T.repens (Huia) mRNA for heat shock protei...	44	0.33
377	gb|L77146.1|ZEFHSC7R Danio rerio heat shock cognate (hsc70) mRNA...	44	0.33
378	emb|BX120005.6| Zebrafish DNA sequence from clone RP71-56I13 in ...	44	0.33
379	gb|AF053059.1|AF053059 Paralichthys olivaceus heat shock protein...	44	0.33
380	gb|U58209.1|ZMU58209 Zea mays lumenal binding protein cBiPe3 mRN...	44	0.33
381	gb|U58208.1|ZMU58208 Zea mays lumenal binding protein cBiPe2 mRN...	44	0.33
382	gb|BC066491.1| Danio rerio heat shock protein 8, mRNA (cDNA clon...	44	0.33
383	gb|M59449.1|MZEB70A Zea mays polypeptide chain-binding protein m...	44	0.33
384	gb|U08820.1|PSU08820 Pisum sativum HSP70b mRNA, partial cds	44	0.33
385	gb|AY651255.1| Cryptobia helicis heat shock protein 70 cytosolic...	42	1.3
386	gb|AC150414.2| Branchiostoma floridae clone CH302-62C22, complet...	42	1.3
387	gb|AY617976.1| Sterkiella histriomuscorum clone UGC1O0006_M14_R ...	42	1.3
388	gb|AY618164.1| Sterkiella histriomuscorum clone UGC1O0006_M22_R ...	42	1.3
389	gb|BT023894.1| Drosophila melanogaster LP19893 full insert cDNA	42	1.3
390	ref|XM_872816.1| PREDICTED: Bos taurus similar to Septin-11, tra...	42	1.3
391	ref|XM_864283.1| PREDICTED: Bos taurus similar to Septin-11, tra...	42	1.3
392	ref|XM_615857.2| PREDICTED: Bos taurus similar to Septin-11, tra...	42	1.3
393	emb|AJ249329.1|CSA249329 Cucumis sativus mRNA for heat shock pro...	42	1.3
394	gb|DQ173923.1| Homarus americanus heat shock protein 70 mRNA, co...	42	1.3
395	gb|AY913842.2| Leishmania donovani strain DD8 heat shock protein...	42	1.3
396	gb|AF474375.1| Penaeus monodon heat shock protein 70 mRNA, compl...	42	1.3
397	emb|Y08020.1|LIHSP706 L.infantum hsp70 gene, clone B2g6	42	1.3
398	emb|X85798.1|LIHSP70 L.infantum hsp70 gene	42	1.3
399	emb|Y08019.1|LIHSP701 L.infantum hsp70 gene, clone B2g1	42	1.3
400	gb|AE011965.1| Xanthomonas axonopodis pv. citri str. 306, secti...	42	1.3
401	ref|NM_176503.1| Drosophila melanogaster Heat shock protein cogn...	42	1.3
402	ref|NM_176502.1| Drosophila melanogaster Heat shock protein cogn...	42	1.3
403	ref|NM_169627.1| Drosophila melanogaster Heat shock protein cogn...	42	1.3
404	ref|NM_169626.1| Drosophila melanogaster Heat shock protein cogn...	42	1.3
405	ref|NM_169625.1| Drosophila melanogaster Heat shock protein cogn...	42	1.3
406	dbj|AB240143.1| Chlorella pyrenoidosa hsp70 mRNA for heat shock ...	42	1.3
407	ref|NM_079632.4| Drosophila melanogaster Heat shock protein cogn...	42	1.3
408	gb|AY084193.1| Drosophila melanogaster RH04426 full insert cDNA	42	1.3
409	gb|AC009904.7| Drosophila melanogaster, chromosome 3R, region 88...	42	1.3
410	gb|AC007648.6|AC007648 Drosophila melanogaster, chromosome 3R, r...	42	1.3
411	emb|X95688.1|ACHSP70HM A.cepa mRNA for heat shock protein 70-lik...	42	1.3
412	gb|AE003708.3| Drosophila melanogaster chromosome 3R, section 46...	42	1.3
413	gb|L14605.1|LEIHSP70G Leishmania amazonensis heat shock protein ...	42	1.3
414	gb|U64207.1|PCU64207 Penicillium citrinum heat shock protein 70 ...	42	1.3
415	gb|L14604.1|LEIHSP70C Leishmania amazonensis heat shock protein ...	42	1.3
416	gb|M36114.1|DROHSC4A2 D.melanogaster heat shock cognate 4 (hsc4)...	42	1.3
417	ref|NM_112093.1| Arabidopsis thaliana HSP70; ATP binding AT3G125...	40	5.2
418	gb|AC009388.5| Drosophila melanogaster clone BACR11P22, complete...	40	5.2
419	gb|AC152826.2| Mus musculus BAC clone RP23-111C21 from chromosom...	40	5.2
420	ref|XM_870731.1| PREDICTED: Bos taurus similar to Heat shock cog...	40	5.2
421	ref|XM_590005.2| PREDICTED: Bos taurus similar to MEGF11 protein...	40	5.2
422	gb|AY645906.1| Litopenaeus vannamei heat shock protein 70 gene, ...	40	5.2
423	ref|NM_020804.2| Homo sapiens protein kinase C and casein kinase...	40	5.2
424	ref|NM_019400.1| Mus musculus rabaptin, RAB GTPase binding effec...	40	5.2
425	gb|AY702003.1| Leishmania donovani strain MHOM/IN/1983/AG83 heat...	40	5.2
426	gb|AC116569.6| Mus musculus BAC clone RP23-59O19 from chromosome...	40	5.2
427	gb|AC138173.2| Mus musculus strain C57BL/6J clone rp23-364j24 ma...	40	5.2
428	ref|XM_751924.1| Ustilago maydis 521 hypothetical protein (UM008...	40	5.2
429	ref|XM_389647.1| Gibberella zeae PH-1 chromosome 4 GR78_NEUCR 78...	40	5.2
430	gb|AC125075.4| Mus musculus BAC clone RP23-468P13 from chromosom...	40	5.2
431	ref|XM_531893.2| PREDICTED: Canis familiaris similar to MEGF10 p...	40	5.2
432	gb|BC009814.1| Mus musculus rabaptin, RAB GTPase binding effecto...	40	5.2
433	emb|Z80223.1|CEF26D10 Caenorhabditis elegans Cosmid F26D10, comp...	40	5.2
434	gb|AC122207.2| Mus musculus BAC clone RP23-88I22 from 16, comple...	40	5.2
435	gb|BC060166.1| Mus musculus rabaptin, RAB GTPase binding effecto...	40	5.2
436	gb|BC040228.1| Homo sapiens protein kinase C and casein kinase s...	40	5.2
437	gb|AC119816.5| Mus musculus chromosome 5, clone RP23-59B8, compl...	40	5.2
438	ref|NM_019124.1| Rattus norvegicus rabaptin, RAB GTPase binding ...	40	5.2
439	emb|CR936845.11| Mouse DNA sequence from clone DN-279H6 on chrom...	40	5.2
440	gb|AC163665.4| Mus musculus BAC clone RP23-325J23 from chromosom...	40	5.2
441	gb|AC160532.4| Mus musculus chromosome 5, clone RP24-158N23, com...	40	5.2
442	emb|CR861449.1| Pongo pygmaeus mRNA; cDNA DKFZp459D242 (from clo...	40	5.2
443	emb|CR859322.1| Pongo pygmaeus mRNA; cDNA DKFZp459F0227 (from cl...	40	5.2
444	emb|AL834211.1|HSM805614 Homo sapiens mRNA; cDNA DKFZp761O232 (f...	40	5.2
445	emb|AL596136.5| Mouse DNA sequence from clone RP23-83I13 on chro...	40	5.2
446	emb|AJ002551.1|ATAJ2551 Arabidopsis thaliana mRNA for heat shock...	40	5.2
447	emb|AJ318883.1|OED318883 Ostrea edulis partial hsp70 gene for he...	40	5.2
448	emb|AJ318882.1|CGI318882 Crassostrea gigas partial hsp70 gene fo...	40	5.2
449	emb|AJ305316.1|OED305316 Ostrea edulis hsc70 gene, exons 1-6	40	5.2
450	emb|AJ305315.1|CGI305315 Crassostrea gigas hsc70 gene, exons 1-6	40	5.2
451	dbj|AB205151.1| Brevundimonas diminuta orf1-orf7 genes for hypot...	40	5.2
452	gb|AC010114.6| Drosophila melanogaster 3L BAC RP98-10P9 (Roswell...	40	5.2
453	gb|AC091218.2| Drosophila melanogaster 3L BAC RP98-3E24 (Roswell...	40	5.2
454	gb|AY113617.1| Drosophila melanogaster RH65663 full insert cDNA	40	5.2
455	ref|NM_168310.1| Drosophila melanogaster smaug CG5263-RC, transc...	40	5.2
456	ref|NM_168309.1| Drosophila melanogaster smaug CG5263-RB, transc...	40	5.2
457	ref|NM_143338.2| Drosophila melanogaster CG12259-RA (CG12259), mRNA	40	5.2
458	ref|NM_079263.2| Drosophila melanogaster smaug CG5263-RA, transc...	40	5.2
459	dbj|AK137236.1| Mus musculus adult male urinary bladder cDNA, RI...	40	5.2
460	dbj|AK134587.1| Mus musculus adult male medulla oblongata cDNA, ...	40	5.2
461	dbj|AK151901.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	40	5.2
462	gb|AY059885.1| Arabidopsis thaliana 70 kDa heat shock protein (T...	40	5.2
463	gb|AC161601.4| Mus musculus BAC clone RP23-333L19 from chromosom...	40	5.2
464	gb|AY058607.1| Drosophila melanogaster LD30037 full length cDNA	40	5.2
465	gb|AY054190.1| Arabidopsis thaliana AT3g12580/T2E22_110 mRNA, co...	40	5.2
466	gb|AY054183.1| Arabidopsis thaliana AT3g12580/T2E22_110 mRNA, co...	40	5.2
467	gb|AC159265.2| Mus musculus BAC clone RP23-462H20 from chromosom...	40	5.2
468	gb|AC018763.6| Homo sapiens chromosome 5 clone CTD-2305C23, comp...	40	5.2
469	dbj|AK019413.1| Mus musculus 13 days embryo head cDNA, RIKEN ful...	40	5.2
470	ref|NM_070667.2| Caenorhabditis elegans Heat Shock Protein famil...	40	5.2
471	gb|AY847068.1| Toxoplasma gondii dual-family immunophilin 57 kDa...	40	5.2
472	dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D...	40	5.2
473	gb|AF242529.1|AF242529 Homo sapiens protein kinase C and casein ...	40	5.2
474	gb|AY150182.1| Balanus amphitrite 70kDa heat shock protein mRNA,...	40	5.2
475	gb|AY691667.1| Oxyuranus scutellatus scutellatus HSP70 mRNA, com...	40	5.2
476	emb|BX324208.5| Zebrafish DNA sequence from clone RP71-38B8 in l...	40	5.2
477	gb|AC069474.4|AC069474 Arabidopsis thaliana chromosome 3 BAC T2E...	40	5.2
478	gb|AF248490.1|AF248490 Mus musculus rabaptin-5gamma mRNA, comple...	40	5.2
479	gb|AF144646.1|AF144646 Crassostrea gigas heat shock protein 70 (...	40	5.2
480	gb|AF291716.1|AF291716 Leishmania braziliensis heat shock protei...	40	5.2
481	gb|AF132213.1|AF132213 Drosophila melanogaster smaug protein mRN...	40	5.2
482	dbj|AP005728.2| Oryza sativa (japonica cultivar-group) genomic D...	40	5.2
483	dbj|AB122064.1| Crassostrea gigas HSC71 mRNA for 71kDa heat shoc...	40	5.2
484	dbj|AP002055.2| Arabidopsis thaliana genomic DNA, chromosome 3, ...	40	5.2
485	dbj|AK110255.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	5.2
486	ref|XM_309751.2| Anopheles gambiae str. PEST ENSANGP00000012762 ...	40	5.2
487	gb|AC148295.3| Mus musculus BAC clone RP24-346N5 from 3, complet...	40	5.2
488	gb|AF159852.1|AF159852 Drosophila melanogaster RNA-binding prote...	40	5.2
489	gb|AE003763.3| Drosophila melanogaster chromosome 3R, section 10...	40	5.2
490	gb|AF104402.1|AF104402 Rattus norvegicus syndapin I mRNA, comple...	40	5.2
491	gb|AE003553.3| Drosophila melanogaster chromosome 3L, section 32...	40	5.2
492	gb|AC124990.16| Mus musculus chromosome 3, clone RP24-283J17, co...	40	5.2
493	ref|NM_017294.1| Rattus norvegicus protein kinase C and casein k...	40	5.2
494	emb|BX001057.4| Zebrafish DNA sequence from clone CH211-89G13 in...	40	5.2
495	gb|BC080274.1| Mus musculus cDNA clone IMAGE:6852593, containing...	40	5.2
496	emb|Z82285.1|CET28F3 Caenorhabditis elegans Cosmid T28F3, comple...	40	5.2
497	gb|U70777.1|RNU70777 Rattus norvegicus rabaptin mRNA, complete cds	40	5.2
498	emb|AL512346.41| Mouse DNA sequence from clone RP23-322E15 on ch...	40	5.2
499	gb|M18540.1|CELHSP70 C.elegans heat shock protein 70A gene, comp...	40	5.2
500	dbj|D85844.1| Rattus norvegicus mRNA for rat rabaptin-5, complet...	40	5.2

---

>gb|BT016462.1| Zea mays clone Contig295 mRNA sequence
          Length = 1014

 Score =  178 bits (90), Expect = 9e-42
 Identities = 200/238 (84%), Gaps = 6/238 (2%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttagtcgacctcctngatcttggggccagggccgccggatgcagcaggggtgtcatcgtn 218
           |||||| ||||||| |||||||||||||||||| |||  | |||| || | ||| |||| 
Sbjct: 848 ttagtccacctcctcgatcttggggccagggccaccgcttccagccggagcgtcctcgtc 789

                                                                       
Query: 219 catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 272
           |||||| ||  |      |||||||||||| || ||||||||||||||||||||||||||
Sbjct: 788 catgccgccggcgccacccatgtcggcacccgcgccctggtacatcttggcgatgatggg 729

                                                                       
Query: 273 gttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctg 332
           |||||| |||  ||||||||||||||||||||| || |||||||||||||| || |||||
Sbjct: 728 gttgcaaaggctctccagctccttcatcttgtcatcgaactcgtccgcctcggcgagctg 669

                                                                     
Query: 333 gttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
           ||| | |||||||||   |||||| |  |||||||| |||||||||||||||||||||
Sbjct: 668 gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcg 611

---

>gb|AY914601.1| Zea mays heat shock protein 70 mRNA, partial cds
          Length = 1284

 Score =  178 bits (90), Expect = 9e-42
 Identities = 200/238 (84%), Gaps = 6/238 (2%)
 Strand = Plus / Minus

                                                                        
Query: 159  ttagtcgacctcctngatcttggggccagggccgccggatgcagcaggggtgtcatcgtn 218
            |||||| ||||||| |||||||||||||||||| |||  | |||| || | ||| |||| 
Sbjct: 1123 ttagtccacctcctcgatcttggggccagggccaccgcttccagccggagcgtcctcgtc 1064

                                                                        
Query: 219  catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 272
            |||||| ||  |      |||||||||||| || ||||||||||||||||||||||||||
Sbjct: 1063 catgccgccggcgccacccatgtcggcacccgcgccctggtacatcttggcgatgatggg 1004

                                                                        
Query: 273  gttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctg 332
            |||||| |||  ||||||||||||||||||||| || |||||||||||||| || |||||
Sbjct: 1003 gttgcaaaggctctccagctccttcatcttgtcatcgaactcgtccgcctcggcgagctg 944

                                                                      
Query: 333  gttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
            ||| | |||||||||   |||||| |  |||||||| |||||||||||||||||||||
Sbjct: 943  gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcg 886

---

>gb|AY109330.1| Zea mays CL45_1 mRNA sequence
          Length = 3772

 Score =  178 bits (90), Expect = 9e-42
 Identities = 200/238 (84%), Gaps = 6/238 (2%)
 Strand = Plus / Minus

                                                                        
Query: 159  ttagtcgacctcctngatcttggggccagggccgccggatgcagcaggggtgtcatcgtn 218
            |||||| ||||||| |||||||||||||||||| |||  | |||| || | ||| |||| 
Sbjct: 3222 ttagtccacctcctcgatcttggggccagggccaccgcttccagccggagcgtcctcgtc 3163

                                                                        
Query: 219  catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 272
            |||||| ||  |      |||||||||||| || ||||||||||||||||||||||||||
Sbjct: 3162 catgccgccggcgccacccatgtcggcacccgcgccctggtacatcttggcgatgatggg 3103

                                                                        
Query: 273  gttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctg 332
            |||||| |||  ||||||||||||||||||||| || |||||||||||||| || |||||
Sbjct: 3102 gttgcaaaggctctccagctccttcatcttgtcatcgaactcgtccgcctcggcgagctg 3043

                                                                      
Query: 333  gttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
            ||| | |||||||||   |||||| |  |||||||| |||||||||||||||||||||
Sbjct: 3042 gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcg 2985

---

>gb|AC134045.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0022E16
              map C481S, complete sequence
          Length = 179668

 Score =  170 bits (86), Expect = 2e-39
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                          
Query: 214    tcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 273
              |||| |||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 135577 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 135518

                                                                          
Query: 274    ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 333
              ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 135517 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 135458

                                                                      
Query: 334    ttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtc 389
              ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||
Sbjct: 135457 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtc 135402



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 159    ttagtcgacctcctngatcttggggccag 187
              |||||||||||||| ||||||||||||||
Sbjct: 135638 ttagtcgacctcctcgatcttggggccag 135610

---

>emb|X67711.2|OSHSC70A O.sativa hsp70 gene for heat shock protein 70
          Length = 4791

 Score =  170 bits (86), Expect = 2e-39
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                        
Query: 214  tcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 273
            |||| |||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 4513 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 4454

                                                                        
Query: 274  ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 333
            ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 4453 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 4394

                                                                    
Query: 334  ttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtc 389
            ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||
Sbjct: 4393 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtc 4338



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 159  ttagtcgacctcctngatcttggggccag 187
            |||||||||||||| ||||||||||||||
Sbjct: 4574 ttagtcgacctcctcgatcttggggccag 4546

---

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  170 bits (86), Expect = 2e-39
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                            
Query: 214      tcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 273
                |||| |||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 28177022 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 28176963

                                                                            
Query: 274      ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 333
                ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 28176962 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 28176903

                                                                        
Query: 334      ttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtc 389
                ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||
Sbjct: 28176902 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtc 28176847



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                             
Query: 159      ttagtcgacctcctngatcttggggccag 187
                |||||||||||||| ||||||||||||||
Sbjct: 28177083 ttagtcgacctcctcgatcttggggccag 28177055

---

>dbj|AK119710.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-E11, full
           insert sequence
          Length = 529

 Score =  170 bits (86), Expect = 2e-39
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                       
Query: 214 tcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 273
           |||| |||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 253 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 194

                                                                       
Query: 274 ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 333
           ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 193 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 134

                                                                   
Query: 334 ttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtc 389
           ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||
Sbjct: 133 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtc 78



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 159 ttagtcgacctcctngatcttggggccag 187
           |||||||||||||| ||||||||||||||
Sbjct: 314 ttagtcgacctcctcgatcttggggccag 286

---

>dbj|AK119255.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-123-H02, full
            insert sequence
          Length = 2311

 Score =  170 bits (86), Expect = 2e-39
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                        
Query: 214  tcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 273
            |||| |||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 2063 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 2004

                                                                        
Query: 274  ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 333
            ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 2003 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 1944

                                                                    
Query: 334  ttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtc 389
            ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||
Sbjct: 1943 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtc 1888



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 159  ttagtcgacctcctngatcttggggccag 187
            |||||||||||||| ||||||||||||||
Sbjct: 2124 ttagtcgacctcctcgatcttggggccag 2096

---

>dbj|AK065431.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013021C17, full
            insert sequence
          Length = 2380

 Score =  170 bits (86), Expect = 2e-39
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                        
Query: 214  tcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 273
            |||| |||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 1961 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 1902

                                                                        
Query: 274  ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 333
            ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 1901 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 1842

                                                                    
Query: 334  ttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtc 389
            ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||
Sbjct: 1841 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtc 1786



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 159  ttagtcgacctcctngatcttggggccag 187
            |||||||||||||| ||||||||||||||
Sbjct: 2022 ttagtcgacctcctcgatcttggggccag 1994

---

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  170 bits (86), Expect = 2e-39
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                            
Query: 214      tcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 273
                |||| |||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 28161900 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 28161841

                                                                            
Query: 274      ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 333
                ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 28161840 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 28161781

                                                                        
Query: 334      ttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtc 389
                ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||
Sbjct: 28161780 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtc 28161725



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                             
Query: 159      ttagtcgacctcctngatcttggggccag 187
                |||||||||||||| ||||||||||||||
Sbjct: 28161961 ttagtcgacctcctcgatcttggggccag 28161933

---

>gb|BT016812.1| Zea mays clone Contig645 mRNA sequence
          Length = 2327

 Score =  168 bits (85), Expect = 8e-39
 Identities = 198/237 (83%), Gaps = 6/237 (2%)
 Strand = Plus / Minus

                                                                        
Query: 159  ttagtcgacctcctngatcttggggccagggccgccggatgcagcaggggtgtcatcgtn 218
            |||||| ||||||| ||||||||||||||||||||||    | ||||||| ||| |||| 
Sbjct: 1834 ttagtccacctcctcgatcttggggccagggccgccgctgccggcaggggcgtcctcgtc 1775

                                                                        
Query: 219  catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 272
            |||||| ||  |      ||||||  |||| || ||||||||||||||||||||||||||
Sbjct: 1774 catgccgccagcgccgcccatgtcttcacccgcgccctggtacatcttggcgatgatggg 1715

                                                                        
Query: 273  gttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctg 332
            |||||| |||  ||||||||||||||||||||| || |||||||||||||| || |||||
Sbjct: 1714 gttgcagaggctctccagctccttcatcttgtcctcgaactcgtccgcctcggcgagctg 1655

                                                                     
Query: 333  gttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtc 389
            ||| | |||||||||   |||||| |  |||||||| ||||||||||||||||||||
Sbjct: 1654 gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtc 1598

---

>ref|XM_470141.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2522

 Score =  167 bits (84), Expect = 3e-38
 Identities = 128/143 (89%)
 Strand = Plus / Minus

                                                                        
Query: 211  tcatcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 270
            ||||||| ||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 1990 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 1931

                                                                        
Query: 271  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 330
            |||||||||||| ||||||||||||||||||||||||| ||||| ||  ||||||| |||
Sbjct: 1930 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 1871

                                   
Query: 331  tggttcgtgtccagccactggat 353
            |||||  ||||||||||||||||
Sbjct: 1870 tggttgttgtccagccactggat 1848

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  167 bits (84), Expect = 3e-38
 Identities = 128/143 (89%)
 Strand = Plus / Minus

                                                                            
Query: 211      tcatcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 270
                ||||||| ||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 34146522 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 34146463

                                                                            
Query: 271      gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 330
                |||||||||||| ||||||||||||||||||||||||| ||||| ||  ||||||| |||
Sbjct: 34146462 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 34146403

                                       
Query: 331      tggttcgtgtccagccactggat 353
                |||||  ||||||||||||||||
Sbjct: 34146402 tggttgttgtccagccactggat 34146380



 Score =  141 bits (71), Expect = 2e-30
 Identities = 150/177 (84%)
 Strand = Plus / Minus

                                                                           
Query: 214     tcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 273
               |||| |||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 9344803 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 9344744

                                                                           
Query: 274     ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 333
               ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 9344743 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 9344684

                                                                        
Query: 334     ttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
               ||  |||| |||||   |||||||   |||||||| |||||||||||||||||||||
Sbjct: 9344683 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcg 9344627



 Score =  113 bits (57), Expect = 4e-22
 Identities = 122/144 (84%)
 Strand = Plus / Plus

                                                                           
Query: 247     ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 306
               |||||||||||||| | |||||| || ||||| |||  ||| ||||||||||||||||| 
Sbjct: 9383971 ccctggtacatctttgagatgatcggattgcagaggctctcgagctccttcatcttgtcc 9384030

                                                                           
Query: 307     tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagnatcgatg 366
               || |||||||| ||||| || ||||||||   ||| ||||||| |||||||   ||||||
Sbjct: 9384031 tcgaactcgtcggcctcggcgagctggttgccgtcgagccacttgatggcatcctcgatg 9384090

                                       
Query: 367     gcctcctcgatcttcttcttgtcg 390
               || |||||||||||||||||||||
Sbjct: 9384091 gcgtcctcgatcttcttcttgtcg 9384114



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 31/35 (88%)
 Strand = Plus / Plus

                                                  
Query: 159     ttagtcgacctcctngatcttggggccagggccgc 193
               |||||| || |||| |||||||||||||| |||||
Sbjct: 9383868 ttagtccacttcctcgatcttggggccagcgccgc 9383902

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  167 bits (84), Expect = 3e-38
 Identities = 128/143 (89%)
 Strand = Plus / Minus

                                                                            
Query: 211      tcatcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 270
                ||||||| ||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 34236994 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 34236935

                                                                            
Query: 271      gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 330
                |||||||||||| ||||||||||||||||||||||||| ||||| ||  ||||||| |||
Sbjct: 34236934 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 34236875

                                       
Query: 331      tggttcgtgtccagccactggat 353
                |||||  ||||||||||||||||
Sbjct: 34236874 tggttgttgtccagccactggat 34236852



 Score =  141 bits (71), Expect = 2e-30
 Identities = 150/177 (84%)
 Strand = Plus / Minus

                                                                           
Query: 214     tcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 273
               |||| |||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 9342924 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 9342865

                                                                           
Query: 274     ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 333
               ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 9342864 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 9342805

                                                                        
Query: 334     ttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
               ||  |||| |||||   |||||||   |||||||| |||||||||||||||||||||
Sbjct: 9342804 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcg 9342748



 Score =  113 bits (57), Expect = 4e-22
 Identities = 122/144 (84%)
 Strand = Plus / Plus

                                                                           
Query: 247     ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 306
               |||||||||||||| | |||||| || ||||| |||  ||| ||||||||||||||||| 
Sbjct: 9382092 ccctggtacatctttgagatgatcggattgcagaggctctcgagctccttcatcttgtcc 9382151

                                                                           
Query: 307     tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagnatcgatg 366
               || |||||||| ||||| || ||||||||   ||| ||||||| |||||||   ||||||
Sbjct: 9382152 tcgaactcgtcggcctcggcgagctggttgccgtcgagccacttgatggcatcctcgatg 9382211

                                       
Query: 367     gcctcctcgatcttcttcttgtcg 390
               || |||||||||||||||||||||
Sbjct: 9382212 gcgtcctcgatcttcttcttgtcg 9382235



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 31/35 (88%)
 Strand = Plus / Plus

                                                  
Query: 159     ttagtcgacctcctngatcttggggccagggccgc 193
               |||||| || |||| |||||||||||||| |||||
Sbjct: 9381989 ttagtccacttcctcgatcttggggccagcgccgc 9382023

---

>gb|AC104433.8| Oryza sativa chromosome 3 BAC OJ1754_E06 genomic sequence, complete
              sequence
          Length = 163828

 Score =  167 bits (84), Expect = 3e-38
 Identities = 128/143 (89%)
 Strand = Plus / Minus

                                                                          
Query: 211    tcatcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 270
              ||||||| ||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 110334 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 110275

                                                                          
Query: 271    gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 330
              |||||||||||| ||||||||||||||||||||||||| ||||| ||  ||||||| |||
Sbjct: 110274 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 110215

                                     
Query: 331    tggttcgtgtccagccactggat 353
              |||||  ||||||||||||||||
Sbjct: 110214 tggttgttgtccagccactggat 110192

---

>dbj|AK102784.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107K19, full
            insert sequence
          Length = 2370

 Score =  167 bits (84), Expect = 3e-38
 Identities = 128/143 (89%)
 Strand = Plus / Minus

                                                                        
Query: 211  tcatcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 270
            ||||||| ||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 2023 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 1964

                                                                        
Query: 271  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 330
            |||||||||||| ||||||||||||||||||||||||| ||||| ||  ||||||| |||
Sbjct: 1963 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 1904

                                   
Query: 331  tggttcgtgtccagccactggat 353
            |||||  ||||||||||||||||
Sbjct: 1903 tggttgttgtccagccactggat 1881

---

>dbj|AK069740.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023030D03, full
            insert sequence
          Length = 2282

 Score =  167 bits (84), Expect = 3e-38
 Identities = 128/143 (89%)
 Strand = Plus / Minus

                                                                        
Query: 211  tcatcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 270
            ||||||| ||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 2025 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 1966

                                                                        
Query: 271  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 330
            |||||||||||| ||||||||||||||||||||||||| ||||| ||  ||||||| |||
Sbjct: 1965 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 1906

                                   
Query: 331  tggttcgtgtccagccactggat 353
            |||||  ||||||||||||||||
Sbjct: 1905 tggttgttgtccagccactggat 1883

---

>emb|X78415.1|ZMHSP705 Z.mays (cv DH5xDH7) hsp70-5 mRNA for heat shock protein 70
          Length = 842

 Score =  163 bits (82), Expect = 5e-37
 Identities = 198/238 (83%), Gaps = 6/238 (2%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttagtcgacctcctngatcttggggccagggccgccggatgcagcaggggtgtcatcgtn 218
           |||||| ||||||| |||||||||||||||| | |||  | |||| || | ||| |||| 
Sbjct: 662 ttagtccacctcctcgatcttggggccaggggcaccgcttccagccggagcgtcctcgtc 603

                                                                       
Query: 219 catgccaccc------tccatgtcggcaccagcaccctggtacatcttggcgatgatggg 272
           |||||| |||       ||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 602 catgccgcccgcgccacccatgtcggcacccgcgccctggtacatcttggcgatgatggg 543

                                                                       
Query: 273 gttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctg 332
           |||  | |||  ||||||||||||||||||||| || |||||||||||||| || |||||
Sbjct: 542 gttcgaaaggctctccagctccttcatcttgtcatcgaactcgtccgcctcggcgagctg 483

                                                                     
Query: 333 gttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
           ||| | |||||||||   |||||| |  |||||||| |||||||||||||||||||||
Sbjct: 482 gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcg 425

---

>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05,
             complete sequence
          Length = 163130

 Score =  153 bits (77), Expect = 5e-34
 Identities = 194/234 (82%)
 Strand = Plus / Plus

                                                                         
Query: 157   gtttagtcgacctcctngatcttggggccagggccgccggatgcagcaggggtgtcatcg 216
             |||||||||||||||| |||||||||||| | ||||| |    | || || | ||| |||
Sbjct: 43944 gtttagtcgacctcctcgatcttggggcctgcgccgctgccgcccgccggcgcgtcctcg 44003

                                                                         
Query: 217   tncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatggggttg 276
             | |||||| ||  |||||||||| || |  ||||||||||||||||||||||| ||||||
Sbjct: 44004 tccatgcctccggccatgtcggcgccggggccctggtacatcttggcgatgatcgggttg 44063

                                                                         
Query: 277   cacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttc 336
             || | | |||||||||||||||||||||| || |||||||| ||||| || |||||||| 
Sbjct: 44064 cagatgccctccagctccttcatcttgtcctcgaactcgtcggcctcggcgagctggttg 44123

                                                                   
Query: 337   gtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
             ||||| |||||   ||||||   ||||||||| ||||||||| |||||||||||
Sbjct: 44124 gtgtcgagccagctgatggcgccatcgatggcgtcctcgatcctcttcttgtcg 44177

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  153 bits (77), Expect = 5e-34
 Identities = 194/234 (82%)
 Strand = Plus / Plus

                                                                            
Query: 157      gtttagtcgacctcctngatcttggggccagggccgccggatgcagcaggggtgtcatcg 216
                |||||||||||||||| |||||||||||| | ||||| |    | || || | ||| |||
Sbjct: 22454537 gtttagtcgacctcctcgatcttggggcctgcgccgctgccgcccgccggcgcgtcctcg 22454596

                                                                            
Query: 217      tncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatggggttg 276
                | |||||| ||  |||||||||| || |  ||||||||||||||||||||||| ||||||
Sbjct: 22454597 tccatgcctccggccatgtcggcgccggggccctggtacatcttggcgatgatcgggttg 22454656

                                                                            
Query: 277      cacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttc 336
                || | | |||||||||||||||||||||| || |||||||| ||||| || |||||||| 
Sbjct: 22454657 cagatgccctccagctccttcatcttgtcctcgaactcgtcggcctcggcgagctggttg 22454716

                                                                      
Query: 337      gtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
                ||||| |||||   ||||||   ||||||||| ||||||||| |||||||||||
Sbjct: 22454717 gtgtcgagccagctgatggcgccatcgatggcgtcctcgatcctcttcttgtcg 22454770

---

>ref|XM_475365.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1941

 Score =  149 bits (75), Expect = 8e-33
 Identities = 192/232 (82%)
 Strand = Plus / Minus

                                                                        
Query: 159  ttagtcgacctcctngatcttggggccagggccgccggatgcagcaggggtgtcatcgtn 218
            |||||||||||||| |||||||||||| | ||||| |    | || || | ||| |||| 
Sbjct: 1941 ttagtcgacctcctcgatcttggggcctgcgccgctgccgcccgccggcgcgtcctcgtc 1882

                                                                        
Query: 219  catgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgca 278
            |||||| ||  |||||||||| || |  ||||||||||||||||||||||| ||||||||
Sbjct: 1881 catgcctccggccatgtcggcgccggggccctggtacatcttggcgatgatcgggttgca 1822

                                                                        
Query: 279  cagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgt 338
             | | |||||||||||||||||||||| || |||||||| ||||| || |||||||| ||
Sbjct: 1821 gatgccctccagctccttcatcttgtcctcgaactcgtcggcctcggcgagctggttggt 1762

                                                                
Query: 339  gtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
            ||| |||||   ||||||   ||||||||| ||||||||| |||||||||||
Sbjct: 1761 gtcgagccagctgatggcgccatcgatggcgtcctcgatcctcttcttgtcg 1710

---

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score =  141 bits (71), Expect = 2e-30
 Identities = 150/177 (84%)
 Strand = Plus / Minus

                                                                         
Query: 214   tcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 273
             |||| |||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 42203 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 42144

                                                                         
Query: 274   ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 333
             ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 42143 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 42084

                                                                      
Query: 334   ttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
             ||  |||| |||||   |||||||   |||||||| |||||||||||||||||||||
Sbjct: 42083 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcg 42027



 Score =  113 bits (57), Expect = 4e-22
 Identities = 122/144 (84%)
 Strand = Plus / Plus

                                                                         
Query: 247   ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 306
             |||||||||||||| | |||||| || ||||| |||  ||| ||||||||||||||||| 
Sbjct: 81371 ccctggtacatctttgagatgatcggattgcagaggctctcgagctccttcatcttgtcc 81430

                                                                         
Query: 307   tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagnatcgatg 366
             || |||||||| ||||| || ||||||||   ||| ||||||| |||||||   ||||||
Sbjct: 81431 tcgaactcgtcggcctcggcgagctggttgccgtcgagccacttgatggcatcctcgatg 81490

                                     
Query: 367   gcctcctcgatcttcttcttgtcg 390
             || |||||||||||||||||||||
Sbjct: 81491 gcgtcctcgatcttcttcttgtcg 81514



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 31/35 (88%)
 Strand = Plus / Plus

                                                
Query: 159   ttagtcgacctcctngatcttggggccagggccgc 193
             |||||| || |||| |||||||||||||| |||||
Sbjct: 81268 ttagtccacttcctcgatcttggggccagcgccgc 81302

---

>gb|AC137698.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0014A21, from chromosome 3, complete sequence
          Length = 134014

 Score =  141 bits (71), Expect = 2e-30
 Identities = 150/177 (84%)
 Strand = Plus / Plus

                                                                         
Query: 214   tcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 273
             |||| |||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 11162 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 11221

                                                                         
Query: 274   ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 333
             ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 11222 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 11281

                                                                      
Query: 334   ttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
             ||  |||| |||||   |||||||   |||||||| |||||||||||||||||||||
Sbjct: 11282 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcg 11338

---

>dbj|AK109474.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-129-B01, full
            insert sequence
          Length = 2253

 Score =  141 bits (71), Expect = 2e-30
 Identities = 150/177 (84%)
 Strand = Plus / Minus

                                                                        
Query: 214  tcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 273
            |||| |||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 1996 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 1937

                                                                        
Query: 274  ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 333
            ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 1936 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 1877

                                                                     
Query: 334  ttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
            ||  |||| |||||   |||||||   |||||||| |||||||||||||||||||||
Sbjct: 1876 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcg 1820

---

>dbj|AK099275.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023078D02, full
            insert sequence
          Length = 2243

 Score =  141 bits (71), Expect = 2e-30
 Identities = 150/177 (84%)
 Strand = Plus / Minus

                                                                        
Query: 214  tcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 273
            |||| |||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 1999 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 1940

                                                                        
Query: 274  ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 333
            ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 1939 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 1880

                                                                     
Query: 334  ttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
            ||  |||| |||||   |||||||   |||||||| |||||||||||||||||||||
Sbjct: 1879 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcg 1823

---

>dbj|AK072830.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023139H01, full
            insert sequence
          Length = 2252

 Score =  141 bits (71), Expect = 2e-30
 Identities = 150/177 (84%)
 Strand = Plus / Minus

                                                                        
Query: 214  tcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 273
            |||| |||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 2003 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 1944

                                                                        
Query: 274  ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 333
            ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 1943 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 1884

                                                                     
Query: 334  ttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
            ||  |||| |||||   |||||||   |||||||| |||||||||||||||||||||
Sbjct: 1883 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcg 1827

---

>ref|NM_190528.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1947

 Score =  139 bits (70), Expect = 8e-30
 Identities = 138/161 (85%)
 Strand = Plus / Minus

                                                                        
Query: 230  ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 289
            ||||||| || || || |||||||||||||| ||||||||||||||||| | |  |||||
Sbjct: 1870 ccatgtccgcgccggcgccctggtacatcttcgcgatgatggggttgcagatgctctcca 1811

                                                                        
Query: 290  gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 349
            |||||||||||||||| || |||||||||||||| || ||||||||  |||| ||||| |
Sbjct: 1810 gctccttcatcttgtcctcgaactcgtccgcctccgcgagctggttgctgtcgagccagt 1751

                                                     
Query: 350  ggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
             ||||||    |||||||| |||||||||||||||||||||
Sbjct: 1750 tgatggcgccgtcgatggcgtcctcgatcttcttcttgtcg 1710



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 163  tcgacctcctngatcttggggcc 185
            |||||||||| ||||||||||||
Sbjct: 1943 tcgacctcctcgatcttggggcc 1921

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  139 bits (70), Expect = 8e-30
 Identities = 138/161 (85%)
 Strand = Plus / Minus

                                                                            
Query: 230      ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 289
                ||||||| || || || |||||||||||||| ||||||||||||||||| | |  |||||
Sbjct: 36036152 ccatgtccgcgccggcgccctggtacatcttcgcgatgatggggttgcagatgctctcca 36036093

                                                                            
Query: 290      gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 349
                |||||||||||||||| || |||||||||||||| || ||||||||  |||| ||||| |
Sbjct: 36036092 gctccttcatcttgtcctcgaactcgtccgcctccgcgagctggttgctgtcgagccagt 36036033

                                                         
Query: 350      ggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
                 ||||||    |||||||| |||||||||||||||||||||
Sbjct: 36036032 tgatggcgccgtcgatggcgtcctcgatcttcttcttgtcg 36035992



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                       
Query: 163      tcgacctcctngatcttggggcc 185
                |||||||||| ||||||||||||
Sbjct: 36036225 tcgacctcctcgatcttggggcc 36036203

---

>dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0408C03
          Length = 141273

 Score =  139 bits (70), Expect = 8e-30
 Identities = 138/161 (85%)
 Strand = Plus / Minus

                                                                         
Query: 230   ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 289
             ||||||| || || || |||||||||||||| ||||||||||||||||| | |  |||||
Sbjct: 48877 ccatgtccgcgccggcgccctggtacatcttcgcgatgatggggttgcagatgctctcca 48818

                                                                         
Query: 290   gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 349
             |||||||||||||||| || |||||||||||||| || ||||||||  |||| ||||| |
Sbjct: 48817 gctccttcatcttgtcctcgaactcgtccgcctccgcgagctggttgctgtcgagccagt 48758

                                                      
Query: 350   ggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
              ||||||    |||||||| |||||||||||||||||||||
Sbjct: 48757 tgatggcgccgtcgatggcgtcctcgatcttcttcttgtcg 48717



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 163   tcgacctcctngatcttggggcc 185
             |||||||||| ||||||||||||
Sbjct: 48950 tcgacctcctcgatcttggggcc 48928

---

>dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0031D11
          Length = 138108

 Score =  139 bits (70), Expect = 8e-30
 Identities = 138/161 (85%)
 Strand = Plus / Minus

                                                                          
Query: 230    ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 289
              ||||||| || || || |||||||||||||| ||||||||||||||||| | |  |||||
Sbjct: 134830 ccatgtccgcgccggcgccctggtacatcttcgcgatgatggggttgcagatgctctcca 134771

                                                                          
Query: 290    gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 349
              |||||||||||||||| || |||||||||||||| || ||||||||  |||| ||||| |
Sbjct: 134770 gctccttcatcttgtcctcgaactcgtccgcctccgcgagctggttgctgtcgagccagt 134711

                                                       
Query: 350    ggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
               ||||||    |||||||| |||||||||||||||||||||
Sbjct: 134710 tgatggcgccgtcgatggcgtcctcgatcttcttcttgtcg 134670



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 163    tcgacctcctngatcttggggcc 185
              |||||||||| ||||||||||||
Sbjct: 134903 tcgacctcctcgatcttggggcc 134881

---

>gb|U41653.1|SBU41653 Sorghum bicolor heat shock protein 70 (hsp70) pseudogene
          Length = 3305

 Score =  139 bits (70), Expect = 8e-30
 Identities = 129/149 (86%)
 Strand = Plus / Minus

                                                                        
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 300
            ||||| |||||||||||||| || |||||||||||||| | | |||||||||||||||||
Sbjct: 3052 ccagctccctggtacatcttcgcaatgatggggttgcagatgccctccagctccttcatc 2993

                                                                        
Query: 301  ttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagna 360
            |||||||| |||||||| |||||||| ||||||||  ||||||||||   ||||||   |
Sbjct: 2992 ttgtcttcgaactcgtcggcctcagcgagctggttgctgtccagccagctgatggctcca 2933

                                         
Query: 361  tcgatggcctcctcgatcttcttcttgtc 389
            ||||  || ||||||||||||||||||||
Sbjct: 2932 tcgacagcgtcctcgatcttcttcttgtc 2904

---

>emb|X78414.1|ZMHSP704 Z.mays (cv DH5xDH7) hsp70-4 mRNA for heat shock protein 70
          Length = 913

 Score =  137 bits (69), Expect = 3e-29
 Identities = 137/160 (85%)
 Strand = Plus / Minus

                                                                       
Query: 230 ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 289
           |||||||  |||| || |||| ||||||||||||||||||||||||||| |||  |||||
Sbjct: 585 ccatgtcttcacccgcgcccttgtacatcttggcgatgatggggttgcagaggctctcca 526

                                                                       
Query: 290 gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 349
           |||||||||||||||  || |||||||||||||| ||| ||||||  | |||||||||  
Sbjct: 525 gctccttcatcttgtactcgaactcgtccgcctcggcaggctggtcggcgtccagccagc 466

                                                   
Query: 350 ggatggcagnatcgatggcctcctcgatcttcttcttgtc 389
            |||||| |  |||||||| ||||||||||||||||||||
Sbjct: 465 tgatggccgcgtcgatggcgtcctcgatcttcttcttgtc 426



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 159 ttagtcgacctcctngatcttggggccagg 188
           |||||| ||||||| |||||||||||||||
Sbjct: 662 ttagtccacctcctcgatcttggggccagg 633

---

>emb|X61491.1|SOSCE70 S.oleracea sce70 mRNA for 70 kDa heat shock protein of the
            chloroplast envelope membrane
          Length = 2535

 Score =  129 bits (65), Expect = 7e-27
 Identities = 136/160 (85%)
 Strand = Plus / Minus

                                                                        
Query: 230  ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 289
            |||||||  |||||||||| |||||||||||||| ||||| |||||||| | |  |||||
Sbjct: 2250 ccatgtcaccaccagcaccttggtacatcttggcaatgattgggttgcagatgctctcca 2191

                                                                        
Query: 290  gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 349
             ||||||||||||||| || ||||| || |||||||||||||||||   ||| ||||| |
Sbjct: 2190 actccttcatcttgtcatcgaactcatcagcctcagcaagctggttaccgtcaagccatt 2131

                                                    
Query: 350  ggatggcagnatcgatggcctcctcgatcttcttcttgtc 389
            | |||| || ||||||||| || |||||||||||||||||
Sbjct: 2130 gaatggaagcatcgatggcttcttcgatcttcttcttgtc 2091

---

>gb|AF479058.1| Sandersonia aurantiaca 70 kDa heat shock protein mRNA, complete cds
          Length = 1241

 Score =  129 bits (65), Expect = 7e-27
 Identities = 130/152 (85%)
 Strand = Plus / Minus

                                                                       
Query: 238 gcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||||||| ||||||||||||||||||||||||||||| | |  |||||| ||||||
Sbjct: 994 gcaccagcaccttggtacatcttggcgatgatggggttgcagatgctctccagttccttc 935

                                                                       
Query: 298 atcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggca 357
           |||||||| |||||||| || || ||||||||||||||  |||| ||||||||||| || 
Sbjct: 934 atcttgtcatcaaactcatcagcttcagcaagctggttgttgtcgagccactggattgcc 875

                                           
Query: 358 gnatcgatggcctcctcgatcttcttcttgtc 389
              || || || ||||| ||||||||||||||
Sbjct: 874 tggtcaattgcatcctcaatcttcttcttgtc 843

---

>gb|AF034618.1|AF034618 Spinacia oleracea cytosolic heat shock 70 protein (HSC70-1) gene,
            complete cds
          Length = 4349

 Score =  129 bits (65), Expect = 7e-27
 Identities = 136/160 (85%)
 Strand = Plus / Minus

                                                                        
Query: 230  ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 289
            |||||||  |||||||||| |||||||||||||| ||||| |||||||| | |  |||||
Sbjct: 4072 ccatgtcaccaccagcaccttggtacatcttggcaatgattgggttgcagatgctctcca 4013

                                                                        
Query: 290  gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 349
             ||||||||||||||| || ||||| || |||||||||||||||||   ||| ||||| |
Sbjct: 4012 actccttcatcttgtcatcgaactcatcagcctcagcaagctggttaccgtcaagccatt 3953

                                                    
Query: 350  ggatggcagnatcgatggcctcctcgatcttcttcttgtc 389
            | |||| || ||||||||| || |||||||||||||||||
Sbjct: 3952 gaatggaagcatcgatggcttcttcgatcttcttcttgtc 3913

---

>gb|L26243.1|SPIC70A Spinacia oleracea heat shock C70 protein mRNA, complete cds
          Length = 2194

 Score =  129 bits (65), Expect = 7e-27
 Identities = 136/160 (85%)
 Strand = Plus / Minus

                                                                        
Query: 230  ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 289
            |||||||  |||||||||| |||||||||||||| ||||| |||||||| | |  |||||
Sbjct: 1917 ccatgtcaccaccagcaccttggtacatcttggcaatgattgggttgcagatgctctcca 1858

                                                                        
Query: 290  gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 349
             ||||||||||||||| || ||||| || |||||||||||||||||   ||| ||||| |
Sbjct: 1857 actccttcatcttgtcatcgaactcatcagcctcagcaagctggttaccgtcaagccatt 1798

                                                    
Query: 350  ggatggcagnatcgatggcctcctcgatcttcttcttgtc 389
            | |||| || ||||||||| || |||||||||||||||||
Sbjct: 1797 gaatggaagcatcgatggcttcttcgatcttcttcttgtc 1758

---

>emb|AJ249331.1|CSA249331 Cucumis sativus mRNA for heat shock protein 70 isoform-2
          Length = 2617

 Score =  127 bits (64), Expect = 3e-26
 Identities = 126/147 (85%)
 Strand = Plus / Minus

                                                                        
Query: 244  gcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttg 303
            ||||| |||||||||||||| ||||| |||||||| | |  ||||| |||||||||||||
Sbjct: 2223 gcaccttggtacatcttggcaatgattgggttgcaaatgctctccaactccttcatcttg 2164

                                                                        
Query: 304  tcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagnatcg 363
            ||||| |||||||| |||||||| |||||||| | ||||||||| |||||||     |||
Sbjct: 2163 tcttcgaactcgtcagcctcagctagctggttggcgtccagccattggatggactgctcg 2104

                                       
Query: 364  atggcctcctcgatcttcttcttgtcg 390
            ||||| || ||||||||||||||||||
Sbjct: 2103 atggcatcgtcgatcttcttcttgtcg 2077

---

>gb|BT018649.1| Zea mays clone EL01N0505F04.d mRNA sequence
          Length = 1788

 Score =  125 bits (63), Expect = 1e-25
 Identities = 96/107 (89%)
 Strand = Plus / Minus

                                                                        
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 300
            ||||| || ||||||||||||||||||||||||||||| | | |||| ||||||||||||
Sbjct: 1539 ccagcgccttggtacatcttggcgatgatggggttgcagatgccctcgagctccttcatc 1480

                                                           
Query: 301  ttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagcca 347
            |||||||| ||||||||| ||||||| ||||||||  ||||||||||
Sbjct: 1479 ttgtcttcgaactcgtccacctcagctagctggttgctgtccagcca 1433

---

>gb|AF005993.1|AF005993 Triticum aestivum 70 kDa heat shock protein (TaHSP70d) mRNA, complete
            cds
          Length = 2311

 Score =  121 bits (61), Expect = 2e-24
 Identities = 91/101 (90%)
 Strand = Plus / Minus

                                                                        
Query: 247  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 306
            |||||||||||||||||||||||||||||||| | | |||||||||||||||||||||| 
Sbjct: 1967 ccctggtacatcttggcgatgatggggttgcagatgccctccagctccttcatcttgtcc 1908

                                                     
Query: 307  tcaaactcgtccgcctcagcaagctggttcgtgtccagcca 347
            || |||||||| ||||| || |||||||| | |||||||||
Sbjct: 1907 tcgaactcgtcggcctcggcgagctggttggcgtccagcca 1867



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 159  ttagtcgacctcctngatcttggggccagggccgccg 195
            |||||| ||||||| |||||||||||||| |||||||
Sbjct: 2061 ttagtccacctcctcgatcttggggccagcgccgccg 2025

---

>gb|AF527796.1| Cucurbita maxima cell-autonomous heat shock cognate protein 70
            (Hsc70-3) mRNA, complete cds
          Length = 1953

 Score =  115 bits (58), Expect = 1e-22
 Identities = 126/149 (84%)
 Strand = Plus / Minus

                                                                        
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 300
            ||||| || |||||||||||||||||||| |||||||| | |  ||||| ||||||||||
Sbjct: 1862 ccagcgccttggtacatcttggcgatgattgggttgcagatgctctccaactccttcatc 1803

                                                                        
Query: 301  ttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagna 360
            |||||||| ||||| || || ||||| |||||||| | ||| |||||||||||||     
Sbjct: 1802 ttgtcttcgaactcatcggcttcagccagctggttggcgtcaagccactggatggactgc 1743

                                         
Query: 361  tcgatggcctcctcgatcttcttcttgtc 389
            |||||||| || |||||||||||||||||
Sbjct: 1742 tcgatggcatcttcgatcttcttcttgtc 1714

---

>gb|AF161180.1|AF161180 Malus domestica high molecular weight heat shock protein (Hsp2) mRNA,
            complete cds
          Length = 2212

 Score =  115 bits (58), Expect = 1e-22
 Identities = 123/145 (84%)
 Strand = Plus / Minus

                                                                        
Query: 245  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 304
            ||||||||||||||||||| ||||| || ||||| | |  ||||||||||||||||||||
Sbjct: 1891 caccctggtacatcttggcaatgatcggattgcagatgctctccagctccttcatcttgt 1832

                                                                        
Query: 305  cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagnatcga 364
            | ||||||||||| |||||||||||||||||   ||| ||||| ||||||||    || |
Sbjct: 1831 cctcaaactcgtcggcctcagcaagctggtttccgtcaagccattggatggcctggtcaa 1772

                                     
Query: 365  tggcctcctcgatcttcttcttgtc 389
            | || ||||| ||||||||||||||
Sbjct: 1771 ttgcatcctcaatcttcttcttgtc 1747

---

>gb|BT016692.1| Zea mays clone Contig525 mRNA sequence
          Length = 1806

 Score =  113 bits (57), Expect = 4e-22
 Identities = 90/101 (89%)
 Strand = Plus / Minus

                                                                        
Query: 247  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 306
            |||||||||||||| ||||||||||||||||| |   |||| ||||||||||||||||||
Sbjct: 1560 ccctggtacatcttcgcgatgatggggttgcagatcccctcaagctccttcatcttgtct 1501

                                                     
Query: 307  tcaaactcgtccgcctcagcaagctggttcgtgtccagcca 347
            |||||||| ||| ||||||| ||||||||  ||||||||||
Sbjct: 1500 tcaaactcctccacctcagccagctggttgctgtccagcca 1460

---

>gb|AF033852.1|AF033852 Spinacia oleracea cytosolic heat shock 70 protein (HSC70) mRNA,
            complete cds
          Length = 2184

 Score =  105 bits (53), Expect = 1e-19
 Identities = 86/97 (88%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
            |||||||||| ||||||||||| || |||||||||||||| |    ||||||||||||||
Sbjct: 1911 caccagcaccttggtacatcttagcaatgatggggttgcaaatactctccagctccttca 1852

                                                 
Query: 299  tcttgtcttcaaactcgtccgcctcagcaagctggtt 335
            |||| ||||||||||| || |||||||||||||||||
Sbjct: 1851 tcttatcttcaaactcatcagcctcagcaagctggtt 1815

---

>gb|AF034617.1|AF034617 Spinacia oleracea cytosolic heat shock 70 protein (HSC70-3alpha)
            gene, complete cds
          Length = 5903

 Score =  105 bits (53), Expect = 1e-19
 Identities = 86/97 (88%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
            |||||||||| ||||||||||| || |||||||||||||| |    ||||||||||||||
Sbjct: 4486 caccagcaccttggtacatcttagcaatgatggggttgcaaatactctccagctccttca 4427

                                                 
Query: 299  tcttgtcttcaaactcgtccgcctcagcaagctggtt 335
            |||| ||||||||||| || |||||||||||||||||
Sbjct: 4426 tcttatcttcaaactcatcagcctcagcaagctggtt 4390

---

>gb|AF034616.1|AF034616 Spinacia oleracea cytosolic heat shock 70 protein (HSC70-3beta) gene,
            complete cds
          Length = 6425

 Score =  105 bits (53), Expect = 1e-19
 Identities = 86/97 (88%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
            |||||||||| ||||||||||| || |||||||||||||| |    ||||||||||||||
Sbjct: 5013 caccagcaccttggtacatcttagcaatgatggggttgcaaatactctccagctccttca 4954

                                                 
Query: 299  tcttgtcttcaaactcgtccgcctcagcaagctggtt 335
            |||| ||||||||||| || |||||||||||||||||
Sbjct: 4953 tcttatcttcaaactcatcagcctcagcaagctggtt 4917

---

>emb|X03697.1|ZMHSP702 Maize gene for heat shock protein 70 exon 2 and 3'-UT (hsp70; clone
            pMON 9502)
          Length = 1934

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 86/98 (87%)
 Strand = Plus / Minus

                                                                        
Query: 250  tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 309
            ||||||||||| ||||||||||||||||| |   |||| |||||||||||||||||||| 
Sbjct: 1772 tggtacatcttcgcgatgatggggttgcagatcccctcaagctccttcatcttgtcttcg 1713

                                                  
Query: 310  aactcgtccgcctcagcaagctggttcgtgtccagcca 347
            ||||| ||| ||||||| ||||||||  ||||||||||
Sbjct: 1712 aactcctccacctcagccagctggttgctgtccagcca 1675

---

>gb|AF527794.1| Cucurbita maxima non-cell-autonomous heat shock cognate protein 70
            (Hsc70-2) mRNA, complete cds
          Length = 1944

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                        
Query: 230  ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 289
            ||||||| || || ||||| |||||||||||||||||||| |||||||| | |  |||||
Sbjct: 1873 ccatgtcagctccggcaccttggtacatcttggcgatgattgggttgcagatgctctcca 1814

                                                                        
Query: 290  gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 349
             ||||||||||||||| || || || || ||||| || |||||||| |  || |||||||
Sbjct: 1813 actccttcatcttgtcctcgaattcatcggcctccgccagctggttggcatcgagccact 1754

                                                     
Query: 350  ggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
            |||||||    |||||||| || || |||||||||||||||
Sbjct: 1753 ggatggcttgctcgatggcgtcttcaatcttcttcttgtcg 1713

---

>dbj|AB112816.1| Nicotiana benthamiana Hsp70 mRNA for heat shock protein 70, partial
           cds, sub_clone:NbHsp70c-C
          Length = 351

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 250 tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 309
           |||||||||||||| |||||||||||||| | |  ||| |||||||||||||| ||||||
Sbjct: 233 tggtacatcttggcaatgatggggttgcagatgctctcgagctccttcatcttatcttca 174

                                     
Query: 310 aactcgtccgcctcagcaagctggtt 335
           |||||||| || ||||||||||||||
Sbjct: 173 aactcgtcagcttcagcaagctggtt 148

---

>dbj|AB012716.1| Salix gilgiana Hsc70 mRNA for heat shock protein 70 cognate, partial
            cds
          Length = 1475

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 147/180 (81%)
 Strand = Plus / Minus

                                                                        
Query: 211  tcatcgtncatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 270
            ||||| | |||||||||  |||| || || |||||||| || |||||||| || ||||||
Sbjct: 1172 tcatcctccatgccaccacccatatcagctccagcaccttgatacatcttagcaatgatg 1113

                                                                        
Query: 271  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 330
            || ||||| | |  ||| ||||||||||||||||| |||||||| || |||||||| |||
Sbjct: 1112 ggattgcagatgctctcaagctccttcatcttgtcctcaaactcatctgcctcagcgagc 1053

                                                                        
Query: 331  tggttcgtgtccagccactggatggcagnatcgatggcctcctcgatcttcttcttgtcg 390
            |||||  |||| ||||||||||| ||    || || || |||||||| ||||||||||||
Sbjct: 1052 tggttgctgtcgagccactggatagcctggtcaatcgcatcctcgattttcttcttgtcg 993

---

>gb|AY257488.1| Lycopersicon esculentum HSC2-like mRNA, partial sequence
          Length = 804

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 120/144 (83%)
 Strand = Plus / Minus

                                                                       
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 300
           |||||||| |||||||||||||| || || |||||||| | |  ||||| ||||||||||
Sbjct: 523 ccagcaccttggtacatcttggcaataattgggttgcaaatgctctccaactccttcatc 464

                                                                       
Query: 301 ttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagna 360
           ||||||||||| || || | ||||||||||||||| |  || ||||||||||||||    
Sbjct: 463 ttgtcttcaaattcatcagactcagcaagctggttggcatcgagccactggatggcctgc 404

                                   
Query: 361 tcgatggcctcctcgatcttcttc 384
           || ||||| ||||| |||||||||
Sbjct: 403 tcaatggcttcctcaatcttcttc 380



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 159 ttagtcgacctcctngatcttggggccag 187
           |||||||||||||| ||||||||| ||||
Sbjct: 611 ttagtcgacctcctcgatcttgggaccag 583

---

>dbj|AB112814.1| Nicotiana benthamiana Hsp70 mRNA for heat shock protein 70, partial
           cds, sub_clone:NbHsp70c-A
          Length = 422

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 85/97 (87%)
 Strand = Plus / Minus

                                                                       
Query: 239 caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
           ||||||||||||||||||||||||| |||||||| || || | | |||| ||||||||||
Sbjct: 328 caccagcaccctggtacatcttggcaatgatgggattacaaatgccctcaagctccttca 269

                                                
Query: 299 tcttgtcttcaaactcgtccgcctcagcaagctggtt 335
           ||||||| |||||||| || || || |||||||||||
Sbjct: 268 tcttgtcctcaaactcatcagcttctgcaagctggtt 232

---

>gb|AY104350.1| Zea mays PCO083553 mRNA sequence
          Length = 1167

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 120/144 (83%)
 Strand = Plus / Minus

                                                                       
Query: 247 ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 306
           ||||| |||||||| ||||||||||||||||| | | |||||||||||||||||||||| 
Sbjct: 844 ccctgatacatcttcgcgatgatggggttgcagatgccctccagctccttcatcttgtcc 785

                                                                       
Query: 307 tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagnatcgatg 366
           |||||||| ||  |||| || ||||||||  |||| ||||| | ||||||    |||| |
Sbjct: 784 tcaaactcatcaacctcggcgagctggttgttgtcgagccaattgatggccccctcgacg 725

                                   
Query: 367 gcctcctcgatcttcttcttgtcg 390
           || || |||||||| |||||||||
Sbjct: 724 gcgtcatcgatctttttcttgtcg 701

---

>gb|AF002667.1|SCAF002667 Solanum commersonii heat shock cognate protein (SCHSP70) mRNA,
           complete cds
          Length = 1149

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 85/97 (87%)
 Strand = Plus / Minus

                                                                       
Query: 239 caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
           |||||||||||||||||||||| || || ||||| ||||| |||  |||||| |||||||
Sbjct: 949 caccagcaccctggtacatcttagcaattatgggattgcataggctctccagttccttca 890

                                                
Query: 299 tcttgtcttcaaactcgtccgcctcagcaagctggtt 335
           |||| ||||||||||| || || ||||||||||||||
Sbjct: 889 tcttatcttcaaactcatcagcttcagcaagctggtt 853

---

>gb|AY694190.1| Camellia sinensis HSP70 (hsp70) mRNA, partial cds
          Length = 491

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 84/96 (87%)
 Strand = Plus / Minus

                                                                       
Query: 240 accagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcat 299
           |||||||||||| |||||||| || || ||||| ||||| | |  |||||||||||||||
Sbjct: 192 accagcaccctgatacatctttgcaattatgggattgcagatgctctccagctccttcat 133

                                               
Query: 300 cttgtcttcaaactcgtccgcctcagcaagctggtt 335
           |||||| |||||||| |||||||| |||||||||||
Sbjct: 132 cttgtcctcaaactcatccgcctcggcaagctggtt 97

---

>gb|AF527795.1| Cucurbita maxima non-cell-autonomous heat shock cognate protein 70
            (Hsc70-1) mRNA, complete cds
          Length = 1959

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 125/151 (82%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
            |||||||||||||||||||||| || |  || |||||||| | |  ||| || |||||||
Sbjct: 1864 caccagcaccctggtacatcttagcaacaattgggttgcaaatgctctcaagttccttca 1805

                                                                        
Query: 299  tcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcag 358
            | ||||||||||||||||| ||||| ||||| |||||  |||||||||||||||  ||  
Sbjct: 1804 ttttgtcttcaaactcgtcggcctctgcaagttggttattgtccagccactggactgctc 1745

                                           
Query: 359  natcgatggcctcctcgatcttcttcttgtc 389
              |||||||| || ||||||||||| |||||
Sbjct: 1744 cctcgatggcatcttcgatcttctttttgtc 1714

---

>gb|AF509339.1| Saussurea medusa heat shock protein 70 (HSP70) mRNA, partial cds
          Length = 1484

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 120/145 (82%)
 Strand = Plus / Minus

                                                                        
Query: 245  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 304
            |||| ||||||||||| || ||||| ||||||||||    ||| ||||||||||||||||
Sbjct: 1198 caccttggtacatcttagcaatgatcgggttgcacacattctcaagctccttcatcttgt 1139

                                                                        
Query: 305  cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagnatcga 364
            | |||||||| || |||||||||||||||||  |||||| ||||   || ||   ||| |
Sbjct: 1138 cctcaaactcatcagcctcagcaagctggttgctgtccaaccacgaaatagcctcatcaa 1079

                                     
Query: 365  tggcctcctcgatcttcttcttgtc 389
            |||| ||||| ||||||||||||||
Sbjct: 1078 tggcatcctcaatcttcttcttgtc 1054

---

>gb|AC150776.2| Medicago truncatula chromosome 7 BAC clone mte1-45n16, complete
             sequence
          Length = 107886

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 120/145 (82%)
 Strand = Plus / Plus

                                                                         
Query: 245   caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 304
             |||| |||||||||||||| ||||| |||||||| |   | || || |||||||||||||
Sbjct: 27323 caccttggtacatcttggcaatgatagggttgcagacaccttcaagttccttcatcttgt 27382

                                                                         
Query: 305   cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagnatcga 364
             | |||||||| || ||||| ||||||||||| |  || ||||||||||| ||||  || |
Sbjct: 27383 cctcaaactcatcagcctctgcaagctggttggcatctagccactggatagcagcctcaa 27442

                                      
Query: 365   tggcctcctcgatcttcttcttgtc 389
             |||  |||||||||||||| |||||
Sbjct: 27443 tggtgtcctcgatcttctttttgtc 27467

---

>gb|AY372071.1| Nicotiana tabacum heat shock protein 70-3 (HSP70-3) gene, complete
            cds
          Length = 3208

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 84/97 (86%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
            |||||||||| ||||||||||| || |||||||| ||||| | |  ||| ||||||||||
Sbjct: 2928 caccagcaccttggtacatcttagcaatgatgggattgcagatgctctcgagctccttca 2869

                                                 
Query: 299  tcttgtcttcaaactcgtccgcctcagcaagctggtt 335
            |||| ||||||||||| || || ||||||||||||||
Sbjct: 2868 tcttatcttcaaactcatcagcttcagcaagctggtt 2832

---

>gb|AY253326.1| Nicotiana tabacum heat shock protein 70 (Hsp70) mRNA, complete cds
          Length = 2259

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 84/97 (86%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
            |||||||||| ||||||||||| || |||||||| ||||| | |  ||| ||||||||||
Sbjct: 1966 caccagcaccttggtacatcttagcaatgatgggattgcagatgctctcgagctccttca 1907

                                                 
Query: 299  tcttgtcttcaaactcgtccgcctcagcaagctggtt 335
            |||| ||||||||||| || || ||||||||||||||
Sbjct: 1906 tcttatcttcaaactcatcagcttcagcaagctggtt 1870

---

>gb|AY836799.1| Saussurea medusa heat shock protein hsp70 gene, complete cds
          Length = 3290

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 89/104 (85%)
 Strand = Plus / Minus

                                                                        
Query: 245  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 304
            |||| ||||||||||| || ||||| ||||||||||    ||| ||||||||||||||||
Sbjct: 3048 caccttggtacatcttagcaatgatcgggttgcacacattctcaagctccttcatcttgt 2989

                                                        
Query: 305  cttcaaactcgtccgcctcagcaagctggttcgtgtccagccac 348
            | |||||||| || |||||||||||||||||  |||||| ||||
Sbjct: 2988 cctcaaactcatcagcctcagcaagctggttgctgtccaaccac 2945

---

>gb|AF509336.1| Saussurea medusa heat shock protein 70 (HSP70) mRNA, complete cds
          Length = 2224

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 89/104 (85%)
 Strand = Plus / Minus

                                                                        
Query: 245  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 304
            |||| ||||||||||| || ||||| ||||||||||    ||| ||||||||||||||||
Sbjct: 1914 caccttggtacatcttagcaatgatcgggttgcacacattctcaagctccttcatcttgt 1855

                                                        
Query: 305  cttcaaactcgtccgcctcagcaagctggttcgtgtccagccac 348
            | |||||||| || |||||||||||||||||  |||||| ||||
Sbjct: 1854 cctcaaactcatcagcctcagcaagctggttgctgtccaaccac 1811

---

>dbj|AB105430.2| Nicotiana benthamiana Hsp70 mRNA for heat shock protein 70, partial
            cds
          Length = 1203

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 118/143 (82%)
 Strand = Plus / Minus

                                                                        
Query: 247  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 306
            ||||||||||| || || |||| ||||||||| ||| |||| || |||||||| ||||||
Sbjct: 1054 ccctggtacatttttgcaatgaaggggttgcagaggccctctagttccttcattttgtct 995

                                                                        
Query: 307  tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagnatcgatg 366
            |||||||| || ||||| |||||||||||    || ||||| ||||||||    || |||
Sbjct: 994  tcaaactcatcagcctcggcaagctggtttccatcaagccattggatggcttcctcaatg 935

                                   
Query: 367  gcctcctcgatcttcttcttgtc 389
            || ||||| ||||||||||||||
Sbjct: 934  gcatcctcaatcttcttcttgtc 912

---

>gb|AY106152.1| Zea mays PCO094428 mRNA sequence
          Length = 1011

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 118/143 (82%)
 Strand = Plus / Minus

                                                                       
Query: 247 ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 306
           |||||||||||||  | ||||||||||||||| | |  ||||||||||||||||||||| 
Sbjct: 678 ccctggtacatctgtgagatgatggggttgcagatgctctccagctccttcatcttgtcc 619

                                                                       
Query: 307 tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagnatcgatg 366
           || ||||| || ||||| || ||||||||   ||| ||||||| ||||||    ||||| 
Sbjct: 618 tcgaactcctcggcctccgcgagctggttgccgtcgagccacttgatggcgtcctcgatc 559

                                  
Query: 367 gcctcctcgatcttcttcttgtc 389
           |  ||||||||||||||||||||
Sbjct: 558 gtgtcctcgatcttcttcttgtc 536

---

>gb|AY485986.1| Vigna radiata 70 kDa heat shock cognate protein 1 mRNA, complete cds
          Length = 2218

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
            |||||||||| ||||||||||| ||||||||||| ||||| | |  ||||| ||||||||
Sbjct: 1948 caccagcaccttggtacatcttagcgatgatgggattgcatatgctctccaactccttca 1889

                                                  
Query: 299  tcttgtcttcaaactcgtccgcctcagcaagctggttc 336
            ||||||| ||||| || || |||||| |||| ||||||
Sbjct: 1888 tcttgtcctcaaattcatcagcctcaccaagttggttc 1851

---

>gb|AY261674.1| Citrus x paradisi HSP70 mRNA, partial cds
          Length = 276

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 89/105 (84%)
 Strand = Plus / Minus

                                                                       
Query: 252 gtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaaa 311
           |||||||||||| || || |||||||| | | |||||||||| |||||||| ||||||||
Sbjct: 276 gtacatcttggcaataattgggttgcagatgccctccagctctttcatcttatcttcaaa 217

                                                        
Query: 312 ctcgtccgcctcagcaagctggttcgtgtccagccactggatggc 356
           ||| || ||||| || |||||||||  ||| ||||| ||||||||
Sbjct: 216 ctcatctgcctctgcgagctggttcccgtcaagccattggatggc 172

---

>gb|BT013586.1| Lycopersicon esculentum clone 132340F, mRNA sequence
          Length = 2190

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
            |||||||||||||||||||||| || |||||||| || || | | |||| ||||||||||
Sbjct: 1959 caccagcaccctggtacatctttgcaatgatgggattacagatgccctcgagctccttca 1900

                                                 
Query: 299  tcttgtcttcaaactcgtccgcctcagcaagctggtt 335
            ||||||| |||||||| ||  | || |||||||||||
Sbjct: 1899 tcttgtcctcaaactcatcaacttctgcaagctggtt 1863

---

>emb|X54029.1|LEHSC170 Lycopersicon esculentum hsc-1 mRNA for heat shock protein 70 kD
          Length = 2120

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
            |||||||||||||||||||||| || |||||||| || || | | |||| ||||||||||
Sbjct: 1907 caccagcaccctggtacatctttgcaatgatgggattacagatgccctcgagctccttca 1848

                                                 
Query: 299  tcttgtcttcaaactcgtccgcctcagcaagctggtt 335
            ||||||| |||||||| ||  | || |||||||||||
Sbjct: 1847 tcttgtcctcaaactcatcaacttctgcaagctggtt 1811

---

>gb|DQ124007.1| Coffea arabica x Coffea canephora clone HT-SSH4-F01 mRNA sequence
          Length = 262

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 89/105 (84%)
 Strand = Plus / Minus

                                                                       
Query: 252 gtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaaa 311
           |||||||||||| |||||||| ||||| |||  ||||||||||||||||||||| || ||
Sbjct: 262 gtacatcttggctatgatgggattgcaaaggctctccagctccttcatcttgtcctcgaa 203

                                                        
Query: 312 ctcgtccgcctcagcaagctggttcgtgtccagccactggatggc 356
            || || |||||||| ||||| ||  |||| ||||||| ||||||
Sbjct: 202 ttcatctgcctcagctagctgattactgtcaagccacttgatggc 158

---

>gb|AY830127.1| Medicago sativa heat shock protein 70 (HSP70-1) mRNA, complete cds
          Length = 2302

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                        
Query: 245  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 304
            |||| ||||||||||| || ||||| |||||||| | ||  || ||||||||||||||||
Sbjct: 1962 caccttggtacatctttgcaatgattgggttgcagatggtttcaagctccttcatcttgt 1903

                                           
Query: 305  cttcaaactcgtccgcctcagcaagctggtt 335
            |||| ||||| || || ||||||||||||||
Sbjct: 1902 cttcgaactcatcggcttcagcaagctggtt 1872

---

>gb|AC146757.19| Medicago truncatula clone mth2-16n21, complete sequence
          Length = 135915

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                          
Query: 245    caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 304
              |||| ||||||||||| || ||||| ||||| || |  | ||| ||||||||||||||||
Sbjct: 118421 caccttggtacatctttgcaatgattgggttacagattgtctcaagctccttcatcttgt 118480

                                             
Query: 305    cttcaaactcgtccgcctcagcaagctggtt 335
              |||||||||| || || ||||||||||||||
Sbjct: 118481 cttcaaactcatcggcttcagcaagctggtt 118511



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                         
Query: 253   tacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaaac 312
             ||||||||||| ||||| |||||||| |||  ||| || ||||||||||| |||||||||
Sbjct: 35431 tacatcttggcaatgattgggttgcaaaggctctcaagttccttcatcttatcttcaaac 35372

                                                   
Query: 313   tcgtccgcctcagcaagctggttcgtgtccagccactg 350
             || || ||||| || | ||||||  |||||| ||||||
Sbjct: 35371 tcatcagcctctgccaactggttactgtccaaccactg 35334

---

>gb|AC147536.12| Medicago truncatula clone mth2-9l3, complete sequence
          Length = 111486

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                         
Query: 245   caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 304
             |||| ||||||||||| || ||||| ||||| || |  | ||| ||||||||||||||||
Sbjct: 93989 caccttggtacatctttgcaatgattgggttacagattgtctcaagctccttcatcttgt 94048

                                            
Query: 305   cttcaaactcgtccgcctcagcaagctggtt 335
             |||||||||| || || ||||||||||||||
Sbjct: 94049 cttcaaactcatcggcttcagcaagctggtt 94079



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                         
Query: 253   tacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaaac 312
             ||||||||||| ||||| |||||||| |||  ||| || ||||||||||| |||||||||
Sbjct: 10998 tacatcttggcaatgattgggttgcaaaggctctcaagttccttcatcttatcttcaaac 10939

                                                   
Query: 313   tcgtccgcctcagcaagctggttcgtgtccagccactg 350
             || || ||||| || | ||||||  |||||| ||||||
Sbjct: 10938 tcatcagcctctgccaactggttactgtccaaccactg 10901

---

>ref|NM_120328.2| Arabidopsis thaliana HSC70-1; ATP binding AT5G02500 (HSC70-1) mRNA,
            complete cds
          Length = 2371

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1969 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1910

                                                 
Query: 299  tcttgtcttcaaactcgtccgcctcagcaagctggtt 335
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 1909 tcttgtcttcgaactcatcagcctcagccaactggtt 1873



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 370  tcctcgatcttcttcttgtc 389
            ||||||||||||||||||||
Sbjct: 1838 tcctcgatcttcttcttgtc 1819

---

>emb|X99197.1|MS70KDHSP M.sativa mRNA for 70 kD heat shock protein
          Length = 830

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                       
Query: 239 caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
           |||||||||| || ||||||||| | ||||| |||||||| | | |||||||||||||||
Sbjct: 560 caccagcaccttgatacatcttgccaatgatagggttgcaaatgccctccagctccttca 501

                        
Query: 299 tcttgtcttcaaa 311
           ||||||| |||||
Sbjct: 500 tcttgtcctcaaa 488

---

>emb|X77199.1|ATHSC701 A.thaliana hsc70-1 gene
          Length = 4297

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 2146 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 2087

                                                 
Query: 299  tcttgtcttcaaactcgtccgcctcagcaagctggtt 335
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 2086 tcttgtcttcgaactcatcagcctcagccaactggtt 2050



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 370  tcctcgatcttcttcttgtc 389
            ||||||||||||||||||||
Sbjct: 2015 tcctcgatcttcttcttgtc 1996

---

>emb|X74604.1|ATHSC70 A.thaliana hsc70 mRNA for heat shock cognate protein
          Length = 2209

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1938 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1879

                                                 
Query: 299  tcttgtcttcaaactcgtccgcctcagcaagctggtt 335
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 1878 tcttgtcttcgaactcatcagcctcagccaactggtt 1842



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 370  tcctcgatcttcttcttgtc 389
            ||||||||||||||||||||
Sbjct: 1807 tcctcgatcttcttcttgtc 1788

---

>gb|AY035123.1| Arabidopsis thaliana putative dnaK-type molecular chaperone hsc70.1
           protein (At5g02500) mRNA, partial cds
          Length = 860

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
           ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 556 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 497

                                                
Query: 299 tcttgtcttcaaactcgtccgcctcagcaagctggtt 335
           |||||||||| ||||| || |||||||| | ||||||
Sbjct: 496 tcttgtcttcgaactcatcagcctcagccaactggtt 460



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 370 tcctcgatcttcttcttgtc 389
           ||||||||||||||||||||
Sbjct: 425 tcctcgatcttcttcttgtc 406

---

>emb|AL162971.1|ATT22P11 Arabidopsis thaliana DNA chromosome 5, BAC clone T22P11 (ESSA project)
          Length = 96424

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Plus

                                                                         
Query: 239   caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
             ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 35077 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 35136

                                                  
Query: 299   tcttgtcttcaaactcgtccgcctcagcaagctggtt 335
             |||||||||| ||||| || |||||||| | ||||||
Sbjct: 35137 tcttgtcttcgaactcatcagcctcagccaactggtt 35173



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                         
Query: 250   tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 309
             ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 31335 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 31394

                     
Query: 310   aactcgtc 317
             ||||||||
Sbjct: 31395 aactcgtc 31402



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   tcctcgatcttcttcttgtc 389
             ||||||||||||||||||||
Sbjct: 35208 tcctcgatcttcttcttgtc 35227

---

>gb|AY120747.1| Arabidopsis thaliana DnaK-type molecular chaperone hsc70.1
            (At5g02500) mRNA, complete cds
          Length = 2254

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1968 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1909

                                                 
Query: 299  tcttgtcttcaaactcgtccgcctcagcaagctggtt 335
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 1908 tcttgtcttcgaactcatcagcctcagccaactggtt 1872



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 370  tcctcgatcttcttcttgtc 389
            ||||||||||||||||||||
Sbjct: 1837 tcctcgatcttcttcttgtc 1818

---

>gb|AY057481.1| Arabidopsis thaliana AT5g02500/T22P11_90 mRNA, complete cds
          Length = 2228

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1968 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1909

                                                 
Query: 299  tcttgtcttcaaactcgtccgcctcagcaagctggtt 335
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 1908 tcttgtcttcgaactcatcagcctcagccaactggtt 1872



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 370  tcctcgatcttcttcttgtc 389
            ||||||||||||||||||||
Sbjct: 1837 tcctcgatcttcttcttgtc 1818

---

>emb|BX832460.1|CNS0A1Q8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH75ZA02 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 2188

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1949 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1890

                                                 
Query: 299  tcttgtcttcaaactcgtccgcctcagcaagctggtt 335
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 1889 tcttgtcttcgaactcatcagcctcagccaactggtt 1853



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 370  tcctcgatcttcttcttgtc 389
            ||||||||||||||||||||
Sbjct: 1818 tcctcgatcttcttcttgtc 1799

---

>gb|BT002754.1| Arabidopsis thaliana clone C104920 putative dnaK-type molecular
            chaperone hsc70.1 protein (At5g02500) mRNA, complete cds
          Length = 1987

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1864 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1805

                                                 
Query: 299  tcttgtcttcaaactcgtccgcctcagcaagctggtt 335
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 1804 tcttgtcttcgaactcatcagcctcagccaactggtt 1768



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 370  tcctcgatcttcttcttgtc 389
            ||||||||||||||||||||
Sbjct: 1733 tcctcgatcttcttcttgtc 1714

---

>gb|AY929184.1| Latimeria chalumnae heat shock protein 70 (Hsp70) gene, partial cds
          Length = 1839

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 85/101 (84%)
 Strand = Plus / Minus

                                                                        
Query: 247  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 306
            |||||||||| ||||||||||||||| |||||||    |||||| |||||| ||||||  
Sbjct: 1757 ccctggtacagcttggcgatgatgggtttgcacacttgctccagttccttcttcttgtgc 1698

                                                     
Query: 307  tcaaactcgtccgcctcagcaagctggttcgtgtccagcca 347
            ||| ||||||||  |||||| ||||||||  ||||||||||
Sbjct: 1697 tcatactcgtccttctcagccagctggttgctgtccagcca 1657

---

>emb|X54030.1|LEHSC270 Lycopersicon esculentum hsc-2 mRNA for heat shock protein cognate 70
          Length = 2117

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                        
Query: 229  tccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcc 288
            ||||||||  |||| || || |||||||| || || ||||| |||||||| ||   ||| 
Sbjct: 1946 tccatgtcaccacctgctccttggtacatttttgcaatgatagggttgcaaagactctct 1887

                                                                        
Query: 289  agctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccac 348
            ||||||||||||||||| |||||||| || |||||||| ||||||||    || ||||||
Sbjct: 1886 agctccttcatcttgtcctcaaactcttcagcctcagcgagctggttaccatcaagccac 1827

                    
Query: 349  tggatggc 356
            ||||||||
Sbjct: 1826 tggatggc 1819

---

>gb|DQ324856.1| Haliotis discus hannai heat shock protein 70 mRNA, complete cds
          Length = 2631

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                        
Query: 248  cctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtctt 307
            ||||||||| ||||| |||||||||||| ||||   ||||||||||||||  ||||| ||
Sbjct: 1924 cctggtacaacttggtgatgatggggttacacactccctccagctccttctgcttgtgtt 1865

                                                    
Query: 308  caaactcgtccgcctcagcaagctggttcgtgtccagcca 347
            | ||||| |||  ||| ||||||||||| | |||||||||
Sbjct: 1864 cgaactcatccttctcggcaagctggttagagtccagcca 1825

---

>gb|AF035414.1|AF035414 Brassica napus heat shock cognate protein (Hsc70) mRNA, complete cds
          Length = 2184

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 122/151 (80%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 298
            ||||||| || |||||||||||||| ||||| |||||||| | |  ||||| ||||||||
Sbjct: 1930 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaactccttca 1871

                                                                        
Query: 299  tcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcag 358
            ||||||| || ||||| || |||||| | | ||| ||  | ||||||||||| || ||  
Sbjct: 1870 tcttgtcctcgaactcatcagcctcacccaactgattgttctccagccactgaatcgcct 1811

                                           
Query: 359  natcgatggcctcctcgatcttcttcttgtc 389
              || || || ||||||||||||||||||||
Sbjct: 1810 gctcaatagcgtcctcgatcttcttcttgtc 1780

---

>gb|S85730.1| hsc71=major heat-shock-protein-like gene [rainbow trout, testes,
            Genomic, 6825 nt]
          Length = 6825

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                      
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcaca 280
            |||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 6055 caccagcaccctggtacagcttggtgatgatggggttgcaca 6014

---

>dbj|AB196460.1| Oncorhynchus mykiss HSC70A mRNA for heat shock 70kDa protein 8
            isoform a, complete cds
          Length = 2359

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                      
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcaca 280
            |||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 1958 caccagcaccctggtacagcttggtgatgatggggttgcaca 1917

---

>emb|X62799.1|GMHSP70 Glycine max hsp 70 gene
          Length = 3272

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                        
Query: 242  cagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatct 301
            ||||||||||||||||||| || |||||||||||||| |   | |||| |||||||  ||
Sbjct: 2628 cagcaccctggtacatcttagcaatgatggggttgcagatcccttccaactccttctgct 2569

                             
Query: 302  tgtcttcaaactcgtcc 318
            |||| ||||||||||||
Sbjct: 2568 tgtcctcaaactcgtcc 2552

---

>gb|L41253.1|TOMHSC70A Lycopersicon esculentum Hsc70 gene, complete cds
          Length = 3573

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                        
Query: 247  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 306
            |||||||||||||| ||||| ||||||||||| | |  ||| ||||||||||||||||| 
Sbjct: 3206 ccctggtacatcttcgcgataatggggttgcatatgctctcaagctccttcatcttgtcc 3147

                 
Query: 307  tcaaa 311
            |||||
Sbjct: 3146 tcaaa 3142

---

>ref|NM_120327.3| Arabidopsis thaliana ATP binding AT5G02490 mRNA, complete cds
          Length = 2303

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                        
Query: 250  tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 309
            ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 1933 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 1874

                    
Query: 310  aactcgtc 317
            ||||||||
Sbjct: 1873 aactcgtc 1866

---

>gb|BC077998.1| Xenopus laevis cDNA clone MGC:82390 IMAGE:4406669, complete cds
          Length = 2723

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                        
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagg 282
            |||||||||||||||| | ||||| |||||||||||||||||||
Sbjct: 1874 caccagcaccctggtatagcttggtgatgatggggttgcacagg 1831

---

>gb|BT008411.1| Arabidopsis thaliana At5g02490 gene, complete cds
          Length = 1962

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                        
Query: 250  tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 309
            ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 1853 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 1794

                    
Query: 310  aactcgtc 317
            ||||||||
Sbjct: 1793 aactcgtc 1786

---

>gb|AY093152.1| Arabidopsis thaliana DnaK-type molecular chaperone hsc70.1-like
            (At5g02490) mRNA, complete cds
          Length = 2124

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                        
Query: 250  tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 309
            ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 1933 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 1874

                    
Query: 310  aactcgtc 317
            ||||||||
Sbjct: 1873 aactcgtc 1866

---

>emb|Y08892.1|ATHSC70G8 A.thaliana mRNA for Hsc70-G8 protein, partial
          Length = 315

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 250 tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 309
           ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 206 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 147

                   
Query: 310 aactcgtc 317
           ||||||||
Sbjct: 146 aactcgtc 139



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 159 ttagtcgacctcctngatcttggggccag 187
           |||||||||||||| ||||||||| ||||
Sbjct: 315 ttagtcgacctcctcgatcttgggaccag 287

---

>ref|NM_104519.1| Arabidopsis thaliana HSP70T-1; ATP binding AT1G56410 (HSP70T-1) mRNA,
            complete cds
          Length = 1854

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                      
Query: 285  ctccagctccttcatcttgtcttcaaactcgtccgcctcagc 326
            ||||| |||||||||||||| |||||||||||| ||||||||
Sbjct: 1812 ctccaactccttcatcttgtgttcaaactcgtcagcctcagc 1771

---

>gb|AY485987.1| Vigna radiata 70 kDa heat shock cognate protein 2 mRNA, complete cds
          Length = 2264

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 115/143 (80%), Gaps = 3/143 (2%)
 Strand = Plus / Minus

                                                                        
Query: 211  tcatcgtncatgccaccctccatgtcggcaccagcacc---ctggtacatcttggcgatg 267
            ||||||| ||| |||||  ||||||| | |||||||||   ||||||||||||||| |||
Sbjct: 1905 tcatcgtccattccacctcccatgtctggaccagcacctccctggtacatcttggcaatg 1846

                                                                        
Query: 268  atggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagca 327
            || || ||||| | |   ||||  |||||||| ||||| |||||||| || |||||  ||
Sbjct: 1845 ataggattgcagatgctttccaattccttcattttgtcctcaaactcatctgcctctcca 1786

                                   
Query: 328  agctggttcgtgtccagccactg 350
            || |||||  |||||||||||||
Sbjct: 1785 agttggttgctgtccagccactg 1763

---

>gb|DQ446367.1| Arabidopsis thaliana clone pENTR221-At1g56410 heat shock cognate 70
            kDa protein/HSC70/HSP70 (At1g56410) mRNA, complete cds
          Length = 1854

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                      
Query: 285  ctccagctccttcatcttgtcttcaaactcgtccgcctcagc 326
            ||||| |||||||||||||| |||||||||||| ||||||||
Sbjct: 1812 ctccaactccttcatcttgtgttcaaactcgtcagcctcagc 1771

---

>emb|Z32537.1|PSHSC71R P.sativum (little marvel) HSC71.0 mRNA
          Length = 2122

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                        
Query: 245  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 304
            ||||||||||||||||||| ||||| |||||||| |     ||||  |||||||| ||||
Sbjct: 1890 caccctggtacatcttggcaatgatagggttgcagacactttccaattccttcattttgt 1831

                                                                        
Query: 305  cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagnatcga 364
            | |||||||| || ||||| ||||| |||||  |||| | ||||||||| ||    || |
Sbjct: 1830 cctcaaactcatctgcctctgcaagttggttgctgtctaaccactggatagcctgctcaa 1771

                                     
Query: 365  tggcctcctcgatcttcttcttgtc 389
            |||  ||||| ||||||||||||||
Sbjct: 1770 tggtgtcctcaatcttcttcttgtc 1746

---

>emb|X51765.1|LPHSP70 L.polyphyllus mRNA for heat schock protein 70
          Length = 1005

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 304
           ||||||||||||||||||| ||||| |||||||| |||   || || |||||||| ||||
Sbjct: 684 caccctggtacatcttggcaatgattgggttgcagaggctttcaagttccttcattttgt 625

                     
Query: 305 cttcaaactc 314
           | ||||||||
Sbjct: 624 cctcaaactc 615

---

>gb|AC058785.8|AC058785 Arabidopsis thaliana chromosome 1 BAC F13N6 genomic sequence, complete
             sequence
          Length = 90698

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                       
Query: 285   ctccagctccttcatcttgtcttcaaactcgtccgcctcagc 326
             ||||| |||||||||||||| |||||||||||| ||||||||
Sbjct: 29212 ctccaactccttcatcttgtgttcaaactcgtcagcctcagc 29171

---

>emb|CR735051.2|CNS0GTY2 Tetraodon nigroviridis full-length cDNA
          Length = 1868

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1577 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1521

---

>emb|CR734665.2|CNS0GTNC Tetraodon nigroviridis full-length cDNA
          Length = 2238

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1940 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1884

---

>emb|CR732389.2|CNS0GS22 Tetraodon nigroviridis full-length cDNA
          Length = 1982

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1687 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1631

---

>emb|CR731254.2|CNS0GR6J Tetraodon nigroviridis full-length cDNA
          Length = 1156

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 854 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 798

---

>emb|CR730967.2|CNS0GQYK Tetraodon nigroviridis full-length cDNA
          Length = 2232

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1933 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1877

---

>emb|CR730283.2|CNS0GQFK Tetraodon nigroviridis full-length cDNA
          Length = 2238

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1942 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1886

---

>emb|CR729311.2|CNS0GPOL Tetraodon nigroviridis full-length cDNA
          Length = 2216

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1927 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1871

---

>emb|CR725754.2|CNS0GMXS Tetraodon nigroviridis full-length cDNA
          Length = 1557

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 801 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 745

---

>emb|CR724374.2|CNS0GLVG Tetraodon nigroviridis full-length cDNA
          Length = 1874

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1575 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1519

---

>emb|CR722706.2|CNS0GKL4 Tetraodon nigroviridis full-length cDNA
          Length = 1374

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1078 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1022

---

>emb|CR719367.2|CNS0GI0D Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 347 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 291

---

>emb|CR716753.2|CNS0GFZU Tetraodon nigroviridis full-length cDNA
          Length = 956

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 657 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 601

---

>emb|CR711358.2|CNS0GBU2 Tetraodon nigroviridis full-length cDNA
          Length = 623

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 324 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 268

---

>emb|CR703631.2|CNS0G5VF Tetraodon nigroviridis full-length cDNA
          Length = 1151

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 870 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 814

---

>emb|CR699773.2|CNS0G2W9 Tetraodon nigroviridis full-length cDNA
          Length = 1414

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1114 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1058

---

>emb|CR700210.2|CNS0G38E Tetraodon nigroviridis full-length cDNA
          Length = 1664

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1377 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1321

---

>emb|CR699628.2|CNS0G2S8 Tetraodon nigroviridis full-length cDNA
          Length = 1096

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 800 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 744

---

>emb|CR699327.2|CNS0G2JV Tetraodon nigroviridis full-length cDNA
          Length = 1645

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1349 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1293

---

>emb|CR698441.2|CNS0G1V9 Tetraodon nigroviridis full-length cDNA
          Length = 433

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 134 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 78

---

>emb|CR696974.2|CNS0G0QI Tetraodon nigroviridis full-length cDNA
          Length = 1832

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1543 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1487

---

>emb|CR696115.2|CNS0G02N Tetraodon nigroviridis full-length cDNA
          Length = 2230

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1931 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1875

---

>emb|CR694651.2|CNS0FYXZ Tetraodon nigroviridis full-length cDNA
          Length = 1683

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1393 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1337

---

>emb|CR693639.2|CNS0FY5V Tetraodon nigroviridis full-length cDNA
          Length = 2235

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1939 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1883

---

>emb|CR691059.2|CNS0FW67 Tetraodon nigroviridis full-length cDNA
          Length = 1779

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1485 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1429

---

>emb|CR688768.2|CNS0FUEK Tetraodon nigroviridis full-length cDNA
          Length = 1419

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1123 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1067

---

>emb|CR688743.2|CNS0FUDV Tetraodon nigroviridis full-length cDNA
          Length = 1013

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 725 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 669

---

>emb|CR688098.2|CNS0FTVY Tetraodon nigroviridis full-length cDNA
          Length = 2216

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1929 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1873

---

>emb|CR685229.2|CNS0FRO9 Tetraodon nigroviridis full-length cDNA
          Length = 2234

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1937 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1881

---

>emb|CR684600.2|CNS0FR6S Tetraodon nigroviridis full-length cDNA
          Length = 2217

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1932 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1876

---

>emb|CR682045.2|CNS0FP7T Tetraodon nigroviridis full-length cDNA
          Length = 1538

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1253 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1197

---

>emb|CR682007.2|CNS0FP6R Tetraodon nigroviridis full-length cDNA
          Length = 978

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 679 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 623

---

>emb|CR681947.2|CNS0FP53 Tetraodon nigroviridis full-length cDNA
          Length = 1673

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1377 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1321

---

>emb|CR681557.2|CNS0FOU9 Tetraodon nigroviridis full-length cDNA
          Length = 1581

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1281 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1225

---

>emb|CR680840.2|CNS0FOAC Tetraodon nigroviridis full-length cDNA
          Length = 1046

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 746 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 690

---

>emb|CR680599.1|CNS0FO3N Tetraodon nigroviridis full-length cDNA
          Length = 1226

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 948 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 892

---

>emb|CR674390.2|CNS0FJBW Tetraodon nigroviridis full-length cDNA
          Length = 1296

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1005 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 949

---

>emb|CR673444.2|CNS0FILM Tetraodon nigroviridis full-length cDNA
          Length = 1467

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1170 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1114

---

>emb|CR668849.2|CNS0FF1Z Tetraodon nigroviridis full-length cDNA
          Length = 1580

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1282 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1226

---

>emb|CR668292.2|CNS0FEMI Tetraodon nigroviridis full-length cDNA
          Length = 1459

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1167 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1111

---

>emb|CR666588.2|CNS0FDB6 Tetraodon nigroviridis full-length cDNA
          Length = 1261

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 963 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 907

---

>emb|CR664947.2|CNS0FC1L Tetraodon nigroviridis full-length cDNA
          Length = 1560

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1262 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1206

---

>emb|CR664739.2|CNS0FBVT Tetraodon nigroviridis full-length cDNA
          Length = 917

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 617 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 561

---

>emb|CR664071.2|CNS0FBD9 Tetraodon nigroviridis full-length cDNA
          Length = 2047

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1762 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1706

---

>emb|CR663097.2|CNS0FAM7 Tetraodon nigroviridis full-length cDNA
          Length = 1285

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1002 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 946

---

>emb|CR662148.2|CNS0F9VU Tetraodon nigroviridis full-length cDNA
          Length = 1562

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1263 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1207

---

>emb|CR657309.2|CNS0F65F Tetraodon nigroviridis full-length cDNA
          Length = 1218

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 930 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 874

---

>emb|CR656869.2|CNS0F5T7 Tetraodon nigroviridis full-length cDNA
          Length = 1801

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1505 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1449

---

>emb|CR655448.1|CNS0F4PQ Tetraodon nigroviridis full-length cDNA
          Length = 1372

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1088 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1032

---

>emb|CR656433.1|CNS0F5H3 Tetraodon nigroviridis full-length cDNA
          Length = 1511

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1212 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1156

---

>emb|CR656379.1|CNS0F5FL Tetraodon nigroviridis full-length cDNA
          Length = 2215

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1930 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1874

---

>emb|CR656173.1|CNS0F59V Tetraodon nigroviridis full-length cDNA
          Length = 1228

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 938 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 882

---

>emb|CR655567.2|CNS0F4T1 Tetraodon nigroviridis full-length cDNA
          Length = 1251

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 954 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 898

---

>emb|CR654938.1|CNS0F4BK Tetraodon nigroviridis full-length cDNA
          Length = 1232

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 939 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 883

---

>emb|CR654405.2|CNS0F3WR Tetraodon nigroviridis full-length cDNA
          Length = 1263

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 968 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 912

---

>emb|CR654109.2|CNS0F3OJ Tetraodon nigroviridis full-length cDNA
          Length = 1642

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1377 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1321

---

>emb|CR654231.1|CNS0F3RX Tetraodon nigroviridis full-length cDNA
          Length = 2038

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1753 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1697

---

>emb|CR651953.2|CNS0F20N Tetraodon nigroviridis full-length cDNA
          Length = 1144

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 847 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 791

---

>emb|CR651660.2|CNS0F1SI Tetraodon nigroviridis full-length cDNA
          Length = 431

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 134 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 78

---

>emb|CR651251.2|CNS0F1H5 Tetraodon nigroviridis full-length cDNA
          Length = 1937

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1640 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1584

---

>emb|CR650378.1|CNS0F0SW Tetraodon nigroviridis full-length cDNA
          Length = 1483

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1199 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1143

---

>emb|CR649698.2|CNS0F0A0 Tetraodon nigroviridis full-length cDNA
          Length = 1245

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 946 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 890

---

>emb|CR648821.2|CNS0EZLN Tetraodon nigroviridis full-length cDNA
          Length = 1887

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1586 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1530

---

>emb|CR643803.1|CNS0EVQ9 Tetraodon nigroviridis full-length cDNA
          Length = 1221

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 942 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 886

---

>emb|CR641941.2|CNS0EUAJ Tetraodon nigroviridis full-length cDNA
          Length = 445

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 146 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 90

---

>emb|CR638956.2|CNS0ERZM Tetraodon nigroviridis full-length cDNA
          Length = 2037

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1756 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1700

---

>emb|CR633864.2|CNS0EO26 Tetraodon nigroviridis full-length cDNA
          Length = 1618

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1323 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1267

---

>ref|XM_686300.1| PREDICTED: Danio rerio similar to heat shock cognate 70 kDa protein
            (LOC562935), mRNA
          Length = 2448

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                        
Query: 247  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 306
            |||||||||| ||||| ||||||||||||||| ||   |||||||||||||  || ||  
Sbjct: 2057 ccctggtacagcttggtgatgatggggttgcagagcttctccagctccttctgctggtgc 1998

                                                     
Query: 307  tcaaactcgtccgcctcagcaagctggttcgtgtccagcca 347
            |||||||| |||  ||| |||  ||||||| ||||||||||
Sbjct: 1997 tcaaactcctccttctctgcagtctggttcttgtccagcca 1957

---

>dbj|AK222068.1| Arabidopsis thaliana mRNA for dnaK-type molecular chaperone hsc70.1 -
            like, partial cds, clone: RAFL22-80-J10
          Length = 1371

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                             
Query: 285  ctccagctccttcatcttgtcttcaaactcgtc 317
            ||||| |||||||||||||||||||||||||||
Sbjct: 1071 ctccaactccttcatcttgtcttcaaactcgtc 1039

---

>dbj|AB112815.1| Nicotiana benthamiana Hsp70 mRNA for heat shock protein 70, partial
           cds, sub_clone:NbHsp70c-B
          Length = 313

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 127/160 (79%)
 Strand = Plus / Minus

                                                                       
Query: 230 ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 289
           |||||||  |||| ||||| |||||||| ||||| ||||| || ||||| | |  |||||
Sbjct: 196 ccatgtcaccacctgcaccttggtacattttggcaatgattggattgcagatgctctcca 137

                                                                       
Query: 290 gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 349
              ||||||| ||||| ||||| || || | ||||||||||||||| |  || |||||||
Sbjct: 136 atcccttcattttgtcctcaaattcatcagactcagcaagctggttggcatcaagccact 77

                                                   
Query: 350 ggatggcagnatcgatggcctcctcgatcttcttcttgtc 389
           | ||||| |  || ||||| || ||||||||||| |||||
Sbjct: 76  gtatggctgactcaatggcatcttcgatcttctttttgtc 37

---

>gb|BC091445.1| Danio rerio cDNA clone IMAGE:7286763, containing frame-shift errors
          Length = 1375

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                       
Query: 247 ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 306
           |||||||||| ||||| ||||||||||||||| ||   |||||||||||||  || ||  
Sbjct: 970 ccctggtacagcttggtgatgatggggttgcagagcttctccagctccttctgctggtgc 911

                                                    
Query: 307 tcaaactcgtccgcctcagcaagctggttcgtgtccagcca 347
           |||||||| |||  ||| |||  ||||||| ||||||||||
Sbjct: 910 tcaaactcctccttctctgcagtctggttcttgtccagcca 870

---

>emb|AJ249330.1|CSA249330 Cucumis sativus mRNA for heat shock protein 70 isoform-1
          Length = 2370

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 91/112 (81%)
 Strand = Plus / Minus

                                                                        
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 300
            |||||||| || |||||||| || | |||||||||||| |    ||| ||||||||||| 
Sbjct: 2055 ccagcaccttgatacatcttagcaacgatggggttgcaaatactctcaagctccttcatt 1996

                                                                
Query: 301  ttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactgga 352
            || ||||| ||||| || || |||||||| |||||  |||| ||||||||||
Sbjct: 1995 ttatcttcgaactcatcagcttcagcaagttggttgttgtcaagccactgga 1944

---

>emb|CR734111.2|CNS0GT7Y Tetraodon nigroviridis full-length cDNA
          Length = 1839

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 242  cagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            |||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1541 cagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1486

---

>emb|CR728102.2|CNS0GOR0 Tetraodon nigroviridis full-length cDNA
          Length = 2238

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcaca 280
            ||||||| |||||||||||| | |||||||||||||||||
Sbjct: 1940 ccagcactctggtacatctttgtgatgatggggttgcaca 1901

---

>emb|CR703946.1|CNS0G646 Tetraodon nigroviridis full-length cDNA
          Length = 2204

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcaca 280
            ||||||| |||||||||||| | |||||||||||||||||
Sbjct: 1922 ccagcactctggtacatctttgtgatgatggggttgcaca 1883

---

>emb|CR683400.2|CNS0FQ9G Tetraodon nigroviridis full-length cDNA
          Length = 1560

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcaca 280
            ||||||| |||||||||||| | |||||||||||||||||
Sbjct: 1274 ccagcactctggtacatctttgtgatgatggggttgcaca 1235

---

>emb|CR656537.1|CNS0F5JZ Tetraodon nigroviridis full-length cDNA
          Length = 1198

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 241 ccagcaccctggtacatcttggcgatgatggggttgcaca 280
           ||||||| |||||||||||| | |||||||||||||||||
Sbjct: 902 ccagcactctggtacatctttgtgatgatggggttgcaca 863

---

>gb|DQ059998.1| Volvox carteri f. nagariensis heat-shock inducible Hsp70 (hsp70A)
            gene, complete cds
          Length = 6449

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 159  ttagtcgacctcctngatcttggggccagggccgc 193
            |||||||||||||| |||||||||||||| |||||
Sbjct: 5694 ttagtcgacctcctcgatcttggggccagcgccgc 5660

---

>gb|DQ059999.1| Volvox carteri f. nagariensis heat-shock inducible Hsp70 (hsp70A)
            mRNA, complete cds
          Length = 1950

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 159  ttagtcgacctcctngatcttggggccagggccgc 193
            |||||||||||||| |||||||||||||| |||||
Sbjct: 1950 ttagtcgacctcctcgatcttggggccagcgccgc 1916

---

>emb|X13301.1|PHHSP70R Petunia mRNA for heat shock protein hsp70
          Length = 2079

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                        
Query: 286  tccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagc 345
            |||| ||||||||||||||||||||| || || ||||| ||||| |||||  |||| |||
Sbjct: 1802 tccaactccttcatcttgtcttcaaattcatcagcctctgcaagttggttattgtctagc 1743

                
Query: 346  cact 349
            ||||
Sbjct: 1742 cact 1739

---

>emb|X06932.1|PHHSP70G Petunia hsp70 gene
          Length = 2958

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                        
Query: 286  tccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagc 345
            |||| ||||||||||||||||||||| || || ||||| ||||| |||||  |||| |||
Sbjct: 2678 tccaactccttcatcttgtcttcaaattcatcagcctctgcaagttggttattgtctagc 2619

                
Query: 346  cact 349
            ||||
Sbjct: 2618 cact 2615

---

>gb|U23504.1|TNU23504 Trichoplusia ni HSC70 mRNA, complete cds
          Length = 2161

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 247  ccctggtacatcttggcgatgatggggttgca 278
            |||||||||||||||| |||||||||||||||
Sbjct: 1953 ccctggtacatcttggtgatgatggggttgca 1922

---

>emb|CR626889.13| Zebrafish DNA sequence from clone DKEY-4P15 in linkage group 15, complete
              sequence
          Length = 205513

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                                 
Query: 247    ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
              |||||||||| ||||| ||||||||||||||| ||   |||||||||||||
Sbjct: 138774 ccctggtacagcttggtgatgatggggttgcagagcttctccagctccttc 138824

---

>gb|AY762969.1| Acanthopagrus schlegelii HSC70 (HSC70) mRNA, complete cds
          Length = 1953

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            |||| |||| |||||||| ||||| |||||||||||||||||    |||||||||||||
Sbjct: 1846 caccggcactctggtacaacttggtgatgatggggttgcacaccttctccagctccttc 1788

---

>gb|AY029210.1| Ambystoma mexicanum heat shock protein 70 (HSP70) mRNA, complete cds
          Length = 2250

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            |||||||||||||||||| |||||  ||||| ||||||||||    |||||||||||||
Sbjct: 1901 caccagcaccctggtacagcttggtaatgatcgggttgcacactttctccagctccttc 1843

---

>gb|AY436786.1| Rhabdosargus sarba heat shock cognate 70 (hsc70) mRNA, complete cds
          Length = 1950

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||||| |||||| | ||||| |||||||||||||||||    |||||||||||||
Sbjct: 1846 caccagcactctggtatagcttggtgatgatggggttgcacactttctccagctccttc 1788

---

>gb|AY219845.1| Cyprinus carpio constitutive heat shock protein HSC70-2 (hsc70-2)
            mRNA, partial cds
          Length = 1935

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgca 278
            ||||||| |||||||| ||||| |||||||||||||||
Sbjct: 1829 ccagcactctggtacagcttggtgatgatggggttgca 1792

---

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                             
Query: 361     tcgatggcctcctcgatcttcttcttgtcg 390
               ||||||||| ||||||||||||||||||||
Sbjct: 1338539 tcgatggccgcctcgatcttcttcttgtcg 1338510

---

>dbj|AB196461.1| Oncorhynchus mykiss HSC70B mRNA for heat shock 70kDa protein 8
            isoform b, partial cds
          Length = 1864

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcaca 280
            |||| |||| |||||||| ||||| |||||||||||||||||
Sbjct: 1507 caccggcactctggtacagcttggtgatgatggggttgcaca 1466

---

>gb|AF194819.1|AF194819 Manduca sexta heat shock cognate 70 protein mRNA, complete cds
          Length = 2116

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                        
Query: 244  gcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttg 303
            ||||||||||||| ||||| |||||| |||||||| | | | || |||||||||  ||||
Sbjct: 1926 gcaccctggtacagcttggtgatgatcgggttgcagatgccttcgagctccttctgcttg 1867

                                                          
Query: 304  tcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 349
            | |||| |||| |||   || || |||||||||| ||| |||||||
Sbjct: 1866 tgttcatactcctccttgtcggcgagctggttcgagtctagccact 1821

---

>dbj|AB092840.1| Carassius auratus HSC70 mRNA for heat shock cognate 70 kDa, partial
            cds
          Length = 2208

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgca 278
            ||||||| |||||||| ||||| |||||||||||||||
Sbjct: 1792 ccagcactctggtacagcttggtgatgatggggttgca 1755

---

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                             
Query: 361     tcgatggcctcctcgatcttcttcttgtcg 390
               ||||||||| ||||||||||||||||||||
Sbjct: 1362119 tcgatggccgcctcgatcttcttcttgtcg 1362090

---

>gb|AY485988.1| Vigna radiata 70 kDa heat shock cognate protein 3 mRNA, complete cds
          Length = 2314

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 88/109 (80%)
 Strand = Plus / Minus

                                                                        
Query: 245  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 304
            ||||||||||||| ||||| ||||| || ||||| | |   ||||  |||||||| || |
Sbjct: 1935 caccctggtacattttggcaatgataggattgcagacgctttccaattccttcattttat 1876

                                                             
Query: 305  cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggat 353
            | |||||||| || ||||| |||||||||||  |||||| ||| |||||
Sbjct: 1875 cctcaaactcatctgcctctgcaagctggttgctgtccaaccattggat 1827

---

>gb|AY423868.1| Leishmania tarentolae 70 kDa heat shock protein (hsp70) gene,
            complete cds
          Length = 1974

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 249  ctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            ||||||||||||||  ||||| |||||||| | | ||||||||||||||
Sbjct: 1845 ctggtacatcttggtcatgatcgggttgcatatgtcctccagctccttc 1797

---

>gb|M76725.2| Chlamydomonas reinhardtii 70 kDa heat shock protein (hsp70) gene,
            complete cds
          Length = 4808

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 264  gatgatggggttgcacagggcctccagctcctt 296
            ||||||||||||||||||  |||||||||||||
Sbjct: 3682 gatgatggggttgcacagcccctccagctcctt 3650



 Score = 48.1 bits (24), Expect = 0.021
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 159  ttagtcgacctcctngatcttggggcc 185
            |||||||||||||| ||||||||||||
Sbjct: 3799 ttagtcgacctcctcgatcttggggcc 3773

---

>emb|BX833094.1|CNS0A0GB Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL33ZH03 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 767

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 285 ctccagctccttcatcttgtcttcaaactcgtc 317
           ||||| ||||||||||||||||| |||||||||
Sbjct: 543 ctccaactccttcatcttgtctttaaactcgtc 511

---

>gb|U26448.1|EGU26448 Echinococcus granulosus heat shock 70 kDa protein mRNA, complete cds
          Length = 2136

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 248  cctggtacatcttggcgatgatggggttgcaca 280
            ||||||||||||| ||||| |||||||||||||
Sbjct: 1843 cctggtacatcttcgcgattatggggttgcaca 1811

---

>ref|XM_882866.1| PREDICTED: Bos taurus similar to Rab GTPase binding effector
           protein 1 (Rabaptin-5) (Rabaptin-5alpha), transcript
           variant 6 (LOC504785), mRNA
          Length = 3746

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 282 ggcctccagctccttcatcttgtcttca 309
           ||||||||||||||| ||||||||||||
Sbjct: 858 ggcctccagctccttaatcttgtcttca 831

---

>ref|XM_882853.1| PREDICTED: Bos taurus similar to Rab GTPase binding effector
           protein 1 (Rabaptin-5) (Rabaptin-5alpha), transcript
           variant 5 (LOC504785), mRNA
          Length = 3824

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 282 ggcctccagctccttcatcttgtcttca 309
           ||||||||||||||| ||||||||||||
Sbjct: 858 ggcctccagctccttaatcttgtcttca 831

---

>ref|XM_882846.1| PREDICTED: Bos taurus similar to Rab GTPase binding effector
           protein 1 (Rabaptin-5) (Rabaptin-5alpha), transcript
           variant 4 (LOC504785), mRNA
          Length = 1229

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 282 ggcctccagctccttcatcttgtcttca 309
           ||||||||||||||| ||||||||||||
Sbjct: 858 ggcctccagctccttaatcttgtcttca 831

---

>ref|XM_869715.1| PREDICTED: Bos taurus similar to Rab GTPase binding effector
           protein 1 (Rabaptin-5) (Rabaptin-5alpha), transcript
           variant 2 (LOC504785), mRNA
          Length = 3845

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 282 ggcctccagctccttcatcttgtcttca 309
           ||||||||||||||| ||||||||||||
Sbjct: 858 ggcctccagctccttaatcttgtcttca 831

---

>gb|AY524794.1| Thellungiella halophila heat shock cognate protein 70 (hsc70) mRNA,
            complete cds
          Length = 2208

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                        
Query: 256  atcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcg 315
            |||||||| ||||| |||||||| | |  |||||  |||||||||||| |||| ||||| 
Sbjct: 1886 atcttggcaatgattgggttgcaaatgctctccaattccttcatcttggcttcgaactca 1827

                                
Query: 316  tccgcctcagcaagctggtt 335
            || |||||||| | ||||||
Sbjct: 1826 tcagcctcagccaactggtt 1807

---

>emb|CR723474.2|CNS0GL6G Tetraodon nigroviridis full-length cDNA
          Length = 1722

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 241  ccagcaccctggtacatcttggcgatgatggggttgcaca 280
            ||||||| |||||||||||| |  ||||||||||||||||
Sbjct: 1415 ccagcactctggtacatctttgtcatgatggggttgcaca 1376

---

>ref|XM_797036.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 7 (LOC576276), mRNA
          Length = 2475

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgca 278
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1977 caccagcagcttggtacatcttggtgatgatgggggtgca 1938

---

>ref|XM_797035.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 6 (LOC576276), mRNA
          Length = 2069

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgca 278
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1977 caccagcagcttggtacatcttggtgatgatgggggtgca 1938

---

>ref|XM_797034.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 5 (LOC576276), mRNA
          Length = 2045

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgca 278
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1977 caccagcagcttggtacatcttggtgatgatgggggtgca 1938

---

>ref|XM_776060.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 1 (LOC576276), mRNA
          Length = 2075

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgca 278
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1977 caccagcagcttggtacatcttggtgatgatgggggtgca 1938

---

>ref|XM_797027.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 4 (LOC576276), mRNA
          Length = 1449

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgca 278
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1357 caccagcagcttggtacatcttggtgatgatgggggtgca 1318

---

>ref|XM_797023.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 3 (LOC576276), mRNA
          Length = 1976

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgca 278
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1887 caccagcagcttggtacatcttggtgatgatgggggtgca 1848

---

>emb|AJ004940.1|GGAJ4940 Gallus gallus mRNA for heat shock cognate 70
          Length = 2120

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 249  ctggtacatcttggcgatgatggggttgcaca 280
            |||||||| ||||| |||||||||||||||||
Sbjct: 1882 ctggtacagcttggtgatgatggggttgcaca 1851

---

>dbj|AB167744.1| Numida meleagris hspa8 mRNA for heat shock protein, complete cds
          Length = 2269

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 249  ctggtacatcttggcgatgatggggttgcaca 280
            |||||||| ||||| |||||||||||||||||
Sbjct: 1962 ctggtacagcttggtgatgatggggttgcaca 1931

---

>gb|L19533.1|CRUU14HS Cricetulus griseus heat resistant protein gene
          Length = 4730

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgca 278
            ||||||||| |||||||| |||||  ||||||||||||||
Sbjct: 4195 caccagcactctggtacagcttggtaatgatggggttgca 4156

---

>emb|CR386963.1| Gallus gallus finished cDNA, clone ChEST104m7
          Length = 747

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 249 ctggtacatcttggcgatgatggggttgcaca 280
           |||||||| ||||| |||||||||||||||||
Sbjct: 351 ctggtacagcttggtgatgatggggttgcaca 320

---

>ref|NM_205003.1| Gallus gallus heat shock cognate 70 (HSC70), mRNA
          Length = 2120

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 249  ctggtacatcttggcgatgatggggttgcaca 280
            |||||||| ||||| |||||||||||||||||
Sbjct: 1882 ctggtacagcttggtgatgatggggttgcaca 1851

---

>gb|M34561.1|CRUHSP70A Chinese hamster heat shock protein (cognate form of hsp70) mRNA,
            complete cds
          Length = 2243

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgca 278
            ||||||||| |||||||| |||||  ||||||||||||||
Sbjct: 1895 caccagcactctggtacagcttggtaatgatggggttgca 1856

---

>gb|AY651253.1| Rhynchobodo ATCC50359 heat shock protein 70 cytosolic isoform gene,
            partial cds
          Length = 1828

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 244  gcaccctggtacatcttggcgat 266
            |||||||||||||||||||||||
Sbjct: 1791 gcaccctggtacatcttggcgat 1769

---

>gb|DQ025691.1| Oncorhynchus nerka clone One.hsc71.19.34 genomic sequence
          Length = 340

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 239 caccagcaccctggtacatcttggcgatgatgggg 273
           |||||||||||||||| | ||||| ||||||||||
Sbjct: 35  caccagcaccctggtatagcttggtgatgatgggg 1

---

>gb|DQ025620.1| Oncorhynchus keta clone Oke.hsc71.19.23 genomic sequence
          Length = 343

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 239 caccagcaccctggtacatcttggcgatgatgggg 273
           |||||||||||||||| | ||||| ||||||||||
Sbjct: 35  caccagcaccctggtatagcttggtgatgatgggg 1

---

>gb|DQ025546.1| Oncorhynchus tshawytscha clone Ots.hsc71.19.32 genomic sequence
          Length = 360

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 239 caccagcaccctggtacatcttggcgatgatgggg 273
           |||||||||||||||| | ||||| ||||||||||
Sbjct: 326 caccagcaccctggtatagcttggtgatgatgggg 360

---

>ref|XM_508938.1| PREDICTED: Pan troglodytes similar to heat shock protein 8; heat
           shock protein cognate 70; heat shock 70kD protein 8
           (LOC451761), mRNA
          Length = 816

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 244 gcaccctggtacatcttggcgatgatggggttgca 278
           |||| |||||||| ||||| |||||||||||||||
Sbjct: 716 gcactctggtacagcttggtgatgatggggttgca 682

---

>ref|XM_508830.1| PREDICTED: Pan troglodytes heat shock 70kDa protein 8 (LOC451629),
            mRNA
          Length = 3500

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 244  gcaccctggtacatcttggcgatgatggggttgca 278
            |||| |||||||| ||||| |||||||||||||||
Sbjct: 3146 gcactctggtacagcttggtgatgatggggttgca 3112

---

>ref|XM_518899.1| PREDICTED: Pan troglodytes similar to Heat shock 70 kDa protein 1
            (HSP70.1) (HSP70-1/HSP70-2) (LOC463182), mRNA
          Length = 1368

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 264  gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
            |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 1221 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 1167

---

>ref|NM_001003067.1| Canis familiaris heat shock protein 70 (HSP70), mRNA
          Length = 2322

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 264  gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
            |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 1915 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 1861

---

>ref|NM_174550.1| Bos taurus heat shock 70 kD protein 1 (HSPA1A), mRNA
          Length = 2369

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 264  gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
            |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 1977 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 1923

---

>gb|AY662497.1| Bos taurus heat shock protein 70 kDa mRNA, complete cds
          Length = 1926

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 264  gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
            |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 1821 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 1767

---

>gb|AF134726.1| Homo sapiens BAC clone 215O12 NG35, NG36, G9A, NG22, G9, HSP70-2,
              HSP70-1, HSP70-HOM, snRNP, G7A, NG37, NG23, and MutSH5
              genes, complete cds
          Length = 180283

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                     
Query: 264    gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
              |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 100591 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 100645



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                    
Query: 264   gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
             |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 88392 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 88446

---

>gb|BC063507.1| Homo sapiens heat shock 70kDa protein 1B, mRNA (cDNA clone MGC:74463
            IMAGE:4153196), complete cds
          Length = 2537

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 264  gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
            |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 2019 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 1965

---

>gb|BC016660.1| Homo sapiens heat shock 70kDa protein 8, transcript variant 1, mRNA
            (cDNA clone MGC:9495 IMAGE:3923981), complete cds
          Length = 2259

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 244  gcaccctggtacatcttggcgatgatggggttgca 278
            |||| |||||||| ||||| |||||||||||||||
Sbjct: 1899 gcactctggtacagcttggtgatgatggggttgca 1865

---

>gb|BC016179.1| Homo sapiens heat shock 70kDa protein 8, transcript variant 1, mRNA
            (cDNA clone MGC:17984 IMAGE:3920744), complete cds
          Length = 2276

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 244  gcaccctggtacatcttggcgatgatggggttgca 278
            |||| |||||||| ||||| |||||||||||||||
Sbjct: 1899 gcactctggtacagcttggtgatgatggggttgca 1865

---

>gb|BC019816.2| Homo sapiens heat shock 70kDa protein 8, transcript variant 1, mRNA
            (cDNA clone MGC:29929 IMAGE:2899894), complete cds
          Length = 2250

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 244  gcaccctggtacatcttggcgatgatggggttgca 278
            |||| |||||||| ||||| |||||||||||||||
Sbjct: 1899 gcactctggtacagcttggtgatgatggggttgca 1865

---

>gb|BC007276.1| Homo sapiens heat shock 70kDa protein 8, mRNA (cDNA clone
            IMAGE:3162067), partial cds
          Length = 2031

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 244  gcaccctggtacatcttggcgatgatggggttgca 278
            |||| |||||||| ||||| |||||||||||||||
Sbjct: 1666 gcactctggtacagcttggtgatgatggggttgca 1632

---

>ref|NM_006597.3| Homo sapiens heat shock 70kDa protein 8 (HSPA8), transcript variant
            1, mRNA
          Length = 2276

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 244  gcaccctggtacatcttggcgatgatggggttgca 278
            |||| |||||||| ||||| |||||||||||||||
Sbjct: 1919 gcactctggtacagcttggtgatgatggggttgca 1885

---

>gb|DQ440299.1| Aedes aegypti clone AET-381 heat shock cognate 70 mRNA, complete cds
          Length = 1956

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            |||| |||| |||||||| ||||| ||||||||| ||||| | ||  ||||||||||||
Sbjct: 1846 caccggcactctggtacagcttggtgatgatgggattgcagacggattccagctccttc 1788

---

>gb|AY559741.1| Homo sapiens sequence in region of NEU1 and HSPA1B genes
          Length = 1173

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 264 gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
           |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 483 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 537

---

>gb|AY456093.1| Phytophthora nicotianae heat shock protein 70 (Hsp70a) gene,
           complete cds
          Length = 4220

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 152 cgactgtttagtcgacctcctngatcttggggcc 185
           |||||| ||||||||||||||  |||||||||||
Sbjct: 407 cgactgcttagtcgacctcctcaatcttggggcc 440

---

>gb|AY466608.1| Sus scrofa heat shock protein 70.2 (hsp70.2) mRNA, complete cds
          Length = 1926

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 264  gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
            |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 1821 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 1767

---

>gb|BC008907.2| Homo sapiens heat shock 70kDa protein 8, mRNA (cDNA clone
           IMAGE:3836086), partial cds
          Length = 919

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 244 gcaccctggtacatcttggcgatgatggggttgca 278
           |||| |||||||| ||||| |||||||||||||||
Sbjct: 561 gcactctggtacagcttggtgatgatggggttgca 527

---

>gb|BC009322.2| Homo sapiens heat shock 70kDa protein 1A, mRNA (cDNA clone MGC:15236
            IMAGE:4123837), complete cds
          Length = 2380

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 264  gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
            |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 1861 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 1807

---

>gb|BC002423.1| Homo sapiens ribosomal protein L8, mRNA (cDNA clone IMAGE:3163368),
           **** WARNING: chimeric clone ****
          Length = 1912

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 244 gcaccctggtacatcttggcgatgatggggttgca 278
           |||| |||||||| ||||| |||||||||||||||
Sbjct: 661 gcactctggtacagcttggtgatgatggggttgca 627

---

>ref|XM_812644.1| Trypanosoma cruzi strain CL Brener heat shock protein 70 (HSP70)
            (Tc00.1047053511211.160) partial mRNA
          Length = 1965

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 247  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            |||||||||||||| |  ||||||||  ||||||||  |||||||||||||
Sbjct: 1850 ccctggtacatcttcgtcatgatgggcgtgcacaggttctccagctccttc 1800

---

>ref|XM_812645.1| Trypanosoma cruzi strain CL Brener heat shock protein 70 (HSP70)
            (Tc00.1047053511211.170) partial mRNA
          Length = 2034

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 247  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            |||||||||||||| |  ||||||||  ||||||||  |||||||||||||
Sbjct: 1847 ccctggtacatcttcgtcatgatgggcgtgcacaggttctccagctccttc 1797

---

>gb|BC018740.1| Homo sapiens heat shock 70kDa protein 1A, mRNA (cDNA clone MGC:31885
            IMAGE:4906865), complete cds
          Length = 2445

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 264  gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
            |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 1928 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 1874

---

>gb|BC112920.1| Homo sapiens cDNA clone IMAGE:7484542, **** WARNING: chimeric clone
           ****
          Length = 1273

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 244 gcaccctggtacatcttggcgatgatggggttgca 278
           |||| |||||||| ||||| |||||||||||||||
Sbjct: 912 gcactctggtacagcttggtgatgatggggttgca 878

---

>emb|AL929592.8| Human DNA sequence from clone DAQB-147D11 on chromosome 6 Contains the
             5' end of the VARS2 gene for valyl-tRNA synthetase 2, the
             LSM2 gene for the LSM2 homolog, U6 small nuclear RNA
             associated (S. cerevisiae) factor, the HSPA1L gene for the
             heat shock 10kDa protein 1-like factor, the HSPA1A gene
             for the heat shock 70kDa protein 1A, the HSPA1B gene for
             the heat shock 70kDa protein 1B, the C6orf48 gene for
             chromosome 6 open reading frame 48, and 4 CpG islands,
             complete sequence
          Length = 59836

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                    
Query: 264   gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
             |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 41592 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 41538



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                    
Query: 264   gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
             |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 29394 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 29340

---

>emb|AL671762.10| Human DNA sequence from clone XXbac-254B15 on chromosome 6 contains the
             5' end of the VARS2 gene for valyl-tRNA synthetase 2, the
             gene for  chromosome 6 open reading frame 28, the HSPA1L
             gene for heat shock 70kDa protein 1-like, the HSPA1A gene
             for heat shock 70kDa protein 1A, the HSPA1B gene for heat
             shock 70kDa protein 1B, the gene for chromosome 6 open
             reading frame 48, the NEU1 gene for sialidase 1 (lysosomal
             sialidase), the gene forchromosome 6 open reading frame
             29, the gene for  HLA-B associated transcript 8, the gene
             for chromosome 6 open reading frame 46 and eight CpG
             islands, complete sequence
          Length = 113582

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                    
Query: 264   gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
             |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 37619 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 37565



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                    
Query: 264   gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
             |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 25425 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 25371

---

>emb|AL662834.8| Human DNA sequence from clone XXbac-40G17 on chromosome 6 contains the
             MSH5 gene for mutS homolog 5 (e. coli), the gene for NG23
             protein, the gene for chromosome 6 open reading frame 27,
             the VARS2 gene for valyl-tRNA synthetase 2, the gene for
             chromosome 6 open reading frame 28, the HSPA1L gene for
             heat shock 70kDa protein 1-like, the HSPA1A gene for heat
             shock 70kDa protein 1A, the HSPA1B gene for heat shock
             70kDa protein 1B, the gene for chromosome 6 open reading
             frame 48, the NEU1 gene for sialidase 1 (lysosomal
             sialidase), the gene for chromosome 6 open reading frame
             29, the BAT8 gene for HLA-B associated transcript 8, the
             gene for chromosome 6 open reading frame 46 and nine CpG
             islands, complete sequence
          Length = 179894

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                    
Query: 264   gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
             |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 93658 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 93604



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                    
Query: 264   gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
             |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 81462 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 81408

---

>gb|AY149619.1| Bos taurus heat-shock 70-kilodalton protein 1A (HSPA1A) gene,
            HSPA1A-D allele, complete cds
          Length = 8566

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 264  gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
            |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 3288 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 3234

---

>gb|AY149618.1| Bos taurus heat-shock 70-kilodalton protein 1A (HSPA1A) and heat-shock
             70-kilodalton protein 1B (HSPA1B) genes, complete cds
          Length = 19526

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                    
Query: 264   gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
             |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 14248 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 14194



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 264  gatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtcc 318
            |||||||||||| ||||    ||||||||||||| ||||||  ||||||||||||
Sbjct: 3288 gatgatggggttacacacctgctccagctccttcctcttgtgctcaaactcgtcc 3234

---

>emb|Y00371.1|HSHSC70 Human hsc70 gene for 71 kd heat shock cognate protein
          Length = 5408

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 244  gcaccctggtacatcttggcgatgatggggttgca 278
            |||| |||||||| ||||| |||||||||||||||
Sbjct: 4530 gcactctggtacagcttggtgatgatggggttgca 4496

---

>emb|X67716.1|TCHSPR70 T.cruzi mRNA for HSP70
          Length = 2222

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 247  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
            |||||||||||||| |  ||||||||  ||||||||  |||||||||||||
Sbjct: 1922 ccctggtacatcttcgtcatgatgggcgtgcacaggttctccagctccttc 1872

---

>emb|X58715.1|TCHSP70PA T.cruzi hsp70 mRNA for 70 kDa heat shock protein, partial cds
          Length = 1016

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 247 ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 297
           |||||||||||||| |  ||||||||  ||||||||  |||||||||||||
Sbjct: 647 ccctggtacatcttcgtcatgatgggcgtgcacaggttctccagctccttc 597


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,951,254
Number of Sequences: 3902068
Number of extensions: 2951254
Number of successful extensions: 58356
Number of sequences better than 10.0: 503
Number of HSP's better than 10.0 without gapping: 504
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 57262
Number of HSP's gapped (non-prelim): 1067
length of query: 390
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 368
effective length of database: 17,147,199,772
effective search space: 6310169516096
effective search space used: 6310169516096
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---