Clone Name	rbasd11m11
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AB024528.1| Halocynthia roretzi mitochondrial DNA, complete ...	581	e-163
2	emb|X74513.1|MIPS16SRA P.stolonifera mitochondrial 16S ribosmal ...	54	5e-04
3	gb|AY528924.1| Neophascogale lorentzii tRNA-Val and 16S ribosoma...	46	0.12
4	gb|AY528923.1| Phascolosorex dorsalis tRNA-Val and 16S ribosomal...	46	0.12
5	gb|AY528922.1| Sarcophilus harrisii tRNA-Val and 16S ribosomal R...	46	0.12
6	gb|AY528921.1| Dasyurus geoffroii tRNA-Val and 16S ribosomal RNA...	46	0.12
7	gb|AY528920.1| Dasyurus viverrinus tRNA-Val and 16S ribosomal RN...	46	0.12
8	gb|AY528919.1| Dasyurus spartacus tRNA-Val and 16S ribosomal RNA...	46	0.12
9	gb|AY528918.1| Dasyurus maculatus tRNA-Val and 16S ribosomal RNA...	46	0.12
10	gb|AY528917.1| Dasyurus hallucatus tRNA-Val and 16S ribosomal RN...	46	0.12
11	gb|AY528916.1| Dasycercus cristicauda tRNA-Val and 16S ribosomal...	46	0.12
12	gb|AY528915.1| Dasyuroides byrnei tRNA-Val and 16S ribosomal RNA...	46	0.12
13	gb|AY528914.1| Myoictis wallacei tRNA-Val and 16S ribosomal RNA ...	46	0.12
14	gb|AY528913.1| Myoictis melas tRNA-Val and 16S ribosomal RNA gen...	46	0.12
15	gb|AY528911.1| Pseudantechinus roryi tRNA-Val and 16S ribosomal ...	46	0.12
16	gb|AY528910.1| Pseudantechinus woolleyae tRNA-Val and 16S riboso...	46	0.12
17	gb|AY528909.1| Parantechinus bilarni tRNA-Val and 16S ribosomal ...	46	0.12
18	gb|AY528908.1| Parantechinus apicalis tRNA-Val and 16S ribosomal...	46	0.12
19	gb|AY528907.1| Dasykaluta rosamondae tRNA-Val and 16S ribosomal ...	46	0.12
20	gb|AY528906.1| Phascogale tapoatafa tRNA-Val and 16S ribosomal R...	46	0.12
21	gb|AY528905.1| Murexia longicaudata tRNA-Val and 16S ribosomal R...	46	0.12
22	gb|AY528904.1| Antechinus swainsonii tRNA-Val and 16S ribosomal ...	46	0.12
23	gb|AY857953.1| Epinephelus itajara 16S ribosomal RNA gene, parti...	46	0.12
24	gb|AY857936.1| Megalops atlanticus 16S ribosomal RNA gene, parti...	46	0.12
25	gb|AY561433.1| Ablepharus chernovi voucher NHMC 80.3.79.1 16S ri...	46	0.12
26	gb|AY561432.1| Ablepharus budaki voucher NHMC 80.3.131.13 16S ri...	46	0.12
27	gb|AY561431.1| Ablepharus budaki voucher NHMC 80.3.131.12 16S ri...	46	0.12
28	gb|AY561430.1| Ablepharus budaki voucher NHMC 80.3.131.11 16S ri...	46	0.12
29	gb|AY561429.1| Ablepharus budaki voucher NHMC 80.3.131.10 16S ri...	46	0.12
30	gb|AY561428.1| Ablepharus budaki voucher NHMC 80.3.131.9 16S rib...	46	0.12
31	gb|AY561427.1| Ablepharus budaki voucher NHMC 80.3.131.8 16S rib...	46	0.12
32	gb|AY561426.1| Ablepharus budaki voucher NHMC 80.3.131.7 16S rib...	46	0.12
33	gb|AY561425.1| Ablepharus budaki voucher NHMC 80.3.131.6 16S rib...	46	0.12
34	gb|AY561424.1| Ablepharus budaki voucher NHMC 80.3.131.5 16S rib...	46	0.12
35	gb|AY561423.1| Ablepharus budaki voucher NHMC 80.3.131.4 16S rib...	46	0.12
36	gb|AY561422.1| Ablepharus budaki voucher NHMC 80.3.131.3 16S rib...	46	0.12
37	gb|AY561421.1| Ablepharus budaki voucher NHMC 80.3.131.2 16S rib...	46	0.12
38	gb|AY561420.1| Ablepharus budaki voucher NHMC 80.3.131.1 16S rib...	46	0.12
39	gb|AY561419.1| Ablepharus kitaibelii voucher NHMC 80.3.82.105 16...	46	0.12
40	gb|AY561418.1| Ablepharus kitaibelii voucher NHMC 80.3.82.104 16...	46	0.12
41	gb|AY561417.1| Ablepharus kitaibelii voucher NHMC 80.3.82.103 16...	46	0.12
42	gb|AY561416.1| Ablepharus kitaibelii voucher NHMC 80.3.82.102 16...	46	0.12
43	gb|AY561415.1| Ablepharus kitaibelii voucher NHMC 80.3.82.101 16...	46	0.12
44	gb|AY561414.1| Ablepharus kitaibelii voucher NHMC 80.3.82.16 16S...	46	0.12
45	gb|AY561413.1| Ablepharus kitaibelii voucher NHMC 80.3.82.19 16S...	46	0.12
46	gb|AY561412.1| Ablepharus kitaibelii voucher NHMC 80.3.82.18 16S...	46	0.12
47	gb|AY561411.1| Ablepharus kitaibelii voucher NHMC 80.3.82.20 16S...	46	0.12
48	gb|AY561410.1| Ablepharus kitaibelii voucher NHMC 80.3.82.54 16S...	46	0.12
49	gb|AY561409.1| Ablepharus kitaibelii voucher NHMC 80.3.82.25 16S...	46	0.12
50	gb|AY561408.1| Ablepharus kitaibelii voucher NHMC 80.3.82.89 16S...	46	0.12
51	gb|AY561407.1| Ablepharus kitaibelii voucher NHMC 80.3.82.113 16...	46	0.12
52	gb|AY561406.1| Ablepharus kitaibelii voucher NHMC 80.3.82.62 16S...	46	0.12
53	gb|AY561405.1| Ablepharus kitaibelii voucher NHMC 80.3.82.61 16S...	46	0.12
54	gb|AY561404.1| Ablepharus kitaibelii voucher NHMC 80.3.82.1 16S ...	46	0.12
55	gb|AY561403.1| Ablepharus kitaibelii voucher NHMC 80.3.82.72 16S...	46	0.12
56	gb|AY561402.1| Ablepharus kitaibelii voucher NHMC 80.3.82.47 16S...	46	0.12
57	gb|AY561401.1| Ablepharus kitaibelii voucher NHMC 80.3.82.112 16...	46	0.12
58	gb|AY561400.1| Ablepharus kitaibelii voucher NHMC 80.3.82.6 16S ...	46	0.12
59	gb|AY561399.1| Ablepharus kitaibelii voucher NHMC 80.3.82.5 16S ...	46	0.12
60	gb|AY561398.1| Ablepharus kitaibelii voucher NHMC 80.3.82.3 16S ...	46	0.12
61	gb|AY561397.1| Ablepharus kitaibelii voucher NHMC 80.3.82.88 16S...	46	0.12
62	gb|AY561396.1| Ablepharus kitaibelii voucher NHMC 80.3.82.78 16S...	46	0.12
63	gb|AY561395.1| Ablepharus kitaibelii voucher NHMC 80.3.82.119 16...	46	0.12
64	gb|AY561394.1| Ablepharus kitaibelii voucher NHMC 80.3.82.43 16S...	46	0.12
65	gb|AY561393.1| Ablepharus kitaibelii voucher NHMC 80.3.82.57 16S...	46	0.12
66	gb|AY561392.1| Ablepharus kitaibelii voucher NHMC 80.3.82.56 16S...	46	0.12
67	gb|AY561391.1| Ablepharus kitaibelii voucher NHMC 80.3.82.59 16S...	46	0.12
68	gb|AY561390.1| Ablepharus kitaibelii voucher NHMC 80.3.82.55 16S...	46	0.12
69	gb|AY561389.1| Ablepharus kitaibelii voucher NHMC 80.3.82.4 16S ...	46	0.12
70	gb|AY561388.1| Ablepharus kitaibelii voucher NHMC 80.3.82.33 16S...	46	0.12
71	gb|AY561387.1| Ablepharus kitaibelii voucher NHMC 80.3.82.30 16S...	46	0.12
72	gb|AY561386.1| Ablepharus kitaibelii voucher NHMC 80.3.82.63 16S...	46	0.12
73	gb|AY561385.1| Ablepharus kitaibelii voucher NHMC 80.3.82.115 16...	46	0.12
74	gb|AY561384.1| Ablepharus kitaibelii voucher NHMC 80.3.82.65 16S...	46	0.12
75	gb|AY561383.1| Ablepharus kitaibelii voucher NHMC 80.3.82.64 16S...	46	0.12
76	gb|AY561382.1| Ablepharus kitaibelii voucher NHMC 80.3.82.70 16S...	46	0.12
77	gb|AY561381.1| Ablepharus kitaibelii voucher NHMC 80.3.82.87 16S...	46	0.12
78	gb|AY561380.1| Ablepharus kitaibelii voucher NHMC 80.3.82.2 16S ...	46	0.12
79	gb|AY354473.1| Pseudoeurycea ruficauda isolate 51.9 16S ribosoma...	46	0.12
80	gb|AY354472.1| Pseudoeurycea ruficauda isolate 51.8 16S ribosoma...	46	0.12
81	gb|AY354471.1| Pseudoeurycea ruficauda isolate 51.7 16S ribosoma...	46	0.12
82	gb|AY836585.1| Elops affinis 16S ribosomal RNA gene, partial seq...	46	0.12
83	gb|AY835657.1| Symphurus atricaudus 16S ribosomal RNA gene, part...	46	0.12
84	gb|AF302934.1| Lepidosiren paradoxa mitochondrion, complete genome	46	0.12
85	gb|AY315526.1| Amphiglossus igneocaudatus isolate E66-5 16S ribo...	46	0.12
86	gb|AY315525.1| Amphiglossus igneocaudatus isolate E66-4 16S ribo...	46	0.12
87	gb|AY315524.1| Amphiglossus igneocaudatus 16S ribosomal RNA gene...	46	0.12
88	gb|AY526215.1| Leptolalax oshanensis voucher ZYC799 16S ribosoma...	46	0.12
89	gb|AY561306.1| Leptolalax oshanensis 16S ribosomal RNA gene, par...	46	0.12
90	gb|AY822076.1| Heterostichus rostratus 16S ribosomal RNA gene, p...	46	0.12
91	gb|AY822075.1| Gibbonsia elegans 16S ribosomal RNA gene, partial...	46	0.12
92	gb|AY820741.1| Neoclinus blanchardi 16S ribosomal RNA gene, part...	46	0.12
93	gb|AY820740.1| Chaenopsis alepidota 16S ribosomal RNA gene, part...	46	0.12
94	gb|AY693488.1| Pseudotylosurus microps isolate N810 16S ribosoma...	46	0.12
95	gb|AY693485.1| Strongylura anastomella isolate N75b 16S ribosoma...	46	0.12
96	gb|AY693484.1| Strongylura anastomella isolate N75a 16S ribosoma...	46	0.12
97	gb|AY693475.1| Pseudotylosurus microps isolate N640 16S ribosoma...	46	0.12
98	gb|DQ027926.1| Diapterus auratus 16S ribosomal RNA gene, partial...	46	0.12
99	gb|DQ027922.1| Scomberoides lysan 16S ribosomal RNA gene, partia...	46	0.12
100	gb|DQ027915.1| Antennarius avalonis 16S ribosomal RNA gene, part...	46	0.12
101	gb|DQ027911.1| Lota lota 16S ribosomal RNA gene, partial sequenc...	46	0.12
102	gb|DQ027908.1| Lampris guttatus 16S ribosomal RNA gene, partial ...	46	0.12
103	gb|DQ027907.1| Velifer hypselopterus 16S ribosomal RNA gene, par...	46	0.12
104	gb|DQ027906.1| Chlorophthalmus agassizi 16S ribosomal RNA gene, ...	46	0.12
105	gb|AF215256.1| Rhacodactylus cf. leachianus 16S ribosomal RNA ge...	46	0.12
106	gb|AF215243.1| Phelsuma standingi 16S ribosomal RNA gene, partia...	46	0.12
107	gb|AY655502.1| Oryzias latipes 16S large subunit ribosomal RNA g...	46	0.12
108	gb|AY655501.1| Mugil cephalus 16S large subunit ribosomal RNA ge...	46	0.12
109	gb|AY655498.1| Atherion elymus 16S large subunit ribosomal RNA g...	46	0.12
110	gb|AY655497.1| Neostethus bicornis 16S large subunit ribosomal R...	46	0.12
111	gb|AY655496.1| Labidesthes sicculus 16S large subunit ribosomal ...	46	0.12
112	gb|AY655495.1| Atherinella panamensis 16S large subunit ribosoma...	46	0.12
113	gb|AY655492.1| Atherinomorus lacunosus 16S large subunit ribosom...	46	0.12
114	gb|AY655490.1| Rhadinocentrus ornatus 16S large subunit ribosoma...	46	0.12
115	gb|AY655489.1| Chilatherina bleheri 16S large subunit ribosomal ...	46	0.12
116	gb|AY098850.1| Tripterygion delaisi from Portugal 16S ribosomal ...	46	0.12
117	gb|AY098849.1| Tripterygion delaisi from Portugal 16S ribosomal ...	46	0.12
118	gb|AY098848.1| Labrisomus nuchipinnis isolate 2 from Cape Verde ...	46	0.12
119	gb|AY098847.1| Labrisomus nuchipinnis isolate 1 from Cape Verde ...	46	0.12
120	gb|AY098846.1| Ophioblennius atlanticus from Cape Verde 16S ribo...	46	0.12
121	gb|AY098845.1| Scartella cristata from Spain 16S ribosomal RNA g...	46	0.12
122	gb|AY098844.1| Scartella caboverdiana from Cape Verde 16S riboso...	46	0.12
123	gb|AY098843.1| Salaria fluviatilis from Portugal 16S ribosomal R...	46	0.12
124	gb|AY098842.1| Salaria pavo from Lebanon 16S ribosomal RNA gene,...	46	0.12
125	gb|AY098841.1| Parablennius zvonimiri isolate 2 from Italy 16S r...	46	0.12
126	gb|AY098840.1| Parablennius zvonimiri isolate 1 from Italy 16S r...	46	0.12
127	gb|AY098839.1| Parablennius tentacularis isolate 2 from Italy 16...	46	0.12
128	gb|AY098838.1| Parablennius tentacularis isolate 1 from Italy 16...	46	0.12
129	gb|AY098837.1| Parablennius sanguinolentus isolate 1 from Portug...	46	0.12
130	gb|AY098836.1| Parablennius salensis from Cape Verde 16S ribosom...	46	0.12
131	gb|AY098835.1| Parablennius gattorugine from Greece 16S ribosoma...	46	0.12
132	gb|AY098834.1| Parablennius ruber from Portugal 16S ribosomal RN...	46	0.12
133	gb|AY098833.1| Parablennius rouxi from Spain 16S ribosomal RNA g...	46	0.12
134	gb|AY098832.1| Parablennius rouxi from Italy 16S ribosomal RNA g...	46	0.12
135	gb|AY098831.1| Parablennius pilicornis from Portugal 16S ribosom...	46	0.12
136	gb|AY098830.1| Parablennius incognitus from Portugal 16S ribosom...	46	0.12
137	gb|AY098829.1| Parablennius incognitus from Portugal 16S ribosom...	46	0.12
138	gb|AY098828.1| Lipophrys trigloides from Portugal 16S ribosomal ...	46	0.12
139	gb|AY098827.1| Lipophrys trigloides from Portugal 16S ribosomal ...	46	0.12
140	gb|AY098826.1| Lipophrys trigloides from Greece 16S ribosomal RN...	46	0.12
141	gb|AY098825.1| Lipophrys pholis from United Kingdom 16S ribosoma...	46	0.12
142	gb|AY098824.1| Lipophrys nigriceps from Spain 16S ribosomal RNA ...	46	0.12
143	gb|AY098823.1| Lipophrys dalmatinus from Greece 16S ribosomal RN...	46	0.12
144	gb|AY098822.1| Lipophrys caboverdensis from Cape Verde 16S ribos...	46	0.12
145	gb|AY098821.1| Lipophrys canevae from Croatia 16S ribosomal RNA ...	46	0.12
146	gb|AY098820.1| Lipophrys adriaticus from Croatia 16S ribosomal R...	46	0.12
147	gb|AY098819.1| Coryphoblennius galerita from United Kingdom 16S ...	46	0.12
148	gb|AY098818.1| Coryphoblennius galerita from Croatia 16S ribosom...	46	0.12
149	gb|AY098817.1| Coryphoblennius galerita from Portugal 16S riboso...	46	0.12
150	gb|AY098816.1| Coryphoblennius galerita from Portugal 16S riboso...	46	0.12
151	gb|AY098815.1| Blennius ocellaris from Greece 16S ribosomal RNA ...	46	0.12
152	gb|AY098814.1| Aidablennius sphynx from Italy 16S ribosomal RNA ...	46	0.12
153	gb|AY266085.1| Menidia menidia 16S ribosomal RNA gene, partial s...	46	0.12
154	gb|AY266084.1| Atherinops affinis 16S ribosomal RNA gene, partia...	46	0.12
155	gb|AY266083.1| Pseudomugil gertrudae 16S ribosomal RNA gene, par...	46	0.12
156	gb|AY266082.1| Cairnsichthys rhombosomoides 16S ribosomal RNA ge...	46	0.12
157	gb|AY266081.1| Melanotaenia praecox 16S ribosomal RNA gene, part...	46	0.12
158	gb|AY266080.1| Glossolepis incisus 16S ribosomal RNA gene, parti...	46	0.12
159	gb|AY266079.1| Iriatherina werneri 16S ribosomal RNA gene, parti...	46	0.12
160	gb|AY266078.1| Atherinomorus sp. WLS-2003 16S ribosomal RNA gene...	46	0.12
161	gb|AY266077.1| Teramulus waterloti 16S ribosomal RNA gene, parti...	46	0.12
162	gb|AY266076.1| Atherina hepsetus 16S ribosomal RNA gene, partial...	46	0.12
163	gb|AY266075.1| Iso rhothophilus 16S ribosomal RNA gene, partial ...	46	0.12
164	gb|AY266073.1| Rheocles vatosoa 16S ribosomal RNA gene, partial ...	46	0.12
165	gb|AY266072.1| Rheocles lateralis 16S ribosomal RNA gene, partia...	46	0.12
166	gb|AY266071.1| Rheocles derhami 16S ribosomal RNA gene, partial ...	46	0.12
167	gb|AY266070.1| Rheocles alaotrensis 16S ribosomal RNA gene, part...	46	0.12
168	gb|AY266069.1| Rheocles wrightae 16S ribosomal RNA gene, partial...	46	0.12
169	gb|AY266068.1| Bedotia longianalis isolate 2 16S ribosomal RNA g...	46	0.12
170	gb|AY266067.1| Bedotia sp. 'Mahanara' 16S ribosomal RNA gene, pa...	46	0.12
171	gb|AY266066.1| Bedotia sp. 'Karianga' 16S ribosomal RNA gene, pa...	46	0.12
172	gb|AY266065.1| Bedotia geayi 16S ribosomal RNA gene, partial seq...	46	0.12
173	gb|AY266064.1| Bedotia sp. 'Betampona' 16S ribosomal RNA gene, p...	46	0.12
174	gb|AY266063.1| Bedotia masoala 16S ribosomal RNA gene, partial s...	46	0.12
175	gb|AY266062.1| Bedotia sp. 'Vevembe' 16S ribosomal RNA gene, par...	46	0.12
176	gb|AY266061.1| Bedotia sp. 'Manombo' 16S ribosomal RNA gene, par...	46	0.12
177	gb|AY266060.1| Bedotia madagascariensis 16S ribosomal RNA gene, ...	46	0.12
178	gb|AY266059.1| Bedotia sp. 'Sambava' 16S ribosomal RNA gene, par...	46	0.12
179	gb|AY266058.1| Bedotia marojejy 16S ribosomal RNA gene, partial ...	46	0.12
180	gb|AY266057.1| Bedotia sp. 'Antalaha' 16S ribosomal RNA gene, pa...	46	0.12
181	gb|AY266056.1| Bedotia sp. 'Ranomafana' 16S ribosomal RNA gene, ...	46	0.12
182	gb|AY266055.1| Bedotia longianalis isolate 1 16S ribosomal RNA g...	46	0.12
183	gb|AY266054.1| Bedotia sp. 'Beforana' 16S ribosomal RNA gene, pa...	46	0.12
184	gb|AY266053.1| Bedotia sp. 'Ivoloina' 16S ribosomal RNA gene, pa...	46	0.12
185	gb|AY770545.1| Caretta caretta 16S ribosomal RNA gene, partial s...	46	0.12
186	gb|AY770544.1| Chelonia mydas 16S ribosomal RNA gene, partial se...	46	0.12
187	gb|AY958668.1| Syngnathus exilis 16S ribosomal RNA gene, partial...	46	0.12
188	gb|AY462535.1| Oryzias marmoratus haplotype 2 16S ribosomal RNA ...	46	0.12
189	gb|AY462534.1| Oryzias marmoratus haplotype 1 16S ribosomal RNA ...	46	0.12
190	gb|AF416699.1| Bolitoglossa zapoteca specimen-voucher GP 522 clo...	46	0.12
191	gb|AF416698.1| Bolitoglossa zapoteca specimen-voucher GP 522 clo...	46	0.12
192	gb|AF416697.1| Bolitoglossa subpalmata specimen-voucher MVZ 2291...	46	0.12
193	gb|AF416696.1| Bolitoglossa riletti specimen-voucher MVZ 194328 ...	46	0.12
194	gb|AF416695.1| Bolitoglossa riletti specimen-voucher MVZ 146778 ...	46	0.12
195	gb|AF416694.1| Bolitoglossa riletti specimen-voucher MVZ 146767 ...	46	0.12
196	gb|AF416693.1| Bolitoglossa riletti specimen-voucher MVZ 146777 ...	46	0.12
197	gb|AF416692.1| Bolitoglossa riletti specimen-voucher MVZ 146775 ...	46	0.12
198	gb|AF416691.1| Bolitoglossa riletti specimen-voucher MVZ 146774 ...	46	0.12
199	gb|AF416690.1| Bolitoglossa oaxacensis specimen-voucher GP 382 1...	46	0.12
200	gb|AF416689.1| Bolitoglossa macrinii specimen-voucher GP 384 16S...	46	0.12
201	gb|AF416688.1| Bolitoglossa macrinii specimen-voucher MVZ 158524...	46	0.12
202	gb|AF416687.1| Bolitoglossa macrinii specimen-voucher MVZ 158523...	46	0.12
203	gb|AF416686.1| Bolitoglossa hermosa specimen-voucher MVZ 143804 ...	46	0.12
204	gb|AF416685.1| Bolitoglossa hermosa specimen-voucher MVZ 143804 ...	46	0.12
205	gb|AF420043.1| Semnopithecus entellus 12S ribosomal RNA gene, pa...	46	0.12
206	gb|AF420042.1| Pygathrix nemaeus 12S ribosomal RNA gene, partial...	46	0.12
207	gb|AY743418.1| Palea steindachneri 16S ribosomal RNA gene, compl...	46	0.12
208	gb|AY293619.1| Larus dominicanus mitochondrion, complete genome	46	0.12
209	gb|AF366350.1| Dogania subplana mitochondrion, complete genome	46	0.12
210	gb|AY605476.1| Geocalamus acutus voucher MVZ 232838 mitochondrio...	46	0.12
211	gb|AY605475.1| Amphisbaena schmidti voucher MVZ 232754 mitochond...	46	0.12
212	gb|AY605474.1| Diplometopon zarudnyi voucher MVZ 234273 mitochon...	46	0.12
213	gb|AF362763.1| Eudyptula minor mitochondrion, complete genome	46	0.12
214	gb|AY254568.1| Micropterus salmoides 16S ribosomal RNA gene, par...	46	0.12
215	gb|AY254559.1| Maccullochella peelii peelii 16S ribosomal RNA ge...	46	0.12
216	gb|AY254558.1| Maccullochella macquariensis 16S ribosomal RNA ge...	46	0.12
217	gb|AY254557.1| Maccullochella ikei 16S ribosomal RNA gene, parti...	46	0.12
218	gb|AY728235.1| Bolitoglossa n. sp. RLM-2004 mitochondrion, compl...	46	0.12
219	gb|AY728232.1| Plethodon cinereus mitochondrion, complete genome	46	0.12
220	gb|AY728229.1| Nototriton abscondens mitochondrion, partial genome	46	0.12
221	gb|AY728226.1| Aneides hardii mitochondrion, complete genome	46	0.12
222	gb|AY728224.1| Thorius n. sp. RLM-2004 mitochondrion, complete g...	46	0.12
223	gb|AY728223.1| Plethodon elongatus mitochondrion, complete genome	46	0.12
224	gb|AY728214.1| Aneides flavipunctatus mitochondrion, complete ge...	46	0.12
225	gb|AY728213.1| Oedipina poelzi mitochondrion, complete genome	46	0.12
226	gb|AY504839.1| Notopterus notopterus 16S ribosomal RNA gene, par...	46	0.12
227	gb|AY504837.1| Heterotis niloticus 16S ribosomal RNA gene, parti...	46	0.12
228	gb|AY504836.1| Papyrocranus afer 16S ribosomal RNA gene, partial...	46	0.12
229	gb|AY504834.1| Arapaima gigas 16S ribosomal RNA gene, partial se...	46	0.12
230	gb|AY504832.1| Scleropages leichardti 16S ribosomal RNA gene, pa...	46	0.12
231	gb|AY504830.1| Osteoglossum bicirrhosum 16S ribosomal RNA gene, ...	46	0.12
232	gb|AY430243.1| Menidia menidia 16S ribosomal RNA gene, partial s...	46	0.12
233	gb|AY430242.1| Sargocentron punctatissimum 16S ribosomal RNA gen...	46	0.12
234	gb|AY430232.1| Pellona flavipinnis 16S ribosomal RNA gene, parti...	46	0.12
235	gb|AY443574.1| Esox americanus 16S ribosomal RNA gene, partial s...	46	0.12
236	gb|AY443573.1| Esox niger 16S ribosomal RNA gene, partial sequen...	46	0.12
237	gb|AY605473.1| Rhineura floridana voucher MVZ 233342 mitochondri...	46	0.12
238	gb|AY359669.1| Cynoglossus cynoglossus 16S large subunit ribosom...	46	0.12
239	gb|AY359668.1| Symphurus tessellatus 16S large subunit ribosomal...	46	0.12
240	gb|AY359656.1| Citharichthys macrops 16S large subunit ribosomal...	46	0.12
241	gb|AY359654.1| Etropus crossotus 16S large subunit ribosomal RNA...	46	0.12
242	gb|AY365123.1| Pomacentrus coelestis 16S ribosomal RNA gene, par...	46	0.12
243	gb|AY365122.1| Pomacentrus bankanensis 16S ribosomal RNA gene, p...	46	0.12
244	gb|AY365121.1| Chromis fumea 16S ribosomal RNA gene, partial seq...	46	0.12
245	gb|AY365120.1| Abudefduf vaigiensis 16S ribosomal RNA gene, part...	46	0.12
246	gb|AY530874.1| Pomacanthus zonipectus 16S ribosomal RNA gene, pa...	46	0.12
247	gb|AY530868.1| Pomacanthus arcuatus 16S ribosomal RNA gene, part...	46	0.12
248	gb|AY530867.1| Holacanthus bermudensis 16S ribosomal RNA gene, p...	46	0.12
249	gb|AY530864.1| Holacanthus tricolor 16S ribosomal RNA gene, part...	46	0.12
250	gb|AY530863.1| Centropyge potteri 16S ribosomal RNA gene, partia...	46	0.12
251	gb|AY530862.1| Sumireyakko venustus 16S ribosomal RNA gene, part...	46	0.12
252	gb|AY530861.1| Holacanthus ciliaris 16S ribosomal RNA gene, part...	46	0.12
253	gb|AY530858.1| Pomacanthus sexstriatus 16S ribosomal RNA gene, p...	46	0.12
254	gb|AY530857.1| Holacanthus passer 16S ribosomal RNA gene, partia...	46	0.12
255	gb|AY530856.1| Centropyge loriculus 16S ribosomal RNA gene, part...	46	0.12
256	gb|AY530854.1| Pomacanthus asfur 16S ribosomal RNA gene, partial...	46	0.12
257	gb|AY530853.1| Paracentropyge multifasciatus 16S ribosomal RNA g...	46	0.12
258	gb|AY530852.1| Pomacanthus paru 16S ribosomal RNA gene, partial ...	46	0.12
259	gb|AY530851.1| Centropyge aurantonotus 16S ribosomal RNA gene, p...	46	0.12
260	gb|AY530850.1| Genicanthus melanospilos 16S ribosomal RNA gene, ...	46	0.12
261	gb|AY530849.1| Genicanthus lamarck 16S ribosomal RNA gene, parti...	46	0.12
262	gb|AY530847.1| Chaetodontoplus mesoleucus 16S ribosomal RNA gene...	46	0.12
263	gb|AY530846.1| Chaetodontoplus duboulayi 16S ribosomal RNA gene,...	46	0.12
264	gb|AY530845.1| Centropyge bicolor 16S ribosomal RNA gene, partia...	46	0.12
265	gb|AY530844.1| Pomacanthus semicirculatus 16S ribosomal RNA gene...	46	0.12
266	gb|AY530843.1| Apolemichthys trimaculatus 16S ribosomal RNA gene...	46	0.12
267	gb|AY530842.1| Apolemichthys xanthurus 16S ribosomal RNA gene, p...	46	0.12
268	gb|AY530841.1| Centropyge flavissimus 16S ribosomal RNA gene, pa...	46	0.12
269	gb|AY325307.1| Acanthisitta chloris mitochondrion, partial genome	46	0.12
270	gb|AY368310.1| Hippocampus ramulosus 16S ribosomal RNA gene, par...	46	0.12
271	gb|AY368307.1| Mora moro 16S ribosomal RNA gene, partial sequenc...	46	0.12
272	gb|AY368303.1| Coryphaenoides rupestris 16S ribosomal RNA gene, ...	46	0.12
273	gb|AY368301.1| Trachyrincus murrayi 16S ribosomal RNA gene, part...	46	0.12
274	gb|AY368298.1| Pomadasys perotaei 16S ribosomal RNA gene, partia...	46	0.12
275	gb|AY368296.1| Regalecus glesne 16S ribosomal RNA gene, partial ...	46	0.12
276	gb|AY520100.1| Micropterus treculii isolate MtreA 16S ribosomal ...	46	0.12
277	gb|AY130837.1| Brycinus macrolepidotus 16S ribosomal RNA gene, p...	46	0.12
278	gb|AY687385.1| Pelodiscus sinensis mitochondrion, complete genome	46	0.12
279	gb|AY676201.1| Chinemys reevesi mitochondrion, complete genome	46	0.12
280	gb|DQ452302.1| Hippocampus spinosissimus voucher IMSS 0001 16S r...	46	0.12
281	gb|AY762354.1| Pseudoeurycea obesa clone e51.5 16S ribosomal RNA...	46	0.12
282	gb|AY762353.1| Pseudoeurycea obesa clone e51.6 16S ribosomal RNA...	46	0.12
283	gb|AY762352.1| Pseudoeurycea papenfussi clone e33.27 16S ribosom...	46	0.12
284	gb|AY762351.1| Pseudoeurycea papenfussi clone e33.29 16S ribosom...	46	0.12
285	gb|AY762350.1| Pseudoeurycea papenfussi clone e33.26 16S ribosom...	46	0.12
286	gb|AY292596.1| Histrio histrio 16S ribosomal RNA gene, partial s...	46	0.12
287	gb|AY292595.1| Antennarius nummifer 16S ribosomal RNA gene, part...	46	0.12
288	gb|AY292593.1| Halieutichthys aculeatus 16S ribosomal RNA gene, ...	46	0.12
289	gb|AY292592.1| Tetrabrachium ocellatum 16S ribosomal RNA gene, p...	46	0.12
290	gb|AY292591.1| Tathicarpus butleri 16S ribosomal RNA gene, parti...	46	0.12
291	gb|AY292590.1| Chaunax pictus 16S ribosomal RNA gene, partial se...	46	0.12
292	gb|AF518230.1| Uranoscopus scaber 16S ribosomal RNA gene, partia...	46	0.12
293	gb|AF518226.1| Sebastes oculatus 16S ribosomal RNA gene, partial...	46	0.12
294	gb|AY603017.1| Stellifer naso 16S ribosomal RNA gene, complete s...	46	0.12
295	gb|AY603015.1| Stellifer microps 16S ribosomal RNA gene, complet...	46	0.12
296	gb|AY603005.1| Macrodon ancylodon 16S ribosomal RNA gene, comple...	46	0.12
297	gb|AY763726.1| Parachanna obscura 12S ribosomal RNA gene, partia...	46	0.12
298	gb|AY763724.1| Channa bleheri 12S ribosomal RNA gene, partial se...	46	0.12
299	gb|AY763717.1| Parosphromenus paludicola 12S ribosomal RNA gene,...	46	0.12
300	gb|AY763716.1| Parosphromenus ornaticauda 12S ribosomal RNA gene...	46	0.12
301	gb|AY763715.1| Parosphromenus anjunganensis 12S ribosomal RNA ge...	46	0.12
302	gb|AY763696.1| Helostoma temminckii 12S ribosomal RNA gene, part...	46	0.12
303	gb|DQ017374.1| Symphurus plagusia large subunit ribosomal RNA ge...	46	0.12
304	gb|AY998029.1| Symphurus plagusia voucher LBP717 16S ribosomal R...	46	0.12
305	gb|AY998026.1| Etropus crossotus voucher LBP506 16S ribosomal RN...	46	0.12
306	gb|AY998024.1| Symphurus tessellatus voucher LBP513 16S ribosoma...	46	0.12
307	gb|AY998020.1| Etropus longimanus voucher LBP886 16S ribosomal R...	46	0.12
308	gb|AY309457.1| Ninox novaeseelandiae mitochondrion, complete genome	46	0.12
309	gb|AY309456.1| Strigops habroptilus mitochondrion, complete genome	46	0.12
310	gb|AY309455.1| Anseranas semipalmata mitochondrion, complete genome	46	0.12
311	gb|AF519662.1| Parosphromenus deissneri isolate B91 12S ribosoma...	46	0.12
312	gb|AF519655.1| Betta macrostoma isolate B174 12S ribosomal RNA g...	46	0.12
313	gb|AY526157.1| Bolitoglossa alvaradoi voucher MVZ215735 16S ribo...	46	0.12
314	gb|AY526156.1| Bolitoglossa synoria voucher LDW11114 16S ribosom...	46	0.12
315	gb|AY526155.1| Bolitoglossa sp. MGP-3 16S ribosomal RNA gene, pa...	46	0.12
316	gb|AY526154.1| Bolitoglossa sp. MGP-3 16S ribosomal RNA gene, pa...	46	0.12
317	gb|AY526153.1| Bolitoglossa rostrata voucher MVZs5517 16S riboso...	46	0.12
318	gb|AY526152.1| Bolitoglossa rostrata voucher MVZs5243 16S riboso...	46	0.12
319	gb|AY526151.1| Bolitoglossa porrasorum voucher LDW10436 16S ribo...	46	0.12
320	gb|AY526150.1| Bolitoglossa morio voucher MVZs813 16S ribosomal ...	46	0.12
321	gb|AY526149.1| Bolitoglossa longissima voucher LDW11212 16S ribo...	46	0.12
322	gb|AY526148.1| Bolitoglossa lincolni voucher MVZs1943 16S riboso...	46	0.12
323	gb|AY526147.1| Bolitoglossa franklini voucher MVZ185991 16S ribo...	46	0.12
324	gb|AY526146.1| Bolitoglossa flavimembris voucher MVZs2015 16S ri...	46	0.12
325	gb|AY526145.1| Bolitoglossa dunni voucher LDW11217 16S ribosomal...	46	0.12
326	gb|AY526144.1| Bolitoglossa diaphora voucher LDW10973 16S riboso...	46	0.12
327	gb|AY526143.1| Bolitoglossa decora voucher USNM497533 16S riboso...	46	0.12
328	gb|AY526142.1| Bolitoglossa conanti voucher LDW10957 16S ribosom...	46	0.12
329	gb|AY526141.1| Bolitoglossa celaque voucher LDW11094 16S ribosom...	46	0.12
330	gb|AY526140.1| Bolitoglossa celaque voucher LDW11093 16S ribosom...	46	0.12
331	gb|AY526137.1| Bolitoglossa sp. MGP-4 16S ribosomal RNA gene, pa...	46	0.12
332	gb|AY526136.1| Bolitoglossa sp. MGP-2 16S ribosomal RNA gene, pa...	46	0.12
333	gb|AY526135.1| Bolitoglossa sp. MGP-1 16S ribosomal RNA gene, pa...	46	0.12
334	gb|AY526134.1| Bolitoglossa sima voucher MVZs2057 16S ribosomal ...	46	0.12
335	gb|AY526133.1| Bolitoglossa schizodactyla 16S ribosomal RNA gene...	46	0.12
336	gb|AY526132.1| Bolitoglossa pesrubra voucher UCR12068 16S riboso...	46	0.12
337	gb|AY526131.1| Bolitoglossa peruviana voucher KU217421 16S ribos...	46	0.12
338	gb|AY526130.1| Bolitoglossa peruviana voucher LSUMZH-12838 16S r...	46	0.12
339	gb|AY526129.1| Bolitoglossa paraensis voucher LSUMZH-13735 16S r...	46	0.12
340	gb|AY526128.1| Bolitoglossa paraensis voucher LSUMZH-3086 16S ri...	46	0.12
341	gb|AY526127.1| Bolitoglossa paraensis voucher INPA3098 16S ribos...	46	0.12
342	gb|AY526126.1| Bolitoglossa palmata voucher KU217423 16S ribosom...	46	0.12
343	gb|AY526125.1| Bolitoglossa palmata voucher KU217422 16S ribosom...	46	0.12
344	gb|AY526124.1| Bolitoglossa minutula voucher MVZs12932 16S ribos...	46	0.12
345	gb|AY526123.1| Bolitoglossa medemi voucher 13237 16S ribosomal R...	46	0.12
346	gb|AY526122.1| Bolitoglossa gracilis voucher MVZ229171 16S ribos...	46	0.12
347	gb|AY526121.1| Bolitoglossa gracilis voucher MVZ229170 16S ribos...	46	0.12
348	gb|AY526120.1| Bolitoglossa epimela voucher MVZ181260 16S riboso...	46	0.12
349	gb|AY526119.1| Bolitoglossa colonnea 16S ribosomal RNA gene, par...	46	0.12
350	gb|AY526118.1| Bolitoglossa biseriata voucher 13236 16S ribosoma...	46	0.12
351	gb|AY526117.1| Bolitoglossa altamazonica voucher KU222111 16S ri...	46	0.12
352	gb|AY526116.1| Bolitoglossa rufescens voucher MVZ194333 16S ribo...	46	0.12
353	gb|AY526115.1| Bolitoglossa occidentalis voucher MVZ194254 16S r...	46	0.12
354	gb|AY458868.1| Prietella phreatophila voucher TNHC 24986 12S rib...	46	0.12
355	gb|AY458867.1| Prietella lundbergi 12S ribosomal RNA gene, parti...	46	0.12
356	gb|AY458866.1| Prietella lundbergi voucher TNHC 25767-68 12S rib...	46	0.12
357	gb|AF231525.1| Strongylura scapularis 16S ribosomal RNA gene, pa...	46	0.12
358	gb|AF231518.1| Strongylura hubbsi 16S ribosomal RNA gene, partia...	46	0.12
359	gb|AF231517.1| Strongylura fluviatilis 16S ribosomal RNA gene, p...	46	0.12
360	gb|AF231516.1| Strongylura marina clone STRI-1485 16S ribosomal ...	46	0.12
361	gb|AF231513.1| Ablennes hians 16S ribosomal RNA gene, partial se...	46	0.12
362	gb|AY583695.1| Trionyx axenaria 16S ribosomal RNA gene, complete...	46	0.12
363	gb|AY583694.1| Pelodiscus sinensis 16S ribosomal RNA gene, compl...	46	0.12
364	gb|AY574900.1| Pycnonotus eutilotus voucher Sarawak-BPBBM1 16S r...	46	0.12
365	gb|AY574898.1| Criniger phaeocephalus voucher Sarawak-YBBM2 16S ...	46	0.12
366	gb|AY574897.1| Criniger phaeocephalus voucher Sarawak-YBBS3 16S ...	46	0.12
367	gb|AY574896.1| Criniger phaeocephalus voucher Sarawak-YBBS2 16S ...	46	0.12
368	gb|AY574895.1| Criniger phaeocephalus voucher Sarawak-YBBS1 16S ...	46	0.12
369	gb|AY574894.1| Criniger phaeocephalus voucher Sarawak-YBBM1 16S ...	46	0.12
370	gb|AY574892.1| Pycnonotus brunneus voucher Sarawak-REBW1 16S rib...	46	0.12
371	gb|AY574891.1| Pycnonotus brunneus voucher Sarawak-REBF1 16S rib...	46	0.12
372	gb|AY574890.1| Criniger ochraceus voucher Sarawak-OCHBS1 16S rib...	46	0.12
373	gb|AY574889.1| Pycnonotus plumosus voucher Sarawak-OWBS4 16S rib...	46	0.12
374	gb|AY574888.1| Pycnonotus plumosus voucher Sarawak-OWBS3 16S rib...	46	0.12
375	gb|AY574887.1| Pycnonotus plumosus voucher Sarawak-OWBS2 16S rib...	46	0.12
376	gb|AY574886.1| Pycnonotus plumosus voucher Sarawak-OWBS1 16S rib...	46	0.12
377	gb|DQ185446.1| Mugil cephalus 16S ribosomal RNA gene, partial se...	46	0.12
378	gb|AF338707.3| Tinamus major mitochondrion, complete genome	46	0.12
379	gb|AF338713.2| Casuarius casuarius mitochondrion, complete genome	46	0.12
380	gb|AF338708.2| Apteryx haastii mitochondrion, complete genome	46	0.12
381	gb|AY452257.1| Rhadinocentrus ornatus isolate WPK-by 16S ribosom...	46	0.12
382	gb|AY452256.1| Rhadinocentrus ornatus isolate FIS-bw 16S ribosom...	46	0.12
383	gb|AY452255.1| Rhadinocentrus ornatus isolate TCB-se 16S ribosom...	46	0.12
384	gb|AY452254.1| Rhadinocentrus ornatus isolate BRI-sc 16S ribosom...	46	0.12
385	gb|AY452253.1| Rhadinocentrus ornatus isolate NOO-kk 16S ribosom...	46	0.12
386	gb|AY452252.1| Rhadinocentrus ornatus isolate CLA-ul 16S ribosom...	46	0.12
387	gb|AY452251.1| Rhadinocentrus ornatus isolate CLA-bu 16S ribosom...	46	0.12
388	gb|AY452250.1| Rhadinocentrus ornatus isolate BRW-cu 16S ribosom...	46	0.12
389	gb|AY452249.1| Rhadinocentrus ornatus isolate LOA-cc 16S ribosom...	46	0.12
390	gb|AY452248.1| Rhadinocentrus ornatus isolate NSI-bl 16S ribosom...	46	0.12
391	gb|AY452247.1| Rhadinocentrus ornatus isolate SOC-uc 16S ribosom...	46	0.12
392	gb|AY452246.1| Rhadinocentrus ornatus isolate GMM-cw 16S ribosom...	46	0.12
393	gb|AY452245.1| Rhadinocentrus ornatus isolate BIS-ms 16S ribosom...	46	0.12
394	gb|AY452244.1| Rhadinocentrus ornatus isolate LOA-ep 16S ribosom...	46	0.12
395	gb|AY452243.1| Rhadinocentrus ornatus isolate NSI-ar 16S ribosom...	46	0.12
396	gb|AY461521.1| Melanotaenia duboulayi 16S ribosomal RNA gene, pa...	46	0.12
397	gb|AY523996.1| Chiropterotriton chondrostega clone E33.22 16S ri...	46	0.12
398	gb|AY522495.1| Chiropterotriton chondrostega clone E9.12 16S rib...	46	0.12
399	gb|AY522494.1| Chiropterotriton chondrostega clone E33.21 16S ri...	46	0.12
400	gb|AY522493.1| Chiropterotriton sp. K clone E28.25 16S ribosomal...	46	0.12
401	gb|AY522492.1| Chiropterotriton sp. K clone E28.23 16S ribosomal...	46	0.12
402	gb|AY522491.1| Chiropterotriton sp. K clone E28.22 16S ribosomal...	46	0.12
403	gb|AY522490.1| Chiropterotriton sp. J clone E16.13 16S ribosomal...	46	0.12
404	gb|AY522489.1| Chiropterotriton sp. J clone E16.12 16S ribosomal...	46	0.12
405	gb|AY522488.1| Chiropterotriton sp. I clone E28.18 16S ribosomal...	46	0.12
406	gb|AY522487.1| Chiropterotriton sp. I clone E28.17 16S ribosomal...	46	0.12
407	gb|AY522486.1| Chiropterotriton sp. H clone E28.16 16S ribosomal...	46	0.12
408	gb|AY522485.1| Chiropterotriton sp. H clone A1.9 16S ribosomal R...	46	0.12
409	gb|AY522484.1| Chiropterotriton sp. H clone E9.21 16S ribosomal ...	46	0.12
410	gb|AY522483.1| Chiropterotriton sp. H clone E16.18 16S ribosomal...	46	0.12
411	gb|AY522482.1| Chiropterotriton sp. H clone E16.19 16S ribosomal...	46	0.12
412	gb|AY522481.1| Chiropterotriton sp. L clone E28.14 16S ribosomal...	46	0.12
413	gb|AY522480.1| Chiropterotriton sp. L clone E28.20 16S ribosomal...	46	0.12
414	gb|AY522479.1| Chiropterotriton sp. F clone E28.21 16S ribosomal...	46	0.12
415	gb|AY522478.1| Chiropterotriton sp. F clone E28.19 16S ribosomal...	46	0.12
416	gb|AY522477.1| Chiropterotriton sp. F clone E28.13 16S ribosomal...	46	0.12
417	gb|AY522474.1| Chiropterotriton arboreus clone E10.12 16S riboso...	46	0.12
418	gb|AY522473.1| Chiropterotriton multidentatus clone E30.6 16S ri...	46	0.12
419	gb|AY522472.1| Chiropterotriton multidentatus clone E30.8 16S ri...	46	0.12
420	gb|AY522471.1| Chiropterotriton sp. 15 clone A2.8 16S ribosomal ...	46	0.12
421	gb|AY522470.1| Chiropterotriton magnipes clone A2.5 16S ribosoma...	46	0.12
422	gb|AY522469.1| Chiropterotriton magnipes clone A2.6 16S ribosoma...	46	0.12
423	gb|AY522468.1| Chiropterotriton magnipes clone A2.3 16S ribosoma...	46	0.12
424	gb|AY522467.1| Chiropterotriton lavae clone E16.16 16S ribosomal...	46	0.12
425	gb|AY522466.1| Chiropterotriton lavae clone E16.17 16S ribosomal...	46	0.12
426	gb|AY522465.1| Chiropterotriton dimidiatus clone A2.12 16S ribos...	46	0.12
427	gb|AY522464.1| Chiropterotriton dimidiatus clone A2.2 16S riboso...	46	0.12
428	gb|AY522463.1| Chiropterotriton dimidiatus clone E16.26 16S ribo...	46	0.12
429	gb|AY522462.1| Chiropterotriton cracens clone E30.2 16S ribosoma...	46	0.12
430	gb|AY522461.1| Chiropterotriton cracens clone E9.9 16S ribosomal...	46	0.12
431	gb|AY522460.1| Chiropterotriton cracens clone E9.6 16S ribosomal...	46	0.12
432	gb|AY522459.1| Chiropterotriton cracens clone E9.1 16S ribosomal...	46	0.12
433	gb|AY522458.1| Chiropterotriton cracens clone A2.20 16S ribosoma...	46	0.12
434	gb|AY522457.1| Chiropterotriton cracens clone A2.19 16S ribosoma...	46	0.12
435	gb|AY522456.1| Chiropterotriton cracens clone E9.8 16S ribosomal...	46	0.12
436	gb|AY522455.1| Chiropterotriton terrestris clone E9.10 16S ribos...	46	0.12
437	gb|AY522454.1| Chiropterotriton sp. C clone E43.4 16S ribosomal ...	46	0.12
438	gb|AY522453.1| Chiropterotriton sp. C clone E9.18 16S ribosomal ...	46	0.12
439	gb|AY522452.1| Chiropterotriton orculus clone E10.7 16S ribosoma...	46	0.12
440	gb|AY522451.1| Chiropterotriton orculus clone E10.8 16S ribosoma...	46	0.12
441	gb|AY522450.1| Chiropterotriton orculus clone E31.8 16S ribosoma...	46	0.12
442	gb|AY522449.1| Chiropterotriton orculus clone E31.7 16S ribosoma...	46	0.12
443	gb|AY522448.1| Chiropterotriton orculus clone E31-10 16S ribosom...	46	0.12
444	gb|AY522447.1| Chiropterotriton orculus clone E10.14 16S ribosom...	46	0.12
445	gb|AY522446.1| Chiropterotriton orculus clone A1.7 16S ribosomal...	46	0.12
446	gb|AY522445.1| Chiropterotriton orculus clone E31.3 16S ribosoma...	46	0.12
447	gb|AY522444.1| Chiropterotriton orculus clone E28.3 16S ribosoma...	46	0.12
448	gb|AY522443.1| Chiropterotriton orculus clone E28.2 16S ribosoma...	46	0.12
449	gb|AY522442.1| Chiropterotriton orculus clone E28.1 16S ribosoma...	46	0.12
450	gb|U73252.1|CAU73252 Cynolebias antenori mitochondrial 16S ribos...	46	0.12
451	gb|U73251.1|CAU73251 Cynolebias affinis mitochondrial 16S riboso...	46	0.12
452	gb|U73250.1|NKU73250 Nothobranchius kirki mitochondrial 16S ribo...	46	0.12
453	gb|AY395863.1| Antrozous dubiaquercus 12S ribosomal RNA gene, pa...	46	0.12
454	gb|AY395835.1| Anoura caudifer 12S ribosomal RNA gene, partial s...	46	0.12
455	gb|AY395813.1| Hylonycteris underwoodi 12S ribosomal RNA gene, p...	46	0.12
456	gb|AY742552.1| Micropterus treculii isolate MtreG 16S ribosomal ...	46	0.12
457	gb|AY742551.1| Micropterus treculii isolate MtreE 16S ribosomal ...	46	0.12
458	gb|AY742550.1| Micropterus salmoides isolate MsalA 16S ribosomal...	46	0.12
459	gb|AY742549.1| Micropterus punctulatus isolate MpunK 16S ribosom...	46	0.12
460	gb|AY742548.1| Micropterus punctulatus isolate MpunA 16S ribosom...	46	0.12
461	gb|AY742547.1| Micropterus notius isolate MnotD 16S ribosomal RN...	46	0.12
462	gb|AY742546.1| Micropterus notius isolate MnotA 16S ribosomal RN...	46	0.12
463	gb|AY742545.1| Micropterus floridanus isolate MflaH 16S ribosoma...	46	0.12
464	gb|AY742544.1| Micropterus floridanus isolate MflaG 16S ribosoma...	46	0.12
465	gb|AY742543.1| Micropterus dolomieu isolate MdolJ 16S ribosomal ...	46	0.12
466	gb|AY742542.1| Micropterus dolomieu isolate MdolD 16S ribosomal ...	46	0.12
467	gb|AY742541.1| Micropterus coosae isolate McooG 16S ribosomal RN...	46	0.12
468	gb|AY742540.1| Micropterus cataractae isolate McatD 16S ribosoma...	46	0.12
469	gb|AY742516.1| Archoplites interruptus isolate AintA 16S ribosom...	46	0.12
470	gb|DQ097100.1| Lacerta agilis isolate HO2 16S ribosomal RNA gene...	46	0.12
471	gb|DQ097099.1| Lacerta strigata isolate 4 16S ribosomal RNA gene...	46	0.12
472	gb|DQ097098.1| Lacerta strigata isolate 3 16S ribosomal RNA gene...	46	0.12
473	gb|DQ097097.1| Lacerta schreiberi isolate Lou4 16S ribosomal RNA...	46	0.12
474	gb|AY336632.1| Neurergus crocatus 16S ribosomal RNA gene, partia...	46	0.12
475	gb|AY450622.1| Herpele squalostoma voucher BMNH-2002.97 16S ribo...	46	0.12
476	gb|AY499298.1| Lynx canadensis voucher Lca7 16S ribosomal RNA ge...	46	0.12
477	gb|AY499297.1| Lynx canadensis voucher Lca3 16S ribosomal RNA ge...	46	0.12
478	gb|AY098631.1| Neopomacentrus cyanomos 16S small subunit ribosom...	46	0.12
479	gb|AY098630.1| Dischistodus perspicillatus 16S small subunit rib...	46	0.12
480	gb|AY098629.1| Chrysiptera rollandi 16S small subunit ribosomal ...	46	0.12
481	gb|AY098628.1| Azurina hirundo 16S small subunit ribosomal RNA g...	46	0.12
482	gb|AY098627.1| Acanthochromis polyacanthus 16S small subunit rib...	46	0.12
483	gb|AY277307.1| Hippocampus guttulatus 16S ribosomal RNA gene, pa...	46	0.12
484	gb|AY277306.1| Hippocampus hippocampus 16S ribosomal RNA gene, p...	46	0.12
485	gb|AY277303.1| Hippocampus ingens 16S ribosomal RNA gene, partia...	46	0.12
486	gb|AY277301.1| Hippocampus reidi 16S ribosomal RNA gene, partial...	46	0.12
487	gb|AY277298.1| Hippocampus kelloggi 16S ribosomal RNA gene, part...	46	0.12
488	gb|AY277297.1| Hippocampus queenslandicus 16S ribosomal RNA gene...	46	0.12
489	gb|AY277296.1| Hippocampus spinosissimus 16S ribosomal RNA gene,...	46	0.12
490	gb|AY277295.1| Hippocampus camelopardalis 16S ribosomal RNA gene...	46	0.12
491	gb|AY277293.1| Hippocampus coronatus 16S ribosomal RNA gene, par...	46	0.12
492	gb|AY277292.1| Hippocampus mohnikei 16S ribosomal RNA gene, part...	46	0.12
493	gb|AY277291.1| Hippocampus trimaculatus 16S ribosomal RNA gene, ...	46	0.12
494	gb|AY277290.1| Hippocampus whitei 16S ribosomal RNA gene, partia...	46	0.12
495	gb|AY277289.1| Hippocampus comes 16S ribosomal RNA gene, partial...	46	0.12
496	gb|AY277287.1| Hippocampus breviceps 16S ribosomal RNA gene, par...	46	0.12
497	gb|AY277286.1| Hippocampus bargibanti 16S ribosomal RNA gene, pa...	46	0.12
498	gb|AF202806.1| Empidonax oberholseri 16S ribosomal RNA gene, par...	46	0.12
499	gb|AF202805.1| Vireo huttoni 16S ribosomal RNA gene, partial seq...	46	0.12
500	gb|AF202804.1| Vireo gilvus 16S ribosomal RNA gene, partial sequ...	46	0.12

---

>dbj|AB024528.1| Halocynthia roretzi mitochondrial DNA, complete genome
          Length = 14771

 Score =  581 bits (293), Expect = e-163
 Identities = 317/326 (97%), Gaps = 2/326 (0%)
 Strand = Plus / Minus

                                                                         
Query: 242   tttttaaatttcttatcgagacaactaanacctgagacacctatcactagactacaatt- 300
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| 
Sbjct: 12672 tttttaaatttcttatcgagacaactaagacctgagacacctatcactagactacaattg 12613

                                                                         
Query: 301   -aatagtcaaattactacgctacattaagccccttgcgccatctatctaaacactgngca 359
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 12612 gaatagtcaaattactacgctacattaagccccttgcgccatctatctaaacactgtgca 12553

                                                                         
Query: 360   natgttgtttactatctgcatcaataaactaagtctttagtaaacccacaaatctacagc 419
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 12552 gatgttgtttactatctgcatcaataaactaagtctttagtaaacccacaaatctacagc 12493

                                                                         
Query: 420   caaattccttaataagacattcccacaaattaaaataaancacatttcaacttaccatta 479
             ||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 12492 caaattccttaataagacaatcccacaaattaaaataaaacacatttcaacttaccatta 12433

                                                                         
Query: 480   aatcaaatacacttatactcatcttancattataattactacttataacaataccaacca 539
             |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 12432 aatcaaatacacttatactcatcttagcattataattactacttataacaataccaacca 12373

                                       
Query: 540   acacttaaaattnaaaaacaaattat 565
             |||||||||||| |||||||||||||
Sbjct: 12372 acacttaaaattaaaaaacaaattat 12347



 Score =  349 bits (176), Expect = 6e-93
 Identities = 191/196 (97%), Gaps = 1/196 (0%)
 Strand = Plus / Minus

                                                                         
Query: 1     ctattaatgcgatntgaactctcctaattgattgcgctgttatccctggggttggttctt 60
             |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 12912 ctattaat-cgatatgaactctcctaattgattgcgctgttatccctggggttggttctt 12854

                                                                         
Query: 61    natttncttaaaaatcagggatcgtaatataaaataacactaattctantatcactgaaa 120
              |||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 12853 catttccttaaaaatcagggatcgtaatataaaataacactaattctaatatcactgaaa 12794

                                                                         
Query: 121   ttaaatcacatcaacaactgccccagttaaaggatttcaacttatattaaactgattaac 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 12793 ttaaatcacatcaacaactgccccagttaaaggatttcaacttatattaaactgattaac 12734

                             
Query: 181   cttaaccacccagggt 196
             ||||||||||||||||
Sbjct: 12733 cttaaccacccagggt 12718

---

>emb|X74513.1|MIPS16SRA P.stolonifera mitochondrial 16S ribosmal RNA gene
          Length = 1556

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 285  tcactagactacaattaatagtcaaattactacgctacattaa 327
            ||||||| ||||||||||||| ||||||| |||||||| ||||
Sbjct: 1081 tcactagtctacaattaatagacaaattattacgctactttaa 1039



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 31   attgcgctgttatccctggggttggttct 59
            ||||||||||||||||| |||||||||||
Sbjct: 1333 attgcgctgttatccctagggttggttct 1305

---

>gb|AY528924.1| Neophascogale lorentzii tRNA-Val and 16S ribosomal RNA genes,
            complete sequence; mitochondrial
          Length = 1640

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1356 gattgcgctgttatccctggggt 1334

---

>gb|AY528923.1| Phascolosorex dorsalis tRNA-Val and 16S ribosomal RNA genes, complete
            sequence; mitochondrial
          Length = 1648

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1367 gattgcgctgttatccctggggt 1345

---

>gb|AY528922.1| Sarcophilus harrisii tRNA-Val and 16S ribosomal RNA genes, complete
            sequence; mitochondrial
          Length = 1652

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1369 gattgcgctgttatccctggggt 1347

---

>gb|AY528921.1| Dasyurus geoffroii tRNA-Val and 16S ribosomal RNA genes, complete
            sequence; mitochondrial
          Length = 1644

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1358 gattgcgctgttatccctggggt 1336

---

>gb|AY528920.1| Dasyurus viverrinus tRNA-Val and 16S ribosomal RNA genes, complete
            sequence; mitochondrial
          Length = 1640

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1354 gattgcgctgttatccctggggt 1332

---

>gb|AY528919.1| Dasyurus spartacus tRNA-Val and 16S ribosomal RNA genes, complete
            sequence; mitochondrial
          Length = 1643

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1359 gattgcgctgttatccctggggt 1337

---

>gb|AY528918.1| Dasyurus maculatus tRNA-Val and 16S ribosomal RNA genes, complete
            sequence; mitochondrial
          Length = 1643

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1357 gattgcgctgttatccctggggt 1335

---

>gb|AY528917.1| Dasyurus hallucatus tRNA-Val and 16S ribosomal RNA genes, complete
            sequence; mitochondrial
          Length = 1643

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1356 gattgcgctgttatccctggggt 1334

---

>gb|AY528916.1| Dasycercus cristicauda tRNA-Val and 16S ribosomal RNA genes, complete
            sequence; mitochondrial
          Length = 1646

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1362 gattgcgctgttatccctggggt 1340

---

>gb|AY528915.1| Dasyuroides byrnei tRNA-Val and 16S ribosomal RNA genes, complete
            sequence; mitochondrial
          Length = 1642

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1357 gattgcgctgttatccctggggt 1335

---

>gb|AY528914.1| Myoictis wallacei tRNA-Val and 16S ribosomal RNA genes, complete
            sequence; mitochondrial
          Length = 1638

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1356 gattgcgctgttatccctggggt 1334

---

>gb|AY528913.1| Myoictis melas tRNA-Val and 16S ribosomal RNA genes, complete
            sequence; mitochondrial
          Length = 1646

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1363 gattgcgctgttatccctggggt 1341

---

>gb|AY528911.1| Pseudantechinus roryi tRNA-Val and 16S ribosomal RNA genes, complete
            sequence; mitochondrial
          Length = 1658

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1374 gattgcgctgttatccctggggt 1352

---

>gb|AY528910.1| Pseudantechinus woolleyae tRNA-Val and 16S ribosomal RNA genes,
            complete sequence; mitochondrial
          Length = 1655

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1370 gattgcgctgttatccctggggt 1348

---

>gb|AY528909.1| Parantechinus bilarni tRNA-Val and 16S ribosomal RNA genes, complete
            sequence; mitochondrial
          Length = 1639

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1355 gattgcgctgttatccctggggt 1333

---

>gb|AY528908.1| Parantechinus apicalis tRNA-Val and 16S ribosomal RNA genes, complete
            sequence; mitochondrial
          Length = 1651

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1362 gattgcgctgttatccctggggt 1340

---

>gb|AY528907.1| Dasykaluta rosamondae tRNA-Val and 16S ribosomal RNA genes, complete
            sequence; mitochondrial
          Length = 1660

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1375 gattgcgctgttatccctggggt 1353

---

>gb|AY528906.1| Phascogale tapoatafa tRNA-Val and 16S ribosomal RNA genes, complete
            sequence; mitochondrial
          Length = 1647

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1359 gattgcgctgttatccctggggt 1337

---

>gb|AY528905.1| Murexia longicaudata tRNA-Val and 16S ribosomal RNA genes, complete
            sequence; mitochondrial
          Length = 1645

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1354 gattgcgctgttatccctggggt 1332

---

>gb|AY528904.1| Antechinus swainsonii tRNA-Val and 16S ribosomal RNA genes, complete
            sequence; mitochondrial
          Length = 1643

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1358 gattgcgctgttatccctggggt 1336

---

>gb|AY857953.1| Epinephelus itajara 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 616

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 484 gattgcgctgttatccctggggt 462

---

>gb|AY857936.1| Megalops atlanticus 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 621

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 489 gattgcgctgttatccctggggt 467

---

>gb|AY561433.1| Ablepharus chernovi voucher NHMC 80.3.79.1 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 438

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 317 gattgcgctgttatccctggggt 295

---

>gb|AY561432.1| Ablepharus budaki voucher NHMC 80.3.131.13 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 487

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 366 gattgcgctgttatccctggggt 344

---

>gb|AY561431.1| Ablepharus budaki voucher NHMC 80.3.131.12 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 487

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 366 gattgcgctgttatccctggggt 344

---

>gb|AY561430.1| Ablepharus budaki voucher NHMC 80.3.131.11 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 487

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 366 gattgcgctgttatccctggggt 344

---

>gb|AY561429.1| Ablepharus budaki voucher NHMC 80.3.131.10 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 487

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 366 gattgcgctgttatccctggggt 344

---

>gb|AY561428.1| Ablepharus budaki voucher NHMC 80.3.131.9 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 487

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 366 gattgcgctgttatccctggggt 344

---

>gb|AY561427.1| Ablepharus budaki voucher NHMC 80.3.131.8 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 487

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 366 gattgcgctgttatccctggggt 344

---

>gb|AY561426.1| Ablepharus budaki voucher NHMC 80.3.131.7 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 487

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 366 gattgcgctgttatccctggggt 344

---

>gb|AY561425.1| Ablepharus budaki voucher NHMC 80.3.131.6 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 487

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 366 gattgcgctgttatccctggggt 344

---

>gb|AY561424.1| Ablepharus budaki voucher NHMC 80.3.131.5 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 487

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 366 gattgcgctgttatccctggggt 344

---

>gb|AY561423.1| Ablepharus budaki voucher NHMC 80.3.131.4 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 487

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 366 gattgcgctgttatccctggggt 344

---

>gb|AY561422.1| Ablepharus budaki voucher NHMC 80.3.131.3 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 487

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 366 gattgcgctgttatccctggggt 344

---

>gb|AY561421.1| Ablepharus budaki voucher NHMC 80.3.131.2 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 487

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 366 gattgcgctgttatccctggggt 344

---

>gb|AY561420.1| Ablepharus budaki voucher NHMC 80.3.131.1 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 487

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 366 gattgcgctgttatccctggggt 344

---

>gb|AY561419.1| Ablepharus kitaibelii voucher NHMC 80.3.82.105 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 509

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 388 gattgcgctgttatccctggggt 366

---

>gb|AY561418.1| Ablepharus kitaibelii voucher NHMC 80.3.82.104 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 509

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 388 gattgcgctgttatccctggggt 366

---

>gb|AY561417.1| Ablepharus kitaibelii voucher NHMC 80.3.82.103 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 509

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 388 gattgcgctgttatccctggggt 366

---

>gb|AY561416.1| Ablepharus kitaibelii voucher NHMC 80.3.82.102 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 509

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 388 gattgcgctgttatccctggggt 366

---

>gb|AY561415.1| Ablepharus kitaibelii voucher NHMC 80.3.82.101 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 509

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 388 gattgcgctgttatccctggggt 366

---

>gb|AY561414.1| Ablepharus kitaibelii voucher NHMC 80.3.82.16 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 448

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 327 gattgcgctgttatccctggggt 305

---

>gb|AY561413.1| Ablepharus kitaibelii voucher NHMC 80.3.82.19 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 448

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 327 gattgcgctgttatccctggggt 305

---

>gb|AY561412.1| Ablepharus kitaibelii voucher NHMC 80.3.82.18 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 448

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 327 gattgcgctgttatccctggggt 305

---

>gb|AY561411.1| Ablepharus kitaibelii voucher NHMC 80.3.82.20 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 448

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 327 gattgcgctgttatccctggggt 305

---

>gb|AY561410.1| Ablepharus kitaibelii voucher NHMC 80.3.82.54 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 453

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 332 gattgcgctgttatccctggggt 310

---

>gb|AY561409.1| Ablepharus kitaibelii voucher NHMC 80.3.82.25 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 453

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 332 gattgcgctgttatccctggggt 310

---

>gb|AY561408.1| Ablepharus kitaibelii voucher NHMC 80.3.82.89 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 487

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 366 gattgcgctgttatccctggggt 344

---

>gb|AY561407.1| Ablepharus kitaibelii voucher NHMC 80.3.82.113 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 487

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 366 gattgcgctgttatccctggggt 344

---

>gb|AY561406.1| Ablepharus kitaibelii voucher NHMC 80.3.82.62 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 442

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 321 gattgcgctgttatccctggggt 299

---

>gb|AY561405.1| Ablepharus kitaibelii voucher NHMC 80.3.82.61 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 442

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 321 gattgcgctgttatccctggggt 299

---

>gb|AY561404.1| Ablepharus kitaibelii voucher NHMC 80.3.82.1 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 442

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 321 gattgcgctgttatccctggggt 299

---

>gb|AY561403.1| Ablepharus kitaibelii voucher NHMC 80.3.82.72 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 445

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 324 gattgcgctgttatccctggggt 302

---

>gb|AY561402.1| Ablepharus kitaibelii voucher NHMC 80.3.82.47 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 445

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 324 gattgcgctgttatccctggggt 302

---

>gb|AY561401.1| Ablepharus kitaibelii voucher NHMC 80.3.82.112 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 445

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 324 gattgcgctgttatccctggggt 302

---

>gb|AY561400.1| Ablepharus kitaibelii voucher NHMC 80.3.82.6 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 442

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 321 gattgcgctgttatccctggggt 299

---

>gb|AY561399.1| Ablepharus kitaibelii voucher NHMC 80.3.82.5 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 442

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 321 gattgcgctgttatccctggggt 299

---

>gb|AY561398.1| Ablepharus kitaibelii voucher NHMC 80.3.82.3 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 486

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 365 gattgcgctgttatccctggggt 343

---

>gb|AY561397.1| Ablepharus kitaibelii voucher NHMC 80.3.82.88 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 486

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 365 gattgcgctgttatccctggggt 343

---

>gb|AY561396.1| Ablepharus kitaibelii voucher NHMC 80.3.82.78 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 486

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 365 gattgcgctgttatccctggggt 343

---

>gb|AY561395.1| Ablepharus kitaibelii voucher NHMC 80.3.82.119 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 486

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 365 gattgcgctgttatccctggggt 343

---

>gb|AY561394.1| Ablepharus kitaibelii voucher NHMC 80.3.82.43 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 485

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 364 gattgcgctgttatccctggggt 342

---

>gb|AY561393.1| Ablepharus kitaibelii voucher NHMC 80.3.82.57 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 485

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 364 gattgcgctgttatccctggggt 342

---

>gb|AY561392.1| Ablepharus kitaibelii voucher NHMC 80.3.82.56 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 485

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 364 gattgcgctgttatccctggggt 342

---

>gb|AY561391.1| Ablepharus kitaibelii voucher NHMC 80.3.82.59 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 485

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 364 gattgcgctgttatccctggggt 342

---

>gb|AY561390.1| Ablepharus kitaibelii voucher NHMC 80.3.82.55 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 485

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 364 gattgcgctgttatccctggggt 342

---

>gb|AY561389.1| Ablepharus kitaibelii voucher NHMC 80.3.82.4 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 484

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 363 gattgcgctgttatccctggggt 341

---

>gb|AY561388.1| Ablepharus kitaibelii voucher NHMC 80.3.82.33 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 458

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 337 gattgcgctgttatccctggggt 315

---

>gb|AY561387.1| Ablepharus kitaibelii voucher NHMC 80.3.82.30 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 435

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 314 gattgcgctgttatccctggggt 292

---

>gb|AY561386.1| Ablepharus kitaibelii voucher NHMC 80.3.82.63 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 486

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 365 gattgcgctgttatccctggggt 343

---

>gb|AY561385.1| Ablepharus kitaibelii voucher NHMC 80.3.82.115 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 486

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 365 gattgcgctgttatccctggggt 343

---

>gb|AY561384.1| Ablepharus kitaibelii voucher NHMC 80.3.82.65 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 486

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 365 gattgcgctgttatccctggggt 343

---

>gb|AY561383.1| Ablepharus kitaibelii voucher NHMC 80.3.82.64 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 486

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 365 gattgcgctgttatccctggggt 343

---

>gb|AY561382.1| Ablepharus kitaibelii voucher NHMC 80.3.82.70 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 459

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 338 gattgcgctgttatccctggggt 316

---

>gb|AY561381.1| Ablepharus kitaibelii voucher NHMC 80.3.82.87 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 460

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 339 gattgcgctgttatccctggggt 317

---

>gb|AY561380.1| Ablepharus kitaibelii voucher NHMC 80.3.82.2 16S ribosomal RNA
           gene, partial sequence; mitochondrial
          Length = 459

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 338 gattgcgctgttatccctggggt 316

---

>gb|AY354473.1| Pseudoeurycea ruficauda isolate 51.9 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 514

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 404 gattgcgctgttatccctggggt 382

---

>gb|AY354472.1| Pseudoeurycea ruficauda isolate 51.8 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 514

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 404 gattgcgctgttatccctggggt 382

---

>gb|AY354471.1| Pseudoeurycea ruficauda isolate 51.7 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 514

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 404 gattgcgctgttatccctggggt 382

---

>gb|AY836585.1| Elops affinis 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 494

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 397 gattgcgctgttatccctggggt 375

---

>gb|AY835657.1| Symphurus atricaudus 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 474

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 406 gattgcgctgttatccctggggt 384

---

>gb|AF302934.1| Lepidosiren paradoxa mitochondrion, complete genome
          Length = 16403

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 2366 gattgcgctgttatccctggggt 2344

---

>gb|AY315526.1| Amphiglossus igneocaudatus isolate E66-5 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 554

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 404 gattgcgctgttatccctggggt 382

---

>gb|AY315525.1| Amphiglossus igneocaudatus isolate E66-4 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 554

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 404 gattgcgctgttatccctggggt 382

---

>gb|AY315524.1| Amphiglossus igneocaudatus 16S ribosomal RNA gene, partial
           sequence; mitochondrial
          Length = 547

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 419 gattgcgctgttatccctggggt 397

---

>gb|AY526215.1| Leptolalax oshanensis voucher ZYC799 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 395

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 363 gattgcgctgttatccctggggt 341

---

>gb|AY561306.1| Leptolalax oshanensis 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 397

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 365 gattgcgctgttatccctggggt 343

---

>gb|AY822076.1| Heterostichus rostratus 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 529

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 397 gattgcgctgttatccctggggt 375

---

>gb|AY822075.1| Gibbonsia elegans 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 526

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 399 gattgcgctgttatccctggggt 377

---

>gb|AY820741.1| Neoclinus blanchardi 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 505

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 378 gattgcgctgttatccctggggt 356

---

>gb|AY820740.1| Chaenopsis alepidota 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 528

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 395 gattgcgctgttatccctggggt 373

---

>gb|AY693488.1| Pseudotylosurus microps isolate N810 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 522

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 412 gattgcgctgttatccctggggt 390

---

>gb|AY693485.1| Strongylura anastomella isolate N75b 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 525

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 415 gattgcgctgttatccctggggt 393

---

>gb|AY693484.1| Strongylura anastomella isolate N75a 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 525

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 415 gattgcgctgttatccctggggt 393

---

>gb|AY693475.1| Pseudotylosurus microps isolate N640 16S ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 522

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 412 gattgcgctgttatccctggggt 390

---

>gb|DQ027926.1| Diapterus auratus 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 545

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 446 gattgcgctgttatccctggggt 424

---

>gb|DQ027922.1| Scomberoides lysan 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 564

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 465 gattgcgctgttatccctggggt 443

---

>gb|DQ027915.1| Antennarius avalonis 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 542

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 443 gattgcgctgttatccctggggt 421

---

>gb|DQ027911.1| Lota lota 16S ribosomal RNA gene, partial sequence; mitochondrial
          Length = 540

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 441 gattgcgctgttatccctggggt 419

---

>gb|DQ027908.1| Lampris guttatus 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 527

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 428 gattgcgctgttatccctggggt 406

---

>gb|DQ027907.1| Velifer hypselopterus 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 545

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 446 gattgcgctgttatccctggggt 424

---

>gb|DQ027906.1| Chlorophthalmus agassizi 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 555

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 456 gattgcgctgttatccctggggt 434

---

>gb|AF215256.1| Rhacodactylus cf. leachianus 16S ribosomal RNA gene, partial
           sequence; mitochondrial
          Length = 548

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 422 gattgcgctgttatccctggggt 400

---

>gb|AF215243.1| Phelsuma standingi 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 518

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 397 gattgcgctgttatccctggggt 375

---

>gb|AY655502.1| Oryzias latipes 16S large subunit ribosomal RNA gene, partial
           sequence; mitochondrial
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 442 gattgcgctgttatccctggggt 420

---

>gb|AY655501.1| Mugil cephalus 16S large subunit ribosomal RNA gene, partial
           sequence; mitochondrial
          Length = 568

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 464 gattgcgctgttatccctggggt 442

---

>gb|AY655498.1| Atherion elymus 16S large subunit ribosomal RNA gene, partial
           sequence; mitochondrial
          Length = 544

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 440 gattgcgctgttatccctggggt 418

---

>gb|AY655497.1| Neostethus bicornis 16S large subunit ribosomal RNA gene, partial
           sequence; mitochondrial
          Length = 541

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 437 gattgcgctgttatccctggggt 415

---

>gb|AY655496.1| Labidesthes sicculus 16S large subunit ribosomal RNA gene, partial
           sequence; mitochondrial
          Length = 549

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 445 gattgcgctgttatccctggggt 423

---

>gb|AY655495.1| Atherinella panamensis 16S large subunit ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 549

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 445 gattgcgctgttatccctggggt 423

---

>gb|AY655492.1| Atherinomorus lacunosus 16S large subunit ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 442 gattgcgctgttatccctggggt 420

---

>gb|AY655490.1| Rhadinocentrus ornatus 16S large subunit ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 441 gattgcgctgttatccctggggt 419

---

>gb|AY655489.1| Chilatherina bleheri 16S large subunit ribosomal RNA gene, partial
           sequence; mitochondrial
          Length = 544

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 440 gattgcgctgttatccctggggt 418

---

>gb|AY098850.1| Tripterygion delaisi from Portugal 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 580

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 473 gattgcgctgttatccctggggt 451

---

>gb|AY098849.1| Tripterygion delaisi from Portugal 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 580

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 473 gattgcgctgttatccctggggt 451

---

>gb|AY098848.1| Labrisomus nuchipinnis isolate 2 from Cape Verde 16S ribosomal RNA
           gene, partial sequence; mitochondrial gene for
           mitochondrial product
          Length = 577

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 471 gattgcgctgttatccctggggt 449

---

>gb|AY098847.1| Labrisomus nuchipinnis isolate 1 from Cape Verde 16S ribosomal RNA
           gene, partial sequence; mitochondrial gene for
           mitochondrial product
          Length = 577

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 471 gattgcgctgttatccctggggt 449

---

>gb|AY098846.1| Ophioblennius atlanticus from Cape Verde 16S ribosomal RNA gene,
           partial sequence; mitochondrial gene for mitochondrial
           product
          Length = 580

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 474 gattgcgctgttatccctggggt 452

---

>gb|AY098845.1| Scartella cristata from Spain 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 574

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 467 gattgcgctgttatccctggggt 445

---

>gb|AY098844.1| Scartella caboverdiana from Cape Verde 16S ribosomal RNA gene,
           partial sequence; mitochondrial gene for mitochondrial
           product
          Length = 574

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 467 gattgcgctgttatccctggggt 445

---

>gb|AY098843.1| Salaria fluviatilis from Portugal 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 574

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 467 gattgcgctgttatccctggggt 445

---

>gb|AY098842.1| Salaria pavo from Lebanon 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 587

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 480 gattgcgctgttatccctggggt 458

---

>gb|AY098841.1| Parablennius zvonimiri isolate 2 from Italy 16S ribosomal RNA gene,
           partial sequence; mitochondrial gene for mitochondrial
           product
          Length = 575

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 468 gattgcgctgttatccctggggt 446

---

>gb|AY098840.1| Parablennius zvonimiri isolate 1 from Italy 16S ribosomal RNA gene,
           partial sequence; mitochondrial gene for mitochondrial
           product
          Length = 575

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 468 gattgcgctgttatccctggggt 446

---

>gb|AY098839.1| Parablennius tentacularis isolate 2 from Italy 16S ribosomal RNA
           gene, partial sequence; mitochondrial gene for
           mitochondrial product
          Length = 566

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 469 gattgcgctgttatccctggggt 447

---

>gb|AY098838.1| Parablennius tentacularis isolate 1 from Italy 16S ribosomal RNA
           gene, partial sequence; mitochondrial gene for
           mitochondrial product
          Length = 576

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 469 gattgcgctgttatccctggggt 447

---

>gb|AY098837.1| Parablennius sanguinolentus isolate 1 from Portugal 16S ribosomal
           RNA gene, partial sequence; mitochondrial gene for
           mitochondrial product
          Length = 575

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 468 gattgcgctgttatccctggggt 446

---

>gb|AY098836.1| Parablennius salensis from Cape Verde 16S ribosomal RNA gene,
           partial sequence; mitochondrial gene for mitochondrial
           product
          Length = 575

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 469 gattgcgctgttatccctggggt 447

---

>gb|AY098835.1| Parablennius gattorugine from Greece 16S ribosomal RNA gene,
           partial sequence; mitochondrial gene for mitochondrial
           product
          Length = 576

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 469 gattgcgctgttatccctggggt 447

---

>gb|AY098834.1| Parablennius ruber from Portugal 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 575

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 468 gattgcgctgttatccctggggt 446

---

>gb|AY098833.1| Parablennius rouxi from Spain 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 576

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 470 gattgcgctgttatccctggggt 448

---

>gb|AY098832.1| Parablennius rouxi from Italy 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 566

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 469 gattgcgctgttatccctggggt 447

---

>gb|AY098831.1| Parablennius pilicornis from Portugal 16S ribosomal RNA gene,
           partial sequence; mitochondrial gene for mitochondrial
           product
          Length = 576

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 469 gattgcgctgttatccctggggt 447

---

>gb|AY098830.1| Parablennius incognitus from Portugal 16S ribosomal RNA gene,
           partial sequence; mitochondrial gene for mitochondrial
           product
          Length = 575

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 468 gattgcgctgttatccctggggt 446

---

>gb|AY098829.1| Parablennius incognitus from Portugal 16S ribosomal RNA gene,
           partial sequence; mitochondrial gene for mitochondrial
           product
          Length = 576

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 469 gattgcgctgttatccctggggt 447

---

>gb|AY098828.1| Lipophrys trigloides from Portugal 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 576

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 468 gattgcgctgttatccctggggt 446

---

>gb|AY098827.1| Lipophrys trigloides from Portugal 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 576

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 468 gattgcgctgttatccctggggt 446

---

>gb|AY098826.1| Lipophrys trigloides from Greece 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 576

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 468 gattgcgctgttatccctggggt 446

---

>gb|AY098825.1| Lipophrys pholis from United Kingdom 16S ribosomal RNA gene,
           partial sequence; mitochondrial gene for mitochondrial
           product
          Length = 576

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 468 gattgcgctgttatccctggggt 446

---

>gb|AY098824.1| Lipophrys nigriceps from Spain 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 575

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 468 gattgcgctgttatccctggggt 446

---

>gb|AY098823.1| Lipophrys dalmatinus from Greece 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 576

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 469 gattgcgctgttatccctggggt 447

---

>gb|AY098822.1| Lipophrys caboverdensis from Cape Verde 16S ribosomal RNA gene,
           partial sequence; mitochondrial gene for mitochondrial
           product
          Length = 575

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 468 gattgcgctgttatccctggggt 446

---

>gb|AY098821.1| Lipophrys canevae from Croatia 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 575

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 468 gattgcgctgttatccctggggt 446

---

>gb|AY098820.1| Lipophrys adriaticus from Croatia 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 576

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 469 gattgcgctgttatccctggggt 447

---

>gb|AY098819.1| Coryphoblennius galerita from United Kingdom 16S ribosomal RNA
           gene, partial sequence; mitochondrial gene for
           mitochondrial product
          Length = 577

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 468 gattgcgctgttatccctggggt 446

---

>gb|AY098818.1| Coryphoblennius galerita from Croatia 16S ribosomal RNA gene,
           partial sequence; mitochondrial gene for mitochondrial
           product
          Length = 577

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 468 gattgcgctgttatccctggggt 446

---

>gb|AY098817.1| Coryphoblennius galerita from Portugal 16S ribosomal RNA gene,
           partial sequence; mitochondrial gene for mitochondrial
           product
          Length = 577

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 468 gattgcgctgttatccctggggt 446

---

>gb|AY098816.1| Coryphoblennius galerita from Portugal 16S ribosomal RNA gene,
           partial sequence; mitochondrial gene for mitochondrial
           product
          Length = 576

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 467 gattgcgctgttatccctggggt 445

---

>gb|AY098815.1| Blennius ocellaris from Greece 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 578

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 471 gattgcgctgttatccctggggt 449

---

>gb|AY098814.1| Aidablennius sphynx from Italy 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 577

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 470 gattgcgctgttatccctggggt 448

---

>gb|AY266085.1| Menidia menidia 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 549

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 445 gattgcgctgttatccctggggt 423

---

>gb|AY266084.1| Atherinops affinis 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 549

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 445 gattgcgctgttatccctggggt 423

---

>gb|AY266083.1| Pseudomugil gertrudae 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 543

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 439 gattgcgctgttatccctggggt 417

---

>gb|AY266082.1| Cairnsichthys rhombosomoides 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 547

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 443 gattgcgctgttatccctggggt 421

---

>gb|AY266081.1| Melanotaenia praecox 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 543

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 439 gattgcgctgttatccctggggt 417

---

>gb|AY266080.1| Glossolepis incisus 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 544

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 440 gattgcgctgttatccctggggt 418

---

>gb|AY266079.1| Iriatherina werneri 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 544

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 440 gattgcgctgttatccctggggt 418

---

>gb|AY266078.1| Atherinomorus sp. WLS-2003 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 562

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 458 gattgcgctgttatccctggggt 436

---

>gb|AY266077.1| Teramulus waterloti 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 550

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 446 gattgcgctgttatccctggggt 424

---

>gb|AY266076.1| Atherina hepsetus 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 549

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 445 gattgcgctgttatccctggggt 423

---

>gb|AY266075.1| Iso rhothophilus 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 547

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 443 gattgcgctgttatccctggggt 421

---

>gb|AY266073.1| Rheocles vatosoa 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 547

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 443 gattgcgctgttatccctggggt 421

---

>gb|AY266072.1| Rheocles lateralis 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 545

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 441 gattgcgctgttatccctggggt 419

---

>gb|AY266071.1| Rheocles derhami 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 442 gattgcgctgttatccctggggt 420

---

>gb|AY266070.1| Rheocles alaotrensis 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 545

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 441 gattgcgctgttatccctggggt 419

---

>gb|AY266069.1| Rheocles wrightae 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 442 gattgcgctgttatccctggggt 420

---

>gb|AY266068.1| Bedotia longianalis isolate 2 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 442 gattgcgctgttatccctggggt 420

---

>gb|AY266067.1| Bedotia sp. 'Mahanara' 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 442 gattgcgctgttatccctggggt 420

---

>gb|AY266066.1| Bedotia sp. 'Karianga' 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 442 gattgcgctgttatccctggggt 420

---

>gb|AY266065.1| Bedotia geayi 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 442 gattgcgctgttatccctggggt 420

---

>gb|AY266064.1| Bedotia sp. 'Betampona' 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 442 gattgcgctgttatccctggggt 420

---

>gb|AY266063.1| Bedotia masoala 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 442 gattgcgctgttatccctggggt 420

---

>gb|AY266062.1| Bedotia sp. 'Vevembe' 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 442 gattgcgctgttatccctggggt 420

---

>gb|AY266061.1| Bedotia sp. 'Manombo' 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 442 gattgcgctgttatccctggggt 420

---

>gb|AY266060.1| Bedotia madagascariensis 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 442 gattgcgctgttatccctggggt 420

---

>gb|AY266059.1| Bedotia sp. 'Sambava' 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 442 gattgcgctgttatccctggggt 420

---

>gb|AY266058.1| Bedotia marojejy 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 442 gattgcgctgttatccctggggt 420

---

>gb|AY266057.1| Bedotia sp. 'Antalaha' 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 442 gattgcgctgttatccctggggt 420

---

>gb|AY266056.1| Bedotia sp. 'Ranomafana' 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 442 gattgcgctgttatccctggggt 420

---

>gb|AY266055.1| Bedotia longianalis isolate 1 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 442 gattgcgctgttatccctggggt 420

---

>gb|AY266054.1| Bedotia sp. 'Beforana' 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 382

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 278 gattgcgctgttatccctggggt 256

---

>gb|AY266053.1| Bedotia sp. 'Ivoloina' 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 545

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 441 gattgcgctgttatccctggggt 419

---

>gb|AY770545.1| Caretta caretta 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 576

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 459 gattgcgctgttatccctggggt 437

---

>gb|AY770544.1| Chelonia mydas 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 590

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 457 gattgcgctgttatccctggggt 435

---

>gb|AY958668.1| Syngnathus exilis 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 514

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 416 gattgcgctgttatccctggggt 394

---

>gb|AY462535.1| Oryzias marmoratus haplotype 2 16S ribosomal RNA gene, partial
           sequence; mitochondrial
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 435 gattgcgctgttatccctggggt 413

---

>gb|AY462534.1| Oryzias marmoratus haplotype 1 16S ribosomal RNA gene, partial
           sequence; mitochondrial
          Length = 546

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 435 gattgcgctgttatccctggggt 413

---

>gb|AF416699.1| Bolitoglossa zapoteca specimen-voucher GP 522 clone OAX_18S 16S
           ribosomal RNA gene, partial sequence; mitochondrial gene
           for mitochondrial product
          Length = 516

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 406 gattgcgctgttatccctggggt 384

---

>gb|AF416698.1| Bolitoglossa zapoteca specimen-voucher GP 522 clone OAX_17S 16S
           ribosomal RNA gene, partial sequence; mitochondrial gene
           for mitochondrial product
          Length = 516

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 406 gattgcgctgttatccctggggt 384

---

>gb|AF416697.1| Bolitoglossa subpalmata specimen-voucher MVZ 229172 16S ribosomal
           RNA gene, partial sequence; mitochondrial gene for
           mitochondrial product
          Length = 515

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 405 gattgcgctgttatccctggggt 383

---

>gb|AF416696.1| Bolitoglossa riletti specimen-voucher MVZ 194328 16S ribosomal RNA
           gene, partial sequence; mitochondrial gene for
           mitochondrial product
          Length = 515

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 405 gattgcgctgttatccctggggt 383

---

>gb|AF416695.1| Bolitoglossa riletti specimen-voucher MVZ 146778 16S ribosomal RNA
           gene, partial sequence; mitochondrial gene for
           mitochondrial product
          Length = 515

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 405 gattgcgctgttatccctggggt 383

---

>gb|AF416694.1| Bolitoglossa riletti specimen-voucher MVZ 146767 16S ribosomal RNA
           gene, partial sequence; mitochondrial gene for
           mitochondrial product
          Length = 515

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 405 gattgcgctgttatccctggggt 383

---

>gb|AF416693.1| Bolitoglossa riletti specimen-voucher MVZ 146777 16S ribosomal RNA
           gene, partial sequence; mitochondrial gene for
           mitochondrial product
          Length = 515

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 405 gattgcgctgttatccctggggt 383

---

>gb|AF416692.1| Bolitoglossa riletti specimen-voucher MVZ 146775 16S ribosomal RNA
           gene, partial sequence; mitochondrial gene for
           mitochondrial product
          Length = 515

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 405 gattgcgctgttatccctggggt 383

---

>gb|AF416691.1| Bolitoglossa riletti specimen-voucher MVZ 146774 16S ribosomal RNA
           gene, partial sequence; mitochondrial gene for
           mitochondrial product
          Length = 515

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 405 gattgcgctgttatccctggggt 383

---

>gb|AF416690.1| Bolitoglossa oaxacensis specimen-voucher GP 382 16S ribosomal RNA
           gene, partial sequence; mitochondrial gene for
           mitochondrial product
          Length = 515

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 405 gattgcgctgttatccctggggt 383

---

>gb|AF416689.1| Bolitoglossa macrinii specimen-voucher GP 384 16S ribosomal RNA
           gene, partial sequence; mitochondrial gene for
           mitochondrial product
          Length = 515

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 405 gattgcgctgttatccctggggt 383

---

>gb|AF416688.1| Bolitoglossa macrinii specimen-voucher MVZ 158524 16S ribosomal RNA
           gene, partial sequence; mitochondrial gene for
           mitochondrial product
          Length = 515

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 405 gattgcgctgttatccctggggt 383

---

>gb|AF416687.1| Bolitoglossa macrinii specimen-voucher MVZ 158523 16S ribosomal RNA
           gene, partial sequence; mitochondrial gene for
           mitochondrial product
          Length = 472

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 405 gattgcgctgttatccctggggt 383

---

>gb|AF416686.1| Bolitoglossa hermosa specimen-voucher MVZ 143804 clone OAX_2S 16S
           ribosomal RNA gene, partial sequence; mitochondrial gene
           for mitochondrial product
          Length = 516

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 406 gattgcgctgttatccctggggt 384

---

>gb|AF416685.1| Bolitoglossa hermosa specimen-voucher MVZ 143804 clone OAX_1S 16S
           ribosomal RNA gene, partial sequence; mitochondrial gene
           for mitochondrial product
          Length = 516

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 406 gattgcgctgttatccctggggt 384

---

>gb|AF420043.1| Semnopithecus entellus 12S ribosomal RNA gene, partial sequence;
            tRNA-Val gene, complete sequence; and 16S ribosomal RNA
            gene, partial sequence; mitochondrial
          Length = 1620

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1529 gattgcgctgttatccctggggt 1507

---

>gb|AF420042.1| Pygathrix nemaeus 12S ribosomal RNA gene, partial sequence; tRNA-Val
            gene, complete sequence; and 16S ribosomal RNA gene,
            partial sequence; mitochondrial
          Length = 1617

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1526 gattgcgctgttatccctggggt 1504

---

>gb|AY743418.1| Palea steindachneri 16S ribosomal RNA gene, complete sequence;
            mitochondrial
          Length = 1607

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 1319 gattgcgctgttatccctggggt 1297

---

>gb|AY293619.1| Larus dominicanus mitochondrion, complete genome
          Length = 16701

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 2417 gattgcgctgttatccctggggt 2395

---

>gb|AF366350.1| Dogania subplana mitochondrion, complete genome
          Length = 17289

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 2425 gattgcgctgttatccctggggt 2403

---

>gb|AY605476.1| Geocalamus acutus voucher MVZ 232838 mitochondrion, complete genome
          Length = 16659

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 2301 gattgcgctgttatccctggggt 2279

---

>gb|AY605475.1| Amphisbaena schmidti voucher MVZ 232754 mitochondrion, complete
            genome
          Length = 17423

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 2325 gattgcgctgttatccctggggt 2303

---

>gb|AY605474.1| Diplometopon zarudnyi voucher MVZ 234273 mitochondrion, complete
            genome
          Length = 16730

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 2290 gattgcgctgttatccctggggt 2268

---

>gb|AF362763.1| Eudyptula minor mitochondrion, complete genome
          Length = 17611

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 2431 gattgcgctgttatccctggggt 2409

---

>gb|AY254568.1| Micropterus salmoides 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 507

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 416 gattgcgctgttatccctggggt 394

---

>gb|AY254559.1| Maccullochella peelii peelii 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 515

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 424 gattgcgctgttatccctggggt 402

---

>gb|AY254558.1| Maccullochella macquariensis 16S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 517

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 426 gattgcgctgttatccctggggt 404

---

>gb|AY254557.1| Maccullochella ikei 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 515

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 424 gattgcgctgttatccctggggt 402

---

>gb|AY728235.1| Bolitoglossa n. sp. RLM-2004 mitochondrion, complete genome
          Length = 21657

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 2258 gattgcgctgttatccctggggt 2236

---

>gb|AY728232.1| Plethodon cinereus mitochondrion, complete genome
          Length = 20001

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 2257 gattgcgctgttatccctggggt 2235

---

>gb|AY728229.1| Nototriton abscondens mitochondrion, partial genome
          Length = 17687

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 4531 gattgcgctgttatccctggggt 4509

---

>gb|AY728226.1| Aneides hardii mitochondrion, complete genome
          Length = 22184

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 2307 gattgcgctgttatccctggggt 2285

---

>gb|AY728224.1| Thorius n. sp. RLM-2004 mitochondrion, complete genome
          Length = 19097

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 2271 gattgcgctgttatccctggggt 2249

---

>gb|AY728223.1| Plethodon elongatus mitochondrion, complete genome
          Length = 18767

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 2291 gattgcgctgttatccctggggt 2269

---

>gb|AY728214.1| Aneides flavipunctatus mitochondrion, complete genome
          Length = 20197

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 2274 gattgcgctgttatccctggggt 2252

---

>gb|AY728213.1| Oedipina poelzi mitochondrion, complete genome
          Length = 16731

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 2260 gattgcgctgttatccctggggt 2238

---

>gb|AY504839.1| Notopterus notopterus 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 608

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 493 gattgcgctgttatccctggggt 471

---

>gb|AY504837.1| Heterotis niloticus 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 607

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 491 gattgcgctgttatccctggggt 469

---

>gb|AY504836.1| Papyrocranus afer 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 611

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 495 gattgcgctgttatccctggggt 473

---

>gb|AY504834.1| Arapaima gigas 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 595

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 479 gattgcgctgttatccctggggt 457

---

>gb|AY504832.1| Scleropages leichardti 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 602

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 486 gattgcgctgttatccctggggt 464

---

>gb|AY504830.1| Osteoglossum bicirrhosum 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 579

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 463 gattgcgctgttatccctggggt 441

---

>gb|AY430243.1| Menidia menidia 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 391

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 376 gattgcgctgttatccctggggt 354

---

>gb|AY430242.1| Sargocentron punctatissimum 16S ribosomal RNA gene, partial
           sequence; mitochondrial
          Length = 391

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 376 gattgcgctgttatccctggggt 354

---

>gb|AY430232.1| Pellona flavipinnis 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 387

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 372 gattgcgctgttatccctggggt 350

---

>gb|AY443574.1| Esox americanus 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 371

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 371 gattgcgctgttatccctggggt 349

---

>gb|AY443573.1| Esox niger 16S ribosomal RNA gene, partial sequence; mitochondrial
          Length = 371

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 371 gattgcgctgttatccctggggt 349

---

>gb|AY605473.1| Rhineura floridana voucher MVZ 233342 mitochondrion, complete genome
          Length = 16988

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 30   gattgcgctgttatccctggggt 52
            |||||||||||||||||||||||
Sbjct: 2380 gattgcgctgttatccctggggt 2358

---

>gb|AY359669.1| Cynoglossus cynoglossus 16S large subunit ribosomal RNA gene,
           partial sequence; mitochondrial
          Length = 591

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 468 gattgcgctgttatccctggggt 446

---

>gb|AY359668.1| Symphurus tessellatus 16S large subunit ribosomal RNA gene, partial
           sequence; mitochondrial
          Length = 584

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 458 gattgcgctgttatccctggggt 436

---

>gb|AY359656.1| Citharichthys macrops 16S large subunit ribosomal RNA gene, partial
           sequence; mitochondrial
          Length = 596

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 470 gattgcgctgttatccctggggt 448

---

>gb|AY359654.1| Etropus crossotus 16S large subunit ribosomal RNA gene, partial
           sequence; mitochondrial
          Length = 585

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 460 gattgcgctgttatccctggggt 438

---

>gb|AY365123.1| Pomacentrus coelestis 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 591

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 478 gattgcgctgttatccctggggt 456

---

>gb|AY365122.1| Pomacentrus bankanensis 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 618

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 503 gattgcgctgttatccctggggt 481

---

>gb|AY365121.1| Chromis fumea 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 592

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 480 gattgcgctgttatccctggggt 458

---

>gb|AY365120.1| Abudefduf vaigiensis 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 588

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 474 gattgcgctgttatccctggggt 452

---

>gb|AY530874.1| Pomacanthus zonipectus 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 541

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 85  gattgcgctgttatccctggggt 107

---

>gb|AY530868.1| Pomacanthus arcuatus 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 544

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 85  gattgcgctgttatccctggggt 107

---

>gb|AY530867.1| Holacanthus bermudensis 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 537

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 85  gattgcgctgttatccctggggt 107

---

>gb|AY530864.1| Holacanthus tricolor 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 535

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 85  gattgcgctgttatccctggggt 107

---

>gb|AY530863.1| Centropyge potteri 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 538

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 30  gattgcgctgttatccctggggt 52
           |||||||||||||||||||||||
Sbjct: 86  gattgcgctgttatccctggggt 108


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,270,109
Number of Sequences: 3902068
Number of extensions: 5270109
Number of successful extensions: 116085
Number of sequences better than 10.0: 2980
Number of HSP's better than 10.0 without gapping: 2980
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 113024
Number of HSP's gapped (non-prelim): 3060
length of query: 565
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 542
effective length of database: 17,143,297,704
effective search space: 9291667355568
effective search space used: 9291667355568
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---