ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd11j09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|L11740.1|BLYEFIA Barley elongation factor 1 alpha, (EF-1A) mR... 983 0.0
2emb|Z23130.1|HVBLT63A H.vulgare BLT63 mRNA, complete CDS 948 0.0
3gb|AF479046.1| Triticum aestivum elongation factor-1 alpha mRNA,... 381 e-102
4dbj|D63581.1| Oryza sativa mRNA for EF-1 alpha, complete cds 283 3e-73
5gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 268 2e-68
6gb|AC090484.4| Genomic sequence for Oryza sativa, Nipponbare str... 268 2e-68
7dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 268 2e-68
8gb|AC125472.2| Oryza sativa (japonica cultivar-group) chromosome... 268 2e-68
9dbj|AK119537.1| Oryza sativa (japonica cultivar-group) cDNA clon... 268 2e-68
10dbj|AK073196.1| Oryza sativa (japonica cultivar-group) cDNA clon... 268 2e-68
11dbj|AK072285.1| Oryza sativa (japonica cultivar-group) cDNA clon... 268 2e-68
12dbj|AK061464.1| Oryza sativa (japonica cultivar-group) cDNA clon... 268 2e-68
13dbj|D63583.1| Oryza sativa mRNA for EF-1 alpha, complete cds 266 7e-68
14dbj|AK105030.2| Oryza sativa (japonica cultivar-group) cDNA clon... 262 1e-66
15dbj|AK119172.1| Oryza sativa (japonica cultivar-group) cDNA clon... 262 1e-66
16dbj|AK103738.1| Oryza sativa (japonica cultivar-group) cDNA clon... 262 1e-66
17dbj|AK072648.1| Oryza sativa (japonica cultivar-group) cDNA clon... 262 1e-66
18dbj|AK062030.1| Oryza sativa (japonica cultivar-group) cDNA clon... 262 1e-66
19gb|AF030517.1|AF030517 Oryza sativa translation elongation facto... 262 1e-66
20dbj|D63580.1| Oryza sativa mRNA for EF-1 alpha, complete cds 262 1e-66
21gb|BT016525.1| Zea mays clone Contig358 mRNA sequence 260 4e-66
22gb|BT017771.1| Zea mays clone EL01N0502E05.c mRNA sequence 260 4e-66
23gb|AF136824.1|AF136824 Zea mays clone b elongation factor 1 alph... 260 4e-66
24gb|AY109326.1| Zea mays CL1256_1 mRNA sequence 260 4e-66
25gb|BT016740.1| Zea mays clone Contig573 mRNA sequence 258 2e-65
26emb|Z50789.1|HVEF1ALFA H.vulgare mRNA for elongation factor 1-alpha 256 6e-65
27gb|M90077.1|WHTTEF1X Wheat translation elongation factor 1 alpha... 254 3e-64
28gb|BT016514.1| Zea mays clone Contig347 mRNA sequence 244 2e-61
29gb|AF136823.1|AF136823 Zea mays clone a elongation factor 1 alph... 244 2e-61
30gb|AF281361.1| Saccharum officinarum elongation factor mRNA, com... 242 1e-60
31gb|BT016889.1| Zea mays clone Contig722 mRNA sequence 238 1e-59
32gb|AF136826.1|AF136826 Zea mays clone d elongation factor 1 alph... 236 6e-59
33gb|BT016906.1| Zea mays clone Contig739 mRNA sequence 234 2e-58
34gb|AF136828.1|AF136828 Zea mays clone f elongation factor 1 alph... 230 4e-57
35gb|AF136827.1|AF136827 Zea mays clone e elongation factor 1 alph... 228 1e-56
36dbj|AK119528.1| Oryza sativa (japonica cultivar-group) cDNA clon... 228 1e-56
37dbj|AK119194.1| Oryza sativa (japonica cultivar-group) cDNA clon... 228 1e-56
38dbj|AK071619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 228 1e-56
39dbj|AK071343.1| Oryza sativa (japonica cultivar-group) cDNA clon... 228 1e-56
40dbj|D63582.1| Oryza sativa mRNA for EF-1 alpha, complete cds 228 1e-56
41gb|AF136825.1|AF136825 Zea mays clone c elongation factor 1 alph... 220 3e-54
42dbj|AK119647.1| Oryza sativa (japonica cultivar-group) cDNA clon... 220 3e-54
43gb|BT016827.1| Zea mays clone Contig660 mRNA sequence 212 9e-52
44gb|BT009129.1| Triticum aestivum clone wl1n.pk0027.f4:fis, full ... 212 9e-52
45dbj|D45408.1|MZEEF1A Zea mays elongation factor 1alpha gene, com... 212 9e-52
46gb|U76259.1|ZMU76259 Zea mays elongation factor 1-alpha (EF1-A) ... 212 9e-52
47dbj|D45407.1|MZEEF1AA Corn mRNA for elongation factor 1A 212 9e-52
48dbj|D12709.1|DARELF1A Daucus carota mRNA for elongation factor 1... 210 3e-51
49gb|BT018898.1| Zea mays clone EL01T0207D05.d mRNA sequence 202 8e-49
50gb|BT016242.1| Zea mays clone Contig75 mRNA sequence 200 3e-48
51gb|AF136829.1|AF136829 Zea mays clone g elongation factor 1 alph... 196 5e-47
52gb|AF181492.1|AF181492 Lilium longiflorum elongation factor-1 al... 194 2e-46
53gb|DQ407753.1| Gymnadenia conopsea EF-1 alpha mRNA, complete cds 192 8e-46
54gb|DQ447160.1| Passiflora edulis translation elongation factor 1... 190 3e-45
55emb|X96678.1|NPELF N.pseudonarcissu mRNA for elongation factor 190 3e-45
56gb|AF331850.1| Saccharum hybrid cultivar CP72-2086 elongation fa... 188 1e-44
57gb|AF331849.1| Saccharum hybrid cultivar CP65-357 elongation fac... 188 1e-44
58gb|AF121261.1|AF121261 Lilium longiflorum elongation factor 1-al... 182 8e-43
59gb|DQ057979.1| Musa acuminata elongation factor-1 alpha mRNA, co... 180 3e-42
60gb|AY550990.1| Elaeis guineensis elongation factor 1-alpha 1 (EF... 178 1e-41
61dbj|AB073630.1| Suaeda japonica sjef-1A mRNA for eukaryotic elon... 178 1e-41
62ref|NM_100666.2| Arabidopsis thaliana calmodulin binding / trans... 165 2e-37
63gb|BT012707.1| Lycopersicon esculentum clone 113585F, mRNA sequence 165 2e-37
64emb|X16431.1|ATEF1A23 A.thaliana A2 and A3 genes encoding elonga... 165 2e-37
65dbj|AK221085.1| Arabidopsis thaliana mRNA for elongation factor ... 165 2e-37
66gb|AY088358.1| Arabidopsis thaliana clone 6135 mRNA, complete se... 165 2e-37
67gb|BT002442.1| Arabidopsis thaliana elongation factor 1-alpha (A... 165 2e-37
68gb|BT002423.1| Arabidopsis thaliana elongation factor 1-alpha (A... 165 2e-37
69gb|AC026875.4|AC026875 Genomic sequence for Arabidopsis thaliana... 165 2e-37
70gb|U63815.1|ATU63815 Arabidopsis thaliana AT.I.24-1, AT.I.24-2, ... 165 2e-37
71gb|AY832572.1| Pseudotsuga menziesii haplotype Pm-EF1A_18 transl... 163 7e-37
72gb|AY832560.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 163 7e-37
73gb|DQ284495.1| Solanum tuberosum clone 063G03 elongation factor-... 161 3e-36
74emb|AJ234435.1|HVU234435 Hordeum vulgare partial mRNA; clone cMW... 159 1e-35
75gb|AY832581.1| Pseudotsuga menziesii haplotype Pm-EF1A_412m1 tra... 155 2e-34
76gb|AY832580.1| Pseudotsuga menziesii haplotype Pm-EF1A_013d2 tra... 155 2e-34
77gb|AY832578.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 155 2e-34
78gb|AY832576.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 155 2e-34
79gb|AY832573.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 155 2e-34
80gb|AY832571.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 155 2e-34
81gb|AY832570.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 155 2e-34
82gb|AY832567.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 155 2e-34
83gb|AY832565.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 155 2e-34
84gb|AY832564.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 155 2e-34
85gb|AY832563.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 155 2e-34
86gb|AY832562.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 155 2e-34
87gb|AF464925.1| Elaeis oleifera elongation factor 1-alpha mRNA, c... 151 3e-33
88dbj|AB073631.1| Salsola komarovii skef-1A mRNA for eukaryotic el... 151 3e-33
89emb|X56856.1|GMTEFS1 G.max tefS1 gene for elongation factor EF-1a 149 1e-32
90gb|AF181491.1|AF181491 Lilium longiflorum elongation factor-1 al... 149 1e-32
91gb|AY832582.1| Pseudotsuga menziesii haplotype Pm-EF1A_412m2 tra... 147 4e-32
92gb|AY832579.1| Pseudotsuga menziesii haplotype Pm-EF1A_013d1 tra... 147 4e-32
93gb|AY832577.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 147 4e-32
94gb|AY832575.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 147 4e-32
95gb|AY832574.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 147 4e-32
96gb|AY832569.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 147 4e-32
97gb|AY832566.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 147 4e-32
98gb|AY832561.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 147 4e-32
99gb|AY832559.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 147 4e-32
100gb|AY832558.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 147 4e-32
101gb|AY832557.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 147 4e-32
102gb|AY832556.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 147 4e-32
103emb|AJ132534.1|PAB132534 Picea abies mRNA for translation elonga... 147 4e-32
104ref|NM_100667.2| Arabidopsis thaliana calmodulin binding / trans... 145 2e-31
105gb|AY123029.1| Arabidopsis thaliana putative elongation factor 1... 145 2e-31
106gb|AY080660.1| Arabidopsis thaliana putative elongation factor 1... 145 2e-31
107gb|AF361822.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, comp... 145 2e-31
108gb|AY065008.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, comp... 145 2e-31
109gb|AY059160.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, comp... 145 2e-31
110gb|AY048275.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, comp... 145 2e-31
111emb|BX829434.1|CNS0A06V Arabidopsis thaliana Full-length cDNA Co... 145 2e-31
112gb|BT003325.1| Arabidopsis thaliana Unknown protein mRNA, comple... 145 2e-31
113gb|DQ174256.1| Gossypium hirsutum translation elongation factor ... 143 7e-31
114emb|X96555.1|PSEF1ALPH P.sativum mRNA for elongation factor 1-alpha 143 7e-31
115gb|AY946009.1| Actinidia deliciosa elongation factor 1 alpha mRN... 143 7e-31
116ref|NM_001035916.1| Arabidopsis thaliana calmodulin binding / tr... 141 3e-30
117ref|NM_100668.2| Arabidopsis thaliana calmodulin binding / trans... 141 3e-30
118gb|BT000595.1| Arabidopsis thaliana elongation factor 1-alpha (... 141 3e-30
119emb|X16430.1|ATEF1AA1 Arabidopsis thaliana EF-1 alpha A1 gene fo... 141 3e-30
120gb|AY039583.1| Arabidopsis thaliana At1g07940/T6D22_14 mRNA, com... 141 3e-30
121gb|AY832568.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 139 1e-29
122ref|NM_125432.2| Arabidopsis thaliana calmodulin binding / trans... 137 4e-29
123gb|BT000688.1| Arabidopsis thaliana clone RAFL08-11-M03 (R11086)... 137 4e-29
124gb|AF360167.1| Arabidopsis thaliana putative translation elongat... 137 4e-29
125emb|X53043.1|LEEF1A L.esculentum gene for elongation factor 1-alpha 137 4e-29
126emb|X14449.1|LELEEF1 Tomato LeEF-1 mRNA for elongation factor 1 ... 137 4e-29
127emb|AJ223969.1|MDAJ39669 Malus domestica mRNA for elongation fac... 137 4e-29
128gb|AY140099.1| Arabidopsis thaliana unknown protein mRNA, comple... 137 4e-29
129gb|AY140095.1| Arabidopsis thaliana unknown protein mRNA, comple... 137 4e-29
130gb|AY133532.1| Arabidopsis thaliana At5g60390/muf9_40 mRNA, comp... 137 4e-29
131gb|AY128802.1| Arabidopsis thaliana elongation factor 1-alpha mR... 137 4e-29
132gb|DQ399793.1| Phoenix dactylifera elongation factor 1-alpha mRN... 137 4e-29
133gb|AY060564.1| Arabidopsis thaliana AT5g60390/muf9_40 mRNA, comp... 137 4e-29
134gb|AF419586.1|AF419586 Arabidopsis thaliana AT5g60390/muf9_40 mR... 137 4e-29
135gb|AY059904.1| Arabidopsis thaliana elongation factor 1-alpha (E... 137 4e-29
136dbj|AK221176.1| Arabidopsis thaliana mRNA for translation elonga... 137 4e-29
137gb|BT006369.1| Arabidopsis thaliana At5g60390/muf9_40 gene, comp... 137 4e-29
138gb|BT002510.1| Arabidopsis thaliana Unknown protein mRNA, comple... 137 4e-29
139dbj|AB011483.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 137 4e-29
140gb|AF041463.1|AF041463 Manihot esculenta elongation factor 1-alp... 137 4e-29
141gb|DQ228347.1| Solanum tuberosum clone 149A09 elongation factor ... 133 6e-28
142gb|AY300042.1| Solanum tuberosum putative translation elongation... 133 6e-28
143gb|AY651886.1| Glycine max elongation factor 1A SMV resistance-r... 133 6e-28
144gb|AY496125.1| Capsicum annuum elongation factor 1-alpha mRNA, c... 133 6e-28
145gb|DQ252511.1| Solanum tuberosum clone 087B12 elongation factor ... 133 6e-28
146gb|BT013246.1| Lycopersicon esculentum clone 134556F, mRNA sequence 129 1e-26
147gb|AY114651.1| Arabidopsis thaliana putative elongation factor 1... 129 1e-26
148gb|AY062553.1| Arabidopsis thaliana putative elongation factor 1... 129 1e-26
149gb|AY039764.1| Sinapis arvensis elongation factor-1 alpha mRNA, ... 129 1e-26
150gb|DQ294264.1| Solanum tuberosum clone 131C12 elongation factor ... 129 1e-26
151gb|DQ174254.1| Gossypium hirsutum translation elongation factor ... 127 4e-26
152gb|DQ174252.1| Gossypium hirsutum translation elongation factor ... 127 4e-26
153dbj|AB073629.1| Bruguiera sexangula bsef-1A mRNA for eukaryotic ... 127 4e-26
154gb|DQ228328.1| Solanum tuberosum clone 135G05 elongation factor ... 125 2e-25
155gb|AF242732.1| Capsicum annuum translation elongation factor 1a ... 125 2e-25
156gb|U04632.1|NTU04632 Nicotiana tabacum Wisconsin 38 vitronectin-... 125 2e-25
157dbj|D63396.1|TOBBY2A Nicotiana tabacum mRNA for elongation facto... 125 2e-25
158gb|DQ442392.1| Striga asiatica clone St460 elongation factor 1 a... 123 6e-25
159emb|AJ222579.1|VFEF1A Vicia faba mRNA for elongation factor 1-al... 123 6e-25
160emb|AJ010225.1|CAR010225 Cicer arietinum mRNA for elongation fac... 123 6e-25
161gb|U80268.1|MDU80268 Malus domestica elongation factor 1 alpha (... 123 6e-25
162gb|DQ228326.1| Solanum tuberosum clone 135F02 elongation factor ... 121 2e-24
163gb|DQ222490.1| Solanum tuberosum clone 098G02 elongation factor ... 121 2e-24
164emb|X16432.1|ATEF1AA4 Arabidopsis thaliana EF-1 alpha-A4 (NAEEFT... 121 2e-24
165dbj|AK221032.1| Arabidopsis thaliana mRNA for elongation factor ... 121 2e-24
166emb|BX814695.1|CNS0ADQC Arabidopsis thaliana Full-length cDNA Co... 121 2e-24
167dbj|AB061263.1| Solanum tuberosum EF-1-alpha mRNA for Elongation... 121 2e-24
168gb|AY378166.1| Cichorium intybus elongation factor 1-alpha mRNA,... 119 9e-24
169gb|DQ174258.1| Gossypium hirsutum translation elongation factor ... 119 9e-24
170gb|DQ174257.1| Gossypium hirsutum translation elongation factor ... 119 9e-24
171gb|DQ174251.1| Gossypium hirsutum translation elongation factor ... 117 4e-23
172dbj|AB019427.1| Nicotiana paniculata mRNA for elongation factor-... 117 4e-23
173emb|CT010481.8| M.truncatula DNA sequence from clone MTH2-62G7 o... 115 1e-22
174dbj|AB106676.1| Avicennia marina EF1-A mRNA for elongation facto... 111 2e-21
175emb|AJ536671.1|STU536671 Solanum tuberosum mRNA for elongation f... 109 9e-21
176gb|DQ174253.1| Gossypium hirsutum translation elongation factor ... 107 4e-20
177gb|DQ174250.1| Gossypium hirsutum translation elongation factor ... 107 4e-20
178emb|AJ004960.1|CAA004960 Cicer arietinum mRNA for elongation fac... 107 4e-20
179dbj|AB056104.1| Carassius auratus mRNA for elongation factor-1 a... 103 6e-19
180gb|AY962821.1| Prunus armeniaca elongation factor 1 alpha mRNA, ... 101 2e-18
181gb|DQ268854.1| Solanum tuberosum clone 171A01 elongation factor ... 101 2e-18
182gb|AY264212.1| Orinocodoras eigenmanni elongation factor-1 alpha... 100 9e-18
183emb|X60302.1|DCEF1A D.carota gene for elongation factor 1A 98 3e-17
184gb|L76077.1|TRBEF1AE Trypanosoma cruzi elongation factor 1-alpha... 98 3e-17
185gb|AY727921.1| Trypanosoma cruzi elongation factor alpha G5 mRNA... 98 3e-17
186gb|AY422992.1| Danio rerio eukaryotic translation elongation fac... 96 1e-16
187gb|BC064291.1| Danio rerio elongation factor 1-alpha, mRNA (cDNA... 96 1e-16
188ref|NM_131263.1| Danio rerio elongation factor 1-alpha (ef1a), mRNA 96 1e-16
189emb|X77689.1|BREF1MRN B.rerio ef-1 alpha mRNA 96 1e-16
190gb|DQ083545.1| Danio rerio eukaryotic translation elongation fac... 96 1e-16
191gb|AY157315.1| Stevia rebaudiana elongation factor 1 alpha mRNA,... 96 1e-16
192gb|AY643400.1| Pimephales promelas elongation factor 1-alpha mRN... 96 1e-16
193gb|L23807.1|ZEFEF1AL Danio rerio elongation factor 1 alpha (EFL1... 96 1e-16
194gb|BT016891.1| Zea mays clone Contig724 mRNA sequence 94 5e-16
195gb|DQ226919.1| Boechera divaricarpa isolate SLW-E-A06 mRNA sequence 94 5e-16
196gb|AF398148.1|AF398148 Brassica rapa subsp. pekinensis translati... 94 5e-16
197gb|DQ353797.1| Ictalurus punctatus isolate C94SB10 elongation fa... 94 5e-16
198gb|AY264256.1| Synodontis sp. GM-2003 elongation factor-1 alpha ... 92 2e-15
199gb|AY264255.1| Centromochlus heckelii elongation factor-1 alpha ... 92 2e-15
200gb|AY264253.1| Tatia intermedia elongation factor-1 alpha gene, ... 92 2e-15
201gb|AY264252.1| Auchenipterichthys thoracatus elongation factor-1... 92 2e-15
202gb|AY264249.1| Parauchenipterus cf. galeatus elongation factor-1... 92 2e-15
203gb|AY264248.1| Acanthodoras cataphractus truncated elongation fa... 92 2e-15
204gb|AY264247.1| Acanthodoras spinosissimus elongation factor-1 al... 92 2e-15
205gb|AY264245.1| Trachydoras cf. microstomus elongation factor-1 a... 92 2e-15
206gb|AY264243.1| Trachydoras steindachneri elongation factor-1 alp... 92 2e-15
207gb|AY264241.1| Leptodoras cf. copei elongation factor-1 alpha ge... 92 2e-15
208gb|AY264240.1| Leptodoras linnelli elongation factor-1 alpha gen... 92 2e-15
209gb|AY264236.1| Leptodoras sp. 3-GM-2003 elongation factor-1 alph... 92 2e-15
210gb|AY264225.1| Hassar sp. GM-2003 elongation factor-1 alpha gene... 92 2e-15
211gb|AY264224.1| Hassar sp. GM-2003 elongation factor-1 alpha gene... 92 2e-15
212gb|AY264223.1| Opsodoras sp. GM-2003 elongation factor-1 alpha g... 92 2e-15
213gb|AY264222.1| Opsodoras ternetzi haplotype I elongation factor-... 92 2e-15
214gb|AY264221.1| Nemadoras hemipeltis elongation factor-1 alpha ge... 92 2e-15
215gb|AY264219.1| Doras micropoeus elongation factor-1 alpha gene, ... 92 2e-15
216gb|AY264217.1| Doraops zuloagai elongation factor-1 alpha gene, ... 92 2e-15
217gb|AY264214.1| Oxydoras niger haplotype II elongation factor-1 a... 92 2e-15
218gb|AY264210.1| Rhinodoras cf. boehlkei elongation factor-1 alpha... 92 2e-15
219gb|AY264209.1| Rhinodoras boehlkei elongation factor-1 alpha gen... 92 2e-15
220gb|AY264208.1| Platydoras costatus elongation factor-1 alpha gen... 92 2e-15
221gb|AY264206.1| Lithodoras dorsalis elongation factor-1 alpha gen... 92 2e-15
222gb|AY264205.1| Megalodoras uranoscopus elongation factor-1 alpha... 92 2e-15
223gb|AY264203.1| Physopyxis lyra elongation factor-1 alpha gene, e... 92 2e-15
224gb|AY264202.1| Hypodoras forficulatus elongation factor-1 alpha ... 92 2e-15
225gb|AY264196.1| Hypophthalmus edentatus elongation factor-1 alpha... 92 2e-15
226ref|XM_799615.1| Trypanosoma cruzi strain CL Brener elongation f... 90 8e-15
227ref|XM_799616.1| Trypanosoma cruzi strain CL Brener elongation f... 90 8e-15
228ref|XM_801736.1| Trypanosoma cruzi strain CL Brener elongation f... 90 8e-15
229ref|XM_814346.1| Trypanosoma cruzi strain CL Brener elongation f... 90 8e-15
230ref|XM_814347.1| Trypanosoma cruzi strain CL Brener elongation f... 90 8e-15
231ref|XM_799617.1| Trypanosoma cruzi strain CL Brener elongation f... 90 8e-15
232ref|XM_801742.1| Trypanosoma cruzi strain CL Brener elongation f... 90 8e-15
233dbj|D29834.1| Trypanosoma cruzi mRNA for elongation factor 1 alp... 90 8e-15
234gb|AY264250.1| Ageneiosus ucayalensis elongation factor-1 alpha ... 88 3e-14
235gb|AF485331.1| Cyprinus carpio elongation factor 1-alpha mRNA, c... 88 3e-14
236ref|NM_001037030.1| Arabidopsis thaliana calmodulin binding / tr... 86 1e-13
237gb|BT012812.1| Lycopersicon esculentum clone 113856R, mRNA sequence 86 1e-13
238gb|AY264199.1| Amblydoras cf. affinis haplotype II elongation fa... 86 1e-13
239ref|XM_817373.1| Trypanosoma brucei TREU927 elongation factor 1-... 86 1e-13
240ref|XM_817372.1| Trypanosoma brucei TREU927 elongation factor 1-... 86 1e-13
241ref|XM_817371.1| Trypanosoma brucei TREU927 elongation factor 1-... 86 1e-13
242gb|U10562.1|TBU10562 Trypanosoma brucei elongation factor-1 alph... 86 1e-13
243gb|L25868.1|TRBTEF1A Trypanosoma brucei elongation factor 1-alph... 86 1e-13
244gb|AY574951.1| Solanum nigrum elongation factor 1 alpha mRNA, pa... 84 5e-13
245gb|AY264254.1| Liosomadoras morrowi elongation factor-1 alpha ge... 84 5e-13
246gb|AY264246.1| Doras punctatus elongation factor-1 alpha gene, e... 84 5e-13
247gb|AY264244.1| Trachydoras nattereri haplotype II elongation fac... 84 5e-13
248gb|AY264238.1| Leptodoras cf. praelongus elongation factor-1 alp... 84 5e-13
249gb|AY264237.1| Leptodoras sp. 1-GM-2003 elongation factor-1 alph... 84 5e-13
250gb|AY264235.1| Leptodoras sp. 3-GM-2003 elongation factor-1 alph... 84 5e-13
251gb|AY264234.1| Leptodoras sp. 3-GM-2003 elongation factor-1 alph... 84 5e-13
252gb|AY264232.1| Leptodoras juruensis elongation factor-1 alpha ge... 84 5e-13
253gb|AY264230.1| Leptodoras hasemani elongation factor-1 alpha gen... 84 5e-13
254gb|AY264227.1| Hemidoras stenopeltis haplotype II elongation fac... 84 5e-13
255gb|AY264226.1| Hemidoras stenopeltis haplotype I elongation fact... 84 5e-13
256gb|AY264220.1| Nemadoras trimaculatus elongation factor-1 alpha ... 84 5e-13
257gb|AY264218.1| Doras carinatus elongation factor-1 alpha gene, e... 84 5e-13
258gb|AY264216.1| Pterodoras granulosus elongation factor-1 alpha g... 84 5e-13
259gb|AY264213.1| Oxydoras niger haplotype I elongation factor-1 al... 84 5e-13
260gb|AY264211.1| Rhinodoras thomersoni elongation factor-1 alpha g... 84 5e-13
261gb|AY264198.1| Zungaro zungaro elongation factor-1 alpha gene, e... 84 5e-13
262gb|AY264197.1| Sorubim lima elongation factor-1 alpha gene, exon... 84 5e-13
263gb|DQ447161.1| Passiflora edulis translation elongation factor 1... 84 5e-13
264gb|AF268670.1|AF268670 Numida meleagris DNA sequence derived usi... 84 5e-13
265dbj|AB183717.1| Lethenteron japonicum LjEF-1a mRNA for elongatio... 84 5e-13
266dbj|AB098024.1| Porphyra yezoensis EF-1a gene for elongation fac... 82 2e-12
267dbj|AB048204.1| Porphyra yezoensis EF-1a mRNA for elongation fac... 82 2e-12
268gb|L47669.1|ZEFEF1A Brachydanio rerio translation elongation fac... 80 8e-12
269ref|XM_697094.1| PREDICTED: Danio rerio hypothetical protein LOC... 78 3e-11
270emb|BX935744.1| Gallus gallus finished cDNA, clone ChEST2k15 78 3e-11
271gb|L00677.1|CHKEF1A Gallus gallus elongation factor 1 alpha mRNA... 78 3e-11
272gb|BT019804.1| Synthetic construct Homo sapiens eukaryotic trans... 76 1e-10
273gb|BT019803.1| Synthetic construct Homo sapiens eukaryotic trans... 76 1e-10
274gb|AY712790.1| Felis catus elongation factor 1 alpha mRNA, compl... 76 1e-10
275gb|BC072542.1| Rattus norvegicus eukaryotic translation elongati... 76 1e-10
276gb|BC063162.1| Rattus norvegicus eukaryotic translation elongati... 76 1e-10
277gb|BC000432.2| Homo sapiens eukaryotic translation elongation fa... 76 1e-10
278gb|AY264239.1| Leptodoras praelongus elongation factor-1 alpha g... 76 1e-10
279gb|AY264233.1| Leptodoras acipenserinus elongation factor-1 alph... 76 1e-10
280gb|AY264228.1| Opsodoras stuebelii elongation factor-1 alpha gen... 76 1e-10
281gb|AY264204.1| Anadoras grypus elongation factor-1 alpha gene, e... 76 1e-10
282gb|AY264201.1| Amblydoras cf. monitor elongation factor-1 alpha ... 76 1e-10
283gb|AY264200.1| Amblydoras nauticus elongation factor-1 alpha gen... 76 1e-10
284ref|XM_852185.1| PREDICTED: Canis familiaris similar to eukaryot... 76 1e-10
285ref|XM_852052.1| PREDICTED: Canis familiaris similar to eukaryot... 76 1e-10
286ref|XM_845314.1| PREDICTED: Canis familiaris similar to eukaryot... 76 1e-10
287ref|XM_846482.1| PREDICTED: Canis familiaris similar to eukaryot... 76 1e-10
288ref|XM_845726.1| PREDICTED: Canis familiaris similar to eukaryot... 76 1e-10
289ref|XM_843675.1| PREDICTED: Canis familiaris similar to eukaryot... 76 1e-10
290ref|XM_851994.1| PREDICTED: Canis familiaris similar to eukaryot... 76 1e-10
291ref|XM_533344.2| PREDICTED: Canis familiaris similar to eukaryot... 76 1e-10
292ref|XM_860644.1| PREDICTED: Canis familiaris similar to eukaryot... 76 1e-10
293ref|XM_860631.1| PREDICTED: Canis familiaris similar to eukaryot... 76 1e-10
294ref|XM_860616.1| PREDICTED: Canis familiaris similar to eukaryot... 76 1e-10
295ref|XM_860599.1| PREDICTED: Canis familiaris similar to eukaryot... 76 1e-10
296ref|XM_847329.1| PREDICTED: Canis familiaris similar to eukaryot... 76 1e-10
297ref|XM_847233.1| PREDICTED: Canis familiaris similar to eukaryot... 76 1e-10
298ref|XM_532203.2| PREDICTED: Canis familiaris eukaryotic translat... 76 1e-10
299ref|XM_862288.1| PREDICTED: Canis familiaris eukaryotic translat... 76 1e-10
300gb|BC018855.2| Homo sapiens eukaryotic translation elongation fa... 76 1e-10
301emb|CR731666.2|CNS0GRHZ Tetraodon nigroviridis full-length cDNA 76 1e-10
302ref|XM_849232.1| PREDICTED: Canis familiaris similar to eukaryot... 76 1e-10
303gb|AY117542.1| Litopenaeus stylirostris elongation factor 1-alph... 76 1e-10
304emb|CR626526.1| full-length cDNA clone CS0DF022YE23 of Fetal bra... 76 1e-10
305emb|CR626229.1| full-length cDNA clone CS0DF035YB19 of Fetal bra... 76 1e-10
306emb|CR622432.1| full-length cDNA clone CS0DF022YE17 of Fetal bra... 76 1e-10
307emb|CR621513.1| full-length cDNA clone CL0BB003ZA11 of Neuroblas... 76 1e-10
308emb|CR616067.1| full-length cDNA clone CS0DF027YE14 of Fetal bra... 76 1e-10
309emb|CR614088.1| full-length cDNA clone CS0DA011YO22 of Neuroblas... 76 1e-10
310emb|CR613690.1| full-length cDNA clone CS0DA008YL24 of Neuroblas... 76 1e-10
311emb|CR608520.1| full-length cDNA clone CS0DF026YL10 of Fetal bra... 76 1e-10
312emb|CR604699.1| full-length cDNA clone CS0DF031YE07 of Fetal bra... 76 1e-10
313emb|CR602821.1| full-length cDNA clone CS0DF033YL04 of Fetal bra... 76 1e-10
314emb|CR600141.1| full-length cDNA clone CS0DF036YB07 of Fetal bra... 76 1e-10
315emb|CR597004.1| full-length cDNA clone CS0DA004YG17 of Neuroblas... 76 1e-10
316emb|CR593279.1| full-length cDNA clone CS0DF032YD11 of Fetal bra... 76 1e-10
317emb|CR592792.1| full-length cDNA clone CS0DF008YI21 of Fetal bra... 76 1e-10
318emb|CR589974.1| full-length cDNA clone CS0DF034YE11 of Fetal bra... 76 1e-10
319gb|AF498320.1| Oncorhynchus mykiss elongation factor EF1 alpha m... 76 1e-10
320ref|NM_001958.2| Homo sapiens eukaryotic translation elongation ... 76 1e-10
321ref|NM_175838.1| Rattus norvegicus eukaryotic translation elonga... 76 1e-10
322gb|AF321836.1| Salmo salar elongation factor 1 alpha mRNA, compl... 76 1e-10
323gb|AF268682.1|AF268682 Meleagris gallopavo DNA sequence derived ... 76 1e-10
324ref|NM_001009326.1| Felis catus elongation factor 1 alpha (EF1A)... 76 1e-10
325ref|XM_215885.3| PREDICTED: Rattus norvegicus similar to zinc fi... 76 1e-10
326gb|AY891430.1| Synthetic construct Homo sapiens clone FLH117043.... 76 1e-10
327gb|AY891104.1| Synthetic construct Homo sapiens clone FLH007860.... 76 1e-10
328gb|AY891103.1| Synthetic construct Homo sapiens clone FLH007859.... 76 1e-10
329gb|BC091297.1| Rattus norvegicus eukaryotic translation elongati... 76 1e-10
330gb|BC111707.1| Rattus norvegicus eukaryotic translation elongati... 76 1e-10
331emb|X61043.1|RNEF1AA R.norvegicus mRNA for elongation factor 1 a... 76 1e-10
332emb|X63561.1|RNELF1A R.norvegicus mRNA for elongation factor 1-a... 76 1e-10
333ref|NM_033539.1| Rattus norvegicus eukaryotic translation elonga... 76 1e-10
334gb|L10339.1|RATEF1AX Rat elongation factor-1 alpha (ef-1) mRNA, ... 76 1e-10
335gb|M81088.1|RATEF1A Rat EF-1-alpha mRNA, 3' end 76 1e-10
336dbj|D00522.1|CRUEF1A Cricetulus longicaudatus mRNA for EF-1 alph... 76 1e-10
337gb|U09823.1|OCU09823 Oryctolagus cuniculus New Zealand white elo... 76 1e-10
338gb|BC108391.1| Mus musculus eukaryotic translation elongation fa... 74 5e-10
339gb|BC083069.1| Mus musculus eukaryotic translation elongation fa... 74 5e-10
340gb|BC099609.1| Mus musculus eukaryotic translation elongation fa... 74 5e-10
341gb|BC004067.1| Mus musculus eukaryotic translation elongation fa... 74 5e-10
342gb|BC004005.1| Mus musculus eukaryotic translation elongation fa... 74 5e-10
343ref|NM_010106.1| Mus musculus eukaryotic translation elongation ... 74 5e-10
344gb|BC018485.1| Mus musculus eukaryotic translation elongation fa... 74 5e-10
345ref|XM_856907.1| PREDICTED: Canis familiaris similar to eukaryot... 74 5e-10
346ref|XM_856877.1| PREDICTED: Canis familiaris similar to eukaryot... 74 5e-10
347ref|XM_856852.1| PREDICTED: Canis familiaris similar to eukaryot... 74 5e-10
348ref|XM_856828.1| PREDICTED: Canis familiaris similar to eukaryot... 74 5e-10
349ref|XM_856800.1| PREDICTED: Canis familiaris similar to eukaryot... 74 5e-10
350ref|XM_856776.1| PREDICTED: Canis familiaris similar to eukaryot... 74 5e-10
351ref|XM_845503.1| PREDICTED: Canis familiaris similar to eukaryot... 74 5e-10
352gb|BC068258.1| Mus musculus eukaryotic translation elongation fa... 74 5e-10
353emb|CR734347.2|CNS0GTEI Tetraodon nigroviridis full-length cDNA 74 5e-10
354emb|CR714097.2|CNS0GDY5 Tetraodon nigroviridis full-length cDNA 74 5e-10
355emb|CR713922.2|CNS0GDTA Tetraodon nigroviridis full-length cDNA 74 5e-10
356emb|CR713230.2|CNS0GDA2 Tetraodon nigroviridis full-length cDNA 74 5e-10
357emb|CR708676.2|CNS0G9RK Tetraodon nigroviridis full-length cDNA 74 5e-10
358emb|CR707980.2|CNS0G988 Tetraodon nigroviridis full-length cDNA 74 5e-10
359emb|CR707258.2|CNS0G8O6 Tetraodon nigroviridis full-length cDNA 74 5e-10
360emb|CR704503.2|CNS0G6JN Tetraodon nigroviridis full-length cDNA 74 5e-10
361emb|CR704481.2|CNS0G6J1 Tetraodon nigroviridis full-length cDNA 74 5e-10
362emb|CR701796.2|CNS0G4GG Tetraodon nigroviridis full-length cDNA 74 5e-10
363emb|CR701403.2|CNS0G45J Tetraodon nigroviridis full-length cDNA 74 5e-10
364emb|CR697637.1|CNS0G18X Tetraodon nigroviridis full-length cDNA 74 5e-10
365emb|CR696165.2|CNS0G041 Tetraodon nigroviridis full-length cDNA 74 5e-10
366emb|CR694079.2|CNS0FYI3 Tetraodon nigroviridis full-length cDNA 74 5e-10
367emb|CR693709.2|CNS0FY7T Tetraodon nigroviridis full-length cDNA 74 5e-10
368emb|CR688857.2|CNS0FUH1 Tetraodon nigroviridis full-length cDNA 74 5e-10
369emb|CR687115.2|CNS0FT4N Tetraodon nigroviridis full-length cDNA 74 5e-10
370emb|CR685287.2|CNS0FRPV Tetraodon nigroviridis full-length cDNA 74 5e-10
371gb|BC050124.1| Mus musculus cDNA clone IMAGE:30028883, **** WARN... 74 5e-10
372emb|X13661.1|MMEF1A Mouse mRNA for elongation factor 1-alpha (EF... 74 5e-10
373gb|BC095965.1| Mus musculus eukaryotic translation elongation fa... 74 5e-10
374gb|BC005660.1| Mus musculus eukaryotic translation elongation fa... 74 5e-10
375gb|BC092276.1| Mus musculus eukaryotic translation elongation fa... 74 5e-10
376gb|BC018223.1| Mus musculus eukaryotic translation elongation fa... 74 5e-10
377dbj|AK137223.1| Mus musculus adult male urinary bladder cDNA, RI... 74 5e-10
378dbj|AK135448.1| Mus musculus 12 days embryo female mullerian duc... 74 5e-10
379dbj|AK152993.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 74 5e-10
380dbj|AK133725.1| Mus musculus 6 days neonate head cDNA, RIKEN ful... 74 5e-10
381dbj|AK141243.1| Mus musculus ES cells cDNA, RIKEN full-length en... 74 5e-10
382dbj|AK150798.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 74 5e-10
383dbj|AK153851.1| Mus musculus 2 days neonate thymus thymic cells ... 74 5e-10
384dbj|AK151479.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 74 5e-10
385dbj|AK162440.1| Mus musculus 12 days embryo embryonic body betwe... 74 5e-10
386dbj|AK162313.1| Mus musculus adult male colon cDNA, RIKEN full-l... 74 5e-10
387dbj|AK166807.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 74 5e-10
388dbj|AK153402.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 74 5e-10
389dbj|AK153387.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 74 5e-10
390dbj|AK166615.1| Mus musculus morula whole body morula cDNA, RIKE... 74 5e-10
391dbj|AK162049.1| Mus musculus 12 days embryo female mullerian duc... 74 5e-10
392dbj|AK164113.1| Mus musculus 12 days embryo spinal cord cDNA, RI... 74 5e-10
393dbj|AK168467.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 74 5e-10
394dbj|AK168424.1| Mus musculus 17 days pregnant adult female amnio... 74 5e-10
395dbj|AK166089.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 74 5e-10
396dbj|AK166058.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 74 5e-10
397dbj|AK166033.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 74 5e-10
398dbj|AK164671.1| Mus musculus 13 days embryo stomach cDNA, RIKEN ... 74 5e-10
399dbj|AK163799.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 74 5e-10
400dbj|AK167873.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 74 5e-10
401dbj|AK166021.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 74 5e-10
402dbj|AK165938.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 74 5e-10
403dbj|AK032914.1| Mus musculus 12 days embryo male wolffian duct i... 74 5e-10
404dbj|AK003188.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 74 5e-10
405dbj|AK081725.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 74 5e-10
406gb|BC040689.1| Mus musculus eukaryotic translation elongation fa... 74 5e-10
407dbj|AK088041.1| Mus musculus 2 days neonate thymus thymic cells ... 74 5e-10
408dbj|AK076696.1| Mus musculus adult male testis cDNA, RIKEN full-... 74 5e-10
409dbj|AK083361.1| Mus musculus 2 days neonate thymus thymic cells ... 74 5e-10
410dbj|AK050635.1| Mus musculus 2 days neonate thymus thymic cells ... 74 5e-10
411dbj|AK012341.1| Mus musculus 11 days embryo whole body cDNA, RIK... 74 5e-10
412dbj|AK011771.1| Mus musculus 10 days embryo whole body cDNA, RIK... 74 5e-10
413dbj|AK196726.1| Mus musculus cDNA, clone:Y1G0122L17, strand:plus... 74 5e-10
414dbj|AK185520.1| Mus musculus cDNA, clone:Y0G0134F15, strand:plus... 74 5e-10
415gb|BC092053.1| Mus musculus eukaryotic translation elongation fa... 74 5e-10
416dbj|AB075952.1| Oreochromis niloticus EF-1a mRNA for elongation ... 74 5e-10
417gb|BC092292.1| Mus musculus cDNA clone IMAGE:5068840, containing... 74 5e-10
418gb|BC003969.1| Mus musculus eukaryotic translation elongation fa... 74 5e-10
419gb|AY264215.1| Agamyxis albomaculatus elongation factor-1 alpha ... 72 2e-09
420ref|XM_844920.1| PREDICTED: Canis familiaris similar to eukaryot... 72 2e-09
421emb|CR734125.2|CNS0GT8C Tetraodon nigroviridis full-length cDNA 72 2e-09
422gb|DQ138080.1| Phytophthora parasitica isolate 149 translation e... 72 2e-09
423emb|BX815663.1|CNS0ABIH Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
424dbj|AK204373.1| Mus musculus cDNA, clone:Y1G0148D05, strand:plus... 72 2e-09
425dbj|AB020734.1| Oryzias latipes gene for polypeptide elongation ... 72 2e-09
426dbj|AB003709.1| Owenia fusiformis mRNA for elongation factor-1al... 72 2e-09
427gb|AY264251.1| Auchenipterus demerarae elongation factor-1 alpha... 70 8e-09
428gb|AY264231.1| Anduzedoras oxyrhynchus elongation factor-1 alpha... 70 8e-09
429gb|AY264207.1| Centrodoras cf. brachiatus elongation factor-1 al... 70 8e-09
430emb|X73529.1|PGEFIA P.graminis ef-1alpha gene for elongation factor 70 8e-09
431emb|AJ720062.1| Gallus gallus mRNA for hypothetical protein, clo... 70 8e-09
432ref|NM_204157.2| Gallus gallus eukaryotic translation elongation... 70 8e-09
433dbj|AB214933.1| Raja kenojei EF-1a mRNA for elongation factor 1 ... 70 8e-09
434dbj|AB124568.1| Pelodiscus sinensis PsEF1a mRNA for elongation f... 70 8e-09
435gb|AC097023.6| Rattus norvegicus BAC CH230-35L12 (Children's Hos... 68 3e-08
436gb|BC060907.1| Danio rerio zgc:73138, mRNA (cDNA clone MGC:73138... 68 3e-08
437gb|AY264258.1| Dianema longibarbus elongation factor-1 alpha gen... 68 3e-08
438ref|NM_200009.1| Danio rerio zgc:73138 (zgc:73138), mRNA 68 3e-08
439ref|XM_846211.1| PREDICTED: Canis familiaris similar to eukaryot... 68 3e-08
440ref|XM_851020.1| PREDICTED: Canis familiaris similar to eukaryot... 68 3e-08
441ref|XM_850978.1| PREDICTED: Canis familiaris similar to eukaryot... 68 3e-08
442ref|XM_850940.1| PREDICTED: Canis familiaris similar to eukaryot... 68 3e-08
443ref|XR_000307.2| PREDICTED: Canis familiaris similar to eukaryot... 68 3e-08
444ref|XM_845929.1| PREDICTED: Canis familiaris similar to eukaryot... 68 3e-08
445ref|XM_851802.1| PREDICTED: Canis familiaris similar to eukaryot... 68 3e-08
446ref|XM_843622.1| PREDICTED: Canis familiaris similar to eukaryot... 68 3e-08
447ref|XR_001576.1| PREDICTED: Mus musculus similar to eukaryotic t... 68 3e-08
448ref|XM_848924.1| PREDICTED: Canis familiaris similar to eukaryot... 68 3e-08
449ref|XR_003310.1| PREDICTED: Mus musculus similar to eukaryotic t... 68 3e-08
450ref|XM_854975.1| PREDICTED: Canis familiaris similar to eukaryot... 68 3e-08
451ref|XM_844790.1| PREDICTED: Canis familiaris similar to eukaryot... 68 3e-08
452ref|XM_850407.1| PREDICTED: Canis familiaris similar to eukaryot... 68 3e-08
453ref|XM_862880.1| PREDICTED: Canis familiaris similar to eukaryot... 68 3e-08
454ref|XM_860614.1| PREDICTED: Canis familiaris similar to eukaryot... 68 3e-08
455ref|XM_532520.2| PREDICTED: Canis familiaris similar to eukaryot... 68 3e-08
456ref|NM_001037464.1| Bos taurus eukaryotic translation elongation... 68 3e-08
457emb|CR734384.2|CNS0GTFJ Tetraodon nigroviridis full-length cDNA 68 3e-08
458emb|CR713766.2|CNS0GDOY Tetraodon nigroviridis full-length cDNA 68 3e-08
459emb|CR691578.2|CNS0FWKM Tetraodon nigroviridis full-length cDNA 68 3e-08
460ref|XM_843767.1| PREDICTED: Canis familiaris similar to eukaryot... 68 3e-08
461ref|XM_843332.1| PREDICTED: Canis familiaris similar to eukaryot... 68 3e-08
462emb|X70940.1|HSEFAC1A2 H.sapiens mRNA for elongation factor 1 al... 68 3e-08
463gb|BC108110.1| Bos taurus cDNA clone MGC:128473 IMAGE:7984422, c... 68 3e-08
464dbj|AB199910.1| Hyla japonica ef 1a mRNA for elongation factor 1... 68 3e-08
465dbj|AB193485.1| Takifugu rubripes EF-1a mRNA for elongation fact... 68 3e-08
466gb|AF268667.1|AF268667 Coturnix coturnix DNA sequence derived us... 68 3e-08
467ref|XM_227080.3| PREDICTED: Rattus norvegicus similar to eukaryo... 68 3e-08
468ref|NM_001037873.1| Takifugu rubripes elongation factor 1 alpha ... 68 3e-08
469gb|AF035178.1|AF035178 Oryctolagus cuniculus elongation factor 1... 68 3e-08
470gb|L10340.1|HUMHS1X Human elongation factor-1 alpha (ef-1) mRNA,... 68 3e-08
471emb|AL840626.7| Mouse DNA sequence from clone RP23-151M8 on chro... 68 3e-08
472dbj|AB013606.1| Oryzias latipes mRNA for elongation factor 1 alp... 68 3e-08
473gb|AC166316.2| Mus musculus chromosome 19, clone RP23-466L5, com... 66 1e-07
474gb|AF063412.1| Limnadia lenticularis elongation factor 1-alpha m... 66 1e-07
475gb|AC158987.3| Mus musculus BAC clone RP23-366K1 from chromosome... 66 1e-07
476ref|XR_004482.1| PREDICTED: Mus musculus similar to eukaryotic t... 66 1e-07
477ref|XR_004003.1| PREDICTED: Mus musculus similar to eukaryotic t... 66 1e-07
478ref|XR_005144.1| PREDICTED: Mus musculus similar to eukaryotic t... 66 1e-07
479ref|XM_851132.1| PREDICTED: Canis familiaris similar to eukaryot... 66 1e-07
480ref|XM_851087.1| PREDICTED: Canis familiaris similar to eukaryot... 66 1e-07
481gb|AF526289.1| Imnadia yeyetta elongation factor-1 alpha gene, p... 66 1e-07
482emb|CR734901.2|CNS0GTTW Tetraodon nigroviridis full-length cDNA 66 1e-07
483emb|CR734626.2|CNS0GTM9 Tetraodon nigroviridis full-length cDNA 66 1e-07
484emb|CR734377.2|CNS0GTFC Tetraodon nigroviridis full-length cDNA 66 1e-07
485emb|CR733596.2|CNS0GSTN Tetraodon nigroviridis full-length cDNA 66 1e-07
486emb|CR733536.2|CNS0GSRZ Tetraodon nigroviridis full-length cDNA 66 1e-07
487emb|CR732462.2|CNS0GS43 Tetraodon nigroviridis full-length cDNA 66 1e-07
488emb|CR731974.2|CNS0GRQJ Tetraodon nigroviridis full-length cDNA 66 1e-07
489emb|CR731790.1|CNS0GRLF Tetraodon nigroviridis full-length cDNA 66 1e-07
490emb|CR731544.2|CNS0GREL Tetraodon nigroviridis full-length cDNA 66 1e-07
491emb|CR731362.2|CNS0GR9J Tetraodon nigroviridis full-length cDNA 66 1e-07
492emb|CR731103.2|CNS0GR2C Tetraodon nigroviridis full-length cDNA 66 1e-07
493emb|CR730819.2|CNS0GQUG Tetraodon nigroviridis full-length cDNA 66 1e-07
494emb|CR730766.2|CNS0GQSZ Tetraodon nigroviridis full-length cDNA 66 1e-07
495emb|CR730432.2|CNS0GQJP Tetraodon nigroviridis full-length cDNA 66 1e-07
496emb|CR730309.2|CNS0GQGA Tetraodon nigroviridis full-length cDNA 66 1e-07
497emb|CR730105.2|CNS0GQAN Tetraodon nigroviridis full-length cDNA 66 1e-07
498emb|CR730060.1|CNS0GQ9E Tetraodon nigroviridis full-length cDNA 66 1e-07
499emb|CR728426.2|CNS0GP00 Tetraodon nigroviridis full-length cDNA 66 1e-07
500emb|CR728405.1|CNS0GOZF Tetraodon nigroviridis full-length cDNA 66 1e-07 
>gb|L11740.1|BLYEFIA Barley elongation factor 1 alpha, (EF-1A) mRNA sequence
          Length = 1725

 Score =  983 bits (496), Expect = 0.0
 Identities = 514/520 (98%), Gaps = 1/520 (0%)
 Strand = Plus / Minus

                                                                        
Query: 1    acatgatgactgtntatggtagcaacattaactgatgaagttccaccaacacaaccgaac 60
            ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1642 acatgatgactatatatggtagcaacattaactgatgaagttccaccaacacaaccgaac 1583

                                                                        
Query: 61   gatacaatgaccagagctttaagcagttcaaacacttctcgacacaaataacccaagcga 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1582 gatacaatgaccagagctttaagcagttcaaacacttctcgacacaaataacccaagcga 1523

                                                                        
Query: 121  ctaaaacaactatcgccaccaccaaacaccgccaccgcgcaccatagatgtggtaaagaa 180
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 1522 ctaaaacaactatcgccaccaccaaacaccgccaccgc-caccatagatgtggtaaagaa 1464

                                                                        
Query: 181  cctgacaccatctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctc 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1463 cctgacaccatctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctc 1404

                                                                        
Query: 241  cttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggc 300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1403 cttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggc 1344

                                                                        
Query: 301  aaaccgacccagaggagggtactgggcaaaggtctncaccaccatgggcttggttggaat 360
            ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 1343 aaaccgacccagaggagggtactgggcaaaggtctccaccaccatgggcttggttggaat 1284

                                                                        
Query: 361  catcttgacgaacccagcatcaccattcttgagaaacttgggcgctgnctccagctcctt 420
            ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 1283 catcttgacgaacccagcatcaccattcttgagaaacttgggcgctgcctccagctcctt 1224

                                                                        
Query: 421  gccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgt 480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1223 gccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgt 1164

                                                    
Query: 481  gtggcagtccancacaggggcataaccgttgctgatctgg 520
            ||||||||||| ||||||||||||||||||||||||||||
Sbjct: 1163 gtggcagtccagcacaggggcataaccgttgctgatctgg 1124
to top
>emb|Z23130.1|HVBLT63A H.vulgare BLT63 mRNA, complete CDS
          Length = 1560

 Score =  948 bits (478), Expect = 0.0
 Identities = 494/499 (98%), Gaps = 1/499 (0%)
 Strand = Plus / Minus

                                                                        
Query: 22   gcaacattaactgatgaagttccaccaacacaaccgaacgatacaatgaccagagcttta 81
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1560 gcaacattaactgatgaagttccaccaacacaaccgaacgatacaatgaccagagcttta 1501

                                                                        
Query: 82   agcagttcaaacacttctcgacacaaataacccaagcgactaaaacaactatcgccacca 141
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1500 agcagttcaaacacttctcgacacaaataacccaagcgactaaaacaactatcgccacca 1441

                                                                        
Query: 142  ccaaacaccgccaccgcgcaccatagatgtggtaaagaacctgacaccatctcatttctt 201
            ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1440 ccaaacaccgccaccgc-caccatagatgtggtaaagaacctgacaccatctcatttctt 1382

                                                                        
Query: 202  cttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgat 261
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1381 cttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgat 1322

                                                                        
Query: 262  cacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggta 321
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1321 cacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggta 1262

                                                                        
Query: 322  ctgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatc 381
            |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1261 ctgggcaaaggtctccaccaccatgggcttggttggaatcatcttgacgaacccagcatc 1202

                                                                        
Query: 382  accattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatctt 441
            |||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||
Sbjct: 1201 accattcttgagaaacttgggcgctgcctccagctccttgcccgaccgcctgtcgatctt 1142

                                                                        
Query: 442  ggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggc 501
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1141 ggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccagcacaggggc 1082

                               
Query: 502  ataaccgttgctgatctgg 520
            |||||||||||||||||||
Sbjct: 1081 ataaccgttgctgatctgg 1063
to top
>gb|AF479046.1| Triticum aestivum elongation factor-1 alpha mRNA, partial cds
          Length = 432

 Score =  381 bits (192), Expect = e-102
 Identities = 293/328 (89%)
 Strand = Plus / Minus

                                                                       
Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
           |||||||||||||  |||||||||||| ||||||||||||||||| ||||| ||||||||
Sbjct: 432 tcatttcttcttggccgcagccttggtcaccttggcgccggtcggatccttnttctccac 373

                                                                       
Query: 253 gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
           |  |||||| || ||||| |||||||||||||||||||||||||| ||||| || |||||
Sbjct: 372 ggccttgataacgcccaccgcaaccgtctgcctcatgtcacgcacagcaaagcggcccag 313

                                                                       
Query: 313 aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
            ||||||||||| || ||||||| |||||||||||||||||| || ||||||||||||||
Sbjct: 312 gggagggtactgagcgaaggtctccaccaccatgggcttggtggggatcatcttgacgaa 253

                                                                       
Query: 373 cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
           ||| |||||||| |||||||| ||||||||||| | ||| | ||||||||| ||||||| 
Sbjct: 252 cccggcatcaccgttcttgaggaacttgggcgccgcctcaatctccttgccagaccgccg 193

                                                                       
Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
           ||||||||||||||||||||| || |||||||| ||||||||||| ||||||||||||| 
Sbjct: 192 gtcgatcttggtctggatctcagcaaacttgacagcgatgtgggacgtgtggcagtccag 133

                                       
Query: 493 cacaggggcataaccgttgctgatctgg 520
           ||| |||||||| |||||||||||||||
Sbjct: 132 cactggggcatagccgttgctgatctgg 105
to top
>dbj|D63581.1| Oryza sativa mRNA for EF-1 alpha, complete cds
          Length = 1630

 Score =  283 bits (143), Expect = 3e-73
 Identities = 281/328 (85%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            ||||||||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 1406 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1347

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            || ||||||| || || ||||| ||||| ||||||||||||||||||||||| ||||| |
Sbjct: 1346 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaa 1287

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || |
Sbjct: 1286 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1227

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| |||||||| ||||||||| |   |||||||||||||||||| || |
Sbjct: 1226 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttgccggatcgtc 1167

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            ||||||||||||||   | ||| || ||||||||||| |||||||| |||||||||||||
Sbjct: 1166 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 1107

                                        
Query: 492  ncacaggggcataaccgttgctgatctg 519
             ||| ||||| || ||||||| ||||||
Sbjct: 1106 gcactggggcgtagccgttgccgatctg 1079
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  268 bits (135), Expect = 2e-68
 Identities = 279/328 (85%)
 Strand = Plus / Minus

                                                                           
Query: 192     ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
               ||||||||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 4101208 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4101149

                                                                           
Query: 252     cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
               || ||||||| || || ||||| ||||| ||||||||||||||||||||||| ||||| |
Sbjct: 4101148 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaa 4101089

                                                                           
Query: 312     gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
               ||||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || |
Sbjct: 4101088 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 4101029

                                                                           
Query: 372     acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
                 ||||||||||| |||||||| ||||||||| |   |||||||||||||||||| || |
Sbjct: 4101028 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttgccggatcgtc 4100969

                                                                           
Query: 432     tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
               ||||||||||||||   | ||| || ||||||||||| ||||| || |||||||||||||
Sbjct: 4100968 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgtgaggtgtggcagtcca 4100909

                                           
Query: 492     ncacaggggcataaccgttgctgatctg 519
                ||| ||||| || || |||| ||||||
Sbjct: 4100908 gcactggggcgtagccattgccgatctg 4100881



 Score =  268 bits (135), Expect = 2e-68
 Identities = 279/328 (85%)
 Strand = Plus / Minus

                                                                           
Query: 193     tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
               |||||||||||||   ||||||||||| |||||||| ||||| || ||||||||||||||
Sbjct: 4084355 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 4084296

                                                                           
Query: 253     gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
               | ||||||| || || ||||| ||||| ||||||||||||||||||||||| ||||| ||
Sbjct: 4084295 gttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaag 4084236

                                                                           
Query: 313     aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
               |||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || | 
Sbjct: 4084235 aggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaaccat 4084176

                                                                           
Query: 373     cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
                ||||||||||| |||||||| ||||||||| |   |||||||||||| || || || ||
Sbjct: 4084175 accagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtct 4084116

                                                                           
Query: 433     gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
               |||||||||||||   | ||| || ||||||||||| |||||||| ||||||||||||| 
Sbjct: 4084115 gtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtccag 4084056

                                           
Query: 493     cacaggggcataaccgttgctgatctgg 520
               ||| ||||| || ||||||| |||||||
Sbjct: 4084055 cactggggcgtagccgttgccgatctgg 4084028



 Score =  262 bits (132), Expect = 1e-66
 Identities = 279/329 (84%)
 Strand = Plus / Minus

                                                                           
Query: 192     ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
               ||||||||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 4078916 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4078857

                                                                           
Query: 252     cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
               || ||||||| || || ||||| ||||| ||||||||||| ||||||||||| ||||| |
Sbjct: 4078856 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 4078797

                                                                           
Query: 312     gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
               ||||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || |
Sbjct: 4078796 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 4078737

                                                                           
Query: 372     acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
                 ||||||||||| |||||||| ||||||||| |   |||||||||||| || || || |
Sbjct: 4078736 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 4078677

                                                                           
Query: 432     tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
               ||||||||||||||   | ||| || ||||||||||| |||||||| |||||||||||||
Sbjct: 4078676 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 4078617

                                            
Query: 492     ncacaggggcataaccgttgctgatctgg 520
                ||| ||||| || ||||||| |||||||
Sbjct: 4078616 gcactggggcgtagccgttgccgatctgg 4078588



 Score =  228 bits (115), Expect = 1e-56
 Identities = 274/328 (83%)
 Strand = Plus / Minus

                                                                           
Query: 192     ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
               |||| |||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 4095038 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4094979

                                                                           
Query: 252     cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
               || ||||||| || || ||||| ||||| ||||||||||||||||| ||||| ||||| |
Sbjct: 4094978 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 4094919

                                                                           
Query: 312     gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
               ||||||||||||  |  ||||||| ||| |||||||||||||| |||||||||||||| |
Sbjct: 4094918 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 4094859

                                                                           
Query: 372     acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
                 ||||||||||| ||||| |  ||||||||| |   ||||||||||||||| || || |
Sbjct: 4094858 taccagcatcaccgttcttcaagaacttgggctccttctccagctccttgccagatcgtc 4094799

                                                                           
Query: 432     tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
               |||| |||||||||   | ||| || |||||||| || |||||||| |||||||||||||
Sbjct: 4094798 tgtcaatcttggtcaccagctcagcaaacttgacagcaatgtgggaggtgtggcagtcca 4094739

                                           
Query: 492     ncacaggggcataaccgttgctgatctg 519
                ||| || ||||| ||||| | ||||||
Sbjct: 4094738 gcactggagcatagccgttaccgatctg 4094711



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 449      atctcggcgaacttgacggcgatg 472
                |||||||||||||||| |||||||
Sbjct: 32280324 atctcggcgaacttgaaggcgatg 32280347
to top
>gb|AC090484.4| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0061L19, from chromosome 3, complete sequence
          Length = 153322

 Score =  268 bits (135), Expect = 2e-68
 Identities = 279/328 (85%)
 Strand = Plus / Plus

                                                                         
Query: 193   tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
             |||||||||||||   ||||||||||| |||||||| ||||| || ||||||||||||||
Sbjct: 15013 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 15072

                                                                         
Query: 253   gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
             | ||||||| || || ||||| ||||| ||||||||||||||||||||||| ||||| ||
Sbjct: 15073 gttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaag 15132

                                                                         
Query: 313   aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
             |||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || | 
Sbjct: 15133 aggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaaccat 15192

                                                                         
Query: 373   cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
              ||||||||||| |||||||| ||||||||| |   |||||||||||| || || || ||
Sbjct: 15193 accagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtct 15252

                                                                         
Query: 433   gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
             |||||||||||||   | ||| || ||||||||||| |||||||| ||||||||||||| 
Sbjct: 15253 gtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtccag 15312

                                         
Query: 493   cacaggggcataaccgttgctgatctgg 520
             ||| ||||| || ||||||| |||||||
Sbjct: 15313 cactggggcgtagccgttgccgatctgg 15340



 Score =  262 bits (132), Expect = 1e-66
 Identities = 279/329 (84%)
 Strand = Plus / Plus

                                                                         
Query: 192   ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
             ||||||||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 20452 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 20511

                                                                         
Query: 252   cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
             || ||||||| || || ||||| ||||| ||||||||||| ||||||||||| ||||| |
Sbjct: 20512 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 20571

                                                                         
Query: 312   gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
             ||||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || |
Sbjct: 20572 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 20631

                                                                         
Query: 372   acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
               ||||||||||| |||||||| ||||||||| |   |||||||||||| || || || |
Sbjct: 20632 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 20691

                                                                         
Query: 432   tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
             ||||||||||||||   | ||| || ||||||||||| |||||||| |||||||||||||
Sbjct: 20692 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 20751

                                          
Query: 492   ncacaggggcataaccgttgctgatctgg 520
              ||| ||||| || ||||||| |||||||
Sbjct: 20752 gcactggggcgtagccgttgccgatctgg 20780



 Score =  228 bits (115), Expect = 1e-56
 Identities = 274/328 (83%)
 Strand = Plus / Plus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            |||| |||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 4330 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4389

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            || ||||||| || || ||||| ||||| ||||||||||||||||| ||||| ||||| |
Sbjct: 4390 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 4449

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||||||||  |  ||||||| ||| |||||||||||||| |||||||||||||| |
Sbjct: 4450 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 4509

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| ||||| |  ||||||||| |   ||||||||||||||| || || |
Sbjct: 4510 taccagcatcaccgttcttcaagaacttgggctccttctccagctccttgccagatcgtc 4569

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            |||| |||||||||   | ||| || |||||||| || |||||||| |||||||||||||
Sbjct: 4570 tgtcaatcttggtcaccagctcagcaaacttgacagcaatgtgggaggtgtggcagtcca 4629

                                        
Query: 492  ncacaggggcataaccgttgctgatctg 519
             ||| || ||||| ||||| | ||||||
Sbjct: 4630 gcactggagcatagccgttaccgatctg 4657
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  268 bits (135), Expect = 2e-68
 Identities = 279/328 (85%)
 Strand = Plus / Minus

                                                                           
Query: 192     ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
               ||||||||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 4101317 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4101258

                                                                           
Query: 252     cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
               || ||||||| || || ||||| ||||| ||||||||||||||||||||||| ||||| |
Sbjct: 4101257 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaa 4101198

                                                                           
Query: 312     gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
               ||||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || |
Sbjct: 4101197 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 4101138

                                                                           
Query: 372     acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
                 ||||||||||| |||||||| ||||||||| |   |||||||||||||||||| || |
Sbjct: 4101137 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttgccggatcgtc 4101078

                                                                           
Query: 432     tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
               ||||||||||||||   | ||| || ||||||||||| ||||| || |||||||||||||
Sbjct: 4101077 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgtgaggtgtggcagtcca 4101018

                                           
Query: 492     ncacaggggcataaccgttgctgatctg 519
                ||| ||||| || || |||| ||||||
Sbjct: 4101017 gcactggggcgtagccattgccgatctg 4100990



 Score =  268 bits (135), Expect = 2e-68
 Identities = 279/328 (85%)
 Strand = Plus / Minus

                                                                           
Query: 193     tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
               |||||||||||||   ||||||||||| |||||||| ||||| || ||||||||||||||
Sbjct: 4084466 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 4084407

                                                                           
Query: 253     gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
               | ||||||| || || ||||| ||||| ||||||||||||||||||||||| ||||| ||
Sbjct: 4084406 gttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaag 4084347

                                                                           
Query: 313     aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
               |||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || | 
Sbjct: 4084346 aggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaaccat 4084287

                                                                           
Query: 373     cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
                ||||||||||| |||||||| ||||||||| |   |||||||||||| || || || ||
Sbjct: 4084286 accagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtct 4084227

                                                                           
Query: 433     gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
               |||||||||||||   | ||| || ||||||||||| |||||||| ||||||||||||| 
Sbjct: 4084226 gtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtccag 4084167

                                           
Query: 493     cacaggggcataaccgttgctgatctgg 520
               ||| ||||| || ||||||| |||||||
Sbjct: 4084166 cactggggcgtagccgttgccgatctgg 4084139



 Score =  262 bits (132), Expect = 1e-66
 Identities = 279/329 (84%)
 Strand = Plus / Minus

                                                                           
Query: 192     ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
               ||||||||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 4079027 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4078968

                                                                           
Query: 252     cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
               || ||||||| || || ||||| ||||| ||||||||||| ||||||||||| ||||| |
Sbjct: 4078967 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 4078908

                                                                           
Query: 312     gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
               ||||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || |
Sbjct: 4078907 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 4078848

                                                                           
Query: 372     acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
                 ||||||||||| |||||||| ||||||||| |   |||||||||||| || || || |
Sbjct: 4078847 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 4078788

                                                                           
Query: 432     tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
               ||||||||||||||   | ||| || ||||||||||| |||||||| |||||||||||||
Sbjct: 4078787 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 4078728

                                            
Query: 492     ncacaggggcataaccgttgctgatctgg 520
                ||| ||||| || ||||||| |||||||
Sbjct: 4078727 gcactggggcgtagccgttgccgatctgg 4078699



 Score =  228 bits (115), Expect = 1e-56
 Identities = 274/328 (83%)
 Strand = Plus / Minus

                                                                           
Query: 192     ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
               |||| |||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 4095149 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4095090

                                                                           
Query: 252     cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
               || ||||||| || || ||||| ||||| ||||||||||||||||| ||||| ||||| |
Sbjct: 4095089 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 4095030

                                                                           
Query: 312     gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
               ||||||||||||  |  ||||||| ||| |||||||||||||| |||||||||||||| |
Sbjct: 4095029 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 4094970

                                                                           
Query: 372     acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
                 ||||||||||| ||||| |  ||||||||| |   ||||||||||||||| || || |
Sbjct: 4094969 taccagcatcaccgttcttcaagaacttgggctccttctccagctccttgccagatcgtc 4094910

                                                                           
Query: 432     tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
               |||| |||||||||   | ||| || |||||||| || |||||||| |||||||||||||
Sbjct: 4094909 tgtcaatcttggtcaccagctcagcaaacttgacagcaatgtgggaggtgtggcagtcca 4094850

                                           
Query: 492     ncacaggggcataaccgttgctgatctg 519
                ||| || ||||| ||||| | ||||||
Sbjct: 4094849 gcactggagcatagccgttaccgatctg 4094822



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 449      atctcggcgaacttgacggcgatg 472
                |||||||||||||||| |||||||
Sbjct: 32370834 atctcggcgaacttgaaggcgatg 32370857
to top
>gb|AC125472.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
            OSJNBa0050H14, complete sequence
          Length = 142245

 Score =  268 bits (135), Expect = 2e-68
 Identities = 279/328 (85%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            ||||||||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 1845 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1786

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            || ||||||| || || ||||| ||||| ||||||||||||||||||||||| ||||| |
Sbjct: 1785 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaa 1726

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || |
Sbjct: 1725 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1666

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| |||||||| ||||||||| |   |||||||||||||||||| || |
Sbjct: 1665 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttgccggatcgtc 1606

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            ||||||||||||||   | ||| || ||||||||||| ||||| || |||||||||||||
Sbjct: 1605 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgtgaggtgtggcagtcca 1546

                                        
Query: 492  ncacaggggcataaccgttgctgatctg 519
             ||| ||||| || || |||| ||||||
Sbjct: 1545 gcactggggcgtagccattgccgatctg 1518
to top
>dbj|AK119537.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-B11, full
            insert sequence
          Length = 1722

 Score =  268 bits (135), Expect = 2e-68
 Identities = 279/328 (85%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||||   ||||||||||| |||||||| ||||| || ||||||||||||||
Sbjct: 1441 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 1382

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
            | ||||||| || || ||||| ||||| ||||||||||||||||||||||| ||||| ||
Sbjct: 1381 gttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaag 1322

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
            |||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || | 
Sbjct: 1321 aggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaaccat 1262

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||| |||||||| ||||||||| |   |||||||||||| || || || ||
Sbjct: 1261 accagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtct 1202

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
            |||||||||||||   | ||| || ||||||||||| |||||||| ||||||||||||| 
Sbjct: 1201 gtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtccag 1142

                                        
Query: 493  cacaggggcataaccgttgctgatctgg 520
            ||| ||||| || ||||||| |||||||
Sbjct: 1141 cactggggcgtagccgttgccgatctgg 1114
to top
>dbj|AK073196.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033024M04, full
            insert sequence
          Length = 2157

 Score =  268 bits (135), Expect = 2e-68
 Identities = 279/328 (85%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            ||||||||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 2001 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1942

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            || ||||||| || || ||||| ||||| ||||||||||||||||||||||| ||||| |
Sbjct: 1941 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaa 1882

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || |
Sbjct: 1881 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1822

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| |||||||| ||||||||| |   |||||||||||||||||| || |
Sbjct: 1821 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttgccggatcgtc 1762

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            ||||||||||||||   | ||| || ||||||||||| ||||| || |||||||||||||
Sbjct: 1761 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgtgaggtgtggcagtcca 1702

                                        
Query: 492  ncacaggggcataaccgttgctgatctg 519
             ||| ||||| || || |||| ||||||
Sbjct: 1701 gcactggggcgtagccattgccgatctg 1674
to top
>dbj|AK072285.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023016F09, full
            insert sequence
          Length = 1653

 Score =  268 bits (135), Expect = 2e-68
 Identities = 279/328 (85%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            ||||||||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 1428 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1369

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            || ||||||| || || ||||| ||||| ||||||||||||||||||||||| ||||| |
Sbjct: 1368 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaa 1309

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || |
Sbjct: 1308 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1249

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| |||||||| ||||||||| |   |||||||||||||||||| || |
Sbjct: 1248 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttgccggatcgtc 1189

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            ||||||||||||||   | ||| || ||||||||||| ||||| || |||||||||||||
Sbjct: 1188 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgtgaggtgtggcagtcca 1129

                                        
Query: 492  ncacaggggcataaccgttgctgatctg 519
             ||| ||||| || || |||| ||||||
Sbjct: 1128 gcactggggcgtagccattgccgatctg 1101
to top
>dbj|AK061464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-308-C01, full
            insert sequence
          Length = 1620

 Score =  268 bits (135), Expect = 2e-68
 Identities = 279/328 (85%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||||   ||||||||||| |||||||| ||||| || ||||||||||||||
Sbjct: 1440 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 1381

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
            | ||||||| || || ||||| ||||| ||||||||||||||||||||||| ||||| ||
Sbjct: 1380 gttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaag 1321

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
            |||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || | 
Sbjct: 1320 aggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaaccat 1261

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||| |||||||| ||||||||| |   |||||||||||| || || || ||
Sbjct: 1260 accagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtct 1201

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
            |||||||||||||   | ||| || ||||||||||| |||||||| ||||||||||||| 
Sbjct: 1200 gtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtccag 1141

                                        
Query: 493  cacaggggcataaccgttgctgatctgg 520
            ||| ||||| || ||||||| |||||||
Sbjct: 1140 cactggggcgtagccgttgccgatctgg 1113
to top
>dbj|D63583.1| Oryza sativa mRNA for EF-1 alpha, complete cds
          Length = 1599

 Score =  266 bits (134), Expect = 7e-68
 Identities = 278/327 (85%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||||   ||||||||||| |||||||| ||||| || ||||||||||||||
Sbjct: 1419 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 1360

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
            | ||||||| || || ||||| ||||| ||||||||||||||||||||||| ||||| ||
Sbjct: 1359 gttcttgatgacgccaacagccaccgtttgcctcatgtcacgcacggcaaaacgaccaag 1300

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
            |||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || | 
Sbjct: 1299 aggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaaccat 1240

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||| |||||||| ||||||||| |   |||||||||||||||||| || ||
Sbjct: 1239 accagcatcaccgttcttgaggaacttgggctccttctccagctccttgccggatcgtct 1180

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
            |||||||||||||   | ||| || ||||||||||| ||||| || ||||||||||||| 
Sbjct: 1179 gtcgatcttggtcaccagctcagcaaacttgacggcaatgtgtgaggtgtggcagtccag 1120

                                       
Query: 493  cacaggggcataaccgttgctgatctg 519
            ||| ||||| || || |||| ||||||
Sbjct: 1119 cactggggcgtagccattgccgatctg 1093
to top
>dbj|AK105030.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-012-F06, full
            insert sequence
          Length = 1632

 Score =  262 bits (132), Expect = 1e-66
 Identities = 279/329 (84%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            ||||||||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 1440 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1381

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            || ||||||| || || ||||| ||||| ||||||||||| ||||||||||| ||||| |
Sbjct: 1380 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 1321

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || |
Sbjct: 1320 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1261

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| |||||||| ||||||||| |   |||||||||||| || || || |
Sbjct: 1260 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 1201

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            ||||||||||||||   | ||| || ||||||||||| |||||||| |||||||||||||
Sbjct: 1200 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 1141

                                         
Query: 492  ncacaggggcataaccgttgctgatctgg 520
             ||| ||||| || ||||||| |||||||
Sbjct: 1140 gcactggggcgtagccgttgccgatctgg 1112
to top
>dbj|AK119172.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-A11, full
            insert sequence
          Length = 1661

 Score =  262 bits (132), Expect = 1e-66
 Identities = 279/329 (84%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            ||||||||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 1435 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1376

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            || ||||||| || || ||||| ||||| ||||||||||| ||||||||||| ||||| |
Sbjct: 1375 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 1316

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || |
Sbjct: 1315 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1256

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| |||||||| ||||||||| |   |||||||||||| || || || |
Sbjct: 1255 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 1196

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            ||||||||||||||   | ||| || ||||||||||| |||||||| |||||||||||||
Sbjct: 1195 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 1136

                                         
Query: 492  ncacaggggcataaccgttgctgatctgg 520
             ||| ||||| || ||||||| |||||||
Sbjct: 1135 gcactggggcgtagccgttgccgatctgg 1107
to top
>dbj|AK103738.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033138K07, full
            insert sequence
          Length = 3222

 Score =  262 bits (132), Expect = 1e-66
 Identities = 279/329 (84%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            ||||||||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 3030 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 2971

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            || ||||||| || || ||||| ||||| ||||||||||| ||||||||||| ||||| |
Sbjct: 2970 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 2911

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || |
Sbjct: 2910 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 2851

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| |||||||| ||||||||| |   |||||||||||| || || || |
Sbjct: 2850 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 2791

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            ||||||||||||||   | ||| || ||||||||||| |||||||| |||||||||||||
Sbjct: 2790 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 2731

                                         
Query: 492  ncacaggggcataaccgttgctgatctgg 520
             ||| ||||| || ||||||| |||||||
Sbjct: 2730 gcactggggcgtagccgttgccgatctgg 2702
to top
>dbj|AK072648.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023126K23, full
            insert sequence
          Length = 1760

 Score =  262 bits (132), Expect = 1e-66
 Identities = 279/329 (84%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            ||||||||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 1439 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1380

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            || ||||||| || || ||||| ||||| ||||||||||| ||||||||||| ||||| |
Sbjct: 1379 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 1320

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || |
Sbjct: 1319 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1260

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| |||||||| ||||||||| |   |||||||||||| || || || |
Sbjct: 1259 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 1200

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            ||||||||||||||   | ||| || ||||||||||| |||||||| |||||||||||||
Sbjct: 1199 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 1140

                                         
Query: 492  ncacaggggcataaccgttgctgatctgg 520
             ||| ||||| || ||||||| |||||||
Sbjct: 1139 gcactggggcgtagccgttgccgatctgg 1111
to top
>dbj|AK062030.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-043-G10, full
            insert sequence
          Length = 1357

 Score =  262 bits (132), Expect = 1e-66
 Identities = 279/329 (84%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            ||||||||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 1161 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1102

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            || ||||||| || || ||||| ||||| ||||||||||| ||||||||||| ||||| |
Sbjct: 1101 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 1042

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || |
Sbjct: 1041 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 982

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| |||||||| ||||||||| |   |||||||||||| || || || |
Sbjct: 981  taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 922

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            ||||||||||||||   | ||| || ||||||||||| |||||||| |||||||||||||
Sbjct: 921  tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 862

                                         
Query: 492  ncacaggggcataaccgttgctgatctgg 520
             ||| ||||| || ||||||| |||||||
Sbjct: 861  gcactggggcgtagccgttgccgatctgg 833
to top
>gb|AF030517.1|AF030517 Oryza sativa translation elongation factor-1 alpha mRNA, complete cds
          Length = 1562

 Score =  262 bits (132), Expect = 1e-66
 Identities = 279/329 (84%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            ||||||||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 1345 ctcatttcttcttgcgggcagccttggtcaccttggcaccggttgggtccttcttctcca 1286

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            || ||||||| || || ||||| ||||| ||||||||||||||||| ||||| ||||| |
Sbjct: 1285 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 1226

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || |
Sbjct: 1225 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1166

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| |||||||| ||||||||| |   |||||||||||| || || || |
Sbjct: 1165 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 1106

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            ||||||||||||||   | ||| || ||||||||||| |||||||| |||||||||||||
Sbjct: 1105 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 1046

                                         
Query: 492  ncacaggggcataaccgttgctgatctgg 520
             ||| ||||| || ||||||| |||||||
Sbjct: 1045 gcactggggcgtagccgttgccgatctgg 1017
to top
>dbj|D63580.1| Oryza sativa mRNA for EF-1 alpha, complete cds
          Length = 1644

 Score =  262 bits (132), Expect = 1e-66
 Identities = 279/329 (84%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            ||||||||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 1418 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1359

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            || ||||||| || || ||||| ||||| ||||||||||| ||||||||||| ||||| |
Sbjct: 1358 cgttcttgatgacgccaacagccaccgtttgcctcatgtcccgcacggcaaaacgaccaa 1299

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||||||||  |  ||||||| ||| |||||||||||||| ||||||||||| || |
Sbjct: 1298 gaggagggtactcagagaaggtctccacaaccatgggcttggtgggaatcatcttaacca 1239

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| |||||||| ||||||||| |   |||||||||||| || || || |
Sbjct: 1238 taccagcatcaccgttcttgaggaacttgggctccttctccagctccttaccagatcgtc 1179

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            ||||||||||||||   | ||| || ||||||||||| |||||||| |||||||||||||
Sbjct: 1178 tgtcgatcttggtcaccagctcagcaaacttgacggcaatgtgggaggtgtggcagtcca 1119

                                         
Query: 492  ncacaggggcataaccgttgctgatctgg 520
             ||| ||||| || ||||||| |||||||
Sbjct: 1118 gcactggggcgtagccgttgccgatctgg 1090
to top
>gb|BT016525.1| Zea mays clone Contig358 mRNA sequence
          Length = 1705

 Score =  260 bits (131), Expect = 4e-66
 Identities = 272/320 (85%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||||   || |||||||| |||||||||||||| || ||||||||||||||
Sbjct: 1423 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1364

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
             |||||||| || || ||||||||||||||||||||||| || |||||||||| ||||||
Sbjct: 1363 actcttgatgactccaacagcaaccgtctgcctcatgtcgcggacggcaaacctacccag 1304

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
             ||||| |||  ||  || |||| ||||||||| |||||||| ||||||||||| || | 
Sbjct: 1303 gggaggatacgcggagaatgtctccaccaccataggcttggtgggaatcatcttcaccat 1244

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||| ||||| || ||||||||| |   ||| ||||||||||| || |||||
Sbjct: 1243 accagcatcaccgttcttcaggaacttgggctccttctcgagctccttgccagatcgcct 1184

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
            ||||||||||||   || ||| || |||||||||||||||||||| ||||||||||||| 
Sbjct: 1183 gtcgatcttggtaatgagctcagcaaacttgacggcgatgtgggaggtgtggcagtccag 1124

                                
Query: 493  cacaggggcataaccgttgc 512
            ||| |||||||| |||||||
Sbjct: 1123 cactggggcatagccgttgc 1104
to top
>gb|BT017771.1| Zea mays clone EL01N0502E05.c mRNA sequence
          Length = 959

 Score =  260 bits (131), Expect = 4e-66
 Identities = 266/312 (85%)
 Strand = Plus / Minus

                                                                       
Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
           |||||||||||| || ||||||||||| |||||||| || || || ||||||||||||||
Sbjct: 804 tcatttcttctttattgcagccttggtcaccttggcaccagttgggtccttcttctccac 745

                                                                       
Query: 253 gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
           ||||||||| || || |||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 744 gctcttgatgactccaacagcaaccgtctgcctcatgtcacggacagcaaaacgacccag 685

                                                                       
Query: 313 aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
           |||||| ||||| |  |||||||  |||||||||||||| || ||||||||||| || | 
Sbjct: 684 aggaggatactgagagaaggtctcaaccaccatgggcttagtgggaatcatcttcaccat 625

                                                                       
Query: 373 cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
            || |||||||||||||| || ||||||||| |   ||| ||||||||||| ||||||||
Sbjct: 624 accggcatcaccattcttcaggaacttgggctccttctcaagctccttgccagaccgcct 565

                                                                       
Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
            |||||||||||   || ||| || |||||||| || |||||||| ||||||||||||| 
Sbjct: 564 atcgatcttggttatgagctcagcaaacttgacagcaatgtgggaggtgtggcagtccag 505

                       
Query: 493 cacaggggcata 504
           ||| ||||||||
Sbjct: 504 cactggggcata 493
to top
>gb|AF136824.1|AF136824 Zea mays clone b elongation factor 1 alpha mRNA, complete cds
          Length = 1604

 Score =  260 bits (131), Expect = 4e-66
 Identities = 272/320 (85%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||||   || |||||||| |||||||||||||| || ||||||||||||||
Sbjct: 1404 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1345

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
             |||||||| || || ||||||||||||||||||||||| || |||||||||| ||||||
Sbjct: 1344 actcttgatgactccaacagcaaccgtctgcctcatgtcgcggacggcaaacctacccag 1285

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
             ||||| |||  ||  || |||| ||||||||| |||||||| ||||||||||| || | 
Sbjct: 1284 gggaggatacgcggagaatgtctccaccaccataggcttggtgggaatcatcttcaccat 1225

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||| ||||| || ||||||||| |   ||| ||||||||||| || |||||
Sbjct: 1224 accagcatcaccgttcttcaggaacttgggctccttctcgagctccttgccagatcgcct 1165

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
            ||||||||||||   || ||| || |||||||||||||||||||| ||||||||||||| 
Sbjct: 1164 gtcgatcttggtaatgagctcagcaaacttgacggcgatgtgggaggtgtggcagtccag 1105

                                
Query: 493  cacaggggcataaccgttgc 512
            ||| |||||||| |||||||
Sbjct: 1104 cactggggcatagccgttgc 1085
to top
>gb|AY109326.1| Zea mays CL1256_1 mRNA sequence
          Length = 2360

 Score =  260 bits (131), Expect = 4e-66
 Identities = 272/320 (85%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||||   || |||||||| |||||||||||||| || ||||||||||||||
Sbjct: 2032 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1973

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
             |||||||| || || ||||||||||||||||||||||| || |||||||||| ||||||
Sbjct: 1972 actcttgatgactccaacagcaaccgtctgcctcatgtcgcggacggcaaacctacccag 1913

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
             ||||| |||  ||  || |||| ||||||||| |||||||| ||||||||||| || | 
Sbjct: 1912 gggaggatacgcggagaatgtctccaccaccataggcttggtgggaatcatcttcaccat 1853

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||| ||||| || ||||||||| |   ||| ||||||||||| || |||||
Sbjct: 1852 accagcatcaccgttcttcaggaacttgggctccttctcgagctccttgccagatcgcct 1793

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
            ||||||||||||   || ||| || |||||||||||||||||||| ||||||||||||| 
Sbjct: 1792 gtcgatcttggtaatgagctcagcaaacttgacggcgatgtgggaggtgtggcagtccag 1733

                                
Query: 493  cacaggggcataaccgttgc 512
            ||| |||||||| |||||||
Sbjct: 1732 cactggggcatagccgttgc 1713
to top
>gb|BT016740.1| Zea mays clone Contig573 mRNA sequence
          Length = 1712

 Score =  258 bits (130), Expect = 2e-65
 Identities = 277/327 (84%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||||   ||||||||||| |||||||| |||||||| ||||||||||||||
Sbjct: 1439 tcatttcttcttggcagcagccttggtcaccttggcaccggtcgggtccttcttctccac 1380

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
             |||||||| || || |||||||||||||| ||||||||||| || ||||||| ||||||
Sbjct: 1379 actcttgatgactccaacagcaaccgtctgtctcatgtcacggacagcaaacctacccag 1320

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
             ||||| ||||| |  || |||| |||||||||||||||||| ||||||||||| || | 
Sbjct: 1319 gggaggatactgcgagaatgtctccaccaccatgggcttggtgggaatcatcttcaccat 1260

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||| ||||| |  ||||||||| ||  ||| ||||||||||| || |||||
Sbjct: 1259 accagcatcaccgttcttcaagaacttgggctctttctcaagctccttgccagaacgcct 1200

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
            ||||||||||||   || ||| || |||||||| || || ||||| ||||||||||||| 
Sbjct: 1199 gtcgatcttggtaatgagctcagcaaacttgacagcaatatgggaggtgtggcagtccag 1140

                                       
Query: 493  cacaggggcataaccgttgctgatctg 519
            ||| |||||||||||||| | ||||||
Sbjct: 1139 cactggggcataaccgttaccgatctg 1113
to top
>emb|Z50789.1|HVEF1ALFA H.vulgare mRNA for elongation factor 1-alpha
          Length = 1609

 Score =  256 bits (129), Expect = 6e-65
 Identities = 270/318 (84%)
 Strand = Plus / Minus

                                                                        
Query: 195  atttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgc 254
            ||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||||||||
Sbjct: 1398 atttcttcttgatggcagccttggtcaccttggctccggtggggtccttcttctccacgc 1339

                                                                        
Query: 255  tcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagag 314
             |||||| ||||| ||||| || || |||||||||||||| || ||||| ||||| ||||
Sbjct: 1338 ccttgatgacaccaacagccacagtttgcctcatgtcacggacagcaaaacgaccaagag 1279

                                                                        
Query: 315  gagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacc 374
            |||||||   ||||||||||| ||| |||||||||||||| ||||||||||| || |  |
Sbjct: 1278 gagggtaagtggcaaaggtctccacaaccatgggcttggtgggaatcatcttcactatac 1219

                                                                        
Query: 375  cagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgt 434
            ||||||||||||||||||| |||||||||   | |||||||||||| || || |||||||
Sbjct: 1218 cagcatcaccattcttgaggaacttgggcagggcctccagctccttacctgatcgcctgt 1159

                                                                        
Query: 435  cgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccanca 494
            |||||||||||   | ||| || |||||||| || ||||| || ||||||||||||| ||
Sbjct: 1158 cgatcttggtcaccagctcagcaaacttgacagcaatgtgtgaggtgtggcagtccagca 1099

                              
Query: 495  caggggcataaccgttgc 512
            | || || || |||||||
Sbjct: 1098 ctggagcgtagccgttgc 1081
to top
>gb|M90077.1|WHTTEF1X Wheat translation elongation factor 1 alpha-subunit (TEF1) mRNA,
            complete cds
          Length = 2062

 Score =  254 bits (128), Expect = 3e-64
 Identities = 272/321 (84%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            |||||||||||||||| ||||||||||| |||||||||||||| || |||||||||||||
Sbjct: 1826 ctcatttcttcttgatggcagccttggtcaccttggcgccggttgggtccttcttctcca 1767

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            | | |||||| ||||| ||||| || || |||||||||||||| || ||||| ||||| |
Sbjct: 1766 cacccttgatgacaccaacagccacagtttgcctcatgtcacggacagcaaaacgaccaa 1707

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            |||| |||||    |||||||||| ||| |||||||||||||| ||||||||||| || |
Sbjct: 1706 gaggtgggtaagtagcaaaggtctccacaaccatgggcttggtgggaatcatcttcacta 1647

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              |||||||||||||||||||| |||||||||   | |||||||||||| || || ||||
Sbjct: 1646 tgccagcatcaccattcttgaggaacttgggcagggcctccagctccttaccagatcgcc 1587

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            ||||||||||||||   | ||| || |||||||| || ||||| || |||||||||||||
Sbjct: 1586 tgtcgatcttggtcaccagctcagcaaacttgacagcaatgtgcgaggtgtggcagtcca 1527

                                 
Query: 492  ncacaggggcataaccgttgc 512
             ||| ||||| || |||||||
Sbjct: 1526 gcactggggcgtagccgttgc 1506
to top
>gb|BT016514.1| Zea mays clone Contig347 mRNA sequence
          Length = 1687

 Score =  244 bits (123), Expect = 2e-61
 Identities = 270/320 (84%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||||   ||||||||||| |||||||||||||| || ||||||||||||||
Sbjct: 1424 tcatttcttcttggcagcagccttggtcaccttggcgccggttgggtccttcttctccac 1365

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
             |||||||| || || |||||||||||||||||||||||||| || ||||||| ||| ||
Sbjct: 1364 actcttgataactccaacagcaaccgtctgcctcatgtcacggacagcaaacctaccaag 1305

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
             ||||| |||   |  || |||| |||||||||||||||||| || |||||||| || | 
Sbjct: 1304 gggaggatacgctgagaatgtctccaccaccatgggcttggtgggtatcatcttcaccat 1245

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||| ||||| || ||||| ||| |   ||| ||||||||||| ||||||||
Sbjct: 1244 accagcatcaccgttcttcaggaactttggctccttctcaagctccttgccagaccgcct 1185

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
            ||||||||||||   || ||| || |||||||| ||||||||||| ||||||||||||| 
Sbjct: 1184 gtcgatcttggtaatgagctcagcaaacttgacagcgatgtgggaggtgtggcagtccag 1125

                                
Query: 493  cacaggggcataaccgttgc 512
            ||| |||||||| |||||||
Sbjct: 1124 cactggggcatagccgttgc 1105
to top
>gb|AF136823.1|AF136823 Zea mays clone a elongation factor 1 alpha mRNA, complete cds
          Length = 1600

 Score =  244 bits (123), Expect = 2e-61
 Identities = 270/320 (84%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||||   || |||||||| |||||||||||||| || ||||||||||||||
Sbjct: 1415 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1356

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
             |||||||| || || ||||||||||||||||||||||| || |||||||||| ||||||
Sbjct: 1355 actcttgatgactccaacagcaaccgtctgcctcatgtcgcggacggcaaacctacccag 1296

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
             ||||| |||  ||  || |||| ||||||||| |||||||| || |||||||| || | 
Sbjct: 1295 gggaggatacgcggagaatgtctccaccaccataggcttggtgggtatcatcttcaccat 1236

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||| ||||| || ||||| ||| |   ||| ||||||||||| || |||||
Sbjct: 1235 accagcatcaccgttcttcaggaactttggctccttctcaagctccttgccagagcgcct 1176

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
            ||||||||||||   || ||| || |||||||| ||||||||||| ||||||||||||| 
Sbjct: 1175 gtcgatcttggtaatgagctcagcaaacttgacagcgatgtgggaggtgtggcagtccag 1116

                                
Query: 493  cacaggggcataaccgttgc 512
            |||||||||||| |||||||
Sbjct: 1115 cacaggggcatagccgttgc 1096
to top
>gb|AF281361.1| Saccharum officinarum elongation factor mRNA, complete cds
          Length = 1745

 Score =  242 bits (122), Expect = 1e-60
 Identities = 275/327 (84%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||||   ||||||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 1447 tcatttcttcttggcagcagccttggtcaccttggcgccggtcgggtccttcttctccac 1388

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
             |||||||| |  || ||||||||||| ||||||||||| || || ||||||| ||| ||
Sbjct: 1387 actcttgatgattccaacagcaaccgtttgcctcatgtcgcggacagcaaacctaccaag 1328

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
             ||||| |||| ||  || |||| ||||||||| |||||||| ||||||||||| || | 
Sbjct: 1327 gggaggatactcggagaatgtctccaccaccatcggcttggtgggaatcatcttcaccat 1268

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||| ||||| || ||||||| | |   ||| ||||||||||| ||||||||
Sbjct: 1267 accagcatcaccgttcttcaggaacttggcctccttctcaagctccttgccagaccgcct 1208

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
            ||||||||||||   || ||| || |||||||| ||||||||||| ||||||||||||| 
Sbjct: 1207 gtcgatcttggtaatgagctcagcaaacttgacagcgatgtgggaggtgtggcagtccag 1148

                                       
Query: 493  cacaggggcataaccgttgctgatctg 519
            ||| || ||||| ||||||| ||||||
Sbjct: 1147 cactggagcatagccgttgccgatctg 1121
to top
>gb|BT016889.1| Zea mays clone Contig722 mRNA sequence
          Length = 930

 Score =  238 bits (120), Expect = 1e-59
 Identities = 249/293 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 gccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacacccaca 271
           |||||||||||||||||||||||||| |||||||||||||| |||||||| || || |||
Sbjct: 318 gccttggtaaccttggcgccggtcgggtccttcttctccacactcttgatgactccaaca 377

                                                                       
Query: 272 gcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggcaaag 331
           ||||| |||||||||||||| || || ||||||| ||| || ||||| ||||| |  || 
Sbjct: 378 gcaactgtctgcctcatgtcgcggacagcaaacctaccaaggggaggatactgcgagaat 437

                                                                       
Query: 332 gtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattcttg 391
           |||| |||||||||||||||||| ||||||||||| || |  ||||||||||| ||||| 
Sbjct: 438 gtctccaccaccatgggcttggtgggaatcatcttcaccataccagcatcaccgttcttc 497

                                                                       
Query: 392 agaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctggatc 451
           || ||||||||| |   ||| ||||||||||| ||||||||||||||||||||   ||  
Sbjct: 498 aggaacttgggctccttctcaagctccttgccagaccgcctgtcgatcttggtaatgagt 557

                                                                
Query: 452 tcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcata 504
           || || |||||||| || |||||||| ||||||||||||| ||| ||||||||
Sbjct: 558 tcagcaaacttgacagcaatgtgggaggtgtggcagtccagcactggggcata 610
to top
>gb|AF136826.1|AF136826 Zea mays clone d elongation factor 1 alpha mRNA, complete cds
          Length = 1546

 Score =  236 bits (119), Expect = 6e-59
 Identities = 263/312 (84%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||| || ||||||||||| |||||||| || || || ||||||||||||||
Sbjct: 1375 tcatttcttctttattgcagccttggtcaccttggcaccagttgggtccttcttctccac 1316

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
            ||||||||| || || |||||||||||||||||||||||  | || ||||| ||||||||
Sbjct: 1315 gctcttgatgactccaacagcaaccgtctgcctcatgtcgaggacagcaaaacgacccag 1256

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
            |||||| ||||| |  |||||||  |||||||||||||| || ||||||||||| || | 
Sbjct: 1255 aggaggatactgagagaaggtctcaaccaccatgggcttagtgggaatcatcttcaccat 1196

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             || |||||||||||||| || ||||| ||| |   ||| ||||||||||| || |||||
Sbjct: 1195 accggcatcaccattcttcaggaactttggctccttctcaagctccttgccagagcgcct 1136

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
            ||||||||||||   || ||| || |||||||| || |||||||| ||||||||||||| 
Sbjct: 1135 gtcgatcttggtaatgagctcagcaaacttgacagcaatgtgggaggtgtggcagtccag 1076

                        
Query: 493  cacaggggcata 504
            ||| ||||||||
Sbjct: 1075 cactggggcata 1064
to top
>gb|BT016906.1| Zea mays clone Contig739 mRNA sequence
          Length = 687

 Score =  234 bits (118), Expect = 2e-58
 Identities = 274/327 (83%)
 Strand = Plus / Plus

                                                                       
Query: 193 tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
           |||||||||||||   || |||||||| |||||||| || || || ||||||||||||||
Sbjct: 196 tcatttcttcttggcagccgccttggtcaccttggctcccgttgggtccttcttctccac 255

                                                                       
Query: 253 gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
           |||||| ||||| || || |||||||||||||||||||| || || || || || |||||
Sbjct: 256 gctctttatcacgccgactgcaaccgtctgcctcatgtcgcgaaccgcgaagcgccccag 315

                                                                       
Query: 313 aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
            ||||| |||| ||  || |||| ||||||||||||||| || || ||||||||||||||
Sbjct: 316 tggaggatactcggagaaagtctccaccaccatgggcttcgtggggatcatcttgacgaa 375

                                                                       
Query: 373 cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
            || || ||||| ||||||||||||||||| ||   ||||||||||||||| ||||||| 
Sbjct: 376 gccggcgtcaccgttcttgagaaacttgggggcgctctccagctccttgcccgaccgccg 435

                                                                       
Query: 433 gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
           ||| ||||||||  | | ||| | |||||| |||||||||||||| ||||||||||||| 
Sbjct: 436 gtcaatcttggtgagcagctccgagaacttcacggcgatgtgggacgtgtggcagtccag 495

                                      
Query: 493 cacaggggcataaccgttgctgatctg 519
           ||| ||||| || ||||||| ||||||
Sbjct: 496 caccggggcgtagccgttgccgatctg 522
to top
>gb|AF136828.1|AF136828 Zea mays clone f elongation factor 1 alpha mRNA, complete cds
          Length = 1596

 Score =  230 bits (116), Expect = 4e-57
 Identities = 254/301 (84%)
 Strand = Plus / Minus

                                                                        
Query: 212  gccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacacccaca 271
            |||||||||||||||||||||||||| |||||||||||||| |||||||| || || |||
Sbjct: 1394 gccttggtaaccttggcgccggtcgggtccttcttctccacactcttgatgactccaaca 1335

                                                                        
Query: 272  gcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggcaaag 331
            |||||||||||||||||||| || ||||| |||| |||||| ||||| |||  ||  || 
Sbjct: 1334 gcaaccgtctgcctcatgtcgcggacggctaacctacccaggggaggatacgcggagaat 1275

                                                                        
Query: 332  gtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattcttg 391
            |||| ||||||||| |||||||| || |||||||| || |  ||||||||||| ||||| 
Sbjct: 1274 gtctccaccaccataggcttggtgggtatcatcttcaccataccagcatcaccgttcttc 1215

                                                                        
Query: 392  agaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctggatc 451
            || ||||| ||| |    || ||||||||||| || |||||||||||||||||   || |
Sbjct: 1214 aggaactttggctccttttcaagctccttgccagagcgcctgtcgatcttggtaatgagc 1155

                                                                        
Query: 452  tcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccgttg 511
            || || |||||||| ||||||||||| ||||||||||||| ||||||| |||| ||||||
Sbjct: 1154 tcagcaaacttgacagcgatgtgggaggtgtggcagtccagcacagggccatagccgttg 1095

             
Query: 512  c 512
            |
Sbjct: 1094 c 1094
to top
>gb|AF136827.1|AF136827 Zea mays clone e elongation factor 1 alpha mRNA, complete cds
          Length = 1606

 Score =  228 bits (115), Expect = 1e-56
 Identities = 276/328 (84%), Gaps = 2/328 (0%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||||   || |||||||| |||||||||||||| || ||||||||||||||
Sbjct: 1432 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1373

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
             ||||||||||| || || |||||||||||||||||||| || || ||||||| ||||||
Sbjct: 1372 actcttgatcacgccgactgcaaccgtctgcctcatgtcgcggaccgcaaacctacccag 1313

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
             ||||| |||| ||  || |||| ||||||||||||||| || || | |||||| |||||
Sbjct: 1312 tggaggatactcggagaaagtctccaccaccatgggcttcgtggggaccatcttcacgaa 1253

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctcc-agctccttgccggaccgcc 431
             || || ||||| |||||||||||||| ||| |   |||| ||||||||||| |||||||
Sbjct: 1252 accggcgtcaccgttcttgagaaactttggctc-ctctcctagctccttgcccgaccgcc 1194

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
             ||| ||||||||   || ||| || ||||| |||||||||||||| |||||||||||||
Sbjct: 1193 ggtcaatcttggtaatgagctcagcaaacttcacggcgatgtgggacgtgtggcagtcca 1134

                                        
Query: 492  ncacaggggcataaccgttgctgatctg 519
             ||||||||| || ||||||| ||||||
Sbjct: 1133 gcacaggggcgtagccgttgccgatctg 1106
to top
>dbj|AK119528.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-C04, full
            insert sequence
          Length = 1818

 Score =  228 bits (115), Expect = 1e-56
 Identities = 274/328 (83%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            |||| |||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 1431 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1372

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            || ||||||| || || ||||| ||||| ||||||||||||||||| ||||| ||||| |
Sbjct: 1371 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 1312

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||||||||  |  ||||||| ||| |||||||||||||| |||||||||||||| |
Sbjct: 1311 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 1252

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| ||||| |  ||||||||| |   ||||||||||||||| || || |
Sbjct: 1251 taccagcatcaccgttcttcaagaacttgggctccttctccagctccttgccagatcgtc 1192

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            |||| |||||||||   | ||| || |||||||| || |||||||| |||||||||||||
Sbjct: 1191 tgtcaatcttggtcaccagctcagcaaacttgacagcaatgtgggaggtgtggcagtcca 1132

                                        
Query: 492  ncacaggggcataaccgttgctgatctg 519
             ||| || ||||| ||||| | ||||||
Sbjct: 1131 gcactggagcatagccgttaccgatctg 1104
to top
>dbj|AK119194.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-C03, full
           insert sequence
          Length = 1130

 Score =  228 bits (115), Expect = 1e-56
 Identities = 274/328 (83%)
 Strand = Plus / Minus

                                                                       
Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
           |||| |||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 900 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 841

                                                                       
Query: 252 cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
           || ||||||| || || ||||| ||||| ||||||||||||||||| ||||| ||||| |
Sbjct: 840 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 781

                                                                       
Query: 312 gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
           ||||||||||||  |  ||||||| ||| |||||||||||||| |||||||||||||| |
Sbjct: 780 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 721

                                                                       
Query: 372 acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
             ||||||||||| ||||| |  ||||||||| |   ||||||||||||||| || || |
Sbjct: 720 taccagcatcaccgttcttcaagaacttgggctccttctccagctccttgccagatcgtc 661

                                                                       
Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
           |||| |||||||||   | ||| || |||||||| || |||||||| |||||||||||||
Sbjct: 660 tgtcaatcttggtcaccagctcagcaaacttgacagcaatgtgggaggtgtggcagtcca 601

                                       
Query: 492 ncacaggggcataaccgttgctgatctg 519
            ||| || ||||| ||||| | ||||||
Sbjct: 600 gcactggagcatagccgttaccgatctg 573
to top
>dbj|AK071619.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023100M05, full
            insert sequence
          Length = 1867

 Score =  228 bits (115), Expect = 1e-56
 Identities = 274/328 (83%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            |||| |||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 1706 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1647

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            || ||||||| || || ||||| ||||| ||||||||||||||||| ||||| ||||| |
Sbjct: 1646 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 1587

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||||||||  |  ||||||| ||| |||||||||||||| |||||||||||||| |
Sbjct: 1586 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 1527

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| ||||| |  ||||||||| |   ||||||||||||||| || || |
Sbjct: 1526 taccagcatcaccgttcttcaagaacttgggctccttctccagctccttgccagatcgtc 1467

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            |||| |||||||||   | ||| || |||||||| || |||||||| |||||||||||||
Sbjct: 1466 tgtcaatcttggtcaccagctcagcaaacttgacagcaatgtgggaggtgtggcagtcca 1407

                                        
Query: 492  ncacaggggcataaccgttgctgatctg 519
             ||| || ||||| ||||| | ||||||
Sbjct: 1406 gcactggagcatagccgttaccgatctg 1379
to top
>dbj|AK071343.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023091A02, full
            insert sequence
          Length = 1658

 Score =  228 bits (115), Expect = 1e-56
 Identities = 274/328 (83%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            |||| |||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 1431 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1372

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            || ||||||| || || ||||| ||||| ||||||||||||||||| ||||| ||||| |
Sbjct: 1371 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 1312

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||||||||  |  ||||||| ||| |||||||||||||| |||||||||||||| |
Sbjct: 1311 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 1252

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| ||||| |  ||||||||| |   ||||||||||||||| || || |
Sbjct: 1251 taccagcatcaccgttcttcaagaacttgggctccttctccagctccttgccagatcgtc 1192

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            |||| |||||||||   | ||| || |||||||| || |||||||| |||||||||||||
Sbjct: 1191 tgtcaatcttggtcaccagctcagcaaacttgacagcaatgtgggaggtgtggcagtcca 1132

                                        
Query: 492  ncacaggggcataaccgttgctgatctg 519
             ||| || ||||| ||||| | ||||||
Sbjct: 1131 gcactggagcatagccgttaccgatctg 1104
to top
>dbj|D63582.1| Oryza sativa mRNA for EF-1 alpha, complete cds
          Length = 1637

 Score =  228 bits (115), Expect = 1e-56
 Identities = 274/328 (83%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            |||| |||||||||   ||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 1410 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1351

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            || ||||||| || || ||||| ||||| ||||||||||||||||| ||||| ||||| |
Sbjct: 1350 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 1291

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||||||||  |  ||||||| ||| |||||||||||||| |||||||||||||| |
Sbjct: 1290 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 1231

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| ||||| |  ||||||||| |   ||||||||||||||| || || |
Sbjct: 1230 taccagcatcaccgttcttcaagaacttgggctccttctccagctccttgccagatcgtc 1171

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            |||| |||||||||   | ||| || |||||||| || |||||||| |||||||||||||
Sbjct: 1170 tgtcaatcttggtcaccagctcagcaaacttgacagcaatgtgggaggtgtggcagtcca 1111

                                        
Query: 492  ncacaggggcataaccgttgctgatctg 519
             ||| || ||||| ||||| | ||||||
Sbjct: 1110 gcactggagcatagccgttaccgatctg 1083
to top
>gb|AF136825.1|AF136825 Zea mays clone c elongation factor 1 alpha mRNA, complete cds
          Length = 1609

 Score =  220 bits (111), Expect = 3e-54
 Identities = 267/320 (83%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||||   |||||||| || |||||||| || || || ||||||||||||||
Sbjct: 1420 tcatttcttcttggcagcagccttcgtcaccttggctccagttgggtccttcttctccac 1361

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
             |||||||| || || ||||| ||||| |||||||||||||| |||||||||| ||||||
Sbjct: 1360 actcttgatgactccgacagccaccgtttgcctcatgtcacggacggcaaacctacccag 1301

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
            |||||| |||  ||  || |||| ||||||||| ||||||||||| |||||||| || | 
Sbjct: 1300 aggaggatacgcggagaatgtctccaccaccataggcttggttggtatcatcttcaccat 1241

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||| | ||| || ||||| ||| |   ||| ||||| ||||| || |||||
Sbjct: 1240 accagcatcaccgtacttcaggaactttggctccttctcaagctctttgccagagcgcct 1181

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
            ||||||||||||   || ||| || |||||||| ||||||||||| ||||||||||||| 
Sbjct: 1180 gtcgatcttggtaatgagctcagcaaacttgacagcgatgtgggaggtgtggcagtccag 1121

                                
Query: 493  cacaggggcataaccgttgc 512
            |||||||||||| |||||||
Sbjct: 1120 cacaggggcatagccgttgc 1101
to top
>dbj|AK119647.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-G07, full
            insert sequence
          Length = 1660

 Score =  220 bits (111), Expect = 3e-54
 Identities = 273/328 (83%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            |||| |||||||||   ||||||||||| |||||||  ||||| || |||||||||||||
Sbjct: 1433 ctcacttcttcttggcggcagccttggtcaccttggtaccggttgggtccttcttctcca 1374

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            || ||||||| || || ||||| ||||| ||||||||||||||||| ||||| ||||| |
Sbjct: 1373 cgttcttgatgacgccaacagccaccgtttgcctcatgtcacgcaccgcaaaacgaccaa 1314

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||||||||  |  ||||||| ||| |||||||||||||| |||||||||||||| |
Sbjct: 1313 gaggagggtactcagagaaggtctccacaaccatgggcttggtaggaatcatcttgacca 1254

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| ||||| |  ||||||||| |   ||||||||||||||| || || |
Sbjct: 1253 taccagcatcaccgttcttcaagaacttgggctccttctccagctccttgccagatcgtc 1194

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            |||| |||||||||   | ||| || |||||||| || |||||||| |||||||||||||
Sbjct: 1193 tgtcaatcttggtcaccagctcagcaaacttgacagcaatgtgggaggtgtggcagtcca 1134

                                        
Query: 492  ncacaggggcataaccgttgctgatctg 519
             ||| || ||||| ||||| | ||||||
Sbjct: 1133 gcactggagcatagccgttaccgatctg 1106
to top
>gb|BT016827.1| Zea mays clone Contig660 mRNA sequence
          Length = 1780

 Score =  212 bits (107), Expect = 9e-52
 Identities = 260/312 (83%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||||   |||||||| || |||||||| || || || ||||||||||||||
Sbjct: 1477 tcatttcttcttggcagcagccttcgtcaccttggctccagttgggtccttcttctccac 1418

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
             |||||||| || || ||||| ||||| |||||||||||||| || ||||| ||||| ||
Sbjct: 1417 actcttgatgactccgacagccaccgtttgcctcatgtcacggacagcaaatcgaccaag 1358

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
            |||||| ||||| | |||||||| ||||||||||||||| || |||| |||||| || | 
Sbjct: 1357 aggaggatactgagaaaaggtctccaccaccatgggcttagtgggaaccatcttcaccat 1298

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||| ||||||||||| |||||| |   |||||||||||||||||| |||||
Sbjct: 1297 accagcatcaccgttcttgagaaatttgggctccttctccagctccttgccggatcgcct 1238

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
             || ||||||||   || ||| || |||||||| || ||||| || ||||||||||||| 
Sbjct: 1237 atcaatcttggtaacgagctcagcaaacttgacagcaatgtgtgaggtgtggcagtccag 1178

                        
Query: 493  cacaggggcata 504
             || ||||||||
Sbjct: 1177 aactggggcata 1166
to top
>gb|BT009129.1| Triticum aestivum clone wl1n.pk0027.f4:fis, full insert mRNA sequence
          Length = 2565

 Score =  212 bits (107), Expect = 9e-52
 Identities = 260/312 (83%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||||   |||||||| || |||||||| || || || ||||||||||||||
Sbjct: 2399 tcatttcttcttggcagcagccttcgtcaccttggctccagttgggtccttcttctccac 2340

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
             |||||||| || || ||||| ||||| |||||||||||||| || ||||| ||||| ||
Sbjct: 2339 actcttgatgactccgacagccaccgtttgcctcatgtcacggacagcaaatcgaccaag 2280

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
            |||||| ||||| | |||||||| ||||||||||||||| || |||| |||||| || | 
Sbjct: 2279 aggaggatactgagaaaaggtctccaccaccatgggcttagtgggaaccatcttcaccat 2220

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||| ||||||||||| |||||| |   |||||||||||||||||| |||||
Sbjct: 2219 accagcatcaccgttcttgagaaatttgggctccttctccagctccttgccggatcgcct 2160

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
             || ||||||||   || ||| || |||||||| || ||||| || ||||||||||||| 
Sbjct: 2159 atcaatcttggtaacgagctcagcaaacttgacagcaatgtgtgaggtgtggcagtccag 2100

                        
Query: 493  cacaggggcata 504
             || ||||||||
Sbjct: 2099 aactggggcata 2088
to top
>dbj|D45408.1|MZEEF1A Zea mays elongation factor 1alpha gene, complete cds
          Length = 3062

 Score =  212 bits (107), Expect = 9e-52
 Identities = 260/312 (83%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||||   |||||||| || |||||||| || || || ||||||||||||||
Sbjct: 2710 tcatttcttcttggcagcagccttcgtcaccttggctccagttgggtccttcttctccac 2651

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
             |||||||| || || ||||| ||||| |||||||||||||| || ||||| ||||| ||
Sbjct: 2650 actcttgatgactccgacagccaccgtttgcctcatgtcacggacagcaaatcgaccaag 2591

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
            |||||| ||||| | |||||||| ||||||||||||||| || |||| |||||| || | 
Sbjct: 2590 aggaggatactgagaaaaggtctccaccaccatgggcttagtgggaaccatcttcaccat 2531

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||| ||||||||||| |||||| |   |||||||||||||||||| |||||
Sbjct: 2530 accagcatcaccgttcttgagaaatttgggctccttctccagctccttgccggatcgcct 2471

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
             || ||||||||   || ||| || |||||||| || ||||| || ||||||||||||| 
Sbjct: 2470 atcaatcttggtaacgagctcagcaaacttgacagcaatgtgtgaggtgtggcagtccag 2411

                        
Query: 493  cacaggggcata 504
             || ||||||||
Sbjct: 2410 aactggggcata 2399
to top
>gb|U76259.1|ZMU76259 Zea mays elongation factor 1-alpha (EF1-A) mRNA, complete cds
          Length = 1692

 Score =  212 bits (107), Expect = 9e-52
 Identities = 260/312 (83%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||||   |||||||| || |||||||| || || || ||||||||||||||
Sbjct: 1477 tcatttcttcttggcagcagccttcgtcaccttggctccagttgggtccttcttctccac 1418

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
             |||||||| || || ||||| ||||| |||||||||||||| || ||||| ||||| ||
Sbjct: 1417 actcttgatgactccgacagccaccgtttgcctcatgtcacggacagcaaatcgaccaag 1358

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
            |||||| ||||| | |||||||| ||||||||||||||| || |||| |||||| || | 
Sbjct: 1357 aggaggatactgagaaaaggtctccaccaccatgggcttagtgggaaccatcttcaccat 1298

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||| ||||||||||| |||||| |   |||||||||||||||||| |||||
Sbjct: 1297 accagcatcaccgttcttgagaaatttgggctccttctccagctccttgccggatcgcct 1238

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
             || ||||||||   || ||| || |||||||| || ||||| || ||||||||||||| 
Sbjct: 1237 atcaatcttggtaacgagctcagcaaacttgacagcaatgtgtgaggtgtggcagtccag 1178

                        
Query: 493  cacaggggcata 504
             || ||||||||
Sbjct: 1177 aactggggcata 1166
to top
>dbj|D45407.1|MZEEF1AA Corn mRNA for elongation factor 1A
          Length = 1519

 Score =  212 bits (107), Expect = 9e-52
 Identities = 260/312 (83%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||||   |||||||| || |||||||| || || || ||||||||||||||
Sbjct: 1328 tcatttcttcttggcagcagccttcgtcaccttggctccagttgggtccttcttctccac 1269

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
             |||||||| || || ||||| ||||| |||||||||||||| || ||||| ||||| ||
Sbjct: 1268 actcttgatgactccgacagccaccgtttgcctcatgtcacggacagcaaatcgaccaag 1209

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
            |||||| ||||| | |||||||| ||||||||||||||| || |||| |||||| || | 
Sbjct: 1208 aggaggatactgagaaaaggtctccaccaccatgggcttagtgggaaccatcttcaccat 1149

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||| ||||||||||| |||||| |   |||||||||||||||||| |||||
Sbjct: 1148 accagcatcaccgttcttgagaaatttgggctccttctccagctccttgccggatcgcct 1089

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
             || ||||||||   || ||| || |||||||| || ||||| || ||||||||||||| 
Sbjct: 1088 atcaatcttggtaacgagctcagcaaacttgacagcaatgtgtgaggtgtggcagtccag 1029

                        
Query: 493  cacaggggcata 504
             || ||||||||
Sbjct: 1028 aactggggcata 1017
to top
>dbj|D12709.1|DARELF1A Daucus carota mRNA for elongation factor 1-alpha, complete cds
          Length = 1700

 Score =  210 bits (106), Expect = 3e-51
 Identities = 265/317 (83%), Gaps = 4/317 (1%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            ||||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||||||
Sbjct: 1377 tcatttcttcttgattgcagccttggtgaccttggctccggtaggatccttcttctccac 1318

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
             |||||||| || ||||||||||| ||||||||||||||||| || |||||||  || ||
Sbjct: 1317 actcttgatgactcccacagcaacagtctgcctcatgtcacgaacagcaaaccttccaag 1258

                                                                        
Query: 313  aggagggtactgggca--aaggtctncaccaccatgggcttggttggaatcatcttgacg 370
             ||||||||  || ||  |||||||  ||||||||||||||||||||||||||||| |||
Sbjct: 1257 tggagggta--ggacatgaaggtctcgaccaccatgggcttggttggaatcatcttaacg 1200

                                                                        
Query: 371  aacccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgc 430
            || ||||||||||||||||| | |||||||||| |   ||| || ||||| || || || 
Sbjct: 1199 aaaccagcatcaccattcttcaaaaacttgggctccttctcaagttccttaccagatcga 1140

                                                                        
Query: 431  ctgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcc 490
            |  || |||||||||||||| || || ||||| || || ||||| || |||||||| || 
Sbjct: 1139 cgatcaatcttggtctggatttcagcaaacttaacagcaatgtgagaagtgtggcaatca 1080

                             
Query: 491  ancacaggggcataacc 507
            | ||| || ||||||||
Sbjct: 1079 agcactggagcataacc 1063
to top
>gb|BT018898.1| Zea mays clone EL01T0207D05.d mRNA sequence
          Length = 1483

 Score =  202 bits (102), Expect = 8e-49
 Identities = 248/295 (84%), Gaps = 2/295 (0%)
 Strand = Plus / Minus

                                                                        
Query: 212  gccttggtaaccttggcgccggtcggctccttcttctccac-gctc-ttgatcacaccca 269
            ||||||||||||||||||||||||||  ||||||||||||| | || ||||| || || |
Sbjct: 1366 gccttggtaaccttggcgccggtcggggccttcttctccacaggtcattgatgactccaa 1307

                                                                        
Query: 270  cagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggcaa 329
            ||||||| |||||||||||||| || || ||||||| ||| || ||||| ||||| |  |
Sbjct: 1306 cagcaactgtctgcctcatgtcgcggacagcaaacctaccaaggggaggatactgcgaga 1247

                                                                        
Query: 330  aggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattct 389
            | |||| |||||||||||||||||| ||||||||||| || |  ||||||||||| ||||
Sbjct: 1246 atgtctccaccaccatgggcttggtgggaatcatcttcaccataccagcatcaccgttct 1187

                                                                        
Query: 390  tgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgga 449
            | || ||||||||| |   ||| ||||||||||| ||||||||||||||||||||   ||
Sbjct: 1186 tcaggaacttgggctccttctcaagctccttgccagaccgcctgtcgatcttggtaatga 1127

                                                                   
Query: 450  tctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcata 504
              || || |||||||| || |||||||| ||||||||||||| ||| ||||||||
Sbjct: 1126 gttcagcaaacttgacagcaatgtgggaggtgtggcagtccagcactggggcata 1072
to top
>gb|BT016242.1| Zea mays clone Contig75 mRNA sequence
          Length = 1421

 Score =  200 bits (101), Expect = 3e-48
 Identities = 251/302 (83%)
 Strand = Plus / Minus

                                                                        
Query: 211  agccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacacccac 270
            ||||||||| |||||||| || || || |||||||||||||| |||||||| || || ||
Sbjct: 1179 agccttggtcaccttggctccagttgggtccttcttctccacactcttgatgactccgac 1120

                                                                        
Query: 271  agcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggcaaa 330
            ||| ||||| |||||||||||||| || ||||| ||||| |||||||| || |  | |||
Sbjct: 1119 agccaccgtttgcctcatgtcacggacagcaaagcgaccaagaggaggatattcagaaaa 1060

                                                                        
Query: 331  ggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattctt 390
            ||||| ||| ||||||||||| || |||| |||||| || |  |||||||||||||||||
Sbjct: 1059 ggtctccactaccatgggcttagtgggaaccatcttcaccataccagcatcaccattctt 1000

                                                                        
Query: 391  gagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctggat 450
            |||||| |||||| |   ||| ||||||||||| |||||||| || ||||||||   || 
Sbjct: 999  gagaaatttgggctccttctcaagctccttgccagaccgcctatcaatcttggtaatgag 940

                                                                        
Query: 451  ctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccgtt 510
            ||| || |||||||| || ||||| || ||||||||||||| ||| |||||||| |||||
Sbjct: 939  ctccgcaaacttgacagcaatgtgcgaggtgtggcagtccagcactggggcatagccgtt 880

              
Query: 511  gc 512
            ||
Sbjct: 879  gc 878
to top
>gb|AF136829.1|AF136829 Zea mays clone g elongation factor 1 alpha mRNA, complete cds
          Length = 1592

 Score =  196 bits (99), Expect = 5e-47
 Identities = 258/312 (82%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||||   || |||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 1444 tcatttcttcttggcggccgccttggtcaccttggcgccggtcgggtccttcttctccac 1385

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
             |||||||| || || |||||||| |||||||||||||| || || ||||||| ||| ||
Sbjct: 1384 actcttgatgactccaacagcaactgtctgcctcatgtcgcggacagcaaacctaccaag 1325

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
             |||||  ||  ||  || |||| ||||||||| |||||||| || |||||||| || | 
Sbjct: 1324 gggaggaaacgcggagaatgtctccaccaccataggcttggtgggtatcatcttcaccat 1265

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||| | ||| || ||||| ||| |   ||| ||||||||||| || |||||
Sbjct: 1264 accagcatcaccgtccttcaggaactttggctccttctcaagctccttgccagagcgcct 1205

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
            ||||||||||||   || ||| || |||||||| ||||||||||| ||||||||||||| 
Sbjct: 1204 gtcgatcttggtaatgagctcagcaaacttgacagcgatgtgggaggtgtggcagtccag 1145

                        
Query: 493  cacaggggcata 504
            ||| ||||||||
Sbjct: 1144 cactggggcata 1133
to top
>gb|AF181492.1|AF181492 Lilium longiflorum elongation factor-1 alpha 3 mRNA, complete cds
          Length = 1686

 Score =  194 bits (98), Expect = 2e-46
 Identities = 260/315 (82%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||| |  |||| ||||||||||||||| || || || ||||||||||| ||
Sbjct: 1383 tcatttcttcttcacagcagacttggtaaccttggctccagtgggatccttcttctcaac 1324

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
              ||||||| ||||| |||||||| |||||||||||||| | ||| |||||||  |||||
Sbjct: 1323 attcttgatgacaccgacagcaacagtctgcctcatgtccctcacagcaaacctccccag 1264

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
             ||||| ||||  || |||||||  |||||||| ||||| || ||||||||||| || | 
Sbjct: 1263 tggaggatactcagcgaaggtctcaaccaccatcggcttagtcggaatcatcttcaccat 1204

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||||||||| |||||||| ||  |   |||||||||||| || || |||||
Sbjct: 1203 accagcatcaccattcttcagaaacttcggttccttctccagctccttaccagatcgcct 1144

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
            ||| ||||||||| |||||||||| ||||| || || |||||||| |||||||| || | 
Sbjct: 1143 gtcaatcttggtcaggatctcggcaaacttaacagctatgtgggaggtgtggcaatcaag 1084

                           
Query: 493  cacaggggcataacc 507
             ||||| ||||||||
Sbjct: 1083 gacaggagcataacc 1069
to top
>gb|DQ407753.1| Gymnadenia conopsea EF-1 alpha mRNA, complete cds
          Length = 1682

 Score =  192 bits (97), Expect = 8e-46
 Identities = 253/306 (82%)
 Strand = Plus / Minus

                                                                        
Query: 214  cttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacacccacagc 273
            |||||| |||||||||||| | ||||||||||||||||| |||||||| || || || ||
Sbjct: 1381 cttggtgaccttggcgccgctgggctccttcttctccacactcttgataacgccgacggc 1322

                                                                        
Query: 274  aaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggcaaaggt 333
             ||||||||||||||||| | |||||| || || || || ||||| |||| ||  |||||
Sbjct: 1321 caccgtctgcctcatgtccctcacggcgaagcggccgagcggaggatactcggagaaggt 1262

                                                                        
Query: 334  ctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattcttgag 393
             | ||||||||||||||| |  ||||||||||| ||||| || || || || ||||| ||
Sbjct: 1261 ttccaccaccatgggcttcgacggaatcatcttcacgaaacctgcgtcgccgttcttcag 1202

                                                                        
Query: 394  aaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctggatctc 453
             ||||||||| |   ||| ||||||||||| ||||||| ||||||||||||  |||||||
Sbjct: 1201 gaacttgggctccttctcgagctccttgccagaccgccggtcgatcttggtgaggatctc 1142

                                                                        
Query: 454  ggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccgttgct 513
             ||||||||||| |||||||| || ||||||||||| | ||| || || || ||||||| 
Sbjct: 1141 agcgaacttgacagcgatgtgcgaggtgtggcagtcgagcaccggcgcgtagccgttgcc 1082

                  
Query: 514  gatctg 519
            ||||||
Sbjct: 1081 gatctg 1076
to top
>gb|DQ447160.1| Passiflora edulis translation elongation factor 1a-1 (EF1a1) mRNA,
           partial cds
          Length = 358

 Score =  190 bits (96), Expect = 3e-45
 Identities = 189/221 (85%)
 Strand = Plus / Minus

                                                                       
Query: 299 gcaaaccgacccagaggagggtactgggcaaaggtctncaccaccatgggcttggttgga 358
           ||||| ||||| ||||||||||||| ||  ||||||| |||||||||||||||||| |||
Sbjct: 333 gcaaatcgaccaagaggagggtactcggagaaggtctccaccaccatgggcttggtagga 274

                                                                       
Query: 359 atcatcttgacgaacccagcatcaccattcttgagaaacttgggcgctgnctccagctcc 418
           |||||||| ||||| ||||||||||| ||||| |  || |||||| ||  ||||||||||
Sbjct: 273 atcatcttcacgaatccagcatcaccgttcttcaagaatttgggctctttctccagctcc 214

                                                                       
Query: 419 ttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggat 478
           ||||| |||||||||||||||||||||  ||| || |  ||||||||||| ||||| |||
Sbjct: 213 ttgccagaccgcctgtcgatcttggtcaagatttcagaaaacttgacggcaatgtgtgat 154

                                                    
Query: 479 gtgtggcagtccancacaggggcataaccgttgctgatctg 519
           ||||||||||| | ||| ||||| || ||||||| ||||||
Sbjct: 153 gtgtggcagtcgagcactggggcgtatccgttgccgatctg 113
to top
>emb|X96678.1|NPELF N.pseudonarcissu mRNA for elongation factor
          Length = 988

 Score =  190 bits (96), Expect = 3e-45
 Identities = 253/306 (82%)
 Strand = Plus / Minus

                                                                       
Query: 186 caccatctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttct 245
           ||||| ||||||||||||||   |||||||| || |||||||| || || || |||||||
Sbjct: 738 caccacctcatttcttcttggcagcagcctttgtgaccttggcacctgtaggatccttct 679

                                                                       
Query: 246 tctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaacc 305
           |||| || |||||||| ||||| |||||||| |||||||||||||| |  || |||||||
Sbjct: 678 tctcaacactcttgataacaccaacagcaacagtctgcctcatgtccctaacagcaaacc 619

                                                                       
Query: 306 gacccagaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatct 365
           | ||||  || ||||||| ||| ||||||| ||| ||||| |||||||| ||||||||||
Sbjct: 618 gccccatcggtgggtactcggcgaaggtctccacaaccatcggcttggtcggaatcatct 559

                                                                       
Query: 366 tgacgaacccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccgg 425
           | || | |||||||||||||||||| ||||| || ||| |   ||| |||||||| || |
Sbjct: 558 tcaccatcccagcatcaccattcttcagaaatttcggctccttctcaagctccttacccg 499

                                                                       
Query: 426 accgcctgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggc 485
           | ||||  ||||||||||||  ||| ||||||||| |||| ||||| || || |||||||
Sbjct: 498 atcgccgatcgatcttggtcaagatttcggcgaacctgaccgcgatatgagaggtgtggc 439

                 
Query: 486 agtcca 491
           ||||||
Sbjct: 438 agtcca 433
to top
>gb|AF331850.1| Saccharum hybrid cultivar CP72-2086 elongation factor 1 alpha (SEF1a)
            mRNA, partial cds
          Length = 1578

 Score =  188 bits (95), Expect = 1e-44
 Identities = 269/328 (82%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            ||||||||||||||   ||||||||||| |||||||| || || || |||||||||||||
Sbjct: 1327 ctcatttcttcttggcggcagccttggtcaccttggctccagttgggtccttcttctcca 1268

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            | |||||||| || || ||||| ||||| ||||||||||| ||||| ||||| ||||| |
Sbjct: 1267 cactcttgatgactccaacagccaccgtttgcctcatgtcccgcacagcaaagcgaccaa 1208

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||| || |  |  ||||||| ||||||||||||||| || |||| |||||| || |
Sbjct: 1207 gaggaggatattcagagaaggtctccaccaccatgggcttagtgggaaccatcttcacca 1148

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| |||||||| || |||||| |   ||| ||||||||||| |||||||
Sbjct: 1147 taccagcatcaccgttcttgaggaatttgggctccttctcaagctccttgccagaccgcc 1088

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            | || ||||||||    | ||| || |||||||| || ||||| || |||||||||||||
Sbjct: 1087 tatcaatcttggtaacaagctcagcaaacttgacagcaatgtgtgaggtgtggcagtcca 1028

                                        
Query: 492  ncacaggggcataaccgttgctgatctg 519
             ||| ||||| || ||||||| ||||||
Sbjct: 1027 gcactggggcgtagccgttgccgatctg 1000
to top
>gb|AF331849.1| Saccharum hybrid cultivar CP65-357 elongation factor 1 alpha (SEF1a)
            gene, complete cds
          Length = 4537

 Score =  188 bits (95), Expect = 1e-44
 Identities = 269/328 (82%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            ||||||||||||||   ||||||||||| |||||||| || || || |||||||||||||
Sbjct: 4090 ctcatttcttcttggcggcagccttggtcaccttggctccagttgggtccttcttctcca 4031

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            | |||||||| || || ||||| ||||| ||||||||||| ||||| ||||| ||||| |
Sbjct: 4030 cactcttgatgactccgacagccaccgtttgcctcatgtcccgcacagcaaagcgaccaa 3971

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||| || |  |  ||||||| ||||||||||||||| || |||| |||||| || |
Sbjct: 3970 gaggaggatattcagagaaggtctccaccaccatgggctttgtgggaaccatcttcacca 3911

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
              ||||||||||| |||||||| || |||||| |   ||| ||||||||||| |||||||
Sbjct: 3910 taccagcatcaccgttcttgaggaatttgggctccttctcaagctccttgccagaccgcc 3851

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            | || ||||||||    | ||| || |||||||| || ||||| || |||||||||||||
Sbjct: 3850 tatcaatcttggttacaagctcagcaaacttgacagcaatgtgtgaggtgtggcagtcca 3791

                                        
Query: 492  ncacaggggcataaccgttgctgatctg 519
             ||| ||||| || ||||||| ||||||
Sbjct: 3790 gcactggggcgtagccgttgccgatctg 3763
to top
>gb|AF121261.1|AF121261 Lilium longiflorum elongation factor 1-alpha 1 (EF-1-alpha1) mRNA,
            complete cds
          Length = 1700

 Score =  182 bits (92), Expect = 8e-43
 Identities = 269/329 (81%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            |||| ||||||||||| ||||||||||| |||||||| || || || ||||||||||| |
Sbjct: 1420 ctcacttcttcttgatagcagccttggtcaccttggcaccagtgggatccttcttctcaa 1361

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            | ||||| || || || |||||||| ||||| | |||||| |  || ||||| || || |
Sbjct: 1360 cactcttaataaccccaacagcaacagtctggcgcatgtccctaacagcaaaacgcccaa 1301

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            ||||||| ||||  |  || |||| ||||||||| |||||||| ||||||||||| ||||
Sbjct: 1300 gaggaggatactcagagaatgtctccaccaccataggcttggtcggaatcatcttcacga 1241

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
            | ||||||||||||||||| | |||||| ||| |   ||| |  ||||| || || ||||
Sbjct: 1240 aaccagcatcaccattcttcaaaaacttaggctccttctcaatttccttaccagagcgcc 1181

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            |||||||||||||| ||||||| || |||||||| || |||||||| |||||||| ||||
Sbjct: 1180 tgtcgatcttggtcaggatctcagcaaacttgacagcaatgtgggaggtgtggcaatcca 1121

                                         
Query: 492  ncacaggggcataaccgttgctgatctgg 520
              ||||| |||||||| || | |||||||
Sbjct: 1120 ggacaggagcataaccattaccgatctgg 1092
to top
>gb|DQ057979.1| Musa acuminata elongation factor-1 alpha mRNA, complete cds
          Length = 1644

 Score =  180 bits (91), Expect = 3e-42
 Identities = 224/269 (83%)
 Strand = Plus / Minus

                                                                        
Query: 215  ttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacacccacagca 274
            |||||||||||||| ||||| || ||||||||||||||||| ||||| |||||||| |||
Sbjct: 1408 ttggtaaccttggctccggtgggatccttcttctccacgcttttgataacacccacggca 1349

                                                                        
Query: 275  accgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggcaaaggtc 334
            |||||||| |||||||| |  || ||||||| |||||| || | ||||| ||| || |||
Sbjct: 1348 accgtctgtctcatgtctctaacagcaaacctacccaggggcgagtactcggcgaaagtc 1289

                                                                        
Query: 335  tncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattcttgaga 394
            |  |||||||| ||||| || ||||||||||| || || || ||||| ||||||||||| 
Sbjct: 1288 tcgaccaccatcggctttgtcggaatcatcttcaccaaacctgcatctccattcttgagg 1229

                                                                        
Query: 395  aacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctggatctcg 454
            ||||||||  |   |||||||||||||||||| |||||||| ||||||||| | | ||| 
Sbjct: 1228 aacttgggttccttctccagctccttgccggatcgcctgtcaatcttggtcagaagctcc 1169

                                         
Query: 455  gcgaacttgacggcgatgtgggatgtgtg 483
            || |||||||| || ||||| || |||||
Sbjct: 1168 gcaaacttgacagctatgtgagaagtgtg 1140
to top
>gb|AY550990.1| Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete
            cds
          Length = 1623

 Score =  178 bits (90), Expect = 1e-41
 Identities = 246/299 (82%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            |||| |||||| |||||||| ||  | || ||||||||||| || |||||||| || |||
Sbjct: 1401 gcagacttggtgaccttggcaccactagggtccttcttctcaacactcttgatgactccc 1342

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            ||||| |||||||| |||||||| |  || ||||| ||||| |||||||| ||||| |  
Sbjct: 1341 acagccaccgtctgtctcatgtctctgacagcaaaacgaccaagaggaggatactgagag 1282

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || ||||  |||||||| |||||||| ||||||||||| || || |||||||||||||||
Sbjct: 1281 aaagtctcaaccaccataggcttggtgggaatcatcttcacaaatccagcatcaccattc 1222

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || || ||||| ||| |   ||| ||||||||||| || |||||||| ||||||||  ||
Sbjct: 1221 ttaaggaacttaggctccttctcaagctccttgccagatcgcctgtcaatcttggtgagg 1162

                                                                       
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
            ||||| ||||| ||||| || ||||| || |||||||| || | |||||||||||||||
Sbjct: 1161 atctcagcgaatttgacagcaatgtgagaggtgtggcaatcaagcacaggggcataacc 1103
to top
>dbj|AB073630.1| Suaeda japonica sjef-1A mRNA for eukaryotic elongation factor 1A,
            complete cds
          Length = 1857

 Score =  178 bits (90), Expect = 1e-41
 Identities = 258/315 (81%)
 Strand = Plus / Minus

                                                                        
Query: 193  tcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccac 252
            |||||||||||| || ||||||||||| |||||||| |  || || |||||||| || ||
Sbjct: 1439 tcatttcttcttcatggcagccttggtgaccttggcactagttggttccttcttgtcaac 1380

                                                                        
Query: 253  gctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccag 312
             |||||||| |||||||||||||| |||||||||||||| | ||||||||| ||||| ||
Sbjct: 1379 actcttgatgacacccacagcaacagtctgcctcatgtccctcacggcaaaacgaccaag 1320

                                                                        
Query: 313  aggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaa 372
            ||| | |||||  ||||| |||| |||||||||||||||||| ||||||||||| || | 
Sbjct: 1319 aggtgagtactctgcaaaagtctccaccaccatgggcttggtgggaatcatcttaaccat 1260

                                                                        
Query: 373  cccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcct 432
             ||||||||||||||||| |  || |||||| |   ||| |||||||| || || || ||
Sbjct: 1259 accagcatcaccattcttcaagaatttgggctccttctcgagctccttaccagatcgtct 1200

                                                                        
Query: 433  gtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccan 492
            ||| ||||||||  |||  || || || ||||| || ||||| || ||||| ||||| | 
Sbjct: 1199 gtcaatcttggtaaggagttcagcaaatttgacagcaatgtgagaggtgtgacagtcaag 1140

                           
Query: 493  cacaggggcataacc 507
            |||||| ||||||||
Sbjct: 1139 cacaggtgcataacc 1125
to top
>ref|NM_100666.2| Arabidopsis thaliana calmodulin binding / translation elongation
            factor AT1G07920 mRNA, complete cds
          Length = 1782

 Score =  165 bits (83), Expect = 2e-37
 Identities = 254/312 (81%)
 Strand = Plus / Minus

                                                                        
Query: 199  cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
            ||||||||  |||||||||||||||||||| ||||| || |||||||| || || |||||
Sbjct: 1450 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1391

                                                                        
Query: 259  gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
            ||| ||||| || ||||| |||||||||||||| | ||| || || || || || || ||
Sbjct: 1390 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1331

                                                                        
Query: 319  gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
            |||||  |  ||||||| ||| |||||||||||||||||| ||||||| || |  |||||
Sbjct: 1330 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1271

                                                                        
Query: 379  atcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgat 438
            |||||||||||| |  ||||||||| |   ||| | |||||| || || |||||||| ||
Sbjct: 1270 atcaccattcttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcaat 1211

                                                                        
Query: 439  cttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacagg 498
            |||||||  |||||| | ||||||||| || ||||| || |||||||| ||||  || ||
Sbjct: 1210 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 1151

                        
Query: 499  ggcataaccgtt 510
            ||| ||||||||
Sbjct: 1150 ggcgtaaccgtt 1139
to top
>gb|BT012707.1| Lycopersicon esculentum clone 113585F, mRNA sequence
          Length = 1768

 Score =  165 bits (83), Expect = 2e-37
 Identities = 231/281 (82%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| || ||  ||||||  ||||||
Sbjct: 1414 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacaccc 1355

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| |||||||||||||| | ||| ||||| |||||||  || ||||| | ||||
Sbjct: 1354 acagcaacagtctgcctcatgtccctcacagcaaaacgacccaatggtgggtattcggca 1295

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            |||||||  || |||||||||||||| ||||||||||| || |  |||||||||||||||
Sbjct: 1294 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccattc 1235

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  ||||| ||| |   ||| || ||||| || || |||||||| |||||||||  |
Sbjct: 1234 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 1175

                                                     
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtc 489
            ||||| || |||||||| || |||||||| |||||||||||
Sbjct: 1174 atctcagcaaacttgacagcaatgtgggaagtgtggcagtc 1134
to top
>emb|X16431.1|ATEF1A23 A.thaliana A2 and A3 genes encoding elongation factor 1-alpha
          Length = 6022

 Score =  165 bits (83), Expect = 2e-37
 Identities = 254/312 (81%)
 Strand = Plus / Minus

                                                                        
Query: 199  cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
            ||||||||  |||||||||||||||||||| ||||| || |||||||| || || |||||
Sbjct: 1910 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1851

                                                                        
Query: 259  gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
            ||| ||||| || ||||| |||||||||||||| | ||| || || || || || || ||
Sbjct: 1850 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1791

                                                                        
Query: 319  gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
            |||||  |  ||||||| ||| |||||||||||||||||| ||||||| || |  |||||
Sbjct: 1790 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1731

                                                                        
Query: 379  atcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgat 438
            |||||||||||| |  ||||||||| |   ||| | |||||| || || |||||||| ||
Sbjct: 1730 atcaccattcttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcaat 1671

                                                                        
Query: 439  cttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacagg 498
            |||||||  |||||| | ||||||||| || ||||| || |||||||| ||||  || ||
Sbjct: 1670 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 1611

                        
Query: 499  ggcataaccgtt 510
            ||| ||||||||
Sbjct: 1610 ggcgtaaccgtt 1599



 Score =  145 bits (73), Expect = 2e-31
 Identities = 244/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| 
Sbjct: 5331 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 5272

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            || ||||| |||||||||||||| |  || || || || || || || |||||||  |  
Sbjct: 5271 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 5212

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            ||||||| ||| |||||||||||||||||| ||||||| || |  |||||||||||||||
Sbjct: 5211 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 5152

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  || |||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 5151 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 5092

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| ||||  || ||||| ||||||
Sbjct: 5091 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 5032

              
Query: 509  tt 510
            ||
Sbjct: 5031 tt 5030
to top
>dbj|AK221085.1| Arabidopsis thaliana mRNA for elongation factor 1-alpha, complete
           cds, clone: RAFL22-81-H15
          Length = 630

 Score =  165 bits (83), Expect = 2e-37
 Identities = 254/312 (81%)
 Strand = Plus / Minus

                                                                       
Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
           ||||||||  |||||||||||||||||||| ||||| || |||||||| || || |||||
Sbjct: 358 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 299

                                                                       
Query: 259 gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
           ||| ||||| || ||||| |||||||||||||| | ||| || || || || || || ||
Sbjct: 298 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 239

                                                                       
Query: 319 gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
           |||||  |  ||||||| ||| |||||||||||||||||| ||||||| || |  |||||
Sbjct: 238 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 179

                                                                       
Query: 379 atcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgat 438
           |||||||||||| |  ||||||||| |   ||| | |||||| || || |||||||| ||
Sbjct: 178 atcaccattcttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcaat 119

                                                                       
Query: 439 cttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacagg 498
           |||||||  |||||| | ||||||||| || ||||| || |||||||| ||||  || ||
Sbjct: 118 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 59

                       
Query: 499 ggcataaccgtt 510
           ||| ||||||||
Sbjct: 58  ggcgtaaccgtt 47
to top
>gb|AY088358.1| Arabidopsis thaliana clone 6135 mRNA, complete sequence
          Length = 1687

 Score =  165 bits (83), Expect = 2e-37
 Identities = 254/312 (81%)
 Strand = Plus / Minus

                                                                        
Query: 199  cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
            ||||||||  |||||||||||||||||||| ||||| || |||||||| || || |||||
Sbjct: 1419 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1360

                                                                        
Query: 259  gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
            ||| ||||| || ||||| |||||||||||||| | ||| || || || || || || ||
Sbjct: 1359 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1300

                                                                        
Query: 319  gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
            |||||  |  ||||||| ||| |||||||||||||||||| ||||||| || |  |||||
Sbjct: 1299 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1240

                                                                        
Query: 379  atcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgat 438
            |||||||||||| |  ||||||||| |   ||| | |||||| || || |||||||| ||
Sbjct: 1239 atcaccattcttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcaat 1180

                                                                        
Query: 439  cttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacagg 498
            |||||||  |||||| | ||||||||| || ||||| || |||||||| ||||  || ||
Sbjct: 1179 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 1120

                        
Query: 499  ggcataaccgtt 510
            ||| ||||||||
Sbjct: 1119 ggcgtaaccgtt 1108
to top
>gb|BT002442.1| Arabidopsis thaliana elongation factor 1-alpha (At1g07940) mRNA,
            complete cds
          Length = 1704

 Score =  165 bits (83), Expect = 2e-37
 Identities = 254/312 (81%)
 Strand = Plus / Minus

                                                                        
Query: 199  cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
            ||||||||  |||||||||||||||||||| ||||| || |||||||| || || |||||
Sbjct: 1418 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1359

                                                                        
Query: 259  gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
            ||| ||||| || ||||| |||||||||||||| | ||| || || || || || || ||
Sbjct: 1358 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1299

                                                                        
Query: 319  gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
            |||||  |  ||||||| ||| |||||||||||||||||| ||||||| || |  |||||
Sbjct: 1298 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1239

                                                                        
Query: 379  atcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgat 438
            |||||||||||| |  ||||||||| |   ||| | |||||| || || |||||||| ||
Sbjct: 1238 atcaccattcttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcaat 1179

                                                                        
Query: 439  cttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacagg 498
            |||||||  |||||| | ||||||||| || ||||| || |||||||| ||||  || ||
Sbjct: 1178 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 1119

                        
Query: 499  ggcataaccgtt 510
            ||| ||||||||
Sbjct: 1118 ggcgtaaccgtt 1107
to top
>gb|BT002423.1| Arabidopsis thaliana elongation factor 1-alpha (At1g07920) mRNA,
            complete cds
          Length = 1664

 Score =  165 bits (83), Expect = 2e-37
 Identities = 254/312 (81%)
 Strand = Plus / Minus

                                                                        
Query: 199  cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
            ||||||||  |||||||||||||||||||| ||||| || |||||||| || || |||||
Sbjct: 1418 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1359

                                                                        
Query: 259  gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
            ||| ||||| || ||||| |||||||||||||| | ||| || || || || || || ||
Sbjct: 1358 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1299

                                                                        
Query: 319  gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
            |||||  |  ||||||| ||| |||||||||||||||||| ||||||| || |  |||||
Sbjct: 1298 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1239

                                                                        
Query: 379  atcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgat 438
            |||||||||||| |  ||||||||| |   ||| | |||||| || || |||||||| ||
Sbjct: 1238 atcaccattcttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcaat 1179

                                                                        
Query: 439  cttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacagg 498
            |||||||  |||||| | ||||||||| || ||||| || |||||||| ||||  || ||
Sbjct: 1178 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 1119

                        
Query: 499  ggcataaccgtt 510
            ||| ||||||||
Sbjct: 1118 ggcgtaaccgtt 1107
to top
>gb|AC026875.4|AC026875 Genomic sequence for Arabidopsis thaliana BAC T6D22 from chromosome I,
             complete sequence
          Length = 120965

 Score =  165 bits (83), Expect = 2e-37
 Identities = 254/312 (81%)
 Strand = Plus / Minus

                                                                         
Query: 199   cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
             ||||||||  |||||||||||||||||||| ||||| || |||||||| || || |||||
Sbjct: 12884 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 12825

                                                                         
Query: 259   gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
             ||| ||||| || ||||| |||||||||||||| | ||| || || || || || || ||
Sbjct: 12824 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 12765

                                                                         
Query: 319   gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
             |||||  |  ||||||| ||| |||||||||||||||||| ||||||| || |  |||||
Sbjct: 12764 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 12705

                                                                         
Query: 379   atcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgat 438
             |||||||||||| |  ||||||||| |   ||| | |||||| || || |||||||| ||
Sbjct: 12704 atcaccattcttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcaat 12645

                                                                         
Query: 439   cttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacagg 498
             |||||||  |||||| | ||||||||| || ||||| || |||||||| ||||  || ||
Sbjct: 12644 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 12585

                         
Query: 499   ggcataaccgtt 510
             ||| ||||||||
Sbjct: 12584 ggcgtaaccgtt 12573



 Score =  145 bits (73), Expect = 2e-31
 Identities = 244/302 (80%)
 Strand = Plus / Minus

                                                                         
Query: 209   gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
             |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| 
Sbjct: 16331 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 16272

                                                                         
Query: 269   acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
             || ||||| |||||||||||||| |  || || || || || || || |||||||  |  
Sbjct: 16271 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 16212

                                                                         
Query: 329   aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
             ||||||| ||| |||||||||||||||||| ||||||| || |  |||||||||||||||
Sbjct: 16211 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 16152

                                                                         
Query: 389   ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
             || |  || |||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 16151 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 16092

                                                                         
Query: 449   atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
             ||||| | ||||||||| || ||||| || |||||||| ||||  || ||||| ||||||
Sbjct: 16091 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 16032

               
Query: 509   tt 510
             ||
Sbjct: 16031 tt 16030



 Score =  141 bits (71), Expect = 3e-30
 Identities = 251/312 (80%)
 Strand = Plus / Plus

                                                                         
Query: 199   cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
             ||||||||  |||||||||||||||||||| || || || |||||||| || || |||||
Sbjct: 19257 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 19316

                                                                         
Query: 259   gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
             ||| ||||| || ||||| |||||||||||||| | ||| || || || || || || ||
Sbjct: 19317 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 19376

                                                                         
Query: 319   gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
             |||||  |  ||||||| ||| |||||||||||||||||| ||||||| || |  |||||
Sbjct: 19377 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 19436

                                                                         
Query: 379   atcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgat 438
             |||||||||||| |  || || ||| |   ||| | |||||| || || |||||||| ||
Sbjct: 19437 atcaccattcttcaagaatttaggctccttctcaatctccttaccagaacgcctgtcaat 19496

                                                                         
Query: 439   cttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacagg 498
             |||||||  |||||| | ||||||||| || ||||| || |||||||| ||||  || ||
Sbjct: 19497 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 19556

                         
Query: 499   ggcataaccgtt 510
             ||| ||||||||
Sbjct: 19557 ggcgtaaccgtt 19568
to top
>gb|U63815.1|ATU63815 Arabidopsis thaliana AT.I.24-1, AT.I.24-2, AT.I.24-3, AT.I.24-4,
             AT.I.24-5, AT.I.24-6, AT.I.24-9 and AT.I.24-14 genes,
             partial cds, AT.I.24-7, ascorbate peroxidase (ATHAPX1),
             EF-1alpha-A1, -A2 and -A3 (EF-1alpha) and AT.I.24-13
             genes, complete cds
          Length = 63093

 Score =  165 bits (83), Expect = 2e-37
 Identities = 254/312 (81%)
 Strand = Plus / Plus

                                                                         
Query: 199   cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
             ||||||||  |||||||||||||||||||| ||||| || |||||||| || || |||||
Sbjct: 47828 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 47887

                                                                         
Query: 259   gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
             ||| ||||| || ||||| |||||||||||||| | ||| || || || || || || ||
Sbjct: 47888 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 47947

                                                                         
Query: 319   gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
             |||||  |  ||||||| ||| |||||||||||||||||| ||||||| || |  |||||
Sbjct: 47948 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 48007

                                                                         
Query: 379   atcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgat 438
             |||||||||||| |  ||||||||| |   ||| | |||||| || || |||||||| ||
Sbjct: 48008 atcaccattcttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcaat 48067

                                                                         
Query: 439   cttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacagg 498
             |||||||  |||||| | ||||||||| || ||||| || |||||||| ||||  || ||
Sbjct: 48068 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 48127

                         
Query: 499   ggcataaccgtt 510
             ||| ||||||||
Sbjct: 48128 ggcgtaaccgtt 48139



 Score =  145 bits (73), Expect = 2e-31
 Identities = 244/302 (80%)
 Strand = Plus / Plus

                                                                         
Query: 209   gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
             |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| 
Sbjct: 44398 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 44457

                                                                         
Query: 269   acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
             || ||||| |||||||||||||| |  || || || || || || || |||||||  |  
Sbjct: 44458 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 44517

                                                                         
Query: 329   aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
             ||||||| ||| |||||||||||||||||| ||||||| || |  |||||||||||||||
Sbjct: 44518 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 44577

                                                                         
Query: 389   ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
             || |  || |||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 44578 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 44637

                                                                         
Query: 449   atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
             ||||| | ||||||||| || ||||| || |||||||| ||||  || ||||| ||||||
Sbjct: 44638 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 44697

               
Query: 509   tt 510
             ||
Sbjct: 44698 tt 44699



 Score =  141 bits (71), Expect = 3e-30
 Identities = 251/312 (80%)
 Strand = Plus / Minus

                                                                         
Query: 199   cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
             ||||||||  |||||||||||||||||||| || || || |||||||| || || |||||
Sbjct: 41467 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 41408

                                                                         
Query: 259   gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
             ||| ||||| || ||||| |||||||||||||| | ||| || || || || || || ||
Sbjct: 41407 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 41348

                                                                         
Query: 319   gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
             |||||  |  ||||||| ||| |||||||||||||||||| ||||||| || |  |||||
Sbjct: 41347 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 41288

                                                                         
Query: 379   atcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgat 438
             |||||||||||| |  || || ||| |   ||| | |||||| || || |||||||| ||
Sbjct: 41287 atcaccattcttcaagaatttaggctccttctcaatctccttaccagaacgcctgtcaat 41228

                                                                         
Query: 439   cttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacagg 498
             |||||||  |||||| | ||||||||| || ||||| || |||||||| ||||  || ||
Sbjct: 41227 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 41168

                         
Query: 499   ggcataaccgtt 510
             ||| ||||||||
Sbjct: 41167 ggcgtaaccgtt 41156
to top
>gb|AY832572.1| Pseudotsuga menziesii haplotype Pm-EF1A_18 translation elongation
           factor-1 alpha (EF1A) gene, partial cds
          Length = 1072

 Score =  163 bits (82), Expect = 7e-37
 Identities = 199/239 (83%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || |||||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaagaaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832560.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_5
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  163 bits (82), Expect = 7e-37
 Identities = 199/239 (83%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || |||||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaagaaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|DQ284495.1| Solanum tuberosum clone 063G03 elongation factor-1 alpha-like mRNA,
            complete cds
          Length = 1621

 Score =  161 bits (81), Expect = 3e-36
 Identities = 246/302 (81%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| || ||||| || || || || ||||| || ||| |||||| |||||| 
Sbjct: 1378 gcagccttggtgactttggcaccagtagggtctttcttgtcgacgttcttgaccacacca 1319

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| || || | |||||| | ||| ||||| || ||||  || ||||||| ||||
Sbjct: 1318 acagcaacagtttgacgcatgtccctcacagcaaaacgtcccaatggtgggtactcggca 1259

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            |||||||  || |||||||||||||| ||||||||||| || |  || ||||||||||||
Sbjct: 1258 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccggcatcaccattc 1199

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || | |||||||||| |   ||| || ||||| || || || ||||| |||||||||  |
Sbjct: 1198 ttcaaaaacttgggctccttctcaagttccttaccagaacgtctgtcaatcttggtcaag 1139

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| || |||||||| ||||||||||| ||||||||||||| ||| |||||||| |||
Sbjct: 1138 atctcagcaaacttgacagcgatgtgggaggtgtggcagtccagcactggggcatatccg 1079

              
Query: 509  tt 510
            ||
Sbjct: 1078 tt 1077
to top
>emb|AJ234435.1|HVU234435 Hordeum vulgare partial mRNA; clone cMWG0716.rev
          Length = 325

 Score =  159 bits (80), Expect = 1e-35
 Identities = 139/159 (87%)
 Strand = Plus / Plus

                                                                       
Query: 195 atttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgc 254
           ||||||||||||| ||||||||||| |||||||| ||||| || ||||||||||||||||
Sbjct: 167 atttcttcttgatggcagccttggtcaccttggctccggtggggtccttcttctccacgc 226

                                                                       
Query: 255 tcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagag 314
            |||||| ||||| ||||| || || |||||||||||||| || ||||| ||||| ||||
Sbjct: 227 ccttgatgacaccaacagccacagtttgcctcatgtcacggacagcaaaacgaccaagag 286

                                                  
Query: 315 gagggtactgggcaaaggtctncaccaccatgggcttgg 353
           |||||||   ||||||||||| ||| |||||||||||||
Sbjct: 287 gagggtaagtggcaaaggtctccacaaccatgggcttgg 325
to top
>gb|AY832581.1| Pseudotsuga menziesii haplotype Pm-EF1A_412m1 translation
           elongation factor-1 alpha (EF1A) gene, partial cds
          Length = 1072

 Score =  155 bits (78), Expect = 2e-34
 Identities = 198/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832580.1| Pseudotsuga menziesii haplotype Pm-EF1A_013d2 translation
           elongation factor-1 alpha (EF1A) gene, partial cds
          Length = 1072

 Score =  155 bits (78), Expect = 2e-34
 Identities = 198/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832578.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_24
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  155 bits (78), Expect = 2e-34
 Identities = 198/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832576.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_22
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  155 bits (78), Expect = 2e-34
 Identities = 198/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832573.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_19
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  155 bits (78), Expect = 2e-34
 Identities = 198/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832571.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_17
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  155 bits (78), Expect = 2e-34
 Identities = 198/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832570.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_16
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  155 bits (78), Expect = 2e-34
 Identities = 198/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832567.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_12
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  155 bits (78), Expect = 2e-34
 Identities = 198/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832565.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_10
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  155 bits (78), Expect = 2e-34
 Identities = 198/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832564.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_9
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  155 bits (78), Expect = 2e-34
 Identities = 198/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832563.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_8
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  155 bits (78), Expect = 2e-34
 Identities = 198/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832562.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_7
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  155 bits (78), Expect = 2e-34
 Identities = 198/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AF464925.1| Elaeis oleifera elongation factor 1-alpha mRNA, complete cds
          Length = 1805

 Score =  151 bits (76), Expect = 3e-33
 Identities = 238/293 (81%)
 Strand = Plus / Minus

                                                                        
Query: 212  gccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacacccaca 271
            |||||||| | |||||| || || || ||||||||||||||||||||||| |||||||| 
Sbjct: 1381 gccttggtgatcttggcaccagttggatccttcttctccacgctcttgatgacacccact 1322

                                                                        
Query: 272  gcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggcaaag 331
            || || ||||| | |||||| | ||| ||||| ||||| ||||| |||||||  |  |||
Sbjct: 1321 gctacggtctggcgcatgtccctcacagcaaatcgaccaagaggggggtactcagagaag 1262

                                                                        
Query: 332  gtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattcttg 391
            ||||  || |||||||||||||| |||| |||||| || || || |||||||||||||| 
Sbjct: 1261 gtctcaacaaccatgggcttggtgggaagcatcttcacaaaacctgcatcaccattcttt 1202

                                                                        
Query: 392  agaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctggatc 451
            | |||||||||| ||  ||| || ||||| || ||||||||||| ||||| ||   || |
Sbjct: 1201 aaaaacttgggctctttctcaagttccttaccagaccgcctgtcaatcttagtaacgagc 1142

                                                                 
Query: 452  tcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcata 504
            ||||| ||||| || || || ||||| |||||||||||||  || ||||||||
Sbjct: 1141 tcggcaaacttaacagcaatatgggaggtgtggcagtccagaactggggcata 1089
to top
>dbj|AB073631.1| Salsola komarovii skef-1A mRNA for eukaryotic elongation factor  1A,
            complete cds
          Length = 1646

 Score =  151 bits (76), Expect = 3e-33
 Identities = 262/325 (80%)
 Strand = Plus / Minus

                                                                        
Query: 195  atttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgc 254
            |||||||||| |  ||||||||||| |||||||| || || || ||||||||||| ||  
Sbjct: 1364 atttcttcttaagggcagccttggtgaccttggcaccagttgggtccttcttctcaacat 1305

                                                                        
Query: 255  tcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagag 314
            ||||||| ||||| |||||||| || ||||||||||| | ||||||||| ||||| || |
Sbjct: 1304 tcttgatgacaccaacagcaacagtttgcctcatgtccctcacggcaaaacgaccaaggg 1245

                                                                        
Query: 315  gagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacc 374
            | |||||||  |  || |||| ||||||||| ||||||||||||| |||||| |  |  |
Sbjct: 1244 gtgggtactccgagaaagtctccaccaccataggcttggttggaaccatcttaatcatac 1185

                                                                        
Query: 375  cagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgt 434
            |||||||||||||||| |  || |||||| |   ||| |||||||| || || |||||||
Sbjct: 1184 cagcatcaccattcttcaagaatttgggctccttctcaagctccttacctgaacgcctgt 1125

                                                                        
Query: 435  cgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccanca 494
            |||||||||||   | ||| || ||||| || || ||||| || |||||||| |||| ||
Sbjct: 1124 cgatcttggtcaccaactcagcaaacttaacagcaatgtgagaggtgtggcaatccaaca 1065

                                     
Query: 495  caggggcataaccgttgctgatctg 519
            | ||||| |||||||| | ||||||
Sbjct: 1064 ctggggcgtaaccgtttccgatctg 1040
to top
>emb|X56856.1|GMTEFS1 G.max tefS1 gene for elongation factor EF-1a
          Length = 1979

 Score =  149 bits (75), Expect = 1e-32
 Identities = 240/296 (81%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| ||||| || ||||||||||| ||| ||||||| || |||
Sbjct: 1893 gcagccttggtgaccttggctccggtaggatccttcttctcaacgttcttgatgactccc 1834

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| || || | |||||| |  || ||||||| ||| || ||||| |||| ||  
Sbjct: 1833 acagcaacagtttgacgcatgtccctaacagcaaacctaccaagtggaggatactcggag 1774

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || || |  || |||||||| ||||||||||||||||| || || ||||||||||| |||
Sbjct: 1773 aaagtttcaacaaccatgggtttggttggaatcatcttaacaaaaccagcatcaccgttc 1714

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || | |||||||||| |   ||| ||||| |||||||| |||||||| |||||||||  |
Sbjct: 1713 ttcaaaaacttgggctccttctcaagctctttgccggatcgcctgtcaatcttggtcatg 1654

                                                                    
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcata 504
            |  || || |||||||| || ||||| || ||||||||||| |  |||||||||||
Sbjct: 1653 agttcagcaaacttgacagcaatgtgagaagtgtggcagtcgaggacaggggcata 1598
to top
>gb|AF181491.1|AF181491 Lilium longiflorum elongation factor-1 alpha 2 mRNA, complete cds
          Length = 1761

 Score =  149 bits (75), Expect = 1e-32
 Identities = 187/225 (83%)
 Strand = Plus / Minus

                                                                        
Query: 221  accttggcgccggtcggctccttcttctccacgctcttgatcacacccacagcaaccgtc 280
            |||||||| || ||||| ||||||||||||||  ||||||| |||||||||||||| |||
Sbjct: 1378 accttggctccagtcggttccttcttctccacattcttgataacacccacagcaacagtc 1319

                                                                        
Query: 281  tgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggcaaaggtctncacc 340
            |||||||||||||| || |||||||| || || ||||||||||  | ||| |||| ||||
Sbjct: 1318 tgcctcatgtcacgaacagcaaaccgcccaagtggagggtactcagaaaaagtctccacc 1259

                                                                        
Query: 341  accatgggcttggttggaatcatcttgacgaacccagcatcaccattcttgagaaacttg 400
            ||||| |||||||| ||||||||||| |  |  || ||||| |||||||| |||||||| 
Sbjct: 1258 accattggcttggtaggaatcatcttaatcatacccgcatctccattcttcagaaacttc 1199

                                                         
Query: 401  ggcgctgnctccagctccttgccggaccgcctgtcgatcttggtc 445
            ||| |   ||||| ||||||||| || ||||  || |||||||||
Sbjct: 1198 ggctccttctccaactccttgccagagcgccgatcaatcttggtc 1154
to top
>gb|AY832582.1| Pseudotsuga menziesii haplotype Pm-EF1A_412m2 translation
           elongation factor-1 alpha (EF1A) gene, partial cds
          Length = 1072

 Score =  147 bits (74), Expect = 4e-32
 Identities = 197/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | ||| || | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatatccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832579.1| Pseudotsuga menziesii haplotype Pm-EF1A_013d1 translation
           elongation factor-1 alpha (EF1A) gene, partial cds
          Length = 1072

 Score =  147 bits (74), Expect = 4e-32
 Identities = 197/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | ||| || | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatatccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832577.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_23
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  147 bits (74), Expect = 4e-32
 Identities = 197/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||| ||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggagcataacc 432
to top
>gb|AY832575.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_21
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  147 bits (74), Expect = 4e-32
 Identities = 197/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | ||| || | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatatccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832574.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_20
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  147 bits (74), Expect = 4e-32
 Identities = 197/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||| ||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggagcataacc 432
to top
>gb|AY832569.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_15
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  147 bits (74), Expect = 4e-32
 Identities = 197/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | ||| || | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatatccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832566.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_11
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  147 bits (74), Expect = 4e-32
 Identities = 197/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | ||| || | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatatccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832561.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_6
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  147 bits (74), Expect = 4e-32
 Identities = 197/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||| ||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggagcataacc 432
to top
>gb|AY832559.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_4
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  147 bits (74), Expect = 4e-32
 Identities = 197/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | ||| || | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatatccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832558.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_3
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  147 bits (74), Expect = 4e-32
 Identities = 197/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | ||| || | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatatccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>gb|AY832557.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_2
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  147 bits (74), Expect = 4e-32
 Identities = 197/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatgtccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||| ||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggagcataacc 432
to top
>gb|AY832556.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_1
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  147 bits (74), Expect = 4e-32
 Identities = 197/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | ||| || | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatatccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| | |||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaaccttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>emb|AJ132534.1|PAB132534 Picea abies mRNA for translation elongation factor-1 alpha, partial
          Length = 1747

 Score =  147 bits (74), Expect = 4e-32
 Identities = 197/239 (82%)
 Strand = Plus / Minus

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||||||||| | |||||| | ||| ||||| |||||||  ||||| ||||  || 
Sbjct: 1259 acagcaaccgtctgacgcatgtccctcacagcaaaacgacccaatggaggatactcagcg 1200

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            ||||| | ||| |||||||| |||||||| |||||||| || ||||| ||||| ||||||
Sbjct: 1199 aaggtttccacaaccatgggtttggttggtatcatcttaacaaacccggcatctccattc 1140

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |||||||||||  |   |||||| |||||||| || |||||||| | |||||||  |
Sbjct: 1139 ttaagaaacttgggttccttctccagttccttgccagaacgcctgtcaaccttggtcatg 1080

                                                                       
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
            ||||| |  ||||||||||| |||||| | |||||||| |||| |||||||||||||||
Sbjct: 1079 atctcagaaaacttgacggcaatgtggcaagtgtggcaatccaacacaggggcataacc 1021
to top
>ref|NM_100667.2| Arabidopsis thaliana calmodulin binding / translation elongation
            factor AT1G07930 mRNA, complete cds
          Length = 1778

 Score =  145 bits (73), Expect = 2e-31
 Identities = 244/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| 
Sbjct: 1424 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1365

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            || ||||| |||||||||||||| |  || || || || || || || |||||||  |  
Sbjct: 1364 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1305

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            ||||||| ||| |||||||||||||||||| ||||||| || |  |||||||||||||||
Sbjct: 1304 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1245

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  || |||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1244 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1185

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| ||||  || ||||| ||||||
Sbjct: 1184 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1125

              
Query: 509  tt 510
            ||
Sbjct: 1124 tt 1123
to top
>gb|AY123029.1| Arabidopsis thaliana putative elongation factor 1-alpha (At1g07930)
            mRNA, complete cds
          Length = 1381

 Score =  145 bits (73), Expect = 2e-31
 Identities = 244/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| 
Sbjct: 1328 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1269

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            || ||||| |||||||||||||| |  || || || || || || || |||||||  |  
Sbjct: 1268 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1209

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            ||||||| ||| |||||||||||||||||| ||||||| || |  |||||||||||||||
Sbjct: 1208 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1149

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  || |||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1148 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1089

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| ||||  || ||||| ||||||
Sbjct: 1088 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1029

              
Query: 509  tt 510
            ||
Sbjct: 1028 tt 1027
to top
>gb|AY080660.1| Arabidopsis thaliana putative elongation factor 1-alpha (At1g07930)
            mRNA, complete cds
          Length = 1705

 Score =  145 bits (73), Expect = 2e-31
 Identities = 244/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| 
Sbjct: 1420 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1361

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            || ||||| |||||||||||||| |  || || || || || || || |||||||  |  
Sbjct: 1360 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1301

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            ||||||| ||| |||||||||||||||||| ||||||| || |  |||||||||||||||
Sbjct: 1300 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1241

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  || |||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1240 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1181

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| ||||  || ||||| ||||||
Sbjct: 1180 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1121

              
Query: 509  tt 510
            ||
Sbjct: 1120 tt 1119
to top
>gb|AF361822.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, complete cds
          Length = 1679

 Score =  145 bits (73), Expect = 2e-31
 Identities = 244/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| 
Sbjct: 1420 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1361

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            || ||||| |||||||||||||| |  || || || || || || || |||||||  |  
Sbjct: 1360 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1301

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            ||||||| ||| |||||||||||||||||| ||||||| || |  |||||||||||||||
Sbjct: 1300 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1241

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  || |||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1240 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1181

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| ||||  || ||||| ||||||
Sbjct: 1180 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1121

              
Query: 509  tt 510
            ||
Sbjct: 1120 tt 1119
to top
>gb|AY065008.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, complete cds
          Length = 1657

 Score =  145 bits (73), Expect = 2e-31
 Identities = 244/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| 
Sbjct: 1420 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1361

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            || ||||| |||||||||||||| |  || || || || || || || |||||||  |  
Sbjct: 1360 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1301

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            ||||||| ||| |||||||||||||||||| ||||||| || |  |||||||||||||||
Sbjct: 1300 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1241

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  || |||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1240 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1181

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| ||||  || ||||| ||||||
Sbjct: 1180 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1121

              
Query: 509  tt 510
            ||
Sbjct: 1120 tt 1119
to top
>gb|AY059160.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, complete cds
          Length = 1350

 Score =  145 bits (73), Expect = 2e-31
 Identities = 244/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| 
Sbjct: 1328 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1269

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            || ||||| |||||||||||||| |  || || || || || || || |||||||  |  
Sbjct: 1268 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1209

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            ||||||| ||| |||||||||||||||||| ||||||| || |  |||||||||||||||
Sbjct: 1208 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1149

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  || |||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1148 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1089

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| ||||  || ||||| ||||||
Sbjct: 1088 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1029

              
Query: 509  tt 510
            ||
Sbjct: 1028 tt 1027
to top
>gb|AY048275.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, complete cds
          Length = 1682

 Score =  145 bits (73), Expect = 2e-31
 Identities = 244/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| 
Sbjct: 1414 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1355

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            || ||||| |||||||||||||| |  || || || || || || || |||||||  |  
Sbjct: 1354 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1295

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            ||||||| ||| |||||||||||||||||| ||||||| || |  |||||||||||||||
Sbjct: 1294 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1235

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  || |||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1234 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1175

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| ||||  || ||||| ||||||
Sbjct: 1174 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1115

              
Query: 509  tt 510
            ||
Sbjct: 1114 tt 1113
to top
>emb|BX829434.1|CNS0A06V Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB13ZG03 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1526

 Score =  145 bits (73), Expect = 2e-31
 Identities = 244/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| ||||||||||| || ||||| 
Sbjct: 1377 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1318

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| |||||||||||||| |  || || || || |||| ||| ||||||| ||  
Sbjct: 1317 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1258

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || ||||  || |||||||||||||||||  ||||||| || |  ||||| |||||||||
Sbjct: 1257 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1198

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || | |||||||||| |   ||| | |||||| || || |||||||  |||||||||  |
Sbjct: 1197 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtgaatcttggtcaag 1138

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| |||||||| ||||||||||| || |  || ||||| ||||||
Sbjct: 1137 atctcagagaacttgactgcgatgtgagatgtgtggcaatcgagaactggggcgtaaccg 1078

              
Query: 509  tt 510
            ||
Sbjct: 1077 tt 1076
to top
>gb|BT003325.1| Arabidopsis thaliana Unknown protein mRNA, complete cds
          Length = 1677

 Score =  145 bits (73), Expect = 2e-31
 Identities = 244/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||| 
Sbjct: 1420 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1361

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            || ||||| |||||||||||||| |  || || || || || || || |||||||  |  
Sbjct: 1360 actgcaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1301

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            ||||||| ||| |||||||||||||||||| ||||||| || |  |||||||||||||||
Sbjct: 1300 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1241

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  || |||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1240 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1181

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| ||||  || ||||| ||||||
Sbjct: 1180 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1121

              
Query: 509  tt 510
            ||
Sbjct: 1120 tt 1119
to top
>gb|DQ174256.1| Gossypium hirsutum translation elongation factor 1A-7 (EF1A7) mRNA,
            complete cds
          Length = 1617

 Score =  143 bits (72), Expect = 7e-31
 Identities = 226/278 (81%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            |||| |||||| |||||||| || || || |||||||||||||| |||||||| ||||| 
Sbjct: 1328 gcagacttggtcaccttggctccagttgggtccttcttctccacactcttgattacacca 1269

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| ||||| |||||||| |  |||||||| || || || |||||||||| ||  
Sbjct: 1268 acagcaacagtctgtctcatgtccctaacggcaaaacgtccaagtggagggtactcggag 1209

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            ||||| | ||| |||||||||||||| |||| |||||| |  |  |||||||||||||||
Sbjct: 1208 aaggtttccacaaccatgggcttggtcggaaccatcttaatcataccagcatcaccattc 1149

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  ||||| ||| |   ||| |||||||| || || |||||||| |||||||||  |
Sbjct: 1148 ttcaagaacttaggctccttctcaagctccttaccagatcgcctgtcaatcttggtcaag 1089

                                                  
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggca 486
            | ||| || |||||||| || |||||||| ||||||||
Sbjct: 1088 agctctgcaaacttgacagcaatgtgggaggtgtggca 1051
to top
>emb|X96555.1|PSEF1ALPH P.sativum mRNA for elongation factor 1-alpha
          Length = 1670

 Score =  143 bits (72), Expect = 7e-31
 Identities = 190/230 (82%)
 Strand = Plus / Minus

                                                                        
Query: 215  ttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacacccacagca 274
            ||||| |||||||| || || || |||||||||||||| |||||||| || || ||||||
Sbjct: 1425 ttggtgaccttggctccagttgggtccttcttctccacactcttgatgactccgacagca 1366

                                                                        
Query: 275  accgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggcaaaggtc 334
            || || || |||||||| | ||| ||||| ||||| |||||||| ||||  ||||| || 
Sbjct: 1365 acagtttgtctcatgtccctcacagcaaaacgaccaagaggaggatactcagcaaaagtt 1306

                                                                        
Query: 335  tncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattcttgaga 394
            | |||||||||||||||||||||||||||||| || |  || |||||||||||||| | |
Sbjct: 1305 tccaccaccatgggcttggttggaatcatcttaaccataccggcatcaccattcttcaaa 1246

                                                              
Query: 395  aacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggt 444
            ||||||||| |   ||| | |||||| || || |||||||| ||||||||
Sbjct: 1245 aacttgggctccttctcaatctccttaccagatcgcctgtcaatcttggt 1196
to top
>gb|AY946009.1| Actinidia deliciosa elongation factor 1 alpha mRNA, complete cds
          Length = 1738

 Score =  143 bits (72), Expect = 7e-31
 Identities = 252/313 (80%)
 Strand = Plus / Minus

                                                                        
Query: 192  ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
            |||| |||||||| |  ||||||||||| |||||||| |||||||| |||||||||||||
Sbjct: 1442 ctcacttcttcttcagagcagccttggtgaccttggcaccggtcggatccttcttctcca 1383

                                                                        
Query: 252  cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
            |||||||||| ||||| || || || || || | |||||| | ||| ||||| ||||| |
Sbjct: 1382 cgctcttgatgacaccaaccgccacagtttgacgcatgtctctcacagcaaaacgaccga 1323

                                                                        
Query: 312  gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
            | || |||||||  |  || |||| |||||||||||| ||||| ||||||||||| || |
Sbjct: 1322 gcggtgggtactccgagaaagtctccaccaccatgggtttggtgggaatcatcttcacca 1263

                                                                        
Query: 372  acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
             |||||  ||||||||||| |  ||||||||| |   ||| ||||| ||||| |||| ||
Sbjct: 1262 tcccagagtcaccattcttcaagaacttgggctccttctcgagctctttgccagacctcc 1203

                                                                        
Query: 432  tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
            | || |||||||||   | ||| || ||||| || ||||||||||| |||||||| ||||
Sbjct: 1202 tatcaatcttggtcaaaagctcagcaaacttaactgcgatgtgggaggtgtggcaatcca 1143

                         
Query: 492  ncacaggggcata 504
              || ||||||||
Sbjct: 1142 aaaccggggcata 1130
to top
>ref|NM_001035916.1| Arabidopsis thaliana calmodulin binding / translation elongation
            factor AT1G07940 transcript variant AT1G07940.2 mRNA,
            complete cds
          Length = 1990

 Score =  141 bits (71), Expect = 3e-30
 Identities = 251/312 (80%)
 Strand = Plus / Minus

                                                                        
Query: 199  cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
            ||||||||  |||||||||||||||||||| || || || |||||||| || || |||||
Sbjct: 1581 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 1522

                                                                        
Query: 259  gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
            ||| ||||| || ||||| |||||||||||||| | ||| || || || || || || ||
Sbjct: 1521 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1462

                                                                        
Query: 319  gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
            |||||  |  ||||||| ||| |||||||||||||||||| ||||||| || |  |||||
Sbjct: 1461 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1402

                                                                        
Query: 379  atcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgat 438
            |||||||||||| |  || || ||| |   ||| | |||||| || || |||||||| ||
Sbjct: 1401 atcaccattcttcaagaatttaggctccttctcaatctccttaccagaacgcctgtcaat 1342

                                                                        
Query: 439  cttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacagg 498
            |||||||  |||||| | ||||||||| || ||||| || |||||||| ||||  || ||
Sbjct: 1341 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 1282

                        
Query: 499  ggcataaccgtt 510
            ||| ||||||||
Sbjct: 1281 ggcgtaaccgtt 1270
to top
>ref|NM_100668.2| Arabidopsis thaliana calmodulin binding / translation elongation
            factor AT1G07940 transcript variant AT1G07940.1 mRNA,
            complete cds
          Length = 1864

 Score =  141 bits (71), Expect = 3e-30
 Identities = 251/312 (80%)
 Strand = Plus / Minus

                                                                        
Query: 199  cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
            ||||||||  |||||||||||||||||||| || || || |||||||| || || |||||
Sbjct: 1455 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 1396

                                                                        
Query: 259  gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
            ||| ||||| || ||||| |||||||||||||| | ||| || || || || || || ||
Sbjct: 1395 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1336

                                                                        
Query: 319  gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
            |||||  |  ||||||| ||| |||||||||||||||||| ||||||| || |  |||||
Sbjct: 1335 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1276

                                                                        
Query: 379  atcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgat 438
            |||||||||||| |  || || ||| |   ||| | |||||| || || |||||||| ||
Sbjct: 1275 atcaccattcttcaagaatttaggctccttctcaatctccttaccagaacgcctgtcaat 1216

                                                                        
Query: 439  cttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacagg 498
            |||||||  |||||| | ||||||||| || ||||| || |||||||| ||||  || ||
Sbjct: 1215 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 1156

                        
Query: 499  ggcataaccgtt 510
            ||| ||||||||
Sbjct: 1155 ggcgtaaccgtt 1144
to top
>gb|BT000595.1| Arabidopsis thaliana elongation factor 1-alpha  (At1g07940/T6D22_14)
            mRNA, complete cds
          Length = 1350

 Score =  141 bits (71), Expect = 3e-30
 Identities = 251/312 (80%)
 Strand = Plus / Minus

                                                                        
Query: 199  cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
            ||||||||  |||||||||||||||||||| || || || |||||||| || || |||||
Sbjct: 1338 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 1279

                                                                        
Query: 259  gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
            ||| ||||| || ||||| |||||||||||||| | ||| || || || || || || ||
Sbjct: 1278 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1219

                                                                        
Query: 319  gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
            |||||  |  ||||||| ||| |||||||||||||||||| ||||||| || |  |||||
Sbjct: 1218 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1159

                                                                        
Query: 379  atcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgat 438
            |||||||||||| |  || || ||| |   ||| | |||||| || || |||||||| ||
Sbjct: 1158 atcaccattcttcaagaatttaggctccttctcaatctccttaccagaacgcctgtcaat 1099

                                                                        
Query: 439  cttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacagg 498
            |||||||  |||||| | ||||||||| || ||||| || |||||||| ||||  || ||
Sbjct: 1098 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 1039

                        
Query: 499  ggcataaccgtt 510
            ||| ||||||||
Sbjct: 1038 ggcgtaaccgtt 1027
to top
>emb|X16430.1|ATEF1AA1 Arabidopsis thaliana EF-1 alpha A1 gene for elongation factor 1-alpha
          Length = 3230

 Score =  141 bits (71), Expect = 3e-30
 Identities = 251/312 (80%)
 Strand = Plus / Minus

                                                                        
Query: 199  cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
            ||||||||  |||||||||||||||||||| || || || |||||||| || || |||||
Sbjct: 2589 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 2530

                                                                        
Query: 259  gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
            ||| ||||| || ||||| |||||||||||||| | ||| || || || || || || ||
Sbjct: 2529 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 2470

                                                                        
Query: 319  gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
            |||||  |  ||||||| ||| |||||||||||||||||| ||||||| || |  |||||
Sbjct: 2469 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 2410

                                                                        
Query: 379  atcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgat 438
            |||||||||||| |  || || ||| |   ||| | |||||| || || |||||||| ||
Sbjct: 2409 atcaccattcttcaagaatttaggctccttctcaatctccttaccagaacgcctgtcaat 2350

                                                                        
Query: 439  cttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacagg 498
            |||||||  |||||| | ||||||||| || ||||| || |||||||| ||||  || ||
Sbjct: 2349 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 2290

                        
Query: 499  ggcataaccgtt 510
            ||| ||||||||
Sbjct: 2289 ggcgtaaccgtt 2278
to top
>gb|AY039583.1| Arabidopsis thaliana At1g07940/T6D22_14 mRNA, complete cds
          Length = 1650

 Score =  141 bits (71), Expect = 3e-30
 Identities = 251/312 (80%)
 Strand = Plus / Minus

                                                                        
Query: 199  cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
            ||||||||  |||||||||||||||||||| || || || |||||||| || || |||||
Sbjct: 1410 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 1351

                                                                        
Query: 259  gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
            ||| ||||| || ||||| |||||||||||||| | ||| || || || || || || ||
Sbjct: 1350 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1291

                                                                        
Query: 319  gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
            |||||  |  ||||||| ||| |||||||||||||||||| ||||||| || |  |||||
Sbjct: 1290 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1231

                                                                        
Query: 379  atcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgat 438
            |||||||||||| |  || || ||| |   ||| | |||||| || || |||||||| ||
Sbjct: 1230 atcaccattcttcaagaatttaggctccttctcaatctccttaccagaacgcctgtcaat 1171

                                                                        
Query: 439  cttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacagg 498
            |||||||  |||||| | ||||||||| || ||||| || |||||||| ||||  || ||
Sbjct: 1170 cttggtcaagatctcagagaacttgactgcaatgtgagaggtgtggcaatccaggactgg 1111

                        
Query: 499  ggcataaccgtt 510
            ||| ||||||||
Sbjct: 1110 ggcgtaaccgtt 1099
to top
>gb|AY832568.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_14
           translation elongation factor-1 alpha (EF1A) gene,
           partial cds
          Length = 1072

 Score =  139 bits (70), Expect = 1e-29
 Identities = 196/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||||||||| | ||| || | ||| ||||| |||||||  ||||| |||| ||||
Sbjct: 670 acagcaaccgtctgacgcatatccctcactgcaaaacgacccaatggaggatactcggca 611

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| | ||| ||||| || |||||||||||||||||||| ||||||||||| || |||
Sbjct: 610 aaggtttccacaaccattggtttggttggaatcatcttgacaaacccagcatctccgttc 551

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || || ||||||||  |   ||||||||||||||| || |||||||| |  ||||||  |
Sbjct: 550 ttaaggaacttgggttccttctccagctccttgccagaacgcctgtcaactttggtcatg 491

                                                                      
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataacc 507
           ||||| |  |||||||| || |||||| | |||||||| ||||  ||||||||||||||
Sbjct: 490 atctcagaaaacttgaccgcaatgtggcaagtgtggcaatccaatacaggggcataacc 432
to top
>ref|NM_125432.2| Arabidopsis thaliana calmodulin binding / translation elongation
            factor AT5G60390 transcript variant AT5G60390.1 mRNA,
            complete cds
          Length = 1761

 Score =  137 bits (69), Expect = 4e-29
 Identities = 243/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| ||||||||||| || ||||| 
Sbjct: 1394 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1335

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| |||||||||||||| |  || || || || |||| ||| ||||||| ||  
Sbjct: 1334 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1275

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || ||||  || |||||||||||||||||  ||||||| || |  ||||| |||||||||
Sbjct: 1274 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1215

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || | |||||||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1214 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1155

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| || |  || ||||| ||||||
Sbjct: 1154 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1095

              
Query: 509  tt 510
            ||
Sbjct: 1094 tt 1093
to top
>gb|BT000688.1| Arabidopsis thaliana clone RAFL08-11-M03 (R11086) putative
            translation elongation factor eEF-1 alpha chain (gene A4)
            (At5g60390) mRNA, complete cds
          Length = 1653

 Score =  137 bits (69), Expect = 4e-29
 Identities = 243/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| ||||||||||| || ||||| 
Sbjct: 1391 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1332

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| |||||||||||||| |  || || || || |||| ||| ||||||| ||  
Sbjct: 1331 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1272

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || ||||  || |||||||||||||||||  ||||||| || |  ||||| |||||||||
Sbjct: 1271 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1212

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || | |||||||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1211 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1152

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| || |  || ||||| ||||||
Sbjct: 1151 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1092

              
Query: 509  tt 510
            ||
Sbjct: 1091 tt 1090
to top
>gb|AF360167.1| Arabidopsis thaliana putative translation elongation factor eEF-1
            alpha chain A4 (At5g60390) mRNA, complete cds
          Length = 1597

 Score =  137 bits (69), Expect = 4e-29
 Identities = 243/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| ||||||||||| || ||||| 
Sbjct: 1389 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1330

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| |||||||||||||| |  || || || || |||| ||| ||||||| ||  
Sbjct: 1329 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1270

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || ||||  || |||||||||||||||||  ||||||| || |  ||||| |||||||||
Sbjct: 1269 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1210

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || | |||||||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1209 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1150

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| || |  || ||||| ||||||
Sbjct: 1149 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1090

              
Query: 509  tt 510
            ||
Sbjct: 1089 tt 1088
to top
>emb|X53043.1|LEEF1A L.esculentum gene for elongation factor 1-alpha
          Length = 4565

 Score =  137 bits (69), Expect = 4e-29
 Identities = 223/275 (81%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| || ||  ||||||  ||||| 
Sbjct: 3861 gcagccttggtcaccttggcaccagttgggtccttcttgtcaacattcttgacaacacca 3802

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| |||||||||||||| | ||| ||||| |||||||  |||||||| |  |||
Sbjct: 3801 acagcaacagtctgcctcatgtccctcacagcaaaacgacccaatggagggtattcagca 3742

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            |||||||  || |||||||||||||| ||||||||||| || |  ||||||||||| |||
Sbjct: 3741 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccgttc 3682

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  ||||| ||| |   ||| || ||||| || || |||||||| |||||||||  |
Sbjct: 3681 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 3622

                                               
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtg 483
            ||||| || |||||||| || |||||||| |||||
Sbjct: 3621 atctcagcaaacttgacagcaatgtgggaagtgtg 3587
to top
>emb|X14449.1|LELEEF1 Tomato LeEF-1 mRNA for elongation factor 1 alpha
          Length = 1692

 Score =  137 bits (69), Expect = 4e-29
 Identities = 223/275 (81%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| || ||  ||||||  ||||| 
Sbjct: 1388 gcagccttggtcaccttggcaccagttgggtccttcttgtcaacattcttgacaacacca 1329

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| |||||||||||||| | ||| ||||| |||||||  |||||||| |  |||
Sbjct: 1328 acagcaacagtctgcctcatgtccctcacagcaaaacgacccaatggagggtattcagca 1269

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            |||||||  || |||||||||||||| ||||||||||| || |  ||||||||||| |||
Sbjct: 1268 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccgttc 1209

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  ||||| ||| |   ||| || ||||| || || |||||||| |||||||||  |
Sbjct: 1208 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 1149

                                               
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtg 483
            ||||| || |||||||| || |||||||| |||||
Sbjct: 1148 atctcagcaaacttgacagcaatgtgggaagtgtg 1114
to top
>emb|AJ223969.1|MDAJ39669 Malus domestica mRNA for elongation factor 1 alpha subunit
          Length = 1715

 Score =  137 bits (69), Expect = 4e-29
 Identities = 205/251 (81%)
 Strand = Plus / Minus

                                                                        
Query: 239  tccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacg 298
            ||||||||||| ||||||||||| ||||| || ||||| ||||| | |||||| | ||| 
Sbjct: 1392 tccttcttctcaacgctcttgatgacaccaactgcaacagtctggcgcatgtccctcaca 1333

                                                                        
Query: 299  gcaaaccgacccagaggagggtactgggcaaaggtctncaccaccatgggcttggttgga 358
            ||||| || || || || |||||||  |  |||||||  || |||||||||||||| |||
Sbjct: 1332 gcaaaacgtccgagcggtgggtactcagagaaggtctcaacaaccatgggcttggtggga 1273

                                                                        
Query: 359  atcatcttgacgaacccagcatcaccattcttgagaaacttgggcgctgnctccagctcc 418
            | |||||| || || ||||||||||||||||| | |||||||||| |   ||| ||||||
Sbjct: 1272 agcatcttcacaaatccagcatcaccattctttaaaaacttgggctccttctcaagctcc 1213

                                                                        
Query: 419  ttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggat 478
            ||||| || |||||||||||||| ||   || ||| || ||||||||||| |||||||| 
Sbjct: 1212 ttgccagatcgcctgtcgatctttgtaacgagctcagcaaacttgacggcaatgtgggag 1153

                       
Query: 479  gtgtggcagtc 489
            ||||| |||||
Sbjct: 1152 gtgtgacagtc 1142
to top
>gb|AY140099.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 1601

 Score =  137 bits (69), Expect = 4e-29
 Identities = 243/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| ||||||||||| || ||||| 
Sbjct: 1393 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1334

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| |||||||||||||| |  || || || || |||| ||| ||||||| ||  
Sbjct: 1333 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1274

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || ||||  || |||||||||||||||||  ||||||| || |  ||||| |||||||||
Sbjct: 1273 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1214

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || | |||||||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1213 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1154

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| || |  || ||||| ||||||
Sbjct: 1153 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1094

              
Query: 509  tt 510
            ||
Sbjct: 1093 tt 1092
to top
>gb|AY140095.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 1615

 Score =  137 bits (69), Expect = 4e-29
 Identities = 243/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| ||||||||||| || ||||| 
Sbjct: 1390 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1331

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| |||||||||||||| |  || || || || |||| ||| ||||||| ||  
Sbjct: 1330 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1271

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || ||||  || |||||||||||||||||  ||||||| || |  ||||| |||||||||
Sbjct: 1270 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1211

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || | |||||||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1210 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1151

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| || |  || ||||| ||||||
Sbjct: 1150 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1091

              
Query: 509  tt 510
            ||
Sbjct: 1090 tt 1089
to top
>gb|AY133532.1| Arabidopsis thaliana At5g60390/muf9_40 mRNA, complete cds
          Length = 1350

 Score =  137 bits (69), Expect = 4e-29
 Identities = 243/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| ||||||||||| || ||||| 
Sbjct: 1328 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1269

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| |||||||||||||| |  || || || || |||| ||| ||||||| ||  
Sbjct: 1268 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1209

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || ||||  || |||||||||||||||||  ||||||| || |  ||||| |||||||||
Sbjct: 1208 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1149

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || | |||||||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1148 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1089

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| || |  || ||||| ||||||
Sbjct: 1088 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1029

              
Query: 509  tt 510
            ||
Sbjct: 1028 tt 1027
to top
>gb|AY128802.1| Arabidopsis thaliana elongation factor 1-alpha mRNA, complete cds
          Length = 1526

 Score =  137 bits (69), Expect = 4e-29
 Identities = 243/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| ||||||||||| || ||||| 
Sbjct: 1328 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1269

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| |||||||||||||| |  || || || || |||| ||| ||||||| ||  
Sbjct: 1268 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1209

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || ||||  || |||||||||||||||||  ||||||| || |  ||||| |||||||||
Sbjct: 1208 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1149

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || | |||||||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1148 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1089

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| || |  || ||||| ||||||
Sbjct: 1088 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1029

              
Query: 509  tt 510
            ||
Sbjct: 1028 tt 1027
to top
>gb|DQ399793.1| Phoenix dactylifera elongation factor 1-alpha mRNA, partial cds
          Length = 736

 Score =  137 bits (69), Expect = 4e-29
 Identities = 222/274 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 tccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacg 298
           ||||||||||| ||||||||||| ||||| ||||| || ||||| | |||||| | ||| 
Sbjct: 731 tccttcttctcaacgctcttgatgacaccaacagccactgtctggcgcatgtccctcaca 672

                                                                       
Query: 299 gcaaaccgacccagaggagggtactgggcaaaggtctncaccaccatgggcttggttgga 358
           ||||| ||||| ||||| |||||||| | ||||||||  || |||||||||||||| |||
Sbjct: 671 gcaaaacgaccaagaggtgggtactgagaaaaggtctcaacaaccatgggcttggtagga 612

                                                                       
Query: 359 atcatcttgacgaacccagcatcaccattcttgagaaacttgggcgctgnctccagctcc 418
           |||||||| || || || ||||||||| | || | |||||||||  |   ||| || |||
Sbjct: 611 atcatcttaacaaaacctgcatcaccacttttcaaaaacttgggttccttctcaagttcc 552

                                                                       
Query: 419 ttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggat 478
           || || ||||| ||||| |||| |||  ||||||| || ||||| || || ||||| || 
Sbjct: 551 tttccagaccgtctgtcaatctcggtaaggatctcagcaaacttaacagcaatgtgagag 492

                                             
Query: 479 gtgtggcagtccancacaggggcataaccgttgc 512
           ||||||||||| | |||||| |||||||| ||||
Sbjct: 491 gtgtggcagtcaagcacaggagcataaccattgc 458
to top
>gb|AY060564.1| Arabidopsis thaliana AT5g60390/muf9_40 mRNA, complete cds
          Length = 1595

 Score =  137 bits (69), Expect = 4e-29
 Identities = 243/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| ||||||||||| || ||||| 
Sbjct: 1391 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1332

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| |||||||||||||| |  || || || || |||| ||| ||||||| ||  
Sbjct: 1331 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1272

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || ||||  || |||||||||||||||||  ||||||| || |  ||||| |||||||||
Sbjct: 1271 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1212

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || | |||||||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1211 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1152

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| || |  || ||||| ||||||
Sbjct: 1151 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1092

              
Query: 509  tt 510
            ||
Sbjct: 1091 tt 1090
to top
>gb|AF419586.1|AF419586 Arabidopsis thaliana AT5g60390/muf9_40 mRNA, complete cds
          Length = 1583

 Score =  137 bits (69), Expect = 4e-29
 Identities = 243/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| ||||||||||| || ||||| 
Sbjct: 1391 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1332

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| |||||||||||||| |  || || || || |||| ||| ||||||| ||  
Sbjct: 1331 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1272

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || ||||  || |||||||||||||||||  ||||||| || |  ||||| |||||||||
Sbjct: 1271 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1212

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || | |||||||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1211 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1152

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| || |  || ||||| ||||||
Sbjct: 1151 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1092

              
Query: 509  tt 510
            ||
Sbjct: 1091 tt 1090
to top
>gb|AY059904.1| Arabidopsis thaliana elongation factor 1-alpha (EF-1-alpha) (MUF9.4)
            mRNA, complete cds
          Length = 1616

 Score =  137 bits (69), Expect = 4e-29
 Identities = 243/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| ||||||||||| || ||||| 
Sbjct: 1391 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1332

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| |||||||||||||| |  || || || || |||| ||| ||||||| ||  
Sbjct: 1331 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1272

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || ||||  || |||||||||||||||||  ||||||| || |  ||||| |||||||||
Sbjct: 1271 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1212

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || | |||||||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1211 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1152

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| || |  || ||||| ||||||
Sbjct: 1151 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1092

              
Query: 509  tt 510
            ||
Sbjct: 1091 tt 1090
to top
>dbj|AK221176.1| Arabidopsis thaliana mRNA for translation elongation factor eEF-1
           alpha chain, partial cds, clone: RAFL22-97-N17
          Length = 623

 Score =  137 bits (69), Expect = 4e-29
 Identities = 243/302 (80%)
 Strand = Plus / Minus

                                                                       
Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
           ||||||||||| |||||||| || || || |||||||| ||||||||||| || ||||| 
Sbjct: 410 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 351

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||| |||||||||||||| |  || || || || |||| ||| ||||||| ||  
Sbjct: 350 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 291

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           || ||||  || |||||||||||||||||  ||||||| || |  ||||| |||||||||
Sbjct: 290 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 231

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || | |||||||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 230 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 171

                                                                       
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
           ||||| | ||||||||| || ||||| || |||||||| || |  || ||||| ||||||
Sbjct: 170 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 111

             
Query: 509 tt 510
           ||
Sbjct: 110 tt 109
to top
>gb|BT006369.1| Arabidopsis thaliana At5g60390/muf9_40 gene, complete cds
          Length = 1350

 Score =  137 bits (69), Expect = 4e-29
 Identities = 243/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| ||||||||||| || ||||| 
Sbjct: 1328 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1269

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| |||||||||||||| |  || || || || |||| ||| ||||||| ||  
Sbjct: 1268 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1209

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || ||||  || |||||||||||||||||  ||||||| || |  ||||| |||||||||
Sbjct: 1208 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1149

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || | |||||||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1148 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1089

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| || |  || ||||| ||||||
Sbjct: 1088 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1029

              
Query: 509  tt 510
            ||
Sbjct: 1028 tt 1027
to top
>gb|BT002510.1| Arabidopsis thaliana Unknown protein mRNA, complete cds
          Length = 1576

 Score =  137 bits (69), Expect = 4e-29
 Identities = 243/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| ||||||||||| || ||||| 
Sbjct: 1393 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1334

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| |||||||||||||| |  || || || || |||| ||| ||||||| ||  
Sbjct: 1333 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1274

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || ||||  || |||||||||||||||||  ||||||| || |  ||||| |||||||||
Sbjct: 1273 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1214

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || | |||||||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1213 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1154

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| || |  || ||||| ||||||
Sbjct: 1153 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1094

              
Query: 509  tt 510
            ||
Sbjct: 1093 tt 1092
to top
>dbj|AB011483.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUF9
          Length = 77298

 Score =  137 bits (69), Expect = 4e-29
 Identities = 243/302 (80%)
 Strand = Plus / Minus

                                                                         
Query: 209   gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
             ||||||||||| |||||||| || || || |||||||| ||||||||||| || ||||| 
Sbjct: 11153 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 11094

                                                                         
Query: 269   acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
             |||||||| |||||||||||||| |  || || || || |||| ||| ||||||| ||  
Sbjct: 11093 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 11034

                                                                         
Query: 329   aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
             || ||||  || |||||||||||||||||  ||||||| || |  ||||| |||||||||
Sbjct: 11033 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 10974

                                                                         
Query: 389   ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
             || | |||||||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 10973 ttcaaaaacttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 10914

                                                                         
Query: 449   atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
             ||||| | ||||||||| || ||||| || |||||||| || |  || ||||| ||||||
Sbjct: 10913 atctcagagaacttgactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 10854

               
Query: 509   tt 510
             ||
Sbjct: 10853 tt 10852
to top
>gb|AF041463.1|AF041463 Manihot esculenta elongation factor 1-alpha (MeEF1) gene, complete
            cds
          Length = 4866

 Score =  137 bits (69), Expect = 4e-29
 Identities = 216/266 (81%)
 Strand = Plus / Minus

                                                                        
Query: 242  ttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggca 301
            |||||||| || |||||||||||||| |||||||||||||| | |||||| |  || || 
Sbjct: 4378 ttcttctcaacactcttgatcacaccaacagcaaccgtctggcgcatgtccctaacagcg 4319

                                                                        
Query: 302  aaccgacccagaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatc 361
            || | |||||| |||||||||   |  || |||| ||| |||||||||||||| ||||||
Sbjct: 4318 aatctacccagtggagggtacgcagagaaagtctccacaaccatgggcttggtcggaatc 4259

                                                                        
Query: 362  atcttgacgaacccagcatcaccattcttgagaaacttgggcgctgnctccagctccttg 421
            ||||| |||||||||||||||||||| || | |||||||||| |   ||| ||||| |||
Sbjct: 4258 atcttcacgaacccagcatcaccatttttcaaaaacttgggctccttctcaagctctttg 4199

                                                                        
Query: 422  ccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtg 481
            || ||||  |  || |||||||||  ||| || || ||||| || || |||||||| |||
Sbjct: 4198 ccagacctacgatcaatcttggtcaagatttcagcaaacttcacagcaatgtgggaggtg 4139

                                      
Query: 482  tggcagtccancacaggggcataacc 507
            ||||| |||| ||| |||||||||||
Sbjct: 4138 tggcaatccagcactggggcataacc 4113
to top
>gb|DQ228347.1| Solanum tuberosum clone 149A09 elongation factor 1-alpha-like protein
            mRNA, complete cds
          Length = 1691

 Score =  133 bits (67), Expect = 6e-28
 Identities = 227/281 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| || ||  ||||||  ||||| 
Sbjct: 1379 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacaccg 1320

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| || ||||||||||| | ||| || || |||||||  || ||||| | ||||
Sbjct: 1319 acagcaacagtttgcctcatgtctctcacagcgaaacgacccaatggtgggtattcggca 1260

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            |||||||  || ||||||||||| || ||||||||||| || |  |||||||||||||||
Sbjct: 1259 aaggtctcaacaaccatgggcttagtgggaatcatcttaaccataccagcatcaccattc 1200

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  ||||| ||| |   ||| || ||||| || || |||||||| |||||||||  |
Sbjct: 1199 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 1140

                                                     
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtc 489
            ||||| || |||||||| || |||||||| |||||||||||
Sbjct: 1139 atctcagcaaacttgacagcaatgtgggaagtgtggcagtc 1099
to top
>gb|AY300042.1| Solanum tuberosum putative translation elongation factor protein
           mRNA, partial cds
          Length = 864

 Score =  133 bits (67), Expect = 6e-28
 Identities = 227/281 (80%)
 Strand = Plus / Minus

                                                                       
Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
           ||||||||||| |||||||| || || || |||||||| || ||| ||||||  ||||| 
Sbjct: 845 gcagccttggtcaccttggcaccagttgggtccttcttgtcaacgttcttgacaacacca 786

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||| || ||||||||||| | ||| ||||| |||||||  || |||||||  |||
Sbjct: 785 acagcaacagtttgcctcatgtccctcacagcaaaacgacccaatggtgggtactcagca 726

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           |||||||  || ||||| |||||||| ||||||||||| || |  || ||||||||||||
Sbjct: 725 aaggtctcaacaaccataggcttggtgggaatcatcttaaccatacctgcatcaccattc 666

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || |  ||||| ||| |   ||| || ||||| || || |||||||| |||||||||  |
Sbjct: 665 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 606

                                                    
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtc 489
           ||||| || ||||| || || |||||||| |||||||||||
Sbjct: 605 atctcagcaaactttacagcaatgtgggaagtgtggcagtc 565
to top
>gb|AY651886.1| Glycine max elongation factor 1A SMV resistance-related protein
           mRNA, partial cds
          Length = 965

 Score =  133 bits (67), Expect = 6e-28
 Identities = 238/296 (80%)
 Strand = Plus / Minus

                                                                       
Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
           ||||||||||| |||||||| || || || ||||||||||||||| ||||||| || |||
Sbjct: 566 gcagccttggtgaccttggctccagtaggatccttcttctccacgttcttgatgactccc 507

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||| || || | ||| || |  || ||||| ||||| || || |||||||  |  
Sbjct: 506 acagcaacagtttgacgcatatccctgacagcaaagcgaccaagtggggggtactcagag 447

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           || || |  ||||||||||| ||||| ||||||||||| || || |||||||||||||||
Sbjct: 446 aaagtttcaaccaccatgggtttggtcggaatcatcttaacaaaaccagcatcaccattc 387

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || | |||||||||  |   ||| ||||| ||||| || |||||||| |||||||||  |
Sbjct: 386 ttcaaaaacttgggttccttctcaagctctttgccagatcgcctgtcaatcttggtcatg 327

                                                                   
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcata 504
           |  || || |||||||| || |||||||| ||||||||||| |  |||||||||||
Sbjct: 326 agttcagcaaacttgacagcaatgtgggaagtgtggcagtcaagaacaggggcata 271
to top
>gb|AY496125.1| Capsicum annuum elongation factor 1-alpha mRNA, complete cds
          Length = 635

 Score =  133 bits (67), Expect = 6e-28
 Identities = 227/281 (80%)
 Strand = Plus / Minus

                                                                       
Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
           ||||||||||| |||||||| || || || |||||||| || ||  ||||||  ||||| 
Sbjct: 521 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacacca 462

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||| || ||||||||||| | ||| ||||| |||||||  || ||||| |  |||
Sbjct: 461 acagcaacagtttgcctcatgtctctcacagcaaaacgacccaatggtgggtattcagca 402

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||| |  |||||||| |||||||| ||||||||||| || |  |||||||||||||||
Sbjct: 401 aaggtttcaaccaccattggcttggtgggaatcatcttaaccatgccagcatcaccattc 342

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || |  ||||| ||| |   ||| || ||||| || || ||||||||||||||||||   
Sbjct: 341 ttcaagaacttaggctccttctcgagttccttacctgaacgcctgtcgatcttggtcaaa 282

                                                    
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtc 489
           ||||| || |||||||| || |||||||| |||||||||||
Sbjct: 281 atctcagcaaacttgacagcaatgtgggaagtgtggcagtc 241
to top
>gb|DQ252511.1| Solanum tuberosum clone 087B12 elongation factor 1-alpha-like mRNA,
            complete cds
          Length = 1718

 Score =  133 bits (67), Expect = 6e-28
 Identities = 227/281 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| || ||  ||||||  ||||| 
Sbjct: 1389 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacaccg 1330

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| || ||||||||||| | ||| || || |||||||  || ||||| | ||||
Sbjct: 1329 acagcaacagtttgcctcatgtctctcacagcgaaacgacccaatggtgggtattcggca 1270

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            |||||||  || ||||||||||| || ||||||||||| || |  |||||||||||||||
Sbjct: 1269 aaggtctcaacaaccatgggcttagtgggaatcatcttaaccataccagcatcaccattc 1210

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  ||||| ||| |   ||| || ||||| || || |||||||| |||||||||  |
Sbjct: 1209 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 1150

                                                     
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtc 489
            ||||| || |||||||| || |||||||| |||||||||||
Sbjct: 1149 atctcagcaaacttgacagcaatgtgggaagtgtggcagtc 1109
to top
>gb|BT013246.1| Lycopersicon esculentum clone 134556F, mRNA sequence
          Length = 1728

 Score =  129 bits (65), Expect = 1e-26
 Identities = 197/242 (81%)
 Strand = Plus / Minus

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| ||||| | |||||| | ||||||||| || ||||  || |||||||  |||
Sbjct: 1363 acagcaacagtctgacgcatgtccctcacggcaaaacgtcccaatggtgggtactcagca 1304

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            |||||||  || |||||||||||||| ||||||||||| || |  || ||||||||||||
Sbjct: 1303 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccggcatcaccattc 1244

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || | |||||||||| |   ||| || ||||| || || || ||||| |||||||||  |
Sbjct: 1243 ttcaaaaacttgggctccttctcaagttccttaccagaacgtctgtcaatcttggtcaag 1184

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| || |||||||| || |||||||| ||||||||||| | ||| |||||||| |||
Sbjct: 1183 atctcagcaaacttgacagcaatgtgggaggtgtggcagtcgagcactggggcatatccg 1124

              
Query: 509  tt 510
            ||
Sbjct: 1123 tt 1122
to top
>gb|AY114651.1| Arabidopsis thaliana putative elongation factor 1-a (At1g07920) mRNA,
            complete cds
          Length = 1463

 Score =  129 bits (65), Expect = 1e-26
 Identities = 242/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||  
Sbjct: 1328 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacactg 1269

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            || | ||| |||||||||||||| |  || || || || || || || |||||||  |  
Sbjct: 1268 actgtaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1209

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            ||||||| ||| |||||||||||||||||| ||||||| || |  |||||||||||||||
Sbjct: 1208 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1149

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  || |||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1148 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1089

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| ||||  || ||||| ||||||
Sbjct: 1088 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1029

              
Query: 509  tt 510
            ||
Sbjct: 1028 tt 1027
to top
>gb|AY062553.1| Arabidopsis thaliana putative elongation factor 1-a (At1g07920;
            T6D22.2) mRNA, complete cds
          Length = 1778

 Score =  129 bits (65), Expect = 1e-26
 Identities = 242/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            |||||||||||||||||||| ||||| || |||||||| || || |||||||| ||||  
Sbjct: 1424 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacactg 1365

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            || | ||| |||||||||||||| |  || || || || || || || |||||||  |  
Sbjct: 1364 actgtaacagtctgcctcatgtccctaacagcgaaacgtccaagtggtgggtactcagag 1305

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            ||||||| ||| |||||||||||||||||| ||||||| || |  |||||||||||||||
Sbjct: 1304 aaggtctccacaaccatgggcttggttggagtcatcttcaccataccagcatcaccattc 1245

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  || |||||| |   ||| | |||||| || || |||||||| |||||||||  |
Sbjct: 1244 ttcaagaatttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcaag 1185

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | ||||||||| || ||||| || |||||||| ||||  || ||||| ||||||
Sbjct: 1184 atctcagagaacttgactgcaatgtgagaggtgtggcaatccaagactggggcgtaaccg 1125

              
Query: 509  tt 510
            ||
Sbjct: 1124 tt 1123
to top
>gb|AY039764.1| Sinapis arvensis elongation factor-1 alpha mRNA, partial cds
          Length = 523

 Score =  129 bits (65), Expect = 1e-26
 Identities = 207/255 (81%)
 Strand = Plus / Minus

                                                                       
Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
           ||||||||  ||||||||||| |||||||| ||||| || |||||||| |||||||||||
Sbjct: 258 cttcttgacggcagccttggtcaccttggctccggttgggtccttcttgtccacgctctt 199

                                                                       
Query: 259 gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
           ||| ||||| || ||||| |||||||||||||| | ||| || || || || || || ||
Sbjct: 198 gatgacaccgactgcaacagtctgcctcatgtcccccacagcgaaacgtccaaggggtgg 139

                                                                       
Query: 319 gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
           |||||  |  || ||||  || |||||||||||||| ||| ||||||| || |  |||||
Sbjct: 138 gtactcagagaatgtctcgacaaccatgggcttggtcggagtcatcttcaccataccagc 79

                                                                       
Query: 379 atcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgat 438
           |||||| ||||| | |||||||||| |   ||| | |||||| ||||| |||||||| ||
Sbjct: 78  atcaccgttcttcaaaaacttgggctccttctcaatctccttaccggaacgcctgtcaat 19

                          
Query: 439 cttggtctggatctc 453
           ||||||  |||||||
Sbjct: 18  cttggtgaggatctc 4
to top
>gb|DQ294264.1| Solanum tuberosum clone 131C12 elongation factor 1-alpha-like protein
            mRNA, complete cds
          Length = 1685

 Score =  129 bits (65), Expect = 1e-26
 Identities = 242/302 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| || ||||| || || || || ||||| || ||| ||||||  ||||| 
Sbjct: 1399 gcagccttggtgactttggcaccagtagggtctttcttgtcgacgttcttgacaacacca 1340

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| || || | |||||| | ||| ||||| || ||||  || |||||||  |||
Sbjct: 1339 acagcaacagtttgacgcatgtccctcacagcaaaacgtcccaatggtgggtactcagca 1280

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            |||||||  || |||||||||||||| ||||||||||| || |  || |||||||| |||
Sbjct: 1279 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccggcatcaccgttc 1220

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || | |||||||||| |   ||| || ||||| || || || ||||| |||||||||  |
Sbjct: 1219 ttcaaaaacttgggctccttctcaagttccttaccagaacgtctgtcaatcttggtcaag 1160

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| ||||||||||| || |||||||| ||||||||||| | ||| |||||||| |||
Sbjct: 1159 atctcagcgaacttgacagcaatgtgggaggtgtggcagtcgagcactggggcatatccg 1100

              
Query: 509  tt 510
            ||
Sbjct: 1099 tt 1098
to top
>gb|DQ174254.1| Gossypium hirsutum translation elongation factor 1A-5 (EF1A5) mRNA,
            complete cds
          Length = 1738

 Score =  127 bits (64), Expect = 4e-26
 Identities = 215/266 (80%)
 Strand = Plus / Minus

                                                                        
Query: 221  accttggcgccggtcggctccttcttctccacgctcttgatcacacccacagcaaccgtc 280
            |||||||| || || || |||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 1316 accttggctccagttgggtccttcttctccacactcttgatcacaccaacagcaacagtc 1257

                                                                        
Query: 281  tgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggcaaaggtctncacc 340
            || |||||||| |  |||||||| || || || |||||||||| ||  || || | ||| 
Sbjct: 1256 tgtctcatgtccctaacggcaaaacgtccaagtggagggtactcggagaaagtttccaca 1197

                                                                        
Query: 341  accatgggcttggttggaatcatcttgacgaacccagcatcaccattcttgagaaacttg 400
            |||||||||||||| |||| |||||| |  |  ||||||||||||||||| |  ||||| 
Sbjct: 1196 accatgggcttggtcggaaccatcttaatcataccagcatcaccattcttcaagaactta 1137

                                                                        
Query: 401  ggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcgaac 460
            ||| |   ||| |||||||| || || |||||||| |||||||||  || ||| || |||
Sbjct: 1136 ggctccttctcaagctccttaccagatcgcctgtcaatcttggtcaagagctctgcaaac 1077

                                      
Query: 461  ttgacggcgatgtgggatgtgtggca 486
            ||||| || || ||||| ||||||||
Sbjct: 1076 ttgacagcaatatgggaggtgtggca 1051
to top
>gb|DQ174252.1| Gossypium hirsutum translation elongation factor 1A-3 (EF1A3) mRNA,
            complete cds
          Length = 1711

 Score =  127 bits (64), Expect = 4e-26
 Identities = 224/278 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            |||| |||||| |||||||| || || || |||||||||||||| |||||||||||||| 
Sbjct: 1328 gcagacttggtcaccttggctccagttgggtccttcttctccacactcttgatcacacca 1269

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| ||||| |||||||| |  |||||||| || || || |||||||||  ||  
Sbjct: 1268 acagcaacagtctgtctcatgtccctaacggcaaaacgtccaagtggagggtacgcggag 1209

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            ||||| |  || |||||||||||||| |||| |||||| |  |  |||||||||||||||
Sbjct: 1208 aaggtttctacaaccatgggcttggtcggaaccatcttaatcataccagcatcaccattc 1149

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  ||||| ||| |   ||| |||||||| || || |||||||| |||||||||  |
Sbjct: 1148 ttcaagaacttaggctccttctcaagctccttaccagatcgcctgtcaatcttggtcaag 1089

                                                  
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggca 486
            | ||| || |||||||| || || ||||| ||||||||
Sbjct: 1088 agctctgcaaacttgacagcaatatgggaggtgtggca 1051
to top
>dbj|AB073629.1| Bruguiera sexangula bsef-1A mRNA for eukaryotic elongation factor 1A,
            complete cds
          Length = 1664

 Score =  127 bits (64), Expect = 4e-26
 Identities = 217/269 (80%)
 Strand = Plus / Minus

                                                                        
Query: 239  tccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacg 298
            ||||| ||||| || |||||||| || ||||| ||||| ||||| | |||||| |  |||
Sbjct: 1331 tcctttttctcgacactcttgatgactcccactgcaacagtctggcgcatgtccctgacg 1272

                                                                        
Query: 299  gcaaaccgacccagaggagggtactgggcaaaggtctncaccaccatgggcttggttgga 358
            ||||| | ||| || ||||| |||| ||  || || | ||||||||| |||||||| |||
Sbjct: 1271 gcaaatctaccaagcggaggatactcggagaaagtttccaccaccataggcttggtcgga 1212

                                                                        
Query: 359  atcatcttgacgaacccagcatcaccattcttgagaaacttgggcgctgnctccagctcc 418
            |||||||| ||||||||||||||||||||||| |  ||||||||| |    || ||||||
Sbjct: 1211 atcatcttcacgaacccagcatcaccattcttcaagaacttgggctccttttcaagctcc 1152

                                                                        
Query: 419  ttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggat 478
            ||||| || ||||| || ||||| ||  ||||||| |  |||||||| || ||||| || 
Sbjct: 1151 ttgccagatcgcctatcaatctttgtgaggatctcagaaaacttgacagcaatgtgagag 1092

                                         
Query: 479  gtgtggcagtccancacaggggcataacc 507
            |||||||| ||||  ||||||||||||||
Sbjct: 1091 gtgtggcaatccagaacaggggcataacc 1063
to top
>gb|DQ228328.1| Solanum tuberosum clone 135G05 elongation factor 1-alpha-like protein
            mRNA, complete cds
          Length = 1708

 Score =  125 bits (63), Expect = 2e-25
 Identities = 226/281 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| || ||  ||||||  || || 
Sbjct: 1390 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacgcca 1331

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| || ||||||||||| | ||| ||||| |||||||  || |||||||  |||
Sbjct: 1330 acagcaacagtttgcctcatgtccctcacagcaaaacgacccaatggtgggtactcagca 1271

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            |||||||  || ||||| |||||||| ||||||||||| || |  || ||||||||||||
Sbjct: 1270 aaggtctcaacaaccataggcttggtgggaatcatcttaaccatacctgcatcaccattc 1211

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  ||||| ||| |   ||| || ||||| || || |||||||| |||||||||  |
Sbjct: 1210 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 1151

                                                     
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtc 489
            ||||| || |||||||| || |||||||| |||||||||||
Sbjct: 1150 atctcagcaaacttgacagcaatgtgggaagtgtggcagtc 1110
to top
>gb|AF242732.1| Capsicum annuum translation elongation factor 1a mRNA, complete cds
          Length = 1521

 Score =  125 bits (63), Expect = 2e-25
 Identities = 226/281 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| || ||  ||||||  ||||| 
Sbjct: 1388 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacacca 1329

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| || ||||||||||| | ||| ||||| |||||||  || ||||  |  |||
Sbjct: 1328 acagcaacagtttgcctcatgtctctcacagcaaaacgacccaatggtgggttttctgca 1269

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            ||||| |  |||||||| |||||||| ||||||||||| || |  |||||||||||||||
Sbjct: 1268 aaggtttcaaccaccattggcttggtgggaatcatcttaaccatgccagcatcaccattc 1209

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || || ||||| ||| |   ||| || ||||| || |||| ||||||||||||||||   
Sbjct: 1208 ttaaggaacttaggctccttctcaagttccttacccgaccacctgtcgatcttggtcaaa 1149

                                                     
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtc 489
            |||||  | |||||||| || |||||||| |||||||||||
Sbjct: 1148 atctccccaaacttgacagcaatgtgggaagtgtggcagtc 1108
to top
>gb|U04632.1|NTU04632 Nicotiana tabacum Wisconsin 38 vitronectin-like adhesion protein
            mRNA, complete cds
          Length = 1776

 Score =  125 bits (63), Expect = 2e-25
 Identities = 226/281 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| || ||| ||||||| ||||| 
Sbjct: 1423 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacgttcttgataacacca 1364

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| || || | |||||| | ||| ||||| || ||||  || |||||||  |  
Sbjct: 1363 acagcaacagtttgacgcatgtccctcacagcaaaacgtcccaatggtgggtactcagag 1304

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            |||||||  || |||||||||||||| ||||||||||| || |  |||||||||||||||
Sbjct: 1303 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccattc 1244

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  ||||||||| |   ||| | |||||| || || ||||||||||||||||||   
Sbjct: 1243 ttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcgatcttggtcaaa 1184

                                                     
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtc 489
            || || || |||||||| || |||||||| |||||||||||
Sbjct: 1183 atttctgcaaacttgacagcaatgtgggaggtgtggcagtc 1143
to top
>dbj|D63396.1|TOBBY2A Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds
          Length = 1671

 Score =  125 bits (63), Expect = 2e-25
 Identities = 226/281 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| || ||| ||||||| ||||| 
Sbjct: 1355 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacgttcttgataacacca 1296

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| || || | |||||| | ||| ||||| || ||||  || |||||||  |  
Sbjct: 1295 acagcaacagtttgacgcatgtccctcacagcaaaacgtcccaatggtgggtactcagag 1236

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            |||||||  || |||||||||||||| ||||||||||| || |  |||||||||||||||
Sbjct: 1235 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccattc 1176

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  ||||||||| |   ||| | |||||| || || ||||||||||||||||||   
Sbjct: 1175 ttcaagaacttgggctccttctcaatctccttaccagaacgcctgtcgatcttggtcaaa 1116

                                                     
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtc 489
            || || || |||||||| || |||||||| |||||||||||
Sbjct: 1115 atttctgcaaacttgacagcaatgtgggaggtgtggcagtc 1075
to top
>gb|DQ442392.1| Striga asiatica clone St460 elongation factor 1 alpha subunit mRNA,
           partial cds
          Length = 568

 Score =  123 bits (62), Expect = 6e-25
 Identities = 149/179 (83%)
 Strand = Plus / Minus

                                                                       
Query: 326 gcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcacca 385
           ||||| |||| ||| |||||||||||||| ||||||||||| || |||||||||||||||
Sbjct: 563 gcaaaagtctccacaaccatgggcttggtcggaatcatcttaacaaacccagcatcacca 504

                                                                       
Query: 386 ttcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtc 445
           ||||| |  ||||||||| |   |||||||||||| || |||||||| || ||||| |||
Sbjct: 503 ttcttcaagaacttgggctccttctccagctccttaccagaccgcctatcaatcttagtc 444

                                                                      
Query: 446 tggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcata 504
             || |||| | || ||||| || |||||||| ||||||||||| | ||| ||||||||
Sbjct: 443 acgagctcgacaaatttgacagcaatgtgggaagtgtggcagtcgagcacgggggcata 385
to top
>emb|AJ222579.1|VFEF1A Vicia faba mRNA for elongation factor 1-alpha (EF1-a)
          Length = 1599

 Score =  123 bits (62), Expect = 6e-25
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||| ||||| |||||||| || || || |||||||||||||| |||||||| || || 
Sbjct: 1369 gcagctttggtgaccttggctccagttgggtccttcttctccacactcttgatgactccg 1310

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| || || |||||||| |  || ||||| ||||| || ||||| |||| ||||
Sbjct: 1309 acagcaacagtttgtctcatgtccctaacagcaaaacgaccaagtggaggatactcggca 1250

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || || | ||| |||||||||||||| ||||||||||| || |  || ||||||||||||
Sbjct: 1249 aaagtttccacaaccatgggcttggtgggaatcatcttaaccatacctgcatcaccattc 1190

                                                                    
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggt 444
            || | |||||||||| |   ||| | |||||| || || |||||||| ||||||||
Sbjct: 1189 ttcaaaaacttgggctccttctcaatctccttaccagatcgcctgtcaatcttggt 1134
to top
>emb|AJ010225.1|CAR010225 Cicer arietinum mRNA for elongation factor 1-alpha (clone
           CanEF1-a2), partial
          Length = 626

 Score =  123 bits (62), Expect = 6e-25
 Identities = 248/311 (79%)
 Strand = Plus / Minus

                                                                       
Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
           ||||| ||||| | |||||| || || || ||||||||||| || |||||||| ||||| 
Sbjct: 378 gcagctttggtgatcttggctccagttggatccttcttctcaacactcttgatgacaccg 319

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||| || || | |||||| | |||||| || ||||| || || || |||| ||  
Sbjct: 318 acagcaacagtttgacgcatgtccctcacggcgaaacgaccaagtggtggatactcggag 259

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           || || | ||| ||||| |||||||||||||||||||| || |  |||||||||||||||
Sbjct: 258 aaagtttccacaaccataggcttggttggaatcatcttaacaagaccagcatcaccattc 199

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || | |||||| ||| |   ||| || ||||| || || |||||||||||||||||  | 
Sbjct: 198 ttcaaaaacttaggctccttctcaagttccttaccagatcgcctgtcgatcttggtgaga 139

                                                                       
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
           | ||| |||||||| || || |||||||| ||||| ||||| |  || ||||||||||||
Sbjct: 138 agctcagcgaacttaacagcaatgtgggaggtgtgacagtcgaggactggggcataaccg 79

                      
Query: 509 ttgctgatctg 519
           || | ||||||
Sbjct: 78  tttccgatctg 68
to top
>gb|U80268.1|MDU80268 Malus domestica elongation factor 1 alpha (EF-1alpha) mRNA, partial
           cds
          Length = 748

 Score =  123 bits (62), Expect = 6e-25
 Identities = 248/311 (79%)
 Strand = Plus / Minus

                                                                       
Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
           |||| |||||| |||||||| ||| | || ||||||||||| ||||||||||| ||||| 
Sbjct: 417 gcagacttggtgaccttggcaccgctgggatccttcttctcaacgctcttgataacacca 358

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||| ||||| | ||||||||| || ||||| |||||||  || |||||||  |  
Sbjct: 357 acagcaacagtctggcgcatgtcacgaacagcaaagcgacccaatggtgggtactcagag 298

                                                                       
Query: 329 aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
           ||||||| ||| |||||||||||||| |||| |||||| || |  || ||||| || |||
Sbjct: 297 aaggtctccacaaccatgggcttggtgggaagcatcttcaccatacctgcatctccgttc 238

                                                                       
Query: 389 ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
           || |  ||||| ||| |   ||| | |||||| || |||| |||||| ||||||||  ||
Sbjct: 237 ttcaagaactttggctccttctcaatctcctttccagacctcctgtcaatcttggtaagg 178

                                                                       
Query: 449 atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
           |||||  ||||||| || || ||||| || |||||||| ||||  || |||||||| |||
Sbjct: 177 atctcaccgaacttcacagcaatgtgtgaagtgtggcaatccagaactggggcatatccg 118

                      
Query: 509 ttgctgatctg 519
           || | ||||||
Sbjct: 117 ttaccgatctg 107
to top
>gb|DQ228326.1| Solanum tuberosum clone 135F02 elongation factor 1-alpha-like protein
            mRNA, complete cds
          Length = 1753

 Score =  121 bits (61), Expect = 2e-24
 Identities = 241/302 (79%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| || ||  ||||||  ||||| 
Sbjct: 1379 gcagccttggtcaccttggcaccagttgggtccttcttgtcaacattcttgacaacacca 1320

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| || ||||||||||| | ||| ||||| |||||||  || ||||| |  |||
Sbjct: 1319 acagcaacagtttgcctcatgtccctcacagcaaaacgacccaatggtgggtattcagca 1260

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            |||||||  || |||||||||||||| ||||||||||| || |  ||||||||||| |||
Sbjct: 1259 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccgttc 1200

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  ||||| ||| |   ||| || ||||| || || |||||||| |||||||||  |
Sbjct: 1199 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 1140

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| || ||||| || || |||||||| ||||| ||||| | ||| || ||||| |||
Sbjct: 1139 atctcagcaaactttacagcaatgtgggaagtgtgacagtcaagcactggagcatatccg 1080

              
Query: 509  tt 510
            ||
Sbjct: 1079 tt 1078
to top
>gb|DQ222490.1| Solanum tuberosum clone 098G02 elongation factor 1-alpha-like protein
            mRNA, complete cds
          Length = 1723

 Score =  121 bits (61), Expect = 2e-24
 Identities = 241/302 (79%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| || ||  ||||||  ||||| 
Sbjct: 1390 gcagccttggtcaccttggcaccagttgggtccttcttgtcaacattcttgacaacacca 1331

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| || ||||||||||| | ||| ||||| |||||||  || ||||| |  |||
Sbjct: 1330 acagcaacagtttgcctcatgtccctcacagcaaaacgacccaatggtgggtattcagca 1271

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            |||||||  || |||||||||||||| ||||||||||| || |  ||||||||||| |||
Sbjct: 1270 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccgttc 1211

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  ||||| ||| |   ||| || ||||| || || |||||||| |||||||||  |
Sbjct: 1210 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 1151

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| || ||||| || || |||||||| ||||| ||||| | ||| || ||||| |||
Sbjct: 1150 atctcagcaaactttacagcaatgtgggaagtgtgacagtcaagcactggagcatatccg 1091

              
Query: 509  tt 510
            ||
Sbjct: 1090 tt 1089
to top
>emb|X16432.1|ATEF1AA4 Arabidopsis thaliana EF-1 alpha-A4 (NAEEFTU 4) gene for elongation
            factor 1-alpha
          Length = 2594

 Score =  121 bits (61), Expect = 2e-24
 Identities = 241/302 (79%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| ||||||||||| || ||||| 
Sbjct: 2009 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1950

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| |||||||||||||| |  || || || || |||| ||| ||||||| ||  
Sbjct: 1949 acagcaacggtctgcctcatgtccctaacagcgaaacgtcccaaaggtgggtactcggag 1890

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || ||||  || |||||||||||||||||  ||||||| || |  ||||| |||||||||
Sbjct: 1889 aaagtctcaacaaccatgggcttggttggggtcatcttaaccataccagcgtcaccattc 1830

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || | |||||||||| |   ||| | |||||| || || || ||||| |||||||||  |
Sbjct: 1829 ttcaaaaacttgggctccttctcaatctccttaccagaacgtctgtcaatcttggtcaag 1770

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| | |||||| || || ||||| || |||||||| || |  || ||||| ||||||
Sbjct: 1769 atctcagagaactttactgcaatgtgagaggtgtggcaatcgagaactggggcgtaaccg 1710

              
Query: 509  tt 510
            ||
Sbjct: 1709 tt 1708
to top
>dbj|AK221032.1| Arabidopsis thaliana mRNA for elongation factor 1-alpha, partial
           cds, clone: RAFL22-71-O21
          Length = 599

 Score =  121 bits (61), Expect = 2e-24
 Identities = 159/192 (82%)
 Strand = Plus / Minus

                                                                       
Query: 199 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
           ||||||||  |||||||||||||||||||| || || || |||||||| || || |||||
Sbjct: 273 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 214

                                                                       
Query: 259 gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
           ||| ||||| || ||||| |||||||||||||| | ||| || || || || || || ||
Sbjct: 213 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 154

                                                                       
Query: 319 gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
           |||||  |  ||||||| ||| |||||||||||||||||| ||||||| || |  |||||
Sbjct: 153 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 94

                       
Query: 379 atcaccattctt 390
           ||||||||||||
Sbjct: 93  atcaccattctt 82
to top
>emb|BX814695.1|CNS0ADQC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB8ZA02 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1593

 Score =  121 bits (61), Expect = 2e-24
 Identities = 159/192 (82%)
 Strand = Plus / Minus

                                                                        
Query: 199  cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
            ||||||||  |||||||||||||||||||| || || || |||||||| || || |||||
Sbjct: 1359 cttcttgactgcagccttggtaaccttggctccagttgggtccttcttgtcaacactctt 1300

                                                                        
Query: 259  gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
            ||| ||||| || ||||| |||||||||||||| | ||| || || || || || || ||
Sbjct: 1299 gataacaccgactgcaacagtctgcctcatgtccctcacagcgaaacgtccaagtggtgg 1240

                                                                        
Query: 319  gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
            |||||  |  ||||||| ||| |||||||||||||||||| ||||||| || |  |||||
Sbjct: 1239 gtactcagagaaggtctccacaaccatgggcttggttggagtcatcttcaccataccagc 1180

                        
Query: 379  atcaccattctt 390
            ||||||||||||
Sbjct: 1179 atcaccattctt 1168
to top
>dbj|AB061263.1| Solanum tuberosum EF-1-alpha mRNA for Elongation factor 1-alpha,
            complete cds
          Length = 1756

 Score =  121 bits (61), Expect = 2e-24
 Identities = 241/302 (79%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| || ||||| || || || |||||||| || ||  ||||||  ||||| 
Sbjct: 1379 gcagccttggtcactttggcaccagttgggtccttcttgtcaacattcttgacaacaccg 1320

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| || ||||||||||| | ||| ||||| |||||||  || ||||| |  |||
Sbjct: 1319 acagcaacagtttgcctcatgtctctcacagcaaaacgacccaatggtgggtattcagca 1260

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            |||||||  || |||||||||||||| ||||||||||| || |  ||||||||||| |||
Sbjct: 1259 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccgttc 1200

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  ||||| ||| |   ||| || ||||| || || |||||||| |||||||||  |
Sbjct: 1199 ttcaagaacttaggctccttctcaagttccttacctgaacgcctgtcaatcttggtcaag 1140

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            ||||| || |||||||| || |||||||| ||||| ||||| | ||| || ||||| |||
Sbjct: 1139 atctcagcaaacttgacagcaatgtgggaagtgtgacagtcaagcactggagcatatccg 1080

              
Query: 509  tt 510
            ||
Sbjct: 1079 tt 1078
to top
>gb|AY378166.1| Cichorium intybus elongation factor 1-alpha mRNA, complete cds
          Length = 1582

 Score =  119 bits (60), Expect = 9e-24
 Identities = 192/237 (81%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| ||||| || || ||||| |||||||| || ||  ||||| | ||||| 
Sbjct: 1368 gcagccttggtcaccttagctccagtcgggtccttcttgtcaacattcttggtaacacca 1309

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||||||||| | |||||| | |||||||||||  || || || |||||||  |||
Sbjct: 1308 acagcaaccgtctgacgcatgtccctcacggcaaaccttccaagnggggggtactcagca 1249

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || |||| ||||||||| |||||||||||||||||||| || |  |||||||| || |||
Sbjct: 1248 aaagtctccaccaccataggcttggttggaatcatcttaaccataccagcatctccgttc 1189

                                                                     
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtc 445
            || | |||||| ||| |   ||| |||||||| || || || ||||| |||||||||
Sbjct: 1188 ttcaaaaacttaggctccttctcaagctcctttccagatcgtctgtcaatcttggtc 1132
to top
>gb|DQ174258.1| Gossypium hirsutum translation elongation factor 1A-9 (EF1A9) mRNA,
            complete cds
          Length = 1734

 Score =  119 bits (60), Expect = 9e-24
 Identities = 214/266 (80%)
 Strand = Plus / Minus

                                                                        
Query: 221  accttggcgccggtcggctccttcttctccacgctcttgatcacacccacagcaaccgtc 280
            |||||||| || || || |||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 1316 accttggctccagttgggtccttcttctccacactcttgatcacaccaacagcaacagtc 1257

                                                                        
Query: 281  tgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggcaaaggtctncacc 340
            || |||||||| |  |||||||| || || || |||||||||| ||  || || | ||| 
Sbjct: 1256 tgtctcatgtccctaacggcaaaacgtccaagtggagggtactcggagaaagtttccaca 1197

                                                                        
Query: 341  accatgggcttggttggaatcatcttgacgaacccagcatcaccattcttgagaaacttg 400
            | |||||||||||| |||| |||||| |  |  ||||||||||||||||| |  ||||| 
Sbjct: 1196 agcatgggcttggtcggaaccatcttaatcataccagcatcaccattcttcaagaactta 1137

                                                                        
Query: 401  ggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcgaac 460
            ||| |   ||| |||||||| || || |||||||| |||||||||  || ||| || |||
Sbjct: 1136 ggctccttctcaagctccttaccagatcgcctgtcaatcttggtcaagagctctgcaaac 1077

                                      
Query: 461  ttgacggcgatgtgggatgtgtggca 486
            ||||| || || ||||| ||||||||
Sbjct: 1076 ttgacagcaatatgggaggtgtggca 1051
to top
>gb|DQ174257.1| Gossypium hirsutum translation elongation factor 1A-8 (EF1A8) mRNA,
            complete cds
          Length = 1555

 Score =  119 bits (60), Expect = 9e-24
 Identities = 223/278 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            |||| |||||| |||||||| || |  || |||||||||||||| |||||||||||||| 
Sbjct: 1328 gcagacttggtcaccttggctccagatgggtccttcttctccacactcttgatcacacca 1269

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| ||||| |||||||| |  |||||||| || || || |||||||||  ||  
Sbjct: 1268 acagcaacagtctgtctcatgtccctaacggcaaaacgtccaagtggagggtacgcggag 1209

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            ||||| |  || |||||||||||||| |||| |||||| |  |  |||||||||||||||
Sbjct: 1208 aaggtttcgacaaccatgggcttggtcggaaccatcttaatcataccagcatcaccattc 1149

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  ||||| ||| |   ||| |||||||| || || |||||||| |||||||||  |
Sbjct: 1148 ttcaagaacttaggctccttctcaagctccttaccagatcgcctgtcaatcttggtcaag 1089

                                                  
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggca 486
            | ||| || |||||||| || || ||||| ||||||||
Sbjct: 1088 agctctgcaaacttgacagcaatatgggaggtgtggca 1051
to top
>gb|DQ174251.1| Gossypium hirsutum translation elongation factor 1A-2 (EF1A2) mRNA,
            complete cds
          Length = 1566

 Score =  117 bits (59), Expect = 4e-23
 Identities = 192/237 (81%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            |||| |||||| |||||||| ||||| || ||||||||||| || |||||||| ||||| 
Sbjct: 1328 gcagacttggtgaccttggcaccggttgggtccttcttctcgacactcttgataacacca 1269

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            ||||| || ||||| | |||||| | ||| ||||| |||||||| || |||||||  |  
Sbjct: 1268 acagccacggtctgacgcatgtccctcacagcaaaacgacccaggggtgggtactcagag 1209

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            ||||||| ||| |||||||||||||| ||||||||||| |  |  ||||||||||| |||
Sbjct: 1208 aaggtctccacaaccatgggcttggtaggaatcatcttaatcataccagcatcaccgttc 1149

                                                                     
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtc 445
            || |  ||||||||  |   ||| |||||||| || || |||||||| |||||||||
Sbjct: 1148 ttcaagaacttgggttccttctcaagctccttaccagatcgcctgtcaatcttggtc 1092
to top
>dbj|AB019427.1| Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds
          Length = 1734

 Score =  117 bits (59), Expect = 4e-23
 Identities = 225/281 (80%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| ||||| || || || || |||||||| || ||| ||||||| ||||| 
Sbjct: 1396 gcagccttggtgaccttagcaccagttgggtccttcttgtcaacgttcttgataacacca 1337

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| || || | |||||| | ||| ||||| || ||||  || || ||||  |  
Sbjct: 1336 acagcaacagtttgacgcatgtccctcacagcaaaacgtcccaatggtggatactcagag 1277

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            |||||||  || |||||||||||||| ||||||||||| || |  |||||||||||||||
Sbjct: 1276 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccattc 1217

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  ||||||||| |   ||| |||||||| || || ||||||||||||||||||   
Sbjct: 1216 ttcaagaacttgggctccttctcaagctccttaccagaacgcctgtcgatcttggtcaaa 1157

                                                     
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtc 489
            || || || |||||||| || |||||||| |||||||||||
Sbjct: 1156 atttctgcaaacttgacagcaatgtgggaggtgtggcagtc 1116
to top
>emb|CT010481.8| M.truncatula DNA sequence from clone MTH2-62G7 on chromosome 3,
             complete sequence
          Length = 113400

 Score =  115 bits (58), Expect = 1e-22
 Identities = 191/236 (80%)
 Strand = Plus / Plus

                                                                         
Query: 209   gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
             ||||||||||| |||||||| ||||| || ||||||||||||||   |||||| ||||| 
Sbjct: 72737 gcagccttggtgaccttggctccggtaggatccttcttctccacagccttgatgacacca 72796

                                                                         
Query: 269   acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
             |||||||| || || | |||||| |  || ||||| || || |||||||| || |  |||
Sbjct: 72797 acagcaacagtttgacgcatgtccctgacagcaaaacgtccaagaggaggatattcagca 72856

                                                                         
Query: 329   aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
             |||||||  ||||||||||||||||| |||| |||||| | ||  |||||||||||||||
Sbjct: 72857 aaggtctcaaccaccatgggcttggtgggaaccatcttaatgataccagcatcaccattc 72916

                                                                     
Query: 389   ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggt 444
             || |  ||||||||| |   ||| | |||||| || || |||||||| ||||||||
Sbjct: 72917 ttcaagaacttgggctccttctcaatctccttaccagatcgcctgtcaatcttggt 72972



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 188/236 (79%)
 Strand = Plus / Plus

                                                                         
Query: 209   gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
             ||||| ||||| || ||||| ||||| || ||||||||||||||   |||||| ||||| 
Sbjct: 82274 gcagctttggtgactttggctccggtgggatccttcttctccacagccttgatgacacca 82333

                                                                         
Query: 269   acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
             |||||||| || || | |||||| |  |||||||| || || |||||||| || |  || 
Sbjct: 82334 acagcaacagtttgacgcatgtccctgacggcaaaacgtccaagaggaggatattcagcg 82393

                                                                         
Query: 329   aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
             |||||||  ||||||||||||||||| |||| |||||| | ||  ||||||||||| |||
Sbjct: 82394 aaggtctcaaccaccatgggcttggtgggaaccatcttaatgataccagcatcaccgttc 82453

                                                                     
Query: 389   ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggt 444
             || |  ||||||||| |   ||| | |||||| || || |||||||| ||||||||
Sbjct: 82454 ttcaagaacttgggctccttctcaatctccttaccagatcgcctgtcaatcttggt 82509
to top
>dbj|AB106676.1| Avicennia marina EF1-A mRNA for elongation factor 1A, complete cds
          Length = 1809

 Score =  111 bits (56), Expect = 2e-21
 Identities = 130/155 (83%)
 Strand = Plus / Minus

                                                                        
Query: 236  ggctccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgc 295
            ||||||||||| ||||||||||| || ||||| |||||||| ||||| | ||| ||||| 
Sbjct: 1454 ggctccttcttttccacgctctttatgacaccaacagcaactgtctgacgcatatcacga 1395

                                                                        
Query: 296  acggcaaaccgacccagaggagggtactgggcaaaggtctncaccaccatgggcttggtt 355
            || ||||| |||||||| || ||||| |  |  ||||| | ||| |||||||||||||||
Sbjct: 1394 acagcaaaacgacccagtggtgggtattcagagaaggtttccacaaccatgggcttggtt 1335

                                               
Query: 356  ggaatcatcttgacgaacccagcatcaccattctt 390
            ||||||||||| || || ||||||||||| |||||
Sbjct: 1334 ggaatcatcttcacaaatccagcatcaccgttctt 1300
to top
>emb|AJ536671.1|STU536671 Solanum tuberosum mRNA for elongation factor (ef-1alpha gene)
          Length = 1753

 Score =  109 bits (55), Expect = 9e-21
 Identities = 235/296 (79%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || |  || |||||||| || || |||||||| ||||| 
Sbjct: 1414 gcagccttggtgaccttggctccagatgggtccttcttgtcaacactcttgataacacca 1355

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| || || | |||||| | ||| ||||| || ||||  || ||||||| ||  
Sbjct: 1354 acagcaacagtttgacgcatgtccctcacagcaaaacgccccaatggtgggtactcggag 1295

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            |||||||  || |||||||||||||| ||||||||||| || |  ||||||||||| |||
Sbjct: 1294 aaggtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccgttc 1235

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  ||||| ||| |   ||| || ||||| || || |||||||| ||||| |||  |
Sbjct: 1234 ttcaagaacttaggctccttctcgagttccttaccagaacgcctgtcaatcttagtcaag 1175

                                                                    
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcata 504
            ||||| || |||||||| || || ||||||||||| ||||||| ||| || |||||
Sbjct: 1174 atctcagcaaacttgacagcaatatgggatgtgtgacagtccagcactggagcata 1119
to top
>gb|DQ174253.1| Gossypium hirsutum translation elongation factor 1A-4 (EF1A4) mRNA,
            complete cds
          Length = 1565

 Score =  107 bits (54), Expect = 4e-20
 Identities = 205/256 (80%)
 Strand = Plus / Minus

                                                                        
Query: 190  atctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctc 249
            ||||||||||||||||   ||||  ||||| ||||| || ||||| || |||||||||||
Sbjct: 1347 atctcatttcttcttggcagcagatttggtgaccttagcaccggttggatccttcttctc 1288

                                                                        
Query: 250  cacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacc 309
             ||||||||||| ||||| ||||| || ||||| | |||||| |  || |||||||| ||
Sbjct: 1287 aacgctcttgatgacaccaacagccacagtctgacgcatgtccctgacagcaaaccgtcc 1228

                                                                        
Query: 310  cagaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgac 369
             || || |||||||  |  || |||| ||| ||||| |||||||| |||| |||||| | 
Sbjct: 1227 aaggggtgggtactcagagaaagtctccacaaccataggcttggtgggaaccatctttat 1168

                                                                        
Query: 370  gaacccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccg 429
             | ||| |||||||||||||| |  ||||||||| |   ||| |||||||| || || ||
Sbjct: 1167 catccctgcatcaccattcttcaagaacttgggctccttctcaagctcctttccagatcg 1108

                            
Query: 430  cctgtcgatcttggtc 445
            ||||||||||||||||
Sbjct: 1107 cctgtcgatcttggtc 1092
to top
>gb|DQ174250.1| Gossypium hirsutum translation elongation factor 1A-1 (EF1A1) mRNA,
            complete cds
          Length = 1567

 Score =  107 bits (54), Expect = 4e-20
 Identities = 205/256 (80%)
 Strand = Plus / Minus

                                                                        
Query: 190  atctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctc 249
            ||||||||||||||||   ||||  ||||| ||||| || ||||| || |||||||||||
Sbjct: 1347 atctcatttcttcttggcagcagatttggtgaccttagcaccggttggatccttcttctc 1288

                                                                        
Query: 250  cacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacc 309
             ||||||||||| ||||| ||||| || ||||| | |||||| |  || |||||||| ||
Sbjct: 1287 aacgctcttgatgacaccaacagccacagtctgacgcatgtccctgacagcaaaccgtcc 1228

                                                                        
Query: 310  cagaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgac 369
             || || |||||||  |  || |||| ||| ||||| |||||||| |||| |||||| | 
Sbjct: 1227 aaggggtgggtactcagagaaagtctccacaaccataggcttggtgggaaccatctttat 1168

                                                                        
Query: 370  gaacccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccg 429
             | ||| |||||||||||||| |  ||||||||| |   ||| |||||||| || || ||
Sbjct: 1167 catccctgcatcaccattcttcaagaacttgggctccttctcaagctcctttccagatcg 1108

                            
Query: 430  cctgtcgatcttggtc 445
            ||||||||||||||||
Sbjct: 1107 cctgtcgatcttggtc 1092
to top
>emb|AJ004960.1|CAA004960 Cicer arietinum mRNA for elongation factor 1-alpha (EF1-a)
          Length = 1304

 Score =  107 bits (54), Expect = 4e-20
 Identities = 252/319 (78%)
 Strand = Plus / Minus

                                                                       
Query: 192 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 251
           |||| ||||||||||  ||||||||||| | |||||| || || || ||||||||||| |
Sbjct: 984 ctcacttcttcttgactgcagccttggtgatcttggctccagttggatccttcttctcaa 925

                                                                       
Query: 252 cgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgaccca 311
           | ||||| || ||||| |||||||| || || | |||||| | ||| ||||| ||||| |
Sbjct: 924 cactcttaatgacaccgacagcaacagtttgacgcatgtccctcacagcaaaacgaccaa 865

                                                                       
Query: 312 gaggagggtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacga 371
           | || || |||| ||  || || | ||| ||||| ||||| |||||||||||||| || |
Sbjct: 864 gtggtggatactcggagaaagtttccacaaccataggctttgttggaatcatcttaacaa 805

                                                                       
Query: 372 acccagcatcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcc 431
             ||||||||||||||||| | |||||| ||| |   ||| || ||||| || || || |
Sbjct: 804 gaccagcatcaccattcttcaaaaacttaggctccttctcgagttccttaccagatcgtc 745

                                                                       
Query: 432 tgtcgatcttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtcca 491
           |||| ||||||||  | | ||| |||||||| || || |||||||| ||||| ||||| |
Sbjct: 744 tgtcaatcttggtgagaagctcagcgaacttaacagcaatgtgggaggtgtgacagtcga 685

                              
Query: 492 ncacaggggcataaccgtt 510
             || ||||||||||||||
Sbjct: 684 ggactggggcataaccgtt 666
to top
>dbj|AB056104.1| Carassius auratus mRNA for elongation factor-1 alpha, complete cds
          Length = 1704

 Score =  103 bits (52), Expect = 6e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                        
Query: 242  ttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggca 301
            |||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |||
Sbjct: 1366 ttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacagca 1307

                                
Query: 302  aaccgacccagaggagggta 321
            || ||||| |||||||||||
Sbjct: 1306 aagcgaccaagaggagggta 1287



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 479  gtgtggcagtccancacaggggcata 504
            ||||||||||||| ||||||||||||
Sbjct: 1129 gtgtggcagtccagcacaggggcata 1104
to top
>gb|AY962821.1| Prunus armeniaca elongation factor 1 alpha mRNA, partial cds
          Length = 314

 Score =  101 bits (51), Expect = 2e-18
 Identities = 131/158 (82%)
 Strand = Plus / Minus

                                                                       
Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
           |||| |||||| |||||||| ||  | || ||||||||||||||||||||||| ||||| 
Sbjct: 243 gcagacttggtgaccttggcaccactgggatccttcttctccacgctcttgataacacca 184

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           |||||||| ||||| | ||||||||| || ||||| |||||||  ||||||||||  |  
Sbjct: 183 acagcaacagtctgacgcatgtcacggacagcaaaacgacccaatggagggtactcagag 124

                                                 
Query: 329 aaggtctncaccaccatgggcttggttggaatcatctt 366
           || || | ||| |||||||||||||| |||| ||||||
Sbjct: 123 aaagtttccacaaccatgggcttggtgggaagcatctt 86
to top
>gb|DQ268854.1| Solanum tuberosum clone 171A01 elongation factor 1-alpha-like protein
            mRNA, complete cds
          Length = 1678

 Score =  101 bits (51), Expect = 2e-18
 Identities = 149/182 (81%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| || ||  ||||||  ||||| 
Sbjct: 1354 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacacca 1295

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| || ||||||||||| || || || || |||||||  || ||||| | ||||
Sbjct: 1294 acagcaacagtttgcctcatgtctcgaacagcgaaacgacccaatggtgggtattcggca 1235

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            |||||||  || ||||||||||| || ||||||||||| || |  |||||||||||||||
Sbjct: 1234 aaggtctcaacaaccatgggcttagtgggaatcatcttaaccataccagcatcaccattc 1175

              
Query: 389  tt 390
            ||
Sbjct: 1174 tt 1173
to top
>gb|AY264212.1| Orinocodoras eigenmanni elongation factor-1 alpha gene, exons 4
            through 8 and partial cds
          Length = 1126

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 65/70 (92%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| ||||||||||||||||||||||
Sbjct: 1126 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacgg 1067

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1066 caaaacgacc 1057
to top
>emb|X60302.1|DCEF1A D.carota gene for elongation factor 1A
          Length = 1785

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 238/302 (78%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| ||||||||||| || || ||||||||||| ||   |||||| || || 
Sbjct: 1539 gcagccttggtgaccttggcgccagttggatccttcttctcaacagccttgatgactcca 1480

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            || ||||| ||||| |||||| |||| || || |||| ||| || || |||||||  |||
Sbjct: 1479 actgcaacagtctgtctcatgacacgaacagcgaacctaccgaggggcgggtactcagca 1420

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || ||||  |||||||| |||||||| |||| |||||| || |  |||||||||||||| 
Sbjct: 1419 aatgtctcaaccaccataggcttggtgggaagcatcttaaccattccagcatcaccattt 1360

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  ||||||||| |   ||| ||||||||||| || |  | ||| ||||| |||  |
Sbjct: 1359 ttcaagaacttgggctccttctcaagctccttgccagatcttcggtcaatctttgtcaag 1300

                                                                        
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccg 508
            | ||| || |||||||| || ||||| || |||||||| || |  || ||||||||||||
Sbjct: 1299 agctcagcaaacttgacagcaatgtgagaggtgtggcaatcaagtaccggggcataaccg 1240

              
Query: 509  tt 510
            ||
Sbjct: 1239 tt 1238
to top
>gb|L76077.1|TRBEF1AE Trypanosoma cruzi elongation factor 1-alpha (EF-1alpha) gene,
            complete cds
          Length = 1964

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                        
Query: 413  agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcgatg 472
            |||||||||||||| || | ||||||||||| || ||||||||||||||||   ||||||
Sbjct: 1540 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 1481

                                                            
Query: 473  tgggatgtgtggcagtccancacaggggcataaccgttgctgatctgg 520
            ||| | ||||||||||| | ||| || ||||||||||||| |||||||
Sbjct: 1480 tggcaggtgtggcagtcaagcaccggcgcataaccgttgccgatctgg 1433



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 275  accgtctgcctcatgtcacgcacggcaaaccgacccagaggag 317
            |||||||| | |||||||||||||||||| || || |||||||
Sbjct: 1678 accgtctggcgcatgtcacgcacggcaaagcggccaagaggag 1636
to top
>gb|AY727921.1| Trypanosoma cruzi elongation factor alpha G5 mRNA, complete cds
          Length = 1427

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                        
Query: 413  agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcgatg 472
            |||||||||||||| || | ||||||||||| || ||||||||||||||||   ||||||
Sbjct: 1201 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 1142

                                                            
Query: 473  tgggatgtgtggcagtccancacaggggcataaccgttgctgatctgg 520
            ||| | ||||||||||| | ||| || ||||||||||||| |||||||
Sbjct: 1141 tggcaggtgtggcagtcaagcaccggcgcataaccgttgccgatctgg 1094



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 275  accgtctgcctcatgtcacgcacggcaaaccgacccagaggag 317
            |||||||| | |||||||||||||||||| || || |||||||
Sbjct: 1339 accgtctggcgcatgtcacgcacggcaaagcggccaagaggag 1297
to top
>gb|AY422992.1| Danio rerio eukaryotic translation elongation factor 1 alpha 1
            (EEF1A1) mRNA, complete cds
          Length = 1721

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                        
Query: 242  ttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggca 301
            |||||||| ||||||||||| || || |||||||| |||||||||||||||||||| |||
Sbjct: 1363 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 1304

                                
Query: 302  aaccgacccagaggagggta 321
            || ||||| |||||||||||
Sbjct: 1303 aagcgaccaagaggagggta 1284
to top
>gb|BC064291.1| Danio rerio elongation factor 1-alpha, mRNA (cDNA clone MGC:77644
            IMAGE:6996963), complete cds
          Length = 1760

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                        
Query: 242  ttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggca 301
            |||||||| ||||||||||| || || |||||||| |||||||||||||||||||| |||
Sbjct: 1384 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 1325

                                
Query: 302  aaccgacccagaggagggta 321
            || ||||| |||||||||||
Sbjct: 1324 aagcgaccaagaggagggta 1305
to top
>ref|NM_131263.1| Danio rerio elongation factor 1-alpha (ef1a), mRNA
          Length = 1753

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                        
Query: 242  ttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggca 301
            |||||||| ||||||||||| || || |||||||| |||||||||||||||||||| |||
Sbjct: 1405 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 1346

                                
Query: 302  aaccgacccagaggagggta 321
            || ||||| |||||||||||
Sbjct: 1345 aagcgaccaagaggagggta 1326
to top
>emb|X77689.1|BREF1MRN B.rerio ef-1 alpha mRNA
          Length = 1729

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                        
Query: 242  ttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggca 301
            |||||||| ||||||||||| || || |||||||| |||||||||||||||||||| |||
Sbjct: 1372 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 1313

                                
Query: 302  aaccgacccagaggagggta 321
            || ||||| |||||||||||
Sbjct: 1312 aagcgaccaagaggagggta 1293
to top
>gb|DQ083545.1| Danio rerio eukaryotic translation elongation factor 1 alpha 1 mRNA,
            complete cds
          Length = 1455

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                        
Query: 242  ttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggca 301
            |||||||| ||||||||||| || || |||||||| |||||||||||||||||||| |||
Sbjct: 1397 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 1338

                                
Query: 302  aaccgacccagaggagggta 321
            || ||||| |||||||||||
Sbjct: 1337 aagcgaccaagaggagggta 1318
to top
>gb|AY157315.1| Stevia rebaudiana elongation factor 1 alpha mRNA, complete cds
          Length = 1544

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 252/321 (78%)
 Strand = Plus / Minus

                                                                        
Query: 199  cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 258
            ||||||||  ||||||||||| |||||||| ||||| || |||||||| || || |||||
Sbjct: 1370 cttcttgacagcagccttggtcaccttggctccggttgggtccttcttgtcaacactctt 1311

                                                                        
Query: 259  gatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
            ||| ||||| || ||||||||||| | |||||| | ||| |||||||| || || || ||
Sbjct: 1310 gataacaccgactgcaaccgtctgacgcatgtccctcacagcaaaccgtccaagcggtgg 1251

                                                                        
Query: 319  gtactgggcaaaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagc 378
            |||||  ||||| ||||  || ||||| || || || |||| |||||| || |  || ||
Sbjct: 1250 gtactcagcaaaagtctcaacaaccataggtttagtcggaagcatcttaaccatacctgc 1191

                                                                        
Query: 379  atcaccattcttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgat 438
            ||| |||||||| |  ||||||||  |    || |||||||| || ||||| ||||| ||
Sbjct: 1190 atctccattctttaagaacttgggttccttttcaagctccttaccagaccgtctgtcaat 1131

                                                                        
Query: 439  cttggtctggatctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacagg 498
            |||||||   ||||| |  |||||||| || |||||||| ||||| || || |  || ||
Sbjct: 1130 cttggtcaaaatctcagaaaacttgacagcaatgtgggaggtgtgacaatcgagaaccgg 1071

                                 
Query: 499  ggcataaccgttgctgatctg 519
            |||||||||||| | ||||||
Sbjct: 1070 ggcataaccgttaccgatctg 1050
to top
>gb|AY643400.1| Pimephales promelas elongation factor 1-alpha mRNA, complete cds
          Length = 1748

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                        
Query: 242  ttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggca 301
            |||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |||
Sbjct: 1402 ttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacagca 1343

                                
Query: 302  aaccgacccagaggagggta 321
            || ||||| ||||| |||||
Sbjct: 1342 aagcgaccaagaggggggta 1323
to top
>gb|L23807.1|ZEFEF1AL Danio rerio elongation factor 1 alpha (EFL1-alpha) mRNA, complete cds
          Length = 1739

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                        
Query: 242  ttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggca 301
            |||||||| ||||||||||| || || |||||||| |||||||||||||||||||| |||
Sbjct: 1391 ttcttctcaacgctcttgatgacgccgacagcaacggtctgcctcatgtcacgcacagca 1332

                                
Query: 302  aaccgacccagaggagggta 321
            || ||||| |||||||||||
Sbjct: 1331 aagcgaccaagaggagggta 1312
to top
>gb|BT016891.1| Zea mays clone Contig724 mRNA sequence
          Length = 521

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 92/107 (85%)
 Strand = Plus / Plus

                                                                       
Query: 212 gccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacacccaca 271
           |||||||| |||||||||||||  ||  ||||||||||||| |||||||| |  || |||
Sbjct: 321 gccttggtcaccttggcgccgggtggggccttcttctccacactcttgatgagtccaaca 380

                                                          
Query: 272 gcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagg 318
           |||||||||||||||||||| || |||| ||||| |||||| |||||
Sbjct: 381 gcaaccgtctgcctcatgtcgcggacgggaaacctacccaggggagg 427
to top
>gb|DQ226919.1| Boechera divaricarpa isolate SLW-E-A06 mRNA sequence
          Length = 281

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                       
Query: 338 accaccatgggcttggttggaatcatcttgacgaacccagcatcaccattcttgagaaac 397
           ||||||||||||||||| ||| ||||||| || |  || |||||||||||||| | ||||
Sbjct: 264 accaccatgggcttggtcggagtcatcttcaccataccggcatcaccattcttcaaaaac 205

                                                                       
Query: 398 ttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcg 457
           |||||| |   ||| | |||||| || || |||||||| |||||||||  |||||| | |
Sbjct: 204 ttgggctccttctcaatctccttaccagaacgcctgtcaatcttggtcgagatctcagag 145

                                                                
Query: 458 aacttgacggcgatgtgggatgtgtggcagtccancacaggggcataaccgtt 510
           |||||||| || ||||| || |||||||| || |  || ||||||||||||||
Sbjct: 144 aacttgactgcaatgtgagaggtgtggcaatcgaggactggggcataaccgtt 92
to top
>gb|AF398148.1|AF398148 Brassica rapa subsp. pekinensis translation elongation factor 1
           alpha chain (eEF-1) mRNA, partial cds
          Length = 460

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 130/158 (82%)
 Strand = Plus / Minus

                                                                       
Query: 209 gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
           ||||||||||| ||||| || ||||| || |||||||| || ||||||||||| ||||| 
Sbjct: 273 gcagccttggtgaccttagcaccggttgggtccttcttgtcgacgctcttgataacacca 214

                                                                       
Query: 269 acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
           ||||| ||||||||||||||||| |  || || || |||||||  || |||||||  |  
Sbjct: 213 acagccaccgtctgcctcatgtccctaacagcgaaacgacccaatggtgggtactcagag 154

                                                 
Query: 329 aaggtctncaccaccatgggcttggttggaatcatctt 366
           || ||||  || |||||||||||||||||| |||||||
Sbjct: 153 aaagtctcaacaaccatgggcttggttggagtcatctt 116
to top
>gb|DQ353797.1| Ictalurus punctatus isolate C94SB10 elongation factor 1-alpha mRNA,
           partial cds
          Length = 651

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 71/79 (89%)
 Strand = Plus / Minus

                                                                       
Query: 240 ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
           |||||||||| || |||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 406 ccttcttctcaacactcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 347

                              
Query: 300 caaaccgacccagaggagg 318
           |||| ||||| ||||||||
Sbjct: 346 caaaacgaccaagaggagg 328
to top
>gb|AY264256.1| Synodontis sp. GM-2003 elongation factor-1 alpha gene, exons 4
            through 8 and partial cds
          Length = 1142

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1142 ccttcttctcaacgctcttgatgacaccgacagcaacggtctgcctcatgtcacgcacag 1083

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1082 caaaacgacc 1073
to top
>gb|AY264255.1| Centromochlus heckelii elongation factor-1 alpha gene, exons 4
            through 8 and partial cds
          Length = 1072

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1072 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1013

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1012 caaaacgacc 1003
to top
>gb|AY264253.1| Tatia intermedia elongation factor-1 alpha gene, exons 4 through 8
            and partial cds
          Length = 1118

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1118 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1059

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1058 caaaacgacc 1049
to top
>gb|AY264252.1| Auchenipterichthys thoracatus elongation factor-1 alpha gene, exons 4
            through 8 and partial cds
          Length = 1140

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1140 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1081

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1080 caaaacgacc 1071
to top
>gb|AY264249.1| Parauchenipterus cf. galeatus elongation factor-1 alpha gene, exons 4
            through 8 and partial cds
          Length = 1074

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1074 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1015

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1014 caaaacgacc 1005
to top
>gb|AY264248.1| Acanthodoras cataphractus truncated elongation factor-1 alpha gene,
            exons 4 through 8 and partial cds
          Length = 1131

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1131 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1072

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1071 caaaacgacc 1062
to top
>gb|AY264247.1| Acanthodoras spinosissimus elongation factor-1 alpha gene, exons 4
            through 8 and partial cds
          Length = 1077

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1077 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1018

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1017 caaaacgacc 1008
to top
>gb|AY264245.1| Trachydoras cf. microstomus elongation factor-1 alpha gene, exons 4
            through 8 and partial cds
          Length = 1118

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1118 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1059

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1058 caaaacgacc 1049
to top
>gb|AY264243.1| Trachydoras steindachneri elongation factor-1 alpha gene, exons 4
            through 8 and partial cds
          Length = 1120

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1120 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1061

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1060 caaaacgacc 1051
to top
>gb|AY264241.1| Leptodoras cf. copei elongation factor-1 alpha gene, exons 4 through
            8 and partial cds
          Length = 1109

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1109 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1050

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1049 caaaacgacc 1040
to top
>gb|AY264240.1| Leptodoras linnelli elongation factor-1 alpha gene, exons 4 through 8
            and partial cds
          Length = 1111

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1111 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1052

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1051 caaaacgacc 1042
to top
>gb|AY264236.1| Leptodoras sp. 3-GM-2003 elongation factor-1 alpha gene, exons 4
            through 8 and partial cds
          Length = 1083

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1083 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1024

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1023 caaaacgacc 1014
to top
>gb|AY264225.1| Hassar sp. GM-2003 elongation factor-1 alpha gene, exons 4 through 8
            and partial cds
          Length = 1112

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1112 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1053

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1052 caaaacgacc 1043
to top
>gb|AY264224.1| Hassar sp. GM-2003 elongation factor-1 alpha gene, exons 4 through 8
            and partial cds
          Length = 1112

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1112 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1053

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1052 caaaacgacc 1043
to top
>gb|AY264223.1| Opsodoras sp. GM-2003 elongation factor-1 alpha gene, exons 4 through
            8 and partial cds
          Length = 1113

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1113 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1054

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1053 caaaacgacc 1044
to top
>gb|AY264222.1| Opsodoras ternetzi haplotype I elongation factor-1 alpha gene, exons
            4 through 8 and partial cds
          Length = 1107

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1107 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1048

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1047 caaaacgacc 1038
to top
>gb|AY264221.1| Nemadoras hemipeltis elongation factor-1 alpha gene, exons 4 through
            8 and partial cds
          Length = 1114

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1114 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1055

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1054 caaaacgacc 1045
to top
>gb|AY264219.1| Doras micropoeus elongation factor-1 alpha gene, exons 4 through 8
            and partial cds
          Length = 1112

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1112 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1053

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1052 caaaacgacc 1043
to top
>gb|AY264217.1| Doraops zuloagai elongation factor-1 alpha gene, exons 4 through 8
            and partial cds
          Length = 1120

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1120 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1061

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1060 caaaacgacc 1051
to top
>gb|AY264214.1| Oxydoras niger haplotype II elongation factor-1 alpha gene, exons 4
            through 8 and partial cds
          Length = 1116

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1116 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1057

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1056 caaaacgacc 1047
to top
>gb|AY264210.1| Rhinodoras cf. boehlkei elongation factor-1 alpha gene, exons 4
            through 8 and partial cds
          Length = 1117

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1117 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1058

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1057 caaaacgacc 1048
to top
>gb|AY264209.1| Rhinodoras boehlkei elongation factor-1 alpha gene, exons 4 through 8
            and partial cds
          Length = 1088

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1088 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1029

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1028 caaaacgacc 1019
to top
>gb|AY264208.1| Platydoras costatus elongation factor-1 alpha gene, exons 4 through 8
            and partial cds
          Length = 1108

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1108 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1049

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1048 caaaacgacc 1039
to top
>gb|AY264206.1| Lithodoras dorsalis elongation factor-1 alpha gene, exons 4 through 8
            and partial cds
          Length = 1110

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1110 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1051

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1050 caaaacgacc 1041
to top
>gb|AY264205.1| Megalodoras uranoscopus elongation factor-1 alpha gene, exons 4
            through 8 and partial cds
          Length = 1084

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1084 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1025

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1024 caaaacgacc 1015
to top
>gb|AY264203.1| Physopyxis lyra elongation factor-1 alpha gene, exons 4 through 8 and
            partial cds
          Length = 1105

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1105 ccttcttctcgacgctcttgatgacaccgacagcaacagtctgcctcatgtcacgcacag 1046

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1045 caaaacgacc 1036
to top
>gb|AY264202.1| Hypodoras forficulatus elongation factor-1 alpha gene, exons 4
            through 8 and partial cds
          Length = 1124

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1124 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1065

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1064 caaaacgacc 1055



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 455 gcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcata 504
           |||||||||  ||| |||||||  ||||||||||||| |||||| |||||
Sbjct: 816 gcgaacttgcaggcaatgtgggcagtgtggcagtccagcacaggagcata 767
to top
>gb|AY264196.1| Hypophthalmus edentatus elongation factor-1 alpha gene, exons 4
            through 8 and partial cds
          Length = 1115

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1115 ccttcttctcgacgctcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1056

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1055 caaaacgacc 1046
to top
>ref|XM_799615.1| Trypanosoma cruzi strain CL Brener elongation factor 1-alpha
            (EF-1-alpha) (Tc00.1047053511369.10) partial mRNA
          Length = 1329

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 92/108 (85%)
 Strand = Plus / Minus

                                                                        
Query: 413  agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcgatg 472
            |||||||||||||| || | ||||||||||| || ||||||||||||||||   ||||||
Sbjct: 1103 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 1044

                                                            
Query: 473  tgggatgtgtggcagtccancacaggggcataaccgttgctgatctgg 520
            ||| | ||||||||||| | ||| || ||||| ||||||| |||||||
Sbjct: 1043 tggcaggtgtggcagtcgagcaccggcgcatagccgttgccgatctgg 996



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 275  accgtctgcctcatgtcacgcacggcaaaccgacccagaggag 317
            |||||||| | |||||||||||||||||| || || |||||||
Sbjct: 1241 accgtctggcgcatgtcacgcacggcaaagcggccaagaggag 1199
to top
>ref|XM_799616.1| Trypanosoma cruzi strain CL Brener elongation factor 1-alpha
            (EF-1-alpha) (Tc00.1047053511369.20) partial mRNA
          Length = 1350

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 92/108 (85%)
 Strand = Plus / Minus

                                                                        
Query: 413  agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcgatg 472
            |||||||||||||| || | ||||||||||| || ||||||||||||||||   ||||||
Sbjct: 1124 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 1065

                                                            
Query: 473  tgggatgtgtggcagtccancacaggggcataaccgttgctgatctgg 520
            ||| | ||||||||||| | ||| || ||||| ||||||| |||||||
Sbjct: 1064 tggcaggtgtggcagtcgagcaccggcgcatagccgttgccgatctgg 1017



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 275  accgtctgcctcatgtcacgcacggcaaaccgacccagaggag 317
            |||||||| | |||||||||||||||||| || || |||||||
Sbjct: 1262 accgtctggcgcatgtcacgcacggcaaagcggccaagaggag 1220
to top
>ref|XM_801736.1| Trypanosoma cruzi strain CL Brener elongation factor 1-alpha
            (EF-1-alpha) (Tc00.1047053510119.20) partial mRNA
          Length = 1350

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 92/108 (85%)
 Strand = Plus / Minus

                                                                        
Query: 413  agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcgatg 472
            |||||||||||||| || | ||||||||||| || ||||||||||||||||   ||||||
Sbjct: 1124 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 1065

                                                            
Query: 473  tgggatgtgtggcagtccancacaggggcataaccgttgctgatctgg 520
            ||| | ||||||||||| | ||| || ||||| ||||||| |||||||
Sbjct: 1064 tggcaggtgtggcagtcaagcaccggcgcatagccgttgccgatctgg 1017



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 275  accgtctgcctcatgtcacgcacggcaaaccgacccagaggag 317
            |||||||| | |||||||||||||||||| || || |||||||
Sbjct: 1262 accgtctggcgcatgtcacgcacggcaaagcggccaagaggag 1220
to top
>ref|XM_814346.1| Trypanosoma cruzi strain CL Brener elongation factor 1-alpha
            (EF-1-alpha) (Tc00.1047053511367.360) partial mRNA
          Length = 1350

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 92/108 (85%)
 Strand = Plus / Minus

                                                                        
Query: 413  agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcgatg 472
            |||||||||||||| || | ||||||||||| || ||||||||||||||||   ||||||
Sbjct: 1124 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 1065

                                                            
Query: 473  tgggatgtgtggcagtccancacaggggcataaccgttgctgatctgg 520
            ||| | ||||||||||| | ||| || ||||| ||||||| |||||||
Sbjct: 1064 tggcaggtgtggcagtcaagcaccggcgcatagccgttgccgatctgg 1017



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 275  accgtctgcctcatgtcacgcacggcaaaccgacccagaggag 317
            |||||||| | |||||||||||||||||| || || |||||||
Sbjct: 1262 accgtctggcgcatgtcacgcacggcaaagcggccaagaggag 1220
to top
>ref|XM_814347.1| Trypanosoma cruzi strain CL Brener elongation factor 1-alpha
            (EF-1-alpha) (Tc00.1047053511367.370) partial mRNA
          Length = 1350

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 92/108 (85%)
 Strand = Plus / Minus

                                                                        
Query: 413  agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcgatg 472
            |||||||||||||| || | ||||||||||| || ||||||||||||||||   ||||||
Sbjct: 1124 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 1065

                                                            
Query: 473  tgggatgtgtggcagtccancacaggggcataaccgttgctgatctgg 520
            ||| | ||||||||||| | ||| || ||||| ||||||| |||||||
Sbjct: 1064 tggcaggtgtggcagtcgagcaccggcgcatagccgttgccgatctgg 1017



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 275  accgtctgcctcatgtcacgcacggcaaaccgacccagaggag 317
            |||||||| | |||||||||||||||||| || || |||||||
Sbjct: 1262 accgtctggcgcatgtcacgcacggcaaagcggccaagaggag 1220
to top
>ref|XM_799617.1| Trypanosoma cruzi strain CL Brener elongation factor 1-alpha
           (EF-1-alpha) (Tc00.1047053511369.30) partial mRNA
          Length = 851

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 92/108 (85%)
 Strand = Plus / Minus

                                                                       
Query: 413 agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcgatg 472
           |||||||||||||| || | ||||||||||| || ||||||||||||||||   ||||||
Sbjct: 625 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 566

                                                           
Query: 473 tgggatgtgtggcagtccancacaggggcataaccgttgctgatctgg 520
           ||| | ||||||||||| | ||| || ||||| ||||||| |||||||
Sbjct: 565 tggcaggtgtggcagtcgagcaccggcgcatagccgttgccgatctgg 518



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 275 accgtctgcctcatgtcacgcacggcaaaccgacccagaggag 317
           |||||||| | |||||||||||||||||| || || |||||||
Sbjct: 763 accgtctggcgcatgtcacgcacggcaaagcggccaagaggag 721
to top
>ref|XM_801742.1| Trypanosoma cruzi strain CL Brener elongation factor 1-alpha
            (EF-1-alpha) (Tc00.1047053510119.9) partial mRNA
          Length = 1167

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 92/108 (85%)
 Strand = Plus / Minus

                                                                        
Query: 413  agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcgatg 472
            |||||||||||||| || | ||||||||||| || ||||||||||||||||   ||||||
Sbjct: 1124 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 1065

                                                            
Query: 473  tgggatgtgtggcagtccancacaggggcataaccgttgctgatctgg 520
            ||| | ||||||||||| | ||| || ||||| ||||||| |||||||
Sbjct: 1064 tggcaggtgtggcagtcaagcaccggcgcatagccgttgccgatctgg 1017
to top
>dbj|D29834.1| Trypanosoma cruzi mRNA for elongation factor 1 alpha, partial cds
          Length = 1185

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 92/108 (85%)
 Strand = Plus / Minus

                                                                        
Query: 413  agctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggcgatg 472
            |||||||||||||| || | ||||||||||| || ||||||||||||||||   ||||||
Sbjct: 1064 agctccttgccggagcggcggtcgatcttggactcgatctcggcgaacttgcacgcgatg 1005

                                                            
Query: 473  tgggatgtgtggcagtccancacaggggcataaccgttgctgatctgg 520
            ||| | ||||||||||| | ||| || ||||| ||||||| |||||||
Sbjct: 1004 tggcaggtgtggcagtcaagcaccggcgcatagccgttgccgatctgg 957
to top
>gb|AY264250.1| Ageneiosus ucayalensis elongation factor-1 alpha gene, exons 4
            through 8 and partial cds
          Length = 1136

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||| ||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1136 ccttcttctcaacgytcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1077

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1076 caaaacgacc 1067
to top
>gb|AF485331.1| Cyprinus carpio elongation factor 1-alpha mRNA, complete cds
          Length = 1757

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                        
Query: 242  ttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacggca 301
            |||||||| ||||||||||| ||||| ||||| || |||||||||||||||||||| |||
Sbjct: 1388 ttcttctcaacgctcttgatgacaccaacagctacggtctgcctcatgtcacgcacagca 1329

                                
Query: 302  aaccgacccagaggagggta 321
            || ||||| ||||| |||||
Sbjct: 1328 aagcgaccaagaggggggta 1309
to top
>ref|NM_001037030.1| Arabidopsis thaliana calmodulin binding / translation elongation
            factor AT5G60390 transcript variant AT5G60390.2 mRNA,
            complete cds
          Length = 1715

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 73/83 (87%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || || || |||||||| ||||||||||| || ||||| 
Sbjct: 1348 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1289

                                   
Query: 269  acagcaaccgtctgcctcatgtc 291
            |||||||| ||||||||||||||
Sbjct: 1288 acagcaacggtctgcctcatgtc 1266
to top
>gb|BT012812.1| Lycopersicon esculentum clone 113856R, mRNA sequence
          Length = 2059

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 232/296 (78%)
 Strand = Plus / Minus

                                                                        
Query: 209  gcagccttggtaaccttggcgccggtcggctccttcttctccacgctcttgatcacaccc 268
            ||||||||||| |||||||| || |  || |||||||| || ||  ||||||| ||||| 
Sbjct: 1710 gcagccttggtgaccttggctccagatgggtccttcttgtcaacattcttgataacacca 1651

                                                                        
Query: 269  acagcaaccgtctgcctcatgtcacgcacggcaaaccgacccagaggagggtactgggca 328
            |||||||| || || | |||||| | ||| ||||| || ||||  || ||||||| ||  
Sbjct: 1650 acagcaacagtttgacgcatgtccctcacagcaaaacgtcccaatggtgggtactcggag 1591

                                                                        
Query: 329  aaggtctncaccaccatgggcttggttggaatcatcttgacgaacccagcatcaccattc 388
            || ||||  || |||||||||||||| ||||||||||| || |  ||||||||||| |||
Sbjct: 1590 aatgtctcaacaaccatgggcttggtgggaatcatcttaaccataccagcatcaccgttc 1531

                                                                        
Query: 389  ttgagaaacttgggcgctgnctccagctccttgccggaccgcctgtcgatcttggtctgg 448
            || |  ||||| ||| |   ||| || ||||| || || |||||||| ||||| |||  |
Sbjct: 1530 ttcaagaacttaggctccttctcgagttccttaccagaacgcctgtcaatcttagtcaag 1471

                                                                    
Query: 449  atctcggcgaacttgacggcgatgtgggatgtgtggcagtccancacaggggcata 504
            ||||| || |||||||| || || ||||| ||||| ||||||| ||| || |||||
Sbjct: 1470 atctcagcaaacttgacagcaatatgggaggtgtgacagtccagcactggagcata 1415
to top
>gb|AY264199.1| Amblydoras cf. affinis haplotype II elongation factor-1 alpha gene,
            exons 4 through 8 and partial cds
          Length = 1040

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 70/79 (88%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| || || |||||||| |||||||||||||||||||| |
Sbjct: 1040 ccttcttctcgacgctcttgatgacgccaacagcaacggtctgcctcatgtcacgcacag 981

                               
Query: 300  caaaccgacccagaggagg 318
            |||| ||||| || |||||
Sbjct: 980  caaaacgaccaaggggagg 962
to top
>ref|XM_817373.1| Trypanosoma brucei TREU927 elongation factor 1-alpha (Tb10.70.5650)
            partial mRNA
          Length = 1350

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                        
Query: 409  ctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggc 468
            ||||||||||||||| || || | ||||||||| | || |||||| |||||||||  |||
Sbjct: 1128 ctccagctccttgccagagcgacggtcgatcttcgactcgatctccgcgaacttgcaggc 1069

                                                      
Query: 469  gatgtgggatgtgtggcagtccancacaggggcataaccgtt 510
             ||||| |||||||||||||||| ||| || |||||||||||
Sbjct: 1068 aatgtgcgatgtgtggcagtccagcacgggcgcataaccgtt 1027



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                            
Query: 256  cttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaa 303
            |||||| | ||| ||||| || ||||| | ||||||||||||||||||
Sbjct: 1281 cttgatgataccgacagcgacggtctggcgcatgtcacgcacggcaaa 1234
to top
>ref|XM_817372.1| Trypanosoma brucei TREU927 elongation factor 1-alpha (Tb10.70.5670)
            partial mRNA
          Length = 1350

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                        
Query: 409  ctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggc 468
            ||||||||||||||| || || | ||||||||| | || |||||| |||||||||  |||
Sbjct: 1128 ctccagctccttgccagagcgacggtcgatcttcgactcgatctccgcgaacttgcaggc 1069

                                                      
Query: 469  gatgtgggatgtgtggcagtccancacaggggcataaccgtt 510
             ||||| |||||||||||||||| ||| || |||||||||||
Sbjct: 1068 aatgtgcgatgtgtggcagtccagcacgggcgcataaccgtt 1027



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                            
Query: 256  cttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaa 303
            |||||| | ||| ||||| || ||||| | ||||||||||||||||||
Sbjct: 1281 cttgatgataccgacagcgacggtctggcgcatgtcacgcacggcaaa 1234
to top
>ref|XM_817371.1| Trypanosoma brucei TREU927 elongation factor 1-alpha (Tb10.70.5680)
           partial mRNA
          Length = 1047

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                       
Query: 409 ctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggc 468
           ||||||||||||||| || || | ||||||||| | || |||||| |||||||||  |||
Sbjct: 825 ctccagctccttgccagagcgacggtcgatcttcgactcgatctccgcgaacttgcaggc 766

                                                     
Query: 469 gatgtgggatgtgtggcagtccancacaggggcataaccgtt 510
            ||||| |||||||||||||||| ||| || |||||||||||
Sbjct: 765 aatgtgcgatgtgtggcagtccagcacgggcgcataaccgtt 724



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 256 cttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaa 303
           |||||| | ||| ||||| || ||||| | ||||||||||||||||||
Sbjct: 978 cttgatgataccgacagcgacggtctggcgcatgtcacgcacggcaaa 931
to top
>gb|U10562.1|TBU10562 Trypanosoma brucei elongation factor-1 alpha mRNA, complete cds
          Length = 2024

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                        
Query: 409  ctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggc 468
            ||||||||||||||| || || | ||||||||| | || |||||| |||||||||  |||
Sbjct: 1182 ctccagctccttgccagagcgacggtcgatcttcgactcgatctccgcgaacttgcaggc 1123

                                                      
Query: 469  gatgtgggatgtgtggcagtccancacaggggcataaccgtt 510
             ||||| |||||||||||||||| ||| || |||||||||||
Sbjct: 1122 aatgtgcgatgtgtggcagtccagcacgggcgcataaccgtt 1081



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                            
Query: 256  cttgatcacacccacagcaaccgtctgcctcatgtcacgcacggcaaa 303
            |||||| | ||| ||||| || ||||| | ||||||||||||||||||
Sbjct: 1335 cttgatgataccgacagcgacggtctggcgcatgtcacgcacggcaaa 1288
to top
>gb|L25868.1|TRBTEF1A Trypanosoma brucei elongation factor 1-alpha (tef1) gene, partial cds
          Length = 1195

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                        
Query: 409  ctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttgacggc 468
            ||||||||||||||| || || | ||||||||| | || |||||| |||||||||  |||
Sbjct: 1078 ctccagctccttgccagagcgacggtcgatcttcgactcgatctccgcgaacttgcaggc 1019

                                                      
Query: 469  gatgtgggatgtgtggcagtccancacaggggcataaccgtt 510
             ||||| |||||||||||||||| ||| || |||||||||||
Sbjct: 1018 aatgtgcgatgtgtggcagtccagcacgggcgcataaccgtt 977
to top
>gb|AY574951.1| Solanum nigrum elongation factor 1 alpha mRNA, partial cds
          Length = 215

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 345 tgggcttggttggaatcatcttgacgaacccagcatcaccattcttgagaaacttgggcg 404
           |||||||||| ||||||||||| || |  ||||||||||||||||| |  ||||| ||| 
Sbjct: 214 tgggcttggtgggaatcatcttaaccataccagcatcaccattcttcaagaacttaggct 155

                                                                       
Query: 405 ctgnctccagctccttgccggaccgcctgtcgatcttggtctggatctcggcgaacttga 464
           |   ||| || ||||| || || |||||||| |||||||||  |||||| || |||||||
Sbjct: 154 ccttctcaagttccttaccagaacgcctgtcaatcttggtcaagatctcagcaaacttga 95

                                    
Query: 465 cggcgatgtgggatgtgtggcagtc 489
           | || |||||||| |||||||||||
Sbjct: 94  cagcaatgtgggaagtgtggcagtc 70
to top
>gb|AY264254.1| Liosomadoras morrowi elongation factor-1 alpha gene, exons 4 through
            8 and partial cds
          Length = 1117

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| || |||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1117 ccttcttctcaacactcttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1058

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1057 caaaacgacc 1048
to top
>gb|AY264246.1| Doras punctatus elongation factor-1 alpha gene, exons 4 through 8 and
            partial cds
          Length = 1115

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||| ||||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1115 ccttcttctcaacgttcttgatgacacctacagcaacggtctgcctcatgtcacgcacag 1056

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1055 caaaacgacc 1046
to top
>gb|AY264244.1| Trachydoras nattereri haplotype II elongation factor-1 alpha gene,
            exons 4 through 8 and partial cds
          Length = 1110

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| |||| |||||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 1110 ccttcttctcaacgcccttgatgacaccaacagcaacggtctgcctcatgtcacgcacag 1051

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1050 caaaacgacc 1041
to top
>gb|AY264238.1| Leptodoras cf. praelongus elongation factor-1 alpha gene, exons 4
            through 8 and partial cds
          Length = 1113

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| || || |||||||| |||||||||||||||||||| |
Sbjct: 1113 ccttcttctcaacgctcttgatgacgccaacagcaacggtctgcctcatgtcacgcacag 1054

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1053 caaaacgacc 1044
to top
>gb|AY264237.1| Leptodoras sp. 1-GM-2003 elongation factor-1 alpha gene, exons 4
            through 8 and partial cds
          Length = 1110

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| ||||||| |||||||||||| |
Sbjct: 1110 ccttcttctcaacgctcttgatgacaccaacagcaacggtctgccccatgtcacgcacag 1051

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1050 caaaacgacc 1041
to top
>gb|AY264235.1| Leptodoras sp. 3-GM-2003 elongation factor-1 alpha gene, exons 4
            through 8 and partial cds
          Length = 1111

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                        
Query: 240  ccttcttctccacgctcttgatcacacccacagcaaccgtctgcctcatgtcacgcacgg 299
            |||||||||| ||||||||||| ||||| |||||||| | |||||||||||||||||| |
Sbjct: 1111 ccttcttctcaacgctcttgatgacaccaacagcaacgggctgcctcatgtcacgcacag 1052

                      
Query: 300  caaaccgacc 309
            |||| |||||
Sbjct: 1051 caaaacgacc 1042


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,750,291
Number of Sequences: 3902068
Number of extensions: 3750291
Number of successful extensions: 76905
Number of sequences better than 10.0: 1572
Number of HSP's better than 10.0 without gapping: 1566
Number of HSP's successfully gapped in prelim test: 8
Number of HSP's that attempted gapping in prelim test: 74322
Number of HSP's gapped (non-prelim): 2416
length of query: 520
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 497
effective length of database: 17,143,297,704
effective search space: 8520218958888
effective search space used: 8520218958888
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top