ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd11j01
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY754697.1| Zea mays immunophilin mRNA, complete cds 287 2e-74
2gb|AY103897.1| Zea mays PCO108516 mRNA sequence 287 2e-74
3ref|XM_467909.1| Oryza sativa (japonica cultivar-group), mRNA 246 6e-62
4ref|XM_506987.1| PREDICTED Oryza sativa (japonica cultivar-group... 246 6e-62
5dbj|AK121481.1| Oryza sativa (japonica cultivar-group) cDNA clon... 246 6e-62
6dbj|AK063850.1| Oryza sativa (japonica cultivar-group) cDNA clon... 246 6e-62
7gb|BT016383.1| Zea mays clone Contig216 mRNA sequence 242 1e-60
8dbj|AK100511.1| Oryza sativa (japonica cultivar-group) cDNA clon... 125 2e-25
9dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 119 1e-23
10dbj|AP004159.3| Oryza sativa (japonica cultivar-group) genomic D... 119 1e-23
11gb|DQ428233.1| Sorghum propinquum locus PRC0268 genomic sequence 117 4e-23
12gb|DQ428232.1| Sorghum bicolor voucher PI585454 locus PRC0268 ge... 117 4e-23
13gb|DQ428231.1| Sorghum bicolor voucher PI267539 locus PRC0268 ge... 117 4e-23
14gb|DQ428230.1| Sorghum bicolor voucher PI267408 locus PRC0268 ge... 117 4e-23
15gb|DQ428229.1| Sorghum bicolor voucher PI221607 locus PRC0268 ge... 117 4e-23
16gb|DQ428228.1| Sorghum bicolor voucher PI152702 locus PRC0268 ge... 117 4e-23
17gb|DQ428227.1| Sorghum bicolor voucher NSL92371 locus PRC0268 ge... 117 4e-23
18gb|DQ428226.1| Sorghum bicolor voucher NSL87902 locus PRC0268 ge... 117 4e-23
19gb|DQ428225.1| Sorghum bicolor voucher NSL87666 locus PRC0268 ge... 117 4e-23
20gb|DQ428224.1| Sorghum bicolor voucher NSL77217 locus PRC0268 ge... 117 4e-23
21gb|DQ428223.1| Sorghum bicolor voucher NSL77034 locus PRC0268 ge... 117 4e-23
22gb|DQ428222.1| Sorghum bicolor voucher NSL56174 locus PRC0268 ge... 117 4e-23
23gb|DQ428221.1| Sorghum bicolor voucher NSL56003 locus PRC0268 ge... 117 4e-23
24gb|DQ428220.1| Sorghum bicolor voucher NSL55243 locus PRC0268 ge... 117 4e-23
25gb|DQ428219.1| Sorghum bicolor voucher NSL51365 locus PRC0268 ge... 117 4e-23
26gb|DQ428218.1| Sorghum bicolor voucher NSL51030 locus PRC0268 ge... 117 4e-23
27gb|DQ428217.1| Sorghum bicolor voucher NSL50875 locus PRC0268 ge... 117 4e-23
28gb|U96925.1|VFU96925 Vicia faba immunophilin (FKBP12) mRNA, comp... 96 1e-16
29gb|AY490245.1| Lycopersicon esculentum CONSTANS interacting prot... 84 5e-13
30ref|NM_125831.2| Arabidopsis thaliana FKBP12; FK506 binding / pe... 56 1e-04
31gb|AY081564.1| Arabidopsis thaliana immunophilin (At5g64350) mRN... 56 1e-04
32gb|AY059928.1| Arabidopsis thaliana immunophilin (At5g64350; MSJ... 56 1e-04
33gb|U96924.1|ATU96924 Arabidopsis thaliana immunophilin (FKBP12) ... 56 1e-04
34gb|AY084289.1| Arabidopsis thaliana clone 10243 mRNA, complete s... 56 1e-04
35dbj|AP007284.1| Lotus japonicus genomic DNA, chromosome 6, clone... 48 0.029
36emb|AJ495769.1|HVU495769 Hordeum vulgare mRNA for putative immun... 42 1.8
37gb|DQ271487.1| Mustela vison clone IX2M19 microsatellite sequence 42 1.8
38gb|AF165999.1|AF165999 Drosophila melanogaster sodium-dependent ... 42 1.8
39gb|M92297.2|STMBMANASE Streptomyces lividans mannanase (manA) ge... 42 1.8
40dbj|AB027469.1| Drosophila melanogaster gene for glutamate trans... 42 1.8
41ref|XM_636926.1| Dictyostelium discoideum hypothetical protein (... 40 7.2
42gb|AC126538.1| Homo sapiens chromosome 16 clone CTD-3225F13, com... 40 7.2
43gb|AC133065.3| Homo sapiens chromosome 16 clone RP11-876N24, com... 40 7.2
44emb|AL670597.18| Mouse DNA sequence from clone RP23-235P16 on ch... 40 7.2
45emb|AL954741.9| Zebrafish DNA sequence from clone CH211-255F4 in... 40 7.2
46gb|AY105607.1| Zea mays PCO107138 mRNA sequence 40 7.2
47gb|AC007014.1|AC007014 Homo sapiens chromosome 16 clone 66H6, co... 40 7.2
48dbj|AP000781.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 7.2 
>gb|AY754697.1| Zea mays immunophilin mRNA, complete cds
          Length = 761

 Score =  287 bits (145), Expect = 2e-74
 Identities = 253/289 (87%)
 Strand = Plus / Minus

                                                                       
Query: 174 gagtttggttgaattccccaggctggagagccaccagatccataagcgtagtctggggtg 233
           ||||||||||||||||||||||||||  | || || | ||||||||| || || || |||
Sbjct: 411 gagtttggttgaattccccaggctgggaacccgccggctccataagcataatcaggcgtg 352

                                                                       
Query: 234 cacttaagacgggcgacttcacccaattgcatgtccataactccctcatcccatcctttg 293
           ||||  | ||| || |||||||||| |||||||  |||||||||||| ||||||||||||
Sbjct: 351 cactggatacgagcaacttcacccacttgcatggtcataactccctcgtcccatcctttg 292

                                                                       
Query: 294 atcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttggtactc 353
           |||||||||||| | |||||| |||||  |||||||||||||||||| |||||||| |||
Sbjct: 291 atcactgaaccctgaccaatgctgaaactgaatggctgctgcccagggtccttggtgctc 232

                                                                       
Query: 354 caaaacttcttggacagatcaccgtccttgccgtagccggtgcagtggacggtgaccttc 413
           ||||| ||||||||||||||||  ||||| ||||||||||||||||| ||||||||||||
Sbjct: 231 caaaatttcttggacagatcacgatccttcccgtagccggtgcagtgaacggtgaccttc 172

                                                            
Query: 414 tggcccttgacgggcttggggccggtgccggctctcaggatctccttct 462
           |||||||| |  ||||||||||||||||||| ||||||||||| |||||
Sbjct: 171 tggccctttatcggcttggggccggtgccggatctcaggatctgcttct 123
to top
>gb|AY103897.1| Zea mays PCO108516 mRNA sequence
          Length = 797

 Score =  287 bits (145), Expect = 2e-74
 Identities = 253/289 (87%)
 Strand = Plus / Minus

                                                                       
Query: 174 gagtttggttgaattccccaggctggagagccaccagatccataagcgtagtctggggtg 233
           ||||||||||||||||||||||||||  | || || | ||||||||| || || || |||
Sbjct: 411 gagtttggttgaattccccaggctgggaacccgccggctccataagcataatcaggcgtg 352

                                                                       
Query: 234 cacttaagacgggcgacttcacccaattgcatgtccataactccctcatcccatcctttg 293
           ||||  | ||| || |||||||||| |||||||  |||||||||||| ||||||||||||
Sbjct: 351 cactggatacgagcaacttcacccacttgcatggtcataactccctcgtcccatcctttg 292

                                                                       
Query: 294 atcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttggtactc 353
           |||||||||||| | |||||| |||||  |||||||||||||||||| |||||||| |||
Sbjct: 291 atcactgaaccctgaccaatgctgaaactgaatggctgctgcccagggtccttggtgctc 232

                                                                       
Query: 354 caaaacttcttggacagatcaccgtccttgccgtagccggtgcagtggacggtgaccttc 413
           ||||| ||||||||||||||||  ||||| ||||||||||||||||| ||||||||||||
Sbjct: 231 caaaatttcttggacagatcacgatccttcccgtagccggtgcagtgaacggtgaccttc 172

                                                            
Query: 414 tggcccttgacgggcttggggccggtgccggctctcaggatctccttct 462
           |||||||| |  ||||||||||||||||||| ||||||||||| |||||
Sbjct: 171 tggccctttatcggcttggggccggtgccggatctcaggatctgcttct 123
to top
>ref|XM_467909.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 620

 Score =  246 bits (124), Expect = 6e-62
 Identities = 268/316 (84%)
 Strand = Plus / Minus

                                                                       
Query: 140 ggcgctaagaacttcgatctcgaatatcagctcggagtttggttgaattccccaggctgg 199
           |||||||||||| || |||||||| | |||| | ||||||||| ||||||||||||| ||
Sbjct: 434 ggcgctaagaacctcaatctcgaacaccagcactgagtttggtcgaattccccaggccgg 375

                                                                       
Query: 200 agagccaccagatccataagcgtagtctggggtgcacttaagacgggcgacttcacccaa 259
           | | |||| || |||||| || || || |||||||||| || ||| || |||||||||| 
Sbjct: 374 aaacccactagctccatacgcataatccggggtgcactgaatacgagcaacttcacccac 315

                                                                       
Query: 260 ttgcatgtccataactccctcatcccatcctttgatcactgaacccaggccaatgttgaa 319
           |||||||  |||||||||||| ||||||||||||||||| |||||| |||| || |||||
Sbjct: 314 ttgcatggtcataactccctcgtcccatcctttgatcaccgaaccctggcctatattgaa 255

                                                                       
Query: 320 agcgaatggctgctgcccaggatccttggtactccaaaacttcttggacagatcaccgtc 379
           |  |||||||| ||| || |  ||||| || |||||||||||||| |  ||||||   ||
Sbjct: 254 actgaatggctcctggcctgcgtcctttgtgctccaaaacttcttagcgagatcattatc 195

                                                                       
Query: 380 cttgccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggt 439
            || ||| |||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 194 tttcccgaagccggtgcagtggacggtgaccttctggcccttgacgggcttgggaccggt 135

                           
Query: 440 gccggctctcaggatc 455
           ||||||| ||||||||
Sbjct: 134 gccggctttcaggatc 119
to top
>ref|XM_506987.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1175_B01.15
           mRNA
          Length = 630

 Score =  246 bits (124), Expect = 6e-62
 Identities = 268/316 (84%)
 Strand = Plus / Minus

                                                                       
Query: 140 ggcgctaagaacttcgatctcgaatatcagctcggagtttggttgaattccccaggctgg 199
           |||||||||||| || |||||||| | |||| | ||||||||| ||||||||||||| ||
Sbjct: 433 ggcgctaagaacctcaatctcgaacaccagcactgagtttggtcgaattccccaggccgg 374

                                                                       
Query: 200 agagccaccagatccataagcgtagtctggggtgcacttaagacgggcgacttcacccaa 259
           | | |||| || |||||| || || || |||||||||| || ||| || |||||||||| 
Sbjct: 373 aaacccactagctccatacgcataatccggggtgcactgaatacgagcaacttcacccac 314

                                                                       
Query: 260 ttgcatgtccataactccctcatcccatcctttgatcactgaacccaggccaatgttgaa 319
           |||||||  |||||||||||| ||||||||||||||||| |||||| |||| || |||||
Sbjct: 313 ttgcatggtcataactccctcgtcccatcctttgatcaccgaaccctggcctatattgaa 254

                                                                       
Query: 320 agcgaatggctgctgcccaggatccttggtactccaaaacttcttggacagatcaccgtc 379
           |  |||||||| ||| || |  ||||| || |||||||||||||| |  ||||||   ||
Sbjct: 253 actgaatggctcctggcctgcgtcctttgtgctccaaaacttcttagcgagatcattatc 194

                                                                       
Query: 380 cttgccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggt 439
            || ||| |||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 193 tttcccgaagccggtgcagtggacggtgaccttctggcccttgacgggcttgggaccggt 134

                           
Query: 440 gccggctctcaggatc 455
           ||||||| ||||||||
Sbjct: 133 gccggctttcaggatc 118
to top
>dbj|AK121481.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023149K16, full
           insert sequence
          Length = 620

 Score =  246 bits (124), Expect = 6e-62
 Identities = 268/316 (84%)
 Strand = Plus / Minus

                                                                       
Query: 140 ggcgctaagaacttcgatctcgaatatcagctcggagtttggttgaattccccaggctgg 199
           |||||||||||| || |||||||| | |||| | ||||||||| ||||||||||||| ||
Sbjct: 434 ggcgctaagaacctcaatctcgaacaccagcactgagtttggtcgaattccccaggccgg 375

                                                                       
Query: 200 agagccaccagatccataagcgtagtctggggtgcacttaagacgggcgacttcacccaa 259
           | | |||| || |||||| || || || |||||||||| || ||| || |||||||||| 
Sbjct: 374 aaacccactagctccatacgcataatccggggtgcactgaatacgagcaacttcacccac 315

                                                                       
Query: 260 ttgcatgtccataactccctcatcccatcctttgatcactgaacccaggccaatgttgaa 319
           |||||||  |||||||||||| ||||||||||||||||| |||||| |||| || |||||
Sbjct: 314 ttgcatggtcataactccctcgtcccatcctttgatcaccgaaccctggcctatattgaa 255

                                                                       
Query: 320 agcgaatggctgctgcccaggatccttggtactccaaaacttcttggacagatcaccgtc 379
           |  |||||||| ||| || |  ||||| || |||||||||||||| |  ||||||   ||
Sbjct: 254 actgaatggctcctggcctgcgtcctttgtgctccaaaacttcttagcgagatcattatc 195

                                                                       
Query: 380 cttgccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggt 439
            || ||| |||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 194 tttcccgaagccggtgcagtggacggtgaccttctggcccttgacgggcttgggaccggt 135

                           
Query: 440 gccggctctcaggatc 455
           ||||||| ||||||||
Sbjct: 134 gccggctttcaggatc 119
to top
>dbj|AK063850.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-122-C11, full
           insert sequence
          Length = 630

 Score =  246 bits (124), Expect = 6e-62
 Identities = 268/316 (84%)
 Strand = Plus / Minus

                                                                       
Query: 140 ggcgctaagaacttcgatctcgaatatcagctcggagtttggttgaattccccaggctgg 199
           |||||||||||| || |||||||| | |||| | ||||||||| ||||||||||||| ||
Sbjct: 433 ggcgctaagaacctcaatctcgaacaccagcactgagtttggtcgaattccccaggccgg 374

                                                                       
Query: 200 agagccaccagatccataagcgtagtctggggtgcacttaagacgggcgacttcacccaa 259
           | | |||| || |||||| || || || |||||||||| || ||| || |||||||||| 
Sbjct: 373 aaacccactagctccatacgcataatccggggtgcactgaatacgagcaacttcacccac 314

                                                                       
Query: 260 ttgcatgtccataactccctcatcccatcctttgatcactgaacccaggccaatgttgaa 319
           |||||||  |||||||||||| ||||||||||||||||| |||||| |||| || |||||
Sbjct: 313 ttgcatggtcataactccctcgtcccatcctttgatcaccgaaccctggcctatattgaa 254

                                                                       
Query: 320 agcgaatggctgctgcccaggatccttggtactccaaaacttcttggacagatcaccgtc 379
           |  |||||||| ||| || |  ||||| || |||||||||||||| |  ||||||   ||
Sbjct: 253 actgaatggctcctggcctgcgtcctttgtgctccaaaacttcttagcgagatcattatc 194

                                                                       
Query: 380 cttgccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggt 439
            || ||| |||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 193 tttcccgaagccggtgcagtggacggtgaccttctggcccttgacgggcttgggaccggt 134

                           
Query: 440 gccggctctcaggatc 455
           ||||||| ||||||||
Sbjct: 133 gccggctttcaggatc 118
to top
>gb|BT016383.1| Zea mays clone Contig216 mRNA sequence
          Length = 995

 Score =  242 bits (122), Expect = 1e-60
 Identities = 191/214 (89%)
 Strand = Plus / Minus

                                                                       
Query: 249 acttcacccaattgcatgtccataactccctcatcccatcctttgatcactgaacccagg 308
           |||||||||| |||||||  |||||||||||| |||||||||||||||||||||||| | 
Sbjct: 338 acttcacccacttgcatggtcataactccctcgtcccatcctttgatcactgaaccctga 279

                                                                       
Query: 309 ccaatgttgaaagcgaatggctgctgcccaggatccttggtactccaaaacttcttggac 368
           |||||| |||||  |||||||||||||||||| |||||||| |||||||| |||||||||
Sbjct: 278 ccaatgctgaaactgaatggctgctgcccagggtccttggtgctccaaaatttcttggac 219

                                                                       
Query: 369 agatcaccgtccttgccgtagccggtgcagtggacggtgaccttctggcccttgacgggc 428
           |||||||  ||||| ||||||||||||||||| |||||||||||| | ||||| |  |||
Sbjct: 218 agatcacgatccttcccgtagccggtgcagtgaacggtgaccttccgcccctttatcggc 159

                                             
Query: 429 ttggggccggtgccggctctcaggatctccttct 462
           |||||||||||||||| ||||||||||| |||||
Sbjct: 158 ttggggccggtgccggatctcaggatctgcttct 125



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 174 gagtttggttgaattccccaggctgg 199
           ||||||||||||||||||||||||||
Sbjct: 677 gagtttggttgaattccccaggctgg 652
to top
>dbj|AK100511.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023099N19, full
           insert sequence
          Length = 1896

 Score =  125 bits (63), Expect = 2e-25
 Identities = 102/115 (88%)
 Strand = Plus / Minus

                                                                       
Query: 341 atccttggtactccaaaacttcttggacagatcaccgtccttgccgtagccggtgcagtg 400
           |||||| || |||||||||||||| |  ||||||   || || ||| |||||||||||||
Sbjct: 230 atcctttgtgctccaaaacttcttagcgagatcattatctttcccgaagccggtgcagtg 171

                                                                  
Query: 401 gacggtgaccttctggcccttgacgggcttggggccggtgccggctctcaggatc 455
           ||||||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 170 gacggtgaccttctggcccttgacgggcttgggaccggtgccggctttcaggatc 116
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Plus

                                                                            
Query: 388      agccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccggctc 447
                |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| 
Sbjct: 32038147 agccggtgcagtggacggtgaccttctggcccttgacgggcttgggaccggtgccggctt 32038206

                        
Query: 448      tcaggatc 455
                ||||||||
Sbjct: 32038207 tcaggatc 32038214



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                            
Query: 140      ggcgctaagaacttcgatctcgaatatcagctcggagtttggttgaattccccaggctgg 199
                |||||||||||| || |||||||| | |||| | ||||||||| ||||||||||||| ||
Sbjct: 32036451 ggcgctaagaacctcaatctcgaacaccagcactgagtttggtcgaattccccaggccgg 32036510

                                                      
Query: 200      agagccaccagatccataagcgtagtctggggtgcact 237
                | | |||| || |||||| || || || ||||||||||
Sbjct: 32036511 aaacccactagctccatacgcataatccggggtgcact 32036548



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                          
Query: 249      acttcacccaattgcatgtccataactccctcatcccatcct 290
                |||||||||| |||||||  |||||||||||| |||||||||
Sbjct: 32036880 acttcacccacttgcatggtcataactccctcgtcccatcct 32036921
to top
>dbj|AP004159.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1175_B01
          Length = 96191

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Plus

                                                                         
Query: 388   agccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccggctc 447
             |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| 
Sbjct: 58522 agccggtgcagtggacggtgaccttctggcccttgacgggcttgggaccggtgccggctt 58581

                     
Query: 448   tcaggatc 455
             ||||||||
Sbjct: 58582 tcaggatc 58589



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                         
Query: 140   ggcgctaagaacttcgatctcgaatatcagctcggagtttggttgaattccccaggctgg 199
             |||||||||||| || |||||||| | |||| | ||||||||| ||||||||||||| ||
Sbjct: 56826 ggcgctaagaacctcaatctcgaacaccagcactgagtttggtcgaattccccaggccgg 56885

                                                   
Query: 200   agagccaccagatccataagcgtagtctggggtgcact 237
             | | |||| || |||||| || || || ||||||||||
Sbjct: 56886 aaacccactagctccatacgcataatccggggtgcact 56923



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                       
Query: 249   acttcacccaattgcatgtccataactccctcatcccatcct 290
             |||||||||| |||||||  |||||||||||| |||||||||
Sbjct: 57255 acttcacccacttgcatggtcataactccctcgtcccatcct 57296
to top
>gb|DQ428233.1| Sorghum propinquum locus PRC0268 genomic sequence
          Length = 798

 Score =  117 bits (59), Expect = 4e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 384 ccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccg 443
           |||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||
Sbjct: 110 ccgtagccggtgcagtggacggtgaccttctggccctttaccggcttggggccggtcccg 51

                              
Query: 444 gctctcaggatctccttct 462
           ||||||| ||||| |||||
Sbjct: 50  gctctcaagatctgcttct 32



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 288 cctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttg 347
           |||||||||||||||||||| ||||||||||||  |||||||||||||||||| ||||||
Sbjct: 652 cctttgatcactgaacccagaccaatgttgaaactgaatggctgctgcccagggtccttg 593

             
Query: 348 gt 349
           ||
Sbjct: 592 gt 591
to top
>gb|DQ428232.1| Sorghum bicolor voucher PI585454 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 4e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 384 ccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccg 443
           |||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||
Sbjct: 113 ccgtagccggtgcagtggacggtgaccttctggccctttaccggcttggggccggtcccg 54

                              
Query: 444 gctctcaggatctccttct 462
           ||||||| ||||| |||||
Sbjct: 53  gctctcaagatctgcttct 35



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 288 cctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttg 347
           |||||||||||||||||||| ||||||||||||  |||||||||||||||||| ||||||
Sbjct: 655 cctttgatcactgaacccagaccaatgttgaaactgaatggctgctgcccagggtccttg 596

             
Query: 348 gt 349
           ||
Sbjct: 595 gt 594
to top
>gb|DQ428231.1| Sorghum bicolor voucher PI267539 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 4e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 384 ccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccg 443
           |||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||
Sbjct: 113 ccgtagccggtgcagtggacggtgaccttctggccctttaccggcttggggccggtcccg 54

                              
Query: 444 gctctcaggatctccttct 462
           ||||||| ||||| |||||
Sbjct: 53  gctctcaagatctgcttct 35



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 288 cctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttg 347
           |||||||||||||||||||| ||||||||||||  |||||||||||||||||| ||||||
Sbjct: 655 cctttgatcactgaacccagaccaatgttgaaactgaatggctgctgcccagggtccttg 596

             
Query: 348 gt 349
           ||
Sbjct: 595 gt 594
to top
>gb|DQ428230.1| Sorghum bicolor voucher PI267408 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 4e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 384 ccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccg 443
           |||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||
Sbjct: 113 ccgtagccggtgcagtggacggtgaccttctggccctttaccggcttggggccggtcccg 54

                              
Query: 444 gctctcaggatctccttct 462
           ||||||| ||||| |||||
Sbjct: 53  gctctcaagatctgcttct 35



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 288 cctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttg 347
           |||||||||||||||||||| ||||||||||||  |||||||||||||||||| ||||||
Sbjct: 655 cctttgatcactgaacccagaccaatgttgaaactgaatggctgctgcccagggtccttg 596

             
Query: 348 gt 349
           ||
Sbjct: 595 gt 594
to top
>gb|DQ428229.1| Sorghum bicolor voucher PI221607 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 4e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 384 ccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccg 443
           |||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||
Sbjct: 113 ccgtagccggtgcagtggacggtgaccttctggccctttaccggcttggggccggtcccg 54

                              
Query: 444 gctctcaggatctccttct 462
           ||||||| ||||| |||||
Sbjct: 53  gctctcaagatctgcttct 35



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 288 cctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttg 347
           |||||||||||||||||||| ||||||||||||  |||||||||||||||||| ||||||
Sbjct: 655 cctttgatcactgaacccagaccaatgttgaaactgaatggctgctgcccagggtccttg 596

             
Query: 348 gt 349
           ||
Sbjct: 595 gt 594
to top
>gb|DQ428228.1| Sorghum bicolor voucher PI152702 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 4e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 384 ccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccg 443
           |||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||
Sbjct: 113 ccgtagccggtgcagtggacggtgaccttctggccctttaccggcttggggccggtcccg 54

                              
Query: 444 gctctcaggatctccttct 462
           ||||||| ||||| |||||
Sbjct: 53  gctctcaagatctgcttct 35



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 288 cctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttg 347
           |||||||||||||||||||| ||||||||||||  |||||||||||||||||| ||||||
Sbjct: 655 cctttgatcactgaacccagaccaatgttgaaactgaatggctgctgcccagggtccttg 596

             
Query: 348 gt 349
           ||
Sbjct: 595 gt 594
to top
>gb|DQ428227.1| Sorghum bicolor voucher NSL92371 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 4e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 384 ccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccg 443
           |||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||
Sbjct: 113 ccgtagccggtgcagtggacggtgaccttctggccctttaccggcttggggccggtcccg 54

                              
Query: 444 gctctcaggatctccttct 462
           ||||||| ||||| |||||
Sbjct: 53  gctctcaagatctgcttct 35



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 288 cctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttg 347
           |||||||||||||||||||| ||||||||||||  |||||||||||||||||| ||||||
Sbjct: 655 cctttgatcactgaacccagaccaatgttgaaactgaatggctgctgcccagggtccttg 596

             
Query: 348 gt 349
           ||
Sbjct: 595 gt 594
to top
>gb|DQ428226.1| Sorghum bicolor voucher NSL87902 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 4e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 384 ccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccg 443
           |||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||
Sbjct: 113 ccgtagccggtgcagtggacggtgaccttctggccctttaccggcttggggccggtcccg 54

                              
Query: 444 gctctcaggatctccttct 462
           ||||||| ||||| |||||
Sbjct: 53  gctctcaagatctgcttct 35



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 288 cctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttg 347
           |||||||||||||||||||| ||||||||||||  |||||||||||||||||| ||||||
Sbjct: 655 cctttgatcactgaacccagaccaatgttgaaactgaatggctgctgcccagggtccttg 596

             
Query: 348 gt 349
           ||
Sbjct: 595 gt 594
to top
>gb|DQ428225.1| Sorghum bicolor voucher NSL87666 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 4e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 384 ccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccg 443
           |||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||
Sbjct: 113 ccgtagccggtgcagtggacggtgaccttctggccctttaccggcttggggccggtcccg 54

                              
Query: 444 gctctcaggatctccttct 462
           ||||||| ||||| |||||
Sbjct: 53  gctctcaagatctgcttct 35



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 288 cctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttg 347
           |||||||||||||||||||| ||||||||||||  |||||||||||||||||| ||||||
Sbjct: 655 cctttgatcactgaacccagaccaatgttgaaactgaatggctgctgcccagggtccttg 596

             
Query: 348 gt 349
           ||
Sbjct: 595 gt 594
to top
>gb|DQ428224.1| Sorghum bicolor voucher NSL77217 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 4e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 384 ccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccg 443
           |||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||
Sbjct: 113 ccgtagccggtgcagtggacggtgaccttctggccctttaccggcttggggccggtcccg 54

                              
Query: 444 gctctcaggatctccttct 462
           ||||||| ||||| |||||
Sbjct: 53  gctctcaagatctgcttct 35



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 288 cctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttg 347
           |||||||||||||||||||| ||||||||||||  |||||||||||||||||| ||||||
Sbjct: 655 cctttgatcactgaacccagaccaatgttgaaactgaatggctgctgcccagggtccttg 596

             
Query: 348 gt 349
           ||
Sbjct: 595 gt 594
to top
>gb|DQ428223.1| Sorghum bicolor voucher NSL77034 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 4e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 384 ccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccg 443
           |||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||
Sbjct: 113 ccgtagccggtgcagtggacggtgaccttctggccctttaccggcttggggccggtcccg 54

                              
Query: 444 gctctcaggatctccttct 462
           ||||||| ||||| |||||
Sbjct: 53  gctctcaagatctgcttct 35



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 288 cctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttg 347
           |||||||||||||||||||| ||||||||||||  |||||||||||||||||| ||||||
Sbjct: 655 cctttgatcactgaacccagaccaatgttgaaactgaatggctgctgcccagggtccttg 596

             
Query: 348 gt 349
           ||
Sbjct: 595 gt 594
to top
>gb|DQ428222.1| Sorghum bicolor voucher NSL56174 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 4e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 384 ccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccg 443
           |||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||
Sbjct: 113 ccgtagccggtgcagtggacggtgaccttctggccctttaccggcttggggccggtcccg 54

                              
Query: 444 gctctcaggatctccttct 462
           ||||||| ||||| |||||
Sbjct: 53  gctctcaagatctgcttct 35



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 288 cctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttg 347
           |||||||||||||||||||| ||||||||||||  |||||||||||||||||| ||||||
Sbjct: 655 cctttgatcactgaacccagaccaatgttgaaactgaatggctgctgcccagggtccttg 596

             
Query: 348 gt 349
           ||
Sbjct: 595 gt 594
to top
>gb|DQ428221.1| Sorghum bicolor voucher NSL56003 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 4e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 384 ccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccg 443
           |||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||
Sbjct: 113 ccgtagccggtgcagtggacggtgaccttctggccctttaccggcttggggccggtcccg 54

                              
Query: 444 gctctcaggatctccttct 462
           ||||||| ||||| |||||
Sbjct: 53  gctctcaagatctgcttct 35



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 288 cctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttg 347
           |||||||||||||||||||| ||||||||||||  |||||||||||||||||| ||||||
Sbjct: 655 cctttgatcactgaacccagaccaatgttgaaactgaatggctgctgcccagggtccttg 596

             
Query: 348 gt 349
           ||
Sbjct: 595 gt 594
to top
>gb|DQ428220.1| Sorghum bicolor voucher NSL55243 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 4e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 384 ccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccg 443
           |||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||
Sbjct: 113 ccgtagccggtgcagtggacggtgaccttctggccctttaccggcttggggccggtcccg 54

                              
Query: 444 gctctcaggatctccttct 462
           ||||||| ||||| |||||
Sbjct: 53  gctctcaagatctgcttct 35



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 288 cctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttg 347
           |||||||||||||||||||| ||||||||||||  |||||||||||||||||| ||||||
Sbjct: 655 cctttgatcactgaacccagaccaatgttgaaactgaatggctgctgcccagggtccttg 596

             
Query: 348 gt 349
           ||
Sbjct: 595 gt 594
to top
>gb|DQ428219.1| Sorghum bicolor voucher NSL51365 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 4e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 384 ccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccg 443
           |||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||
Sbjct: 113 ccgtagccggtgcagtggacggtgaccttctggccctttaccggcttggggccggtcccg 54

                              
Query: 444 gctctcaggatctccttct 462
           ||||||| ||||| |||||
Sbjct: 53  gctctcaagatctgcttct 35



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 288 cctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttg 347
           |||||||||||||||||||| ||||||||||||  |||||||||||||||||| ||||||
Sbjct: 655 cctttgatcactgaacccagaccaatgttgaaactgaatggctgctgcccagggtccttg 596

             
Query: 348 gt 349
           ||
Sbjct: 595 gt 594
to top
>gb|DQ428218.1| Sorghum bicolor voucher NSL51030 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 4e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 384 ccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccg 443
           |||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||
Sbjct: 113 ccgtagccggtgcagtggacggtgaccttctggccctttaccggcttggggccggtcccg 54

                              
Query: 444 gctctcaggatctccttct 462
           ||||||| ||||| |||||
Sbjct: 53  gctctcaagatctgcttct 35



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 288 cctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttg 347
           |||||||||||||||||||| ||||||||||||  |||||||||||||||||| ||||||
Sbjct: 655 cctttgatcactgaacccagaccaatgttgaaactgaatggctgctgcccagggtccttg 596

             
Query: 348 gt 349
           ||
Sbjct: 595 gt 594
to top
>gb|DQ428217.1| Sorghum bicolor voucher NSL50875 locus PRC0268 genomic sequence
          Length = 801

 Score =  117 bits (59), Expect = 4e-23
 Identities = 74/79 (93%)
 Strand = Plus / Minus

                                                                       
Query: 384 ccgtagccggtgcagtggacggtgaccttctggcccttgacgggcttggggccggtgccg 443
           |||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||
Sbjct: 113 ccgtagccggtgcagtggacggtgaccttctggccctttaccggcttggggccggtcccg 54

                              
Query: 444 gctctcaggatctccttct 462
           ||||||| ||||| |||||
Sbjct: 53  gctctcaagatctgcttct 35



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 288 cctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttg 347
           |||||||||||||||||||| ||||||||||||  |||||||||||||||||| ||||||
Sbjct: 655 cctttgatcactgaacccagaccaatgttgaaactgaatggctgctgcccagggtccttg 596

             
Query: 348 gt 349
           ||
Sbjct: 595 gt 594
to top
>gb|U96925.1|VFU96925 Vicia faba immunophilin (FKBP12) mRNA, complete cds
          Length = 574

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 117/140 (83%)
 Strand = Plus / Minus

                                                                       
Query: 279 tcatcccatcctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgccca 338
           ||||||||||||||||| || |||||  |||| || ||||||| |||||| | ||| |||
Sbjct: 221 tcatcccatcctttgatgacagaaccttggccgattttgaaagtgaatggattctggcca 162

                                                                       
Query: 339 ggatccttggtactccaaaacttcttggacagatcaccgtccttgccgtagccggtgcag 398
           |||||||| || ||||| |||||||  || || |||||||  || ||||| |||||||||
Sbjct: 161 ggatccttcgtgctccagaacttctgagaaaggtcaccgtttttaccgtaaccggtgcag 102

                               
Query: 399 tggacggtgaccttctggcc 418
           || |||||||| ||||||||
Sbjct: 101 tgaacggtgacgttctggcc 82
to top
>gb|AY490245.1| Lycopersicon esculentum CONSTANS interacting protein 3 (CIP3) mRNA,
           complete cds
          Length = 617

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 153/190 (80%)
 Strand = Plus / Minus

                                                                       
Query: 174 gagtttggttgaattccccaggctggagagccaccagatccataagcgtagtctggggtg 233
           ||||| || ||||| ||||| |||||| | |||||||  |||||||| || || ||||||
Sbjct: 314 gagttgggctgaataccccatgctggaaatccaccagcaccataagcataatcaggggtg 255

                                                                       
Query: 234 cacttaagacgggcgacttcacccaattgcatgtccataactccctcatcccatcctttg 293
           ||| | |  || || ||||| |||||||||||| |||  ||||| |||||||||||||||
Sbjct: 254 cacgttaatcgagcaacttctcccaattgcatgcccagtactccttcatcccatcctttg 195

                                                                       
Query: 294 atcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttggtactc 353
           || |||   ||  |||| || ||||||| ||| |||||||| || |||||||| || |||
Sbjct: 194 ataactttgccttggccgatcttgaaagagaaaggctgctggcctggatccttagtgctc 135

                     
Query: 354 caaaacttct 363
           || |||||||
Sbjct: 134 cagaacttct 125
to top
>ref|NM_125831.2| Arabidopsis thaliana FKBP12; FK506 binding / peptidyl-prolyl
           cis-trans isomerase AT5G64350 (FKBP12) mRNA, complete
           cds
          Length = 632

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 342 tccttggtactccaaaacttcttggacagatcaccgtccttgccgtagccggtgcagtgg 401
           ||||| |||||||| ||||||| ||| |||||||| || || ||| | |||||||| |||
Sbjct: 212 tcctttgtactccagaacttctgggatagatcaccatctttcccgaatccggtgcaatgg 153

                   
Query: 402 acggtgac 409
           ||||||||
Sbjct: 152 acggtgac 145



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 270 ataactccctcatcccatcctttgatcac 298
           ||||| || ||||||||||||||||||||
Sbjct: 284 ataacgccttcatcccatcctttgatcac 256
to top
>gb|AY081564.1| Arabidopsis thaliana immunophilin (At5g64350) mRNA, complete cds
          Length = 510

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 342 tccttggtactccaaaacttcttggacagatcaccgtccttgccgtagccggtgcagtgg 401
           ||||| |||||||| ||||||| ||| |||||||| || || ||| | |||||||| |||
Sbjct: 131 tcctttgtactccagaacttctgggatagatcaccatctttcccgaatccggtgcaatgg 72

                   
Query: 402 acggtgac 409
           ||||||||
Sbjct: 71  acggtgac 64



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 270 ataactccctcatcccatcctttgatcac 298
           ||||| || ||||||||||||||||||||
Sbjct: 203 ataacgccttcatcccatcctttgatcac 175
to top
>gb|AY059928.1| Arabidopsis thaliana immunophilin (At5g64350; MSJ1.19) mRNA,
           complete cds
          Length = 590

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 342 tccttggtactccaaaacttcttggacagatcaccgtccttgccgtagccggtgcagtgg 401
           ||||| |||||||| ||||||| ||| |||||||| || || ||| | |||||||| |||
Sbjct: 189 tcctttgtactccagaacttctgggatagatcaccatctttcccgaatccggtgcaatgg 130

                   
Query: 402 acggtgac 409
           ||||||||
Sbjct: 129 acggtgac 122



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 270 ataactccctcatcccatcctttgatcac 298
           ||||| || ||||||||||||||||||||
Sbjct: 261 ataacgccttcatcccatcctttgatcac 233
to top
>gb|U96924.1|ATU96924 Arabidopsis thaliana immunophilin (FKBP12) mRNA, complete cds
          Length = 617

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 342 tccttggtactccaaaacttcttggacagatcaccgtccttgccgtagccggtgcagtgg 401
           ||||| |||||||| ||||||| ||| |||||||| || || ||| | |||||||| |||
Sbjct: 166 tcctttgtactccagaacttctgggatagatcaccatctttcccgaatccggtgcaatgg 107

                   
Query: 402 acggtgac 409
           ||||||||
Sbjct: 106 acggtgac 99



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 270 ataactccctcatcccatcctttgatcac 298
           ||||| || ||||||||||||||||||||
Sbjct: 238 ataacgccttcatcccatcctttgatcac 210
to top
>gb|AY084289.1| Arabidopsis thaliana clone 10243 mRNA, complete sequence
          Length = 582

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 342 tccttggtactccaaaacttcttggacagatcaccgtccttgccgtagccggtgcagtgg 401
           ||||| |||||||| ||||||| ||| |||||||| || || ||| | |||||||| |||
Sbjct: 212 tcctttgtactccagaacttctgggatagatcaccatctttcccgaatccggtgcaatgg 153

                   
Query: 402 acggtgac 409
           ||||||||
Sbjct: 152 acggtgac 145



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 270 ataactccctcatcccatcctttgatcac 298
           ||||| || ||||||||||||||||||||
Sbjct: 284 ataacgccttcatcccatcctttgatcac 256
to top
>dbj|AP007284.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT23F02, TM0183,
             complete sequence
          Length = 70173

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                         
Query: 174   gagtttggttgaattccccaggctggagagccaccagatccataagcgtagtctggggtg 233
             ||||||||||| |||||||| || ||| |||||||||  |||||||| || || |||| |
Sbjct: 48445 gagtttggttgtattccccaagcaggaaagccaccagcaccataagcataatcaggggag 48386

                 
Query: 234   cact 237
             ||||
Sbjct: 48385 cact 48382



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 60/73 (82%)
 Strand = Plus / Minus

                                                                         
Query: 288   cctttgatcactgaacccaggccaatgttgaaagcgaatggctgctgcccaggatccttg 347
             |||||||| || |||||  |||| || ||||||| ||| || | ||| ||||||||||| 
Sbjct: 47727 cctttgataacagaaccttggccgattttgaaagtgaaaggtttctggccaggatccttt 47668

                          
Query: 348   gtactccaaaact 360
             || ||||||||||
Sbjct: 47667 gtgctccaaaact 47655
to top
>emb|AJ495769.1|HVU495769 Hordeum vulgare mRNA for putative immunophilin
          Length = 835

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 275 tccctcatcccatcctttgatcact 299
           ||||| |||||||||||||||||||
Sbjct: 367 tccctgatcccatcctttgatcact 343
to top
>gb|DQ271487.1| Mustela vison clone IX2M19 microsatellite sequence
          Length = 852

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 260 ttgcatgtccataactccctc 280
           |||||||||||||||||||||
Sbjct: 299 ttgcatgtccataactccctc 319
to top
>gb|AF165999.1|AF165999 Drosophila melanogaster sodium-dependent excitatory amino acid
           transporter 1 mRNA, complete cds
          Length = 2704

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Minus

                                        
Query: 205 caccagatccataagcgtagtctggggtg 233
           |||||||||||||||||| ||||||||||
Sbjct: 564 caccagatccataagcgt-gtctggggtg 537
to top
>gb|M92297.2|STMBMANASE Streptomyces lividans mannanase (manA) gene, complete cds
          Length = 1881

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 375 ccgtccttgccgtagccggtg 395
           |||||||||||||||||||||
Sbjct: 617 ccgtccttgccgtagccggtg 597
to top
>dbj|AB027469.1| Drosophila melanogaster gene for glutamate transporter DGLT-1,
            complete cds
          Length = 8035

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Minus

                                         
Query: 205  caccagatccataagcgtagtctggggtg 233
            |||||||||||||||||| ||||||||||
Sbjct: 5164 caccagatccataagcgt-gtctggggtg 5137
to top
>ref|XM_636926.1| Dictyostelium discoideum hypothetical protein (DDB0204309), partial
           mRNA
          Length = 483

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 276 ccctcatcccatcctttgat 295
           ||||||||||||||||||||
Sbjct: 341 ccctcatcccatcctttgat 322
to top
>gb|AC126538.1| Homo sapiens chromosome 16 clone CTD-3225F13, complete sequence
          Length = 188015

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 446    tctcaggatctccttctgga 465
              ||||||||||||||||||||
Sbjct: 106378 tctcaggatctccttctgga 106397
to top
>gb|AC133065.3| Homo sapiens chromosome 16 clone RP11-876N24, complete sequence
          Length = 142215

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 446    tctcaggatctccttctgga 465
              ||||||||||||||||||||
Sbjct: 126098 tctcaggatctccttctgga 126079
to top
>emb|AL670597.18| Mouse DNA sequence from clone RP23-235P16 on chromosome X, complete
              sequence
          Length = 186284

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 280    catcccatcctttgatcactgaacccag 307
              |||||| ||||| |||||||||||||||
Sbjct: 100593 catcccctccttggatcactgaacccag 100620
to top
>emb|AL954741.9| Zebrafish DNA sequence from clone CH211-255F4 in linkage group 22,
            complete sequence
          Length = 166560

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 260  ttgcatgtccataactccct 279
            ||||||||||||||||||||
Sbjct: 5573 ttgcatgtccataactccct 5592
to top
>gb|AY105607.1| Zea mays PCO107138 mRNA sequence
          Length = 808

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 276 ccctcatcccatcctttgatcact 299
           |||| |||||||||||||||||||
Sbjct: 370 ccctgatcccatcctttgatcact 347
to top
>gb|AC007014.1|AC007014 Homo sapiens chromosome 16 clone 66H6, complete sequence
          Length = 167080

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 446    tctcaggatctccttctgga 465
              ||||||||||||||||||||
Sbjct: 163560 tctcaggatctccttctgga 163579
to top
>dbj|AP000781.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-872D17, complete
              sequence
          Length = 190251

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 445    ctctcaggatctccttctgg 464
              ||||||||||||||||||||
Sbjct: 142089 ctctcaggatctccttctgg 142070


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,798,329
Number of Sequences: 3902068
Number of extensions: 4798329
Number of successful extensions: 82208
Number of sequences better than 10.0: 48
Number of HSP's better than 10.0 without gapping: 46
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 82082
Number of HSP's gapped (non-prelim): 121
length of query: 530
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 507
effective length of database: 17,143,297,704
effective search space: 8691651935928
effective search space used: 8691651935928
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top