Clone Name | rbasd11k03 |
---|---|
Clone Library Name | barley_pub |
>gb|DQ285630.1| Oryza sativa (indica cultivar-group) putative nitrate-induced NOI protein (75-1-127BAC12.1), putative NBS-LRR disease resistance protein (Nbs1-Pi9), putative NBS-LRR disease resistance protein (Nbs3-Pi9), and NBS-LRR disease resistance protein (Pi9) genes, complete cds; putative NBS-LRR disease resistance protein (Nbs4-Pi9) pseudogene, complete sequence; putative NBS-LRR disease resistance protein (Nbs5-Pi9) gene, complete cds; putative NBS-LRR disease resistance protein (Nbs6-Pi9) gene, partial cds; and solo-long terminal repeat retrotransposon, complete sequence Length = 76272 Score = 220 bits (111), Expect = 4e-54 Identities = 165/183 (90%) Strand = Plus / Minus Query: 411 ttggtggcataagattccaccctctcagtcctggcgtctttgcaaggggattcagtatct 470 |||| |||||| |||||||||||||||||||| | |||||||| || || ||||||||| Sbjct: 12561 ttgggggcatatgattccaccctctcagtcctagtctctttgcagggtgaatcagtatct 12502 Query: 471 tgtccattcccagcctttttctcatccctggctttgttgaatataactgtgaatccatca 530 || ||||||||| ||||||||||||| ||||||||||||||||| ||||||||||||||| Sbjct: 12501 tgcccattcccaccctttttctcatctctggctttgttgaatatcactgtgaatccatca 12442 Query: 531 gcagaagctgggtcgttgacgtcccattcgccaaacttgggcaaagggcgaccagattcc 590 |||||||||||||||||||| |||||||| |||||||||||||| || ||||| | |||| Sbjct: 12441 gcagaagctgggtcgttgacatcccattcaccaaacttgggcaagggtcgacctgcttcc 12382 Query: 591 tcc 593 ||| Sbjct: 12381 tcc 12379 Score = 79.8 bits (40), Expect = 1e-11 Identities = 40/40 (100%) Strand = Plus / Minus Query: 266 tacaaggtcttatggatagtatgtatatagcaaaattaaa 305 |||||||||||||||||||||||||||||||||||||||| Sbjct: 12827 tacaaggtcttatggatagtatgtatatagcaaaattaaa 12788 Score = 71.9 bits (36), Expect = 3e-09 Identities = 79/92 (85%), Gaps = 1/92 (1%) Strand = Plus / Minus Query: 143 agaattacaatcagaagttcacttatccaaacgagtgtctggcaaccctcacaccataca 202 ||||||||||||||||||||| |||||| || | | |||| |||||||||| |||||| Sbjct: 12949 agaattacaatcagaagttcatttatccgaatgtgcatctgataaccctcaca-cataca 12891 Query: 203 tacaaacacttcagagttttacgagataccca 234 |||| |||| ||||||||||| ||||| |||| Sbjct: 12890 tacacacacctcagagttttaagagatgccca 12859 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 356 tcaagattgtgtaggacttggcgtcacgcagcaaaaccacttctt 400 |||||||||||||||||| | ||||| ||||||||||| ||||| Sbjct: 12751 tcaagattgtgtaggactggatgtcacacagcaaaaccatttctt 12707
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 208 bits (105), Expect = 2e-50 Identities = 168/189 (88%) Strand = Plus / Minus Query: 405 tttgccttggtggcataagattccaccctctcagtcctggcgtctttgcaaggggattca 464 |||| ||||| |||||| |||||||||||||||||||| | |||||||| || || ||| Sbjct: 10218097 tttgtcttgggggcatatgattccaccctctcagtcctagtttctttgcagggtgaatca 10218038 Query: 465 gtatcttgtccattcccagcctttttctcatccctggctttgttgaatataactgtgaat 524 |||||||| ||||||||| ||||||||||||| ||||||||||||||||| ||||||||| Sbjct: 10218037 gtatcttgcccattcccaccctttttctcatctctggctttgttgaatatcactgtgaat 10217978 Query: 525 ccatcagcagaagctgggtcgttgacgtcccattcgccaaacttgggcaaagggcgacca 584 |||||||| || |||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 10217977 ccatcagcggacgctgggtcgttgacatcccattcaccaaacttgggcaagggacgacct 10217918 Query: 585 gattcctcc 593 | ||||||| Sbjct: 10217917 gcttcctcc 10217909 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 269 aaggtcttatggatagtatgtatatagcaaaattaaa 305 ||||||||||||||||||||||||||||||||||||| Sbjct: 10218354 aaggtcttatggatagtatgtatatagcaaaattaaa 10218318 Score = 63.9 bits (32), Expect = 6e-07 Identities = 78/92 (84%), Gaps = 1/92 (1%) Strand = Plus / Minus Query: 143 agaattacaatcagaagttcacttatccaaacgagtgtctggcaaccctcacaccataca 202 ||||||||||||||||||||| |||||| || | | |||| |||||||||| |||||| Sbjct: 10218479 agaattacaatcagaagttcatttatccgaatgtgcatctgataaccctcaca-cataca 10218421 Query: 203 tacaaacacttcagagttttacgagataccca 234 |||| |||| ||| ||||||| ||||| |||| Sbjct: 10218420 tacacacacctcaaagttttaagagatgccca 10218389 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 356 tcaagattgtgtaggacttggcgtcacgcagcaaaaccacttctt 400 |||||||||||||||||| | ||||||||||||||||| ||||| Sbjct: 10218281 tcaagattgtgtaggactggatgtcacgcagcaaaaccatttctt 10218237
>dbj|AP005659.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0649C11 Length = 138870 Score = 208 bits (105), Expect = 2e-50 Identities = 168/189 (88%) Strand = Plus / Minus Query: 405 tttgccttggtggcataagattccaccctctcagtcctggcgtctttgcaaggggattca 464 |||| ||||| |||||| |||||||||||||||||||| | |||||||| || || ||| Sbjct: 22324 tttgtcttgggggcatatgattccaccctctcagtcctagtttctttgcagggtgaatca 22265 Query: 465 gtatcttgtccattcccagcctttttctcatccctggctttgttgaatataactgtgaat 524 |||||||| ||||||||| ||||||||||||| ||||||||||||||||| ||||||||| Sbjct: 22264 gtatcttgcccattcccaccctttttctcatctctggctttgttgaatatcactgtgaat 22205 Query: 525 ccatcagcagaagctgggtcgttgacgtcccattcgccaaacttgggcaaagggcgacca 584 |||||||| || |||||||||||||| |||||||| |||||||||||||| || ||||| Sbjct: 22204 ccatcagcggacgctgggtcgttgacatcccattcaccaaacttgggcaagggacgacct 22145 Query: 585 gattcctcc 593 | ||||||| Sbjct: 22144 gcttcctcc 22136 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 269 aaggtcttatggatagtatgtatatagcaaaattaaa 305 ||||||||||||||||||||||||||||||||||||| Sbjct: 22581 aaggtcttatggatagtatgtatatagcaaaattaaa 22545 Score = 63.9 bits (32), Expect = 6e-07 Identities = 78/92 (84%), Gaps = 1/92 (1%) Strand = Plus / Minus Query: 143 agaattacaatcagaagttcacttatccaaacgagtgtctggcaaccctcacaccataca 202 ||||||||||||||||||||| |||||| || | | |||| |||||||||| |||||| Sbjct: 22706 agaattacaatcagaagttcatttatccgaatgtgcatctgataaccctcaca-cataca 22648 Query: 203 tacaaacacttcagagttttacgagataccca 234 |||| |||| ||| ||||||| ||||| |||| Sbjct: 22647 tacacacacctcaaagttttaagagatgccca 22616 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 356 tcaagattgtgtaggacttggcgtcacgcagcaaaaccacttctt 400 |||||||||||||||||| | ||||||||||||||||| ||||| Sbjct: 22508 tcaagattgtgtaggactggatgtcacgcagcaaaaccatttctt 22464
>gb|AY104853.1| Zea mays PCO142365 mRNA sequence Length = 1031 Score = 167 bits (84), Expect = 6e-38 Identities = 159/184 (86%) Strand = Plus / Minus Query: 417 gcataagattccaccctctcagtcctggcgtctttgcaaggggattcagtatcttgtcca 476 |||||||||||||||||||||||||||| ||| ||| |||| || ||||| |||||||| Sbjct: 538 gcataagattccaccctctcagtcctggtgtccttggaaggtgactcagtgtcttgtccg 479 Query: 477 ttcccagcctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaa 536 |||||| |||| ||||| || ||||||||||||||||| || |||||||| || |||||| Sbjct: 478 ttcccacccttcttctcgtctctggctttgttgaatatgacagtgaatccgtctgcagaa 419 Query: 537 gctgggtcgttgacgtcccattcgccaaacttgggcaaagggcgaccagattcctccgac 596 ||||| || || || ||||| ||||||||||| ||||| ||||| || |||||||||| | Sbjct: 418 gctggatcattaacatcccaatcgccaaactttggcaaggggcggcctgattcctccgcc 359 Query: 597 atgg 600 |||| Sbjct: 358 atgg 355 Score = 44.1 bits (22), Expect = 0.57 Identities = 73/90 (81%) Strand = Plus / Plus Query: 347 ttgtcctcctcaagattgtgtaggacttggcgtcacgcagcaaaaccacttctttgaatt 406 ||||| |||||| ||||| ||||| || | ||||| || |||||||| ||||||| | Sbjct: 203 ttgtcttcctcaggattgcgtagggctggctgtcacacaacaaaaccatttctttgtgct 262 Query: 407 tgccttggtggcataagattccaccctctc 436 || ||| | |||||||||||||||||||| Sbjct: 263 tggctttgcagcataagattccaccctctc 292 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Minus Query: 190 ctcacaccatacatacaaacacttcagagttttacgagata 230 ||||||||||||||||| ||| |||||||||||||||| Sbjct: 748 ctcacaccatacatacacgcacgcaagagttttacgagata 708 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 272 gtcttatggatagtatgtata 292 ||||||||||||||||||||| Sbjct: 666 gtcttatggatagtatgtata 646 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 272 gtcttatggatagtatgtata 292 ||||||||||||||||||||| Sbjct: 145 gtcttatggatagtatgtata 165 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Plus Query: 190 ctcacaccatacatacaaacacttcagagttttacgagata 230 ||||||||||||||||| ||| |||||||||||||||| Sbjct: 75 ctcacaccatacatacacgcacgcaagagttttacgagata 115
>gb|AF045033.1|AF045033 Zea mays nitrate-induced NOI protein mRNA, complete cds Length = 612 Score = 147 bits (74), Expect = 5e-32 Identities = 158/186 (84%) Strand = Plus / Minus Query: 417 gcataagattccaccctctcagtcctggcgtctttgcaaggggattcagtatcttgtcca 476 |||||||| ||||||||||||||||||| ||| ||| |||| || || || ||||| ||| Sbjct: 335 gcataagactccaccctctcagtcctggggtccttggaaggtgagtctgtgtcttgacca 276 Query: 477 ttcccagcctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaa 536 |||||| |||| |||||||| ||||||||||||||||| || || ||||| || || ||| Sbjct: 275 ttcccacccttcttctcatctctggctttgttgaatatgacagtaaatccgtctgcggaa 216 Query: 537 gctgggtcgttgacgtcccattcgccaaacttgggcaaagggcgaccagattcctccgac 596 || || |||||||| |||||||| |||||||| ||||| || || || |||||||||| | Sbjct: 215 gccggatcgttgacatcccattcaccaaactttggcaagggacggcctgattcctccgcc 156 Query: 597 atggat 602 |||||| Sbjct: 155 atggat 150 Score = 44.1 bits (22), Expect = 0.57 Identities = 35/38 (92%), Gaps = 1/38 (2%) Strand = Plus / Minus Query: 255 tgggtacctcttacaaggtcttatggatagtatgtata 292 ||||||||||| ||| ||||||||||||||||||||| Sbjct: 477 tgggtacctct-acagtgtcttatggatagtatgtata 441
>gb|AF030385.1|AF030385 Zea mays nitrate-induced NOI protein gene, complete cds Length = 5278 Score = 137 bits (69), Expect = 5e-29 Identities = 150/177 (84%) Strand = Plus / Minus Query: 417 gcataagattccaccctctcagtcctggcgtctttgcaaggggattcagtatcttgtcca 476 |||||||| ||||||||||||||||||| ||| ||| |||| || || || ||||| ||| Sbjct: 4352 gcataagactccaccctctcagtcctggggtccttggaaggtgagtctgtgtcttgacca 4293 Query: 477 ttcccagcctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaa 536 |||||| |||| |||||||| ||||||||||||||||| || || ||||| || || ||| Sbjct: 4292 ttcccacccttcttctcatctctggctttgttgaatatgacagtaaatccgtctgcggaa 4233 Query: 537 gctgggtcgttgacgtcccattcgccaaacttgggcaaagggcgaccagattcctcc 593 || || |||||||| |||||||| |||||||| ||||| || || || ||||||||| Sbjct: 4232 gccggatcgttgacatcccattcaccaaactttggcaagggacggcctgattcctcc 4176 Score = 44.1 bits (22), Expect = 0.57 Identities = 35/38 (92%), Gaps = 1/38 (2%) Strand = Plus / Minus Query: 255 tgggtacctcttacaaggtcttatggatagtatgtata 292 ||||||||||| ||| ||||||||||||||||||||| Sbjct: 4719 tgggtacctct-acagtgtcttatggatagtatgtata 4683
>emb|CR962136.2| Medicago truncatula chromosome 5 clone mth2-52n22, COMPLETE SEQUENCE Length = 87738 Score = 87.7 bits (44), Expect = 4e-14 Identities = 74/84 (88%) Strand = Plus / Plus Query: 485 ctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtc 544 ||||||||||||||| |||||||| || || |||||| | || ||||| |||||||| || Sbjct: 58114 ctttttctcatccctagctttgttaaaaatcactgtgtaaccttcagctgaagctggatc 58173 Query: 545 gttgacgtcccattcgccaaactt 568 |||||| ||||||||||||||||| Sbjct: 58174 gttgacatcccattcgccaaactt 58197
>emb|CR931742.1| Medicago truncatula chromosome 5 clone mth2-28i20, COMPLETE SEQUENCE Length = 115743 Score = 87.7 bits (44), Expect = 4e-14 Identities = 74/84 (88%) Strand = Plus / Plus Query: 485 ctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtc 544 ||||||||||||||| |||||||| || || |||||| | || ||||| |||||||| || Sbjct: 22643 ctttttctcatccctagctttgttaaaaatcactgtgtaaccttcagctgaagctggatc 22702 Query: 545 gttgacgtcccattcgccaaactt 568 |||||| ||||||||||||||||| Sbjct: 22703 gttgacatcccattcgccaaactt 22726
>gb|AC161106.13| Medicago truncatula clone mth2-168f23, complete sequence Length = 94766 Score = 79.8 bits (40), Expect = 1e-11 Identities = 79/92 (85%) Strand = Plus / Minus Query: 486 tttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtcg 545 ||||||||||| ||||| |||||||||||||| |||||||| ||||| || || || || Sbjct: 82223 tttttctcatctctggccttgttgaatataacagtgaatccttcagctgatgcaggatca 82164 Query: 546 ttgacgtcccattcgccaaacttgggcaaagg 577 || || |||||||| ||||||||||| ||||| Sbjct: 82163 ttcacatcccattccccaaacttgggtaaagg 82132
>dbj|AK059360.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-026-D12, full insert sequence Length = 303 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 269 aaggtcttatggatagtatgtatatagcaaaattaaa 305 ||||||||||||||||||||||||||||||||||||| Sbjct: 107 aaggtcttatggatagtatgtatatagcaaaattaaa 71 Score = 63.9 bits (32), Expect = 6e-07 Identities = 78/92 (84%), Gaps = 1/92 (1%) Strand = Plus / Minus Query: 143 agaattacaatcagaagttcacttatccaaacgagtgtctggcaaccctcacaccataca 202 ||||||||||||||||||||| |||||| || | | |||| |||||||||| |||||| Sbjct: 232 agaattacaatcagaagttcatttatccgaatgtgcatctgataaccctcaca-cataca 174 Query: 203 tacaaacacttcagagttttacgagataccca 234 |||| |||| ||| ||||||| ||||| |||| Sbjct: 173 tacacacacctcaaagttttaagagatgccca 142 Score = 44.1 bits (22), Expect = 0.57 Identities = 31/34 (91%) Strand = Plus / Minus Query: 356 tcaagattgtgtaggacttggcgtcacgcagcaa 389 |||||||||||||||||| | |||||||||||| Sbjct: 34 tcaagattgtgtaggactggatgtcacgcagcaa 1
>ref|XM_467563.1| Oryza sativa (japonica cultivar-group), mRNA Length = 213 Score = 65.9 bits (33), Expect = 2e-07 Identities = 72/85 (84%) Strand = Plus / Minus Query: 484 cctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggt 543 |||| |||||||||||||||||| |||| || || ||||| || || ||||| || |||| Sbjct: 115 ccttcttctcatccctggctttgctgaagatcaccgtgaaaccgtcggcagaggccgggt 56 Query: 544 cgttgacgtcccattcgccaaactt 568 ||||||||||||| |||| ||||| Sbjct: 55 tgttgacgtcccatgcgccgaactt 31 Score = 40.1 bits (20), Expect = 8.8 Identities = 41/48 (85%) Strand = Plus / Minus Query: 353 tcctcaagattgtgtaggacttggcgtcacgcagcaaaaccacttctt 400 |||||||| ||| || || || |||| ||| ||||||||||||||||| Sbjct: 191 tcctcaaggttgggtggggctgggcgacacacagcaaaaccacttctt 144
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 65.9 bits (33), Expect = 2e-07 Identities = 72/85 (84%) Strand = Plus / Plus Query: 484 cctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggt 543 |||| |||||||||||||||||| |||| || || ||||| || || ||||| || |||| Sbjct: 30174034 ccttcttctcatccctggctttgctgaagatcaccgtgaaaccgtcggcagaggccgggt 30174093 Query: 544 cgttgacgtcccattcgccaaactt 568 ||||||||||||| |||| ||||| Sbjct: 30174094 tgttgacgtcccatgcgccgaactt 30174118 Score = 40.1 bits (20), Expect = 8.8 Identities = 41/48 (85%) Strand = Plus / Plus Query: 353 tcctcaagattgtgtaggacttggcgtcacgcagcaaaaccacttctt 400 |||||||| ||| || || || |||| ||| ||||||||||||||||| Sbjct: 30173730 tcctcaaggttgggtggggctgggcgacacacagcaaaaccacttctt 30173777
>dbj|AP004179.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1124_G07 Length = 93240 Score = 65.9 bits (33), Expect = 2e-07 Identities = 72/85 (84%) Strand = Plus / Plus Query: 484 cctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggt 543 |||| |||||||||||||||||| |||| || || ||||| || || ||||| || |||| Sbjct: 46738 ccttcttctcatccctggctttgctgaagatcaccgtgaaaccgtcggcagaggccgggt 46797 Query: 544 cgttgacgtcccattcgccaaactt 568 ||||||||||||| |||| ||||| Sbjct: 46798 tgttgacgtcccatgcgccgaactt 46822 Score = 40.1 bits (20), Expect = 8.8 Identities = 41/48 (85%) Strand = Plus / Plus Query: 353 tcctcaagattgtgtaggacttggcgtcacgcagcaaaaccacttctt 400 |||||||| ||| || || || |||| ||| ||||||||||||||||| Sbjct: 46434 tcctcaaggttgggtggggctgggcgacacacagcaaaaccacttctt 46481
>ref|NM_124967.2| Arabidopsis thaliana NOI AT5G55850 (NOI) mRNA, complete cds Length = 866 Score = 61.9 bits (31), Expect = 2e-06 Identities = 82/99 (82%) Strand = Plus / Minus Query: 485 ctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtc 544 ||||||||||||||| |||||||||||||| ||||| || || || || || ||||| || Sbjct: 351 ctttttctcatccctagctttgttgaatatcactgtaaaaccttctgctgatgctggatc 292 Query: 545 gttgacgtcccattcgccaaacttgggcaaagggcgacc 583 || || |||||||| ||||| || ||||| || ||||| Sbjct: 291 attcacatcccattcaccaaattttggcaagggacgacc 253
>gb|AY096671.1| Arabidopsis thaliana putative nitrate-induced NOI protein (At5g55850) mRNA, complete cds Length = 271 Score = 61.9 bits (31), Expect = 2e-06 Identities = 82/99 (82%) Strand = Plus / Minus Query: 485 ctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtc 544 ||||||||||||||| |||||||||||||| ||||| || || || || || ||||| || Sbjct: 111 ctttttctcatccctagctttgttgaatatcactgtaaaaccttctgctgatgctggatc 52 Query: 545 gttgacgtcccattcgccaaacttgggcaaagggcgacc 583 || || |||||||| ||||| || ||||| || ||||| Sbjct: 51 attcacatcccattcaccaaattttggcaagggacgacc 13
>gb|AY065260.1| Arabidopsis thaliana putative NOI protein, nitrate-induced (At5g55850) mRNA, complete cds Length = 797 Score = 61.9 bits (31), Expect = 2e-06 Identities = 82/99 (82%) Strand = Plus / Minus Query: 485 ctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtc 544 ||||||||||||||| |||||||||||||| ||||| || || || || || ||||| || Sbjct: 357 ctttttctcatccctagctttgttgaatatcactgtaaaaccttctgctgatgctggatc 298 Query: 545 gttgacgtcccattcgccaaacttgggcaaagggcgacc 583 || || |||||||| ||||| || ||||| || ||||| Sbjct: 297 attcacatcccattcaccaaattttggcaagggacgacc 259
>emb|BX833781.1|CNS09Z02 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL76ZG05 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 624 Score = 61.9 bits (31), Expect = 2e-06 Identities = 82/99 (82%) Strand = Plus / Minus Query: 485 ctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtc 544 ||||||||||||||| |||||||||||||| ||||| || || || || || ||||| || Sbjct: 302 ctttttctcatccctagctttgttgaatatcactgtaaaaccttctgctgatgctggatc 243 Query: 545 gttgacgtcccattcgccaaacttgggcaaagggcgacc 583 || || |||||||| ||||| || ||||| || ||||| Sbjct: 242 attcacatcccattcaccaaattttggcaagggacgacc 204
>dbj|AB018120.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWJ3 Length = 42356 Score = 61.9 bits (31), Expect = 2e-06 Identities = 82/99 (82%) Strand = Plus / Minus Query: 485 ctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtc 544 ||||||||||||||| |||||||||||||| ||||| || || || || || ||||| || Sbjct: 9530 ctttttctcatccctagctttgttgaatatcactgtaaaaccttctgctgatgctggatc 9471 Query: 545 gttgacgtcccattcgccaaacttgggcaaagggcgacc 583 || || |||||||| ||||| || ||||| || ||||| Sbjct: 9470 attcacatcccattcaccaaattttggcaagggacgacc 9432
>gb|AY105745.1| Zea mays PCO136119 mRNA sequence Length = 677 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 489 ttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtcgttg 548 |||||||||||||| ||| |||| || || ||||| || || ||||| || |||| ||| Sbjct: 250 ttctcatccctggccttgctgaagatcaccgtgaacccgtcggcagaggccgggttgttc 191 Query: 549 acgtcccattcgccaaacttggg 571 |||||||||||||| |||||||| Sbjct: 190 acgtcccattcgccgaacttggg 168
>gb|AF030386.1|AF030386 Arabidopsis thaliana NOI protein mRNA, complete cds Length = 632 Score = 61.9 bits (31), Expect = 2e-06 Identities = 82/99 (82%) Strand = Plus / Minus Query: 485 ctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtc 544 ||||||||||||||| |||||||||||||| ||||| || || || || || ||||| || Sbjct: 311 ctttttctcatccctagctttgttgaatatcactgtaaaaccttctgctgatgctggatc 252 Query: 545 gttgacgtcccattcgccaaacttgggcaaagggcgacc 583 || || |||||||| ||||| || ||||| || ||||| Sbjct: 251 attcacatcccattcaccaaattttggcaagggacgacc 213
>gb|DQ160112.1| Taraxacum officinale TO72-1rc (To72-1rc) mRNA, partial cds Length = 350 Score = 60.0 bits (30), Expect = 1e-05 Identities = 75/90 (83%) Strand = Plus / Minus Query: 485 ctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtc 544 ||||||||||| ||| || |||||||||||||| ||||| || ||||| || || ||||| Sbjct: 153 ctttttctcattcctcgccttgttgaatataaccgtgaacccctcagctgatgcagggtc 94 Query: 545 gttgacgtcccattcgccaaacttgggcaa 574 || || ||||| || |||||||| ||||| Sbjct: 93 attcacatcccagtcaccaaactttggcaa 64
>gb|AY140529.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-11 unknown protein gene, exons 1 and 2 and partial cds Length = 1105 Score = 58.0 bits (29), Expect = 4e-05 Identities = 80/97 (82%) Strand = Plus / Minus Query: 484 cctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggt 543 |||||||||| | || ||||||||||| ||||| || ||||| ||||| || | |||| Sbjct: 1004 cctttttctcgtttctagctttgttgaagataacagtaaatccctcagctgatgaagggt 945 Query: 544 cgttgacgtcccattcgccaaacttgggcaaagggcg 580 | || || ||||||||||||||||| ||||| ||||| Sbjct: 944 cattcacatcccattcgccaaactttggcaacgggcg 908
>gb|AY140528.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-4 unknown protein gene, exons 1 and 2 and partial cds Length = 1105 Score = 58.0 bits (29), Expect = 4e-05 Identities = 80/97 (82%) Strand = Plus / Minus Query: 484 cctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggt 543 |||||||||| | || ||||||||||| ||||| || ||||| ||||| || | |||| Sbjct: 1004 cctttttctcgtttctagctttgttgaagataacagtaaatccctcagctgatgaagggt 945 Query: 544 cgttgacgtcccattcgccaaacttgggcaaagggcg 580 | || || ||||||||||||||||| ||||| ||||| Sbjct: 944 cattcacatcccattcgccaaactttggcaacgggcg 908
>gb|AY140527.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-3 unknown protein gene, exons 1 and 2 and partial cds Length = 1105 Score = 58.0 bits (29), Expect = 4e-05 Identities = 80/97 (82%) Strand = Plus / Minus Query: 484 cctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggt 543 |||||||||| | || ||||||||||| ||||| || ||||| ||||| || | |||| Sbjct: 1004 cctttttctcgtttctagctttgttgaagataacagtaaatccctcagctgatgaagggt 945 Query: 544 cgttgacgtcccattcgccaaacttgggcaaagggcg 580 | || || ||||||||||||||||| ||||| ||||| Sbjct: 944 cattcacatcccattcgccaaactttggcaacgggcg 908
>emb|BX833526.1|CNS09ZA1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL60ZB12 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 673 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 485 ctttttctcatccctggctttgttgaatataactgt 520 ||||||||||||||| |||||||||||||| ||||| Sbjct: 231 ctttttctcatccctagctttgttgaatattactgt 196
>gb|AY140526.1| Arabidopsis thaliana clone P3WB2-A11-6094 unknown protein gene, exons 1 and 2 and partial cds Length = 1011 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 501 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 560 ||||||||||| ||||| || ||||| ||||| || | ||||| || || ||||||||| Sbjct: 882 gctttgttgaagataacagtaaatccctcagctgatgaagggtcatttacatcccattcg 823 Query: 561 ccaaacttgggcaaagggcg 580 |||||||| ||||| ||||| Sbjct: 822 ccaaacttcggcaacgggcg 803
>gb|AY140525.1| Arabidopsis thaliana clone P3WB2-A11-6092 unknown protein gene, exons 1 and 2 and partial cds Length = 1011 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 501 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 560 ||||||||||| ||||| || ||||| ||||| || | ||||| || || ||||||||| Sbjct: 882 gctttgttgaagataacagtaaatccctcagctgatgaagggtcatttacatcccattcg 823 Query: 561 ccaaacttgggcaaagggcg 580 |||||||| ||||| ||||| Sbjct: 822 ccaaacttcggcaacgggcg 803
>gb|AY140524.1| Arabidopsis thaliana clone P3WB2-A11-6054 unknown protein gene, exons 1 and 2 and partial cds Length = 1014 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 501 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 560 ||||||||||| ||||| || ||||| ||||| || | ||||| || || ||||||||| Sbjct: 882 gctttgttgaagataacagtaaatccctcagctgatgaagggtcattaacatcccattcg 823 Query: 561 ccaaacttgggcaaagggcg 580 |||||||| ||||| ||||| Sbjct: 822 ccaaacttcggcaacgggcg 803
>gb|AY140522.1| Arabidopsis thaliana clone P3WB2-A11-1220 unknown protein gene, exons 1 and 2 and partial cds Length = 1012 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 501 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 560 ||||||||||| ||||| || ||||| ||||| || | ||||| || || ||||||||| Sbjct: 883 gctttgttgaagataacagtaaatccctcagctgatgaagggtcattaacatcccattcg 824 Query: 561 ccaaacttgggcaaagggcg 580 |||||||| ||||| ||||| Sbjct: 823 ccaaacttcggcaacgggcg 804
>gb|AY140521.1| Arabidopsis thaliana clone P3WB2-A11-1202 unknown protein gene, exons 1 and 2 and partial cds Length = 1012 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 501 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 560 ||||||||||| ||||| || ||||| ||||| || | ||||| || || ||||||||| Sbjct: 883 gctttgttgaagataacagtaaatccctcagctgatgaagggtcattaacatcccattcg 824 Query: 561 ccaaacttgggcaaagggcg 580 |||||||| ||||| ||||| Sbjct: 823 ccaaacttcggcaacgggcg 804
>gb|AY140520.1| Arabidopsis thaliana clone P3WB2-A11-1084 unknown protein gene, exons 1 and 2 and partial cds Length = 1011 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 501 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 560 ||||||||||| ||||| || ||||| ||||| || | ||||| || || ||||||||| Sbjct: 882 gctttgttgaagataacagtaaatccctcagctgatgaagggtcattaacatcccattcg 823 Query: 561 ccaaacttgggcaaagggcg 580 |||||||| ||||| ||||| Sbjct: 822 ccaaacttcggcaacgggcg 803
>gb|AY140519.1| Arabidopsis thaliana clone P3WB2-A11-1074 unknown protein gene, exons 1 and 2 and partial cds Length = 1014 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 501 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 560 ||||||||||| ||||| || ||||| ||||| || | ||||| || || ||||||||| Sbjct: 882 gctttgttgaagataacagtaaatccctcagctgatgaagggtcattaacatcccattcg 823 Query: 561 ccaaacttgggcaaagggcg 580 |||||||| ||||| ||||| Sbjct: 822 ccaaacttcggcaacgggcg 803
>gb|AY140518.1| Arabidopsis thaliana clone P3WB2-A11-1006 unknown protein gene, exons 1 and 2 and partial cds Length = 1014 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 501 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 560 ||||||||||| ||||| || ||||| ||||| || | ||||| || || ||||||||| Sbjct: 882 gctttgttgaagataacagtaaatccctcagctgatgaagggtcattaacatcccattcg 823 Query: 561 ccaaacttgggcaaagggcg 580 |||||||| ||||| ||||| Sbjct: 822 ccaaacttcggcaacgggcg 803
>gb|AY140517.1| Arabidopsis thaliana clone P3WB2-A11-996 unknown protein gene, exons 1 and 2 and partial cds Length = 1014 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 501 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 560 ||||||||||| ||||| || ||||| ||||| || | ||||| || || ||||||||| Sbjct: 882 gctttgttgaagataacagtaaatccctcagctgatgaagggtcattaacatcccattcg 823 Query: 561 ccaaacttgggcaaagggcg 580 |||||||| ||||| ||||| Sbjct: 822 ccaaacttcggcaacgggcg 803
>gb|AY140516.1| Arabidopsis thaliana clone P3WB2-A11-970 unknown protein gene, exons 1 and 2 and partial cds Length = 1014 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 501 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 560 ||||||||||| ||||| || ||||| ||||| || | ||||| || || ||||||||| Sbjct: 882 gctttgttgaagataacagtaaatccctcagctgatgaagggtcattaacatcccattcg 823 Query: 561 ccaaacttgggcaaagggcg 580 |||||||| ||||| ||||| Sbjct: 822 ccaaacttcggcaacgggcg 803
>gb|AY140515.1| Arabidopsis thaliana clone P3WB2-A11-903 unknown protein gene, exons 1 and 2 and partial cds Length = 1017 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 501 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 560 ||||||||||| ||||| || ||||| ||||| || | ||||| || || ||||||||| Sbjct: 882 gctttgttgaagataacagtaaatccctcagctgatgaagggtcattaacatcccattcg 823 Query: 561 ccaaacttgggcaaagggcg 580 |||||||| ||||| ||||| Sbjct: 822 ccaaacttcggcaacgggcg 803
>gb|AY140531.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-15 unknown protein gene, exons 1 and 2 and partial cds Length = 1136 Score = 50.1 bits (25), Expect = 0.009 Identities = 79/97 (81%) Strand = Plus / Minus Query: 484 cctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggt 543 |||||||||| | || ||||| ||||| ||||| || ||||| ||||| || | |||| Sbjct: 1035 cctttttctcgtttctagctttattgaagataacagtaaatccctcagctgatgaagggt 976 Query: 544 cgttgacgtcccattcgccaaacttgggcaaagggcg 580 | || || ||||||||||||||||| ||||| ||||| Sbjct: 975 cattcacatcccattcgccaaacttcggcaacgggcg 939
>gb|AY140530.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-14 unknown protein gene, exons 1 and 2 and partial cds Length = 1137 Score = 50.1 bits (25), Expect = 0.009 Identities = 79/97 (81%) Strand = Plus / Minus Query: 484 cctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggt 543 |||||||||| | || ||||| ||||| ||||| || ||||| ||||| || | |||| Sbjct: 1036 cctttttctcgtttctagctttattgaagataacagtaaatccctcagctgatgaagggt 977 Query: 544 cgttgacgtcccattcgccaaacttgggcaaagggcg 580 | || || ||||||||||||||||| ||||| ||||| Sbjct: 976 cattcacatcccattcgccaaacttcggcaacgggcg 940
>ref|NM_126474.1| Arabidopsis thaliana unknown protein AT2G04410 mRNA, complete cds Length = 521 Score = 48.1 bits (24), Expect = 0.036 Identities = 66/80 (82%) Strand = Plus / Minus Query: 501 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 560 ||||||||||| ||||| || || || ||||| || | ||||| || || ||||||||| Sbjct: 223 gctttgttgaagataacagtaaacccctcagctgatgaagggtcattaacatcccattcg 164 Query: 561 ccaaacttgggcaaagggcg 580 |||||||| ||||| ||||| Sbjct: 163 ccaaacttcggcaacgggcg 144
>gb|AC006951.6| Arabidopsis thaliana chromosome 2 clone T1O3 map RNS1, complete sequence Length = 99804 Score = 48.1 bits (24), Expect = 0.036 Identities = 66/80 (82%) Strand = Plus / Minus Query: 501 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 560 ||||||||||| ||||| || || || ||||| || | ||||| || || ||||||||| Sbjct: 68016 gctttgttgaagataacagtaaacccctcagctgatgaagggtcattaacatcccattcg 67957 Query: 561 ccaaacttgggcaaagggcg 580 |||||||| ||||| ||||| Sbjct: 67956 ccaaacttcggcaacgggcg 67937
>gb|AY058877.1| Arabidopsis thaliana At2g04410/T1O3.18 mRNA, complete cds Length = 563 Score = 48.1 bits (24), Expect = 0.036 Identities = 66/80 (82%) Strand = Plus / Minus Query: 501 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 560 ||||||||||| ||||| || || || ||||| || | ||||| || || ||||||||| Sbjct: 172 gctttgttgaagataacagtaaacccctcagctgatgaagggtcattaacatcccattcg 113 Query: 561 ccaaacttgggcaaagggcg 580 |||||||| ||||| ||||| Sbjct: 112 ccaaacttcggcaacgggcg 93
>gb|AY140523.1| Arabidopsis thaliana clone P3WB2-A11-1248 unknown protein gene, exons 1 and 2 and partial cds Length = 1012 Score = 48.1 bits (24), Expect = 0.036 Identities = 66/80 (82%) Strand = Plus / Minus Query: 501 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 560 ||||||||||| ||||| || || || ||||| || | ||||| || || ||||||||| Sbjct: 883 gctttgttgaagataacagtaaacccctcagctgatgaagggtcattaacatcccattcg 824 Query: 561 ccaaacttgggcaaagggcg 580 |||||||| ||||| ||||| Sbjct: 823 ccaaacttcggcaacgggcg 804
>gb|AC112688.10| Mus musculus chromosome 5, clone RP23-258C13, complete sequence Length = 181175 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Plus Query: 82 aaatcatatatcaacttcacca 103 |||||||||||||||||||||| Sbjct: 1344 aaatcatatatcaacttcacca 1365
>gb|AC121548.17| Mus musculus chromosome 5, clone RP24-86E4, complete sequence Length = 154340 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Plus Query: 82 aaatcatatatcaacttcacca 103 |||||||||||||||||||||| Sbjct: 109851 aaatcatatatcaacttcacca 109872
>ref|NM_123429.2| Arabidopsis thaliana unknown protein AT5G40645 mRNA, complete cds Length = 438 Score = 42.1 bits (21), Expect = 2.2 Identities = 48/57 (84%) Strand = Plus / Minus Query: 509 gaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcgccaaa 565 ||||||||| || ||||| || || || ||||| ||||| ||||||||||| ||||| Sbjct: 197 gaatataaccgtaaatccttcggctgatgctggatcgttcacgtcccattctccaaa 141
>gb|DQ447022.1| Arabidopsis thaliana clone pENTR221-At5g40645 nitrate-responsive NOI protein (At5g40645) mRNA, complete cds Length = 222 Score = 42.1 bits (21), Expect = 2.2 Identities = 48/57 (84%) Strand = Plus / Minus Query: 509 gaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcgccaaa 565 ||||||||| || ||||| || || || ||||| ||||| ||||||||||| ||||| Sbjct: 108 gaatataaccgtaaatccttcggctgatgctggatcgttcacgtcccattctccaaa 52
>emb|AL138899.23| Human DNA sequence from clone RP11-404O13 on chromosome 1 Contains two novel genes, a elongation factor RNA polymerase II 2 (ELL2) pseudogene, the CD1D gene for CD1D antigen, d polypeptide and a ribosomal protein S10 (RPS10) pseudogene, complete sequence Length = 134137 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 316 ttcccaaccattcttcttctg 336 ||||||||||||||||||||| Sbjct: 22089 ttcccaaccattcttcttctg 22069
>emb|AL138649.1|ATT14D3 Arabidopsis thaliana DNA chromosome 3, BAC clone T14D3 Length = 88010 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 285 tatgtatatagcaaaattaaa 305 ||||||||||||||||||||| Sbjct: 34515 tatgtatatagcaaaattaaa 34495
>emb|AJ583272.1| Egadroma subrobustus mitochondrial partial COI gene for cytochrome oxidase subunit I Length = 759 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 79 ctcaaatcatatatcaacttc 99 ||||||||||||||||||||| Sbjct: 708 ctcaaatcatatatcaacttc 728
>emb|AJ583271.1| Egadroma marginatum mitochondrial partial COI gene for cytochrome oxidase subunit I Length = 759 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 79 ctcaaatcatatatcaacttc 99 ||||||||||||||||||||| Sbjct: 708 ctcaaatcatatatcaacttc 728
>emb|AJ583270.1| Egadroma marginatum mitochondrial partial COI gene for cytochrome oxidase subunit I Length = 759 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 79 ctcaaatcatatatcaacttc 99 ||||||||||||||||||||| Sbjct: 708 ctcaaatcatatatcaacttc 728
>emb|AJ583268.1| Egadroma piceus mitochondrial partial COI gene for cytochrome oxidase subunit I Length = 759 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 79 ctcaaatcatatatcaacttc 99 ||||||||||||||||||||| Sbjct: 708 ctcaaatcatatatcaacttc 728
>dbj|AB009052.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNF13 Length = 85992 Score = 42.1 bits (21), Expect = 2.2 Identities = 48/57 (84%) Strand = Plus / Plus Query: 509 gaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcgccaaa 565 ||||||||| || ||||| || || || ||||| ||||| ||||||||||| ||||| Sbjct: 55414 gaatataaccgtaaatccttcggctgatgctggatcgttcacgtcccattctccaaa 55470
>gb|CP000078.1| Leishmania major strain Friedlin chromosome 2, complete sequence Length = 355714 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 628 cgagggggagggagaggggc 647 |||||||||||||||||||| Sbjct: 109590 cgagggggagggagaggggc 109571 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 628 cgagggggagggagaggggc 647 |||||||||||||||||||| Sbjct: 89936 cgagggggagggagaggggc 89917
>gb|AC122214.4| Mus musculus BAC clone RP23-104J10 from chromosome 7, complete sequence Length = 176054 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 358 aagattgtgtaggacttggc 377 |||||||||||||||||||| Sbjct: 7126 aagattgtgtaggacttggc 7145
>gb|AC125223.3| Mus musculus BAC clone RP23-31C10 from 13, complete sequence Length = 221903 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cacaccatacatacaaacac 211 |||||||||||||||||||| Sbjct: 33377 cacaccatacatacaaacac 33358
>gb|AC099930.11| Mus musculus chromosome 7, clone RP23-17C12, complete sequence Length = 224617 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 358 aagattgtgtaggacttggc 377 |||||||||||||||||||| Sbjct: 180995 aagattgtgtaggacttggc 181014
>gb|AC012391.10| Homo sapiens chromosome 10 clone RP11-162A23, complete sequence Length = 181948 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 189 cctcacaccatacatacaaa 208 |||||||||||||||||||| Sbjct: 2278 cctcacaccatacatacaaa 2297
>emb|AL021919.4|HS1045J21 Human DNA sequence from clone RP5-1045J21 on chromosome 1q23.3-24.3 Contains part of the TNR gene for tenascin R (restrictin, janusin), a novel gene and one CpG island, complete sequence Length = 138636 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 ttcccagcctttttctcatc 496 |||||||||||||||||||| Sbjct: 101046 ttcccagcctttttctcatc 101027
>emb|AL954258.2| Pan troglodytes chromosome 22 clone PTB-146D01 map 22q22.3, complete sequence Length = 185080 Score = 40.1 bits (20), Expect = 8.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 290 atatagcaaaattaaacgaccatacttt 317 |||||||||||||||||| |||| |||| Sbjct: 14595 atatagcaaaattaaacgcccattcttt 14568
>emb|AL844182.10| Mouse DNA sequence from clone RP23-399H17 on chromosome 4, complete sequence Length = 201590 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 314 ctttcccaaccattcttcttctgg 337 |||||||||||||||||| ||||| Sbjct: 111528 ctttcccaaccattcttcctctgg 111505
>emb|AL589744.18| Mouse DNA sequence from clone RP23-80C18 on chromosome 13 Contains a nove gene, a ribosomal protein large p1 (Rplp1) pseudogene and the Cmah gene for CMP-N-Acetylneuraminic acid hydroxylase, complete sequence Length = 216800 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 cacaccatacatacaaacac 211 |||||||||||||||||||| Sbjct: 158268 cacaccatacatacaaacac 158287
>dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, complete genome Length = 5727534 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 45 ttttggatgtttgcagttca 64 |||||||||||||||||||| Sbjct: 1832302 ttttggatgtttgcagttca 1832321
>gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 map c245, complete sequence Length = 88149 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 586 attcctccgacatggattga 605 |||||||||||||||||||| Sbjct: 15324 attcctccgacatggattga 15343
>emb|BX465229.7| Zebrafish DNA sequence from clone CH211-174D2 in linkage group 2, complete sequence Length = 154954 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 284 gtatgtatatagcaaaatta 303 |||||||||||||||||||| Sbjct: 123320 gtatgtatatagcaaaatta 123301
>emb|CR387617.1| Gallus gallus finished cDNA, clone ChEST46l16 Length = 883 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 cataatgggcctacccaggt 33 |||||||||||||||||||| Sbjct: 601 cataatgggcctacccaggt 582
>gb|AC105061.16| Mus musculus chromosome 19, clone RP23-117I10, complete sequence Length = 210038 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 cacaccatacatacaaacac 211 |||||||||||||||||||| Sbjct: 127480 cacaccatacatacaaacac 127461
>gb|AC022267.8|AC022267 Homo sapiens BAC clone RP11-407H18 from 4, complete sequence Length = 199472 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 478 tcccagcctttttctcatcc 497 |||||||||||||||||||| Sbjct: 168944 tcccagcctttttctcatcc 168963
>emb|BX324002.8| Zebrafish DNA sequence from clone CH211-129H21 in linkage group 24, complete sequence Length = 178173 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 502 ctttgttgaatataactgtg 521 |||||||||||||||||||| Sbjct: 120365 ctttgttgaatataactgtg 120384
>gb|AY230143.1| Leishmania major clone B2015 phosphoglycan beta 1,2 arabinosyltransferase 1 (SCA1) gene, complete cds Length = 3185 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 628 cgagggggagggagaggggc 647 |||||||||||||||||||| Sbjct: 2834 cgagggggagggagaggggc 2853
>dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 1, complete sequence Length = 3288558 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 326 ttcttcttctggggtggcagcttg 349 |||||||||||||||||| ||||| Sbjct: 2937175 ttcttcttctggggtggctgcttg 2937198
>gb|AF434264.1| Salmo trutta clone 64 internal transcribed spacer 1, complete sequence Length = 575 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 625 cgccgagggggagggagagg 644 |||||||||||||||||||| Sbjct: 109 cgccgagggggagggagagg 90
>gb|AF434263.1| Salmo trutta clone 76 internal transcribed spacer 1, complete sequence Length = 575 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 625 cgccgagggggagggagagg 644 |||||||||||||||||||| Sbjct: 109 cgccgagggggagggagagg 90
>gb|AF434262.1| Salmo trutta clone 75 internal transcribed spacer 1, complete sequence Length = 575 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 625 cgccgagggggagggagagg 644 |||||||||||||||||||| Sbjct: 109 cgccgagggggagggagagg 90
>gb|AF434261.1| Salmo trutta clone 74 internal transcribed spacer 1, complete sequence Length = 575 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 625 cgccgagggggagggagagg 644 |||||||||||||||||||| Sbjct: 109 cgccgagggggagggagagg 90
>gb|AF434260.1| Salmo trutta clone 53 internal transcribed spacer 1, complete sequence Length = 575 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 625 cgccgagggggagggagagg 644 |||||||||||||||||||| Sbjct: 109 cgccgagggggagggagagg 90
>gb|AF434259.1| Salmo trutta clone 68 internal transcribed spacer 1, complete sequence Length = 575 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 625 cgccgagggggagggagagg 644 |||||||||||||||||||| Sbjct: 109 cgccgagggggagggagagg 90
>gb|AF434258.1| Salmo trutta clone 52 internal transcribed spacer 1, complete sequence Length = 575 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 625 cgccgagggggagggagagg 644 |||||||||||||||||||| Sbjct: 109 cgccgagggggagggagagg 90
>gb|AF434257.1| Salmo trutta clone 55 internal transcribed spacer 1, complete sequence Length = 575 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 625 cgccgagggggagggagagg 644 |||||||||||||||||||| Sbjct: 109 cgccgagggggagggagagg 90
>gb|AF434256.1| Salmo trutta clone 51 internal transcribed spacer 1, complete sequence Length = 575 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 625 cgccgagggggagggagagg 644 |||||||||||||||||||| Sbjct: 109 cgccgagggggagggagagg 90
>emb|AL163302.2|HS21C102 Homo sapiens chromosome 21 segment HS21C102 Length = 340000 Score = 40.1 bits (20), Expect = 8.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 290 atatagcaaaattaaacgaccatacttt 317 |||||||||||||||||| |||| |||| Sbjct: 96496 atatagcaaaattaaacgcccattcttt 96469
>emb|BX322562.1|HSQ21A11 Homo sapiens chromosome 21 from cosmid LL21NC02-21A1 map 21q22.3 region D21S171-LA161, complete sequence Length = 45600 Score = 40.1 bits (20), Expect = 8.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 290 atatagcaaaattaaacgaccatacttt 317 |||||||||||||||||| |||| |||| Sbjct: 14960 atatagcaaaattaaacgcccattcttt 14933
>emb|CR962122.2| Medicago truncatula chromosome 5 clone mte1-46l20, COMPLETE SEQUENCE Length = 150486 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 294 agcaaaattaaacgaccatacttt 317 ||||||||||||||| |||||||| Sbjct: 70547 agcaaaattaaacgatcatacttt 70524
>dbj|AP006701.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT08P04, TM0587, complete sequence Length = 110885 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 319 ccaaccattcttcttctggggtgg 342 ||||||||||||||||||| |||| Sbjct: 64483 ccaaccattcttcttctggtgtgg 64460
>emb|AL929506.8| Mouse DNA sequence from clone RP23-223I8 on chromosome 4, complete sequence Length = 63478 Score = 40.1 bits (20), Expect = 8.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 301 ttaaacgaccatactttcccaacc 324 |||||| ||||||||||||||||| Sbjct: 60468 ttaaaccaccatactttcccaacc 60491 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,255,811 Number of Sequences: 3902068 Number of extensions: 6255811 Number of successful extensions: 148528 Number of sequences better than 10.0: 85 Number of HSP's better than 10.0 without gapping: 85 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 148212 Number of HSP's gapped (non-prelim): 313 length of query: 647 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 624 effective length of database: 17,143,297,704 effective search space: 10697417767296 effective search space used: 10697417767296 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)