Clone Name | rbasd11i19 |
---|---|
Clone Library Name | barley_pub |
>gb|AY111169.1| Zea mays CL1744_1 mRNA sequence Length = 798 Score = 168 bits (85), Expect = 1e-38 Identities = 163/189 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||| ||||| ||||| |||| |||| ||||||||||||||||||||| |||||||| || Sbjct: 543 ggccctgatggtggacgtggccagcgccgtgggtttgaggacgctcttggggttcaaggc 484 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||| ||||| ||||| |||||||||||||| || || || ||||| Sbjct: 483 ctgccggatcttgaacacggcccacgccgtcccgatggcgtgcccggcggcgtccagccc 424 Query: 421 ttcgttggtcgccgcagcagctttctctccatacttgtgagatacaaggccggtcgtcac 480 |||||| || || || || ||||| ||||| ||| |||||||||| || ||||||||||| Sbjct: 423 ttcgttcgttgcggcggcggctttgtctccgtacctgtgagatactagcccggtcgtcac 364 Query: 481 agtcgacga 489 ||| ||||| Sbjct: 363 agttgacga 355
>gb|AF001635.1|AF001635 Zea mays physical impedance induced protein (IIG2) mRNA, complete cds Length = 826 Score = 168 bits (85), Expect = 1e-38 Identities = 163/189 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||| ||||| ||||| |||| |||| ||||||||||||||||||||| |||||||| || Sbjct: 543 ggccctgatggtggacgtggccagcgccgtgggtttgaggacgctcttggggttcaaggc 484 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||| ||||| ||||| |||||||||||||| || || || ||||| Sbjct: 483 ctgccggatcttgaacacggcccacgccgtcccgatggcgtgcccggcggcgtccagccc 424 Query: 421 ttcgttggtcgccgcagcagctttctctccatacttgtgagatacaaggccggtcgtcac 480 |||||| || || || || ||||| ||||| ||| |||||||||| || ||||||||||| Sbjct: 423 ttcgttcgttgcggcggcggctttgtctccgtacctgtgagatactagcccggtcgtcac 364 Query: 481 agtcgacga 489 ||| ||||| Sbjct: 363 agttgacga 355
>gb|DQ428641.1| Sorghum propinquum locus PRC1213 genomic sequence Length = 604 Score = 155 bits (78), Expect = 2e-34 Identities = 132/150 (88%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| |||| ||||||||| ||||||||||| |||||||| || Sbjct: 256 ggccttgatggtggacttggccagcgtcgtgggtttcaggacgctcttggggttcaaggc 197 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||||||||| ||||| ||||||||||| || || || || ||||| Sbjct: 196 ctgccggatcttgaacacagcccacgccgtcccgatggcgtggccggcggcgtccagccc 137 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || ||||||||||| ||||| Sbjct: 136 ttcgtttgttgcggcagcagctttgtctcc 107
>dbj|AK071437.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023095M01, full insert sequence Length = 1645 Score = 143 bits (72), Expect = 6e-31 Identities = 165/196 (84%) Strand = Plus / Minus Query: 305 ttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgcctgc 364 |||||| | ||||||||||| || || || || ||||||||||| |||||||| |||||| Sbjct: 1357 ttgatggtagacttggcgagtgaggttggctttaggacgctcttcgggttcaaggcctgc 1298 Query: 365 cggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagcccttcg 424 || | ||||||||| |||||||| || ||||| ||||| ||||| ||||| | |||||| Sbjct: 1297 cgaatcttgaacactgcccatgctgtcccgattgcgtggcctgctgcatccatcccttca 1238 Query: 425 ttggtcgccgcagcagctttctctccatacttgtgagatacaaggccggtcgtcacagtc 484 |||||||| || || |||||||| ||||| ||||| |||||||| ||||| |||||||| Sbjct: 1237 ttggtcgcagccgcggctttctccccatatttgtgggatacaagaccggtagtcacagtt 1178 Query: 485 gacgatgtcgacagaa 500 || ||||| ||||||| Sbjct: 1177 gatgatgtggacagaa 1162
>gb|DQ428640.1| Sorghum bicolor voucher PI585454 locus PRC1213 genomic sequence Length = 611 Score = 139 bits (70), Expect = 1e-29 Identities = 130/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| |||| ||||||||| ||||||||||| |||||||| || Sbjct: 256 ggccttgatggtggacttggccagcgtcgtgggtttcaggacgctcttggggttcaaggc 197 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||| ||||| ||||| |||||||| || || || || || ||||| Sbjct: 196 ctgccggatcttgaacacggcccacgccgtcccgatggcatggccggcggcgtccagccc 137 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || ||||||||||| ||||| Sbjct: 136 ttcgtttgttgcggcagcagctttgtctcc 107
>gb|DQ428639.1| Sorghum bicolor voucher PI267539 locus PRC1213 genomic sequence Length = 611 Score = 139 bits (70), Expect = 1e-29 Identities = 130/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| |||| ||||||||| ||||||||||| |||||||| || Sbjct: 256 ggccttgatggtggacttggccagcgtcgtgggtttcaggacgctcttggggttcaaggc 197 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||| ||||| ||||| |||||||| || || || || || ||||| Sbjct: 196 ctgccggatcttgaacacggcccacgccgtcccgatggcatggccggcggcgtccagccc 137 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || ||||||||||| ||||| Sbjct: 136 ttcgtttgttgcggcagcagctttgtctcc 107
>gb|DQ428638.1| Sorghum bicolor voucher PI267408 locus PRC1213 genomic sequence Length = 611 Score = 139 bits (70), Expect = 1e-29 Identities = 130/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| |||| ||||||||| ||||||||||| |||||||| || Sbjct: 256 ggccttgatggtggacttggccagcgtcgtgggtttcaggacgctcttggggttcaaggc 197 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||| ||||| ||||| |||||||| || || || || || ||||| Sbjct: 196 ctgccggatcttgaacacggcccacgccgtcccgatggcatggccggcggcgtccagccc 137 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || ||||||||||| ||||| Sbjct: 136 ttcgtttgttgcggcagcagctttgtctcc 107
>gb|DQ428636.1| Sorghum bicolor voucher PI152702 locus PRC1213 genomic sequence Length = 611 Score = 139 bits (70), Expect = 1e-29 Identities = 130/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| |||| ||||||||| ||||||||||| |||||||| || Sbjct: 256 ggccttgatggtggacttggccagcgtcgtgggtttcaggacgctcttggggttcaaggc 197 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||| ||||| ||||| |||||||| || || || || || ||||| Sbjct: 196 ctgccggatcttgaacacggcccacgccgtcccgatggcatggccggcggcgtccagccc 137 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || ||||||||||| ||||| Sbjct: 136 ttcgtttgttgcggcagcagctttgtctcc 107
>gb|DQ428635.1| Sorghum bicolor voucher NSL92371 locus PRC1213 genomic sequence Length = 611 Score = 139 bits (70), Expect = 1e-29 Identities = 130/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| |||| ||||||||| ||||||||||| |||||||| || Sbjct: 256 ggccttgatggtggacttggccagcgtcgtgggtttcaggacgctcttggggttcaaggc 197 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||| ||||| ||||| |||||||| || || || || || ||||| Sbjct: 196 ctgccggatcttgaacacggcccacgccgtcccgatggcatggccggcggcgtccagccc 137 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || ||||||||||| ||||| Sbjct: 136 ttcgtttgttgcggcagcagctttgtctcc 107
>gb|DQ428633.1| Sorghum bicolor voucher NSL87902a locus PRC1213 genomic sequence Length = 611 Score = 139 bits (70), Expect = 1e-29 Identities = 130/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| |||| ||||||||| ||||||||||| |||||||| || Sbjct: 256 ggccttgatggtggacttggccagcgtcgtgggtttcaggacgctcttggggttcaaggc 197 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||| ||||| ||||| |||||||| || || || || || ||||| Sbjct: 196 ctgccggatcttgaacacggcccacgccgtcccgatggcatggccggcggcgtccagccc 137 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || ||||||||||| ||||| Sbjct: 136 ttcgtttgttgcggcagcagctttgtctcc 107
>gb|DQ428632.1| Sorghum bicolor voucher NSL87666 locus PRC1213 genomic sequence Length = 611 Score = 139 bits (70), Expect = 1e-29 Identities = 130/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| |||| ||||||||| ||||||||||| |||||||| || Sbjct: 256 ggccttgatggtggacttggccagcgtcgtgggtttcaggacgctcttggggttcaaggc 197 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||| ||||| ||||| |||||||| || || || || || ||||| Sbjct: 196 ctgccggatcttgaacacggcccacgccgtcccgatggcatggccggcggcgtccagccc 137 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || ||||||||||| ||||| Sbjct: 136 ttcgtttgttgcggcagcagctttgtctcc 107
>gb|DQ428631.1| Sorghum bicolor voucher NSL77217b locus PRC1213 genomic sequence Length = 612 Score = 139 bits (70), Expect = 1e-29 Identities = 130/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| |||| ||||||||| ||||||||||| |||||||| || Sbjct: 257 ggccttgatggtggacttggccagcgtcgtgggtttcaggacgctcttggggttcaaggc 198 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||| ||||| ||||| |||||||| || || || || || ||||| Sbjct: 197 ctgccggatcttgaacacggcccacgccgtcccgatggcatggccggcggcgtccagccc 138 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || ||||||||||| ||||| Sbjct: 137 ttcgtttgttgcggcagcagctttgtctcc 108
>gb|DQ428629.1| Sorghum bicolor voucher NSL77034 locus PRC1213 genomic sequence Length = 611 Score = 139 bits (70), Expect = 1e-29 Identities = 130/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| |||| ||||||||| ||||||||||| |||||||| || Sbjct: 256 ggccttgatggtggacttggccagcgtcgtgggtttcaggacgctcttggggttcaaggc 197 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||| ||||| ||||| |||||||| || || || || || ||||| Sbjct: 196 ctgccggatcttgaacacggcccacgccgtcccgatggcatggccggcggcgtccagccc 137 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || ||||||||||| ||||| Sbjct: 136 ttcgtttgttgcggcagcagctttgtctcc 107
>gb|DQ428628.1| Sorghum bicolor voucher NSL56174 locus PRC1213 genomic sequence Length = 611 Score = 139 bits (70), Expect = 1e-29 Identities = 130/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| |||| ||||||||| ||||||||||| |||||||| || Sbjct: 256 ggccttgatggtggacttggccagcgtcgtgggtttcaggacgctcttggggttcaaggc 197 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||| ||||| ||||| |||||||| || || || || || ||||| Sbjct: 196 ctgccggatcttgaacacggcccacgccgtcccgatggcatggccggcggcgtccagccc 137 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || ||||||||||| ||||| Sbjct: 136 ttcgtttgttgcggcagcagctttgtctcc 107
>gb|DQ428627.1| Sorghum bicolor voucher NSL56003 locus PRC1213 genomic sequence Length = 611 Score = 139 bits (70), Expect = 1e-29 Identities = 130/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| |||| ||||||||| ||||||||||| |||||||| || Sbjct: 256 ggccttgatggtggacttggccagcgtcgtgggtttcaggacgctcttggggttcaaggc 197 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||| ||||| ||||| |||||||| || || || || || ||||| Sbjct: 196 ctgccggatcttgaacacggcccacgccgtcccgatggcatggccggcggcgtccagccc 137 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || ||||||||||| ||||| Sbjct: 136 ttcgtttgttgcggcagcagctttgtctcc 107
>gb|DQ428623.1| Sorghum bicolor voucher NSL50875 locus PRC1213 genomic sequence Length = 611 Score = 139 bits (70), Expect = 1e-29 Identities = 130/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| |||| ||||||||| ||||||||||| |||||||| || Sbjct: 256 ggccttgatggtggacttggccagcgtcgtgggtttcaggacgctcttggggttcaaggc 197 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||| ||||| ||||| |||||||| || || || || || ||||| Sbjct: 196 ctgccggatcttgaacacggcccacgccgtcccgatggcatggccggcggcgtccagccc 137 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || ||||||||||| ||||| Sbjct: 136 ttcgtttgttgcggcagcagctttgtctcc 107
>gb|DQ428622.1| Sorghum bicolor voucher BTx623 locus PRC1213 genomic sequence Length = 611 Score = 139 bits (70), Expect = 1e-29 Identities = 130/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| |||| ||||||||| ||||||||||| |||||||| || Sbjct: 256 ggccttgatggtggacttggccagcgtcgtgggtttcaggacgctcttggggttcaaggc 197 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||| ||||| ||||| |||||||| || || || || || ||||| Sbjct: 196 ctgccggatcttgaacacggcccacgccgtcccgatggcatggccggcggcgtccagccc 137 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || ||||||||||| ||||| Sbjct: 136 ttcgtttgttgcggcagcagctttgtctcc 107
>gb|DQ428637.1| Sorghum bicolor voucher PI221607 locus PRC1213 genomic sequence Length = 604 Score = 131 bits (66), Expect = 2e-27 Identities = 129/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| || | ||||||||| ||||||||||| |||||||| || Sbjct: 261 ggccttgatggtggacttggccagtgtcgtgggtttcaggacgctcttggggttcaaggc 202 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||||||||| ||||| || |||||||| || || || || ||||| Sbjct: 201 ctgccggatcttgaacacagcccacgccgtcccaatggcgtggccggcggcgtccagccc 142 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || || |||||||| ||||| Sbjct: 141 ttcgtttgttgcggcggcagctttgtctcc 112
>gb|DQ428634.1| Sorghum bicolor voucher NSL87902b locus PRC1213 genomic sequence Length = 605 Score = 131 bits (66), Expect = 2e-27 Identities = 129/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| || | ||||||||| ||||||||||| |||||||| || Sbjct: 262 ggccttgatggtggacttggccagtgtcgtgggtttcaggacgctcttggggttcaaggc 203 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||||||||| ||||| || |||||||| || || || || ||||| Sbjct: 202 ctgccggatcttgaacacagcccacgccgtcccaatggcgtggccggcggcgtccagccc 143 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || || |||||||| ||||| Sbjct: 142 ttcgtttgttgcggcggcagctttgtctcc 113
>gb|DQ428630.1| Sorghum bicolor voucher NSL77217a locus PRC1213 genomic sequence Length = 605 Score = 131 bits (66), Expect = 2e-27 Identities = 129/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| || | ||||||||| ||||||||||| |||||||| || Sbjct: 262 ggccttgatggtggacttggccagtgtcgtgggtttcaggacgctcttggggttcaaggc 203 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||||||||| ||||| || |||||||| || || || || ||||| Sbjct: 202 ctgccggatcttgaacacagcccacgccgtcccaatggcgtggcccgcggcgtccagccc 143 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || || |||||||| ||||| Sbjct: 142 ttcgtttgttgcggcggcagctttgtctcc 113
>gb|DQ428626.1| Sorghum bicolor voucher NSL55243 locus PRC1213 genomic sequence Length = 604 Score = 131 bits (66), Expect = 2e-27 Identities = 129/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| || | ||||||||| ||||||||||| |||||||| || Sbjct: 261 ggccttgatggtggacttggccagtgtcgtgggtttcaggacgctcttggggttcaaggc 202 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||||||||| ||||| || |||||||| || || || || ||||| Sbjct: 201 ctgccggatcttgaacacagcccacgccgtcccaatggcgtggcccgcggcgtccagccc 142 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || || |||||||| ||||| Sbjct: 141 ttcgtttgttgcggcggcagctttgtctcc 112
>gb|DQ428625.1| Sorghum bicolor voucher NSL51365 locus PRC1213 genomic sequence Length = 604 Score = 131 bits (66), Expect = 2e-27 Identities = 129/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| || | ||||||||| ||||||||||| |||||||| || Sbjct: 261 ggccttgatggtggacttggccagtgtcgtgggtttcaggacgctcttggggttcaaggc 202 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||||||||| ||||| || |||||||| || || || || ||||| Sbjct: 201 ctgccggatcttgaacacagcccacgccgtcccaatggcgtggcccgcggcgtccagccc 142 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || || |||||||| ||||| Sbjct: 141 ttcgtttgttgcggcggcagctttgtctcc 112
>gb|DQ428624.1| Sorghum bicolor voucher NSL51030 locus PRC1213 genomic sequence Length = 604 Score = 131 bits (66), Expect = 2e-27 Identities = 129/150 (86%) Strand = Plus / Minus Query: 301 ggccttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgc 360 |||||||||| |||||||||| || | ||||||||| ||||||||||| |||||||| || Sbjct: 261 ggccttgatggtggacttggccagtgtcgtgggtttcaggacgctcttggggttcaaggc 202 Query: 361 ctgccggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagccc 420 |||||||| ||||||||||||||| ||||| || |||||||| || || || || ||||| Sbjct: 201 ctgccggatcttgaacacagcccacgccgtcccaatggcgtggccggcggcctccagccc 142 Query: 421 ttcgttggtcgccgcagcagctttctctcc 450 |||||| || || || |||||||| ||||| Sbjct: 141 ttcgtttgttgcggcggcagctttgtctcc 112
>gb|AC091774.7| Oryza sativa chromosome 6 BAC OJ1540_H01 genomic sequence, complete sequence Length = 143507 Score = 105 bits (53), Expect = 1e-19 Identities = 125/149 (83%) Strand = Plus / Plus Query: 305 ttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgcctgc 364 |||||| | ||||||||||| || || || || ||||||||||| |||||||| |||||| Sbjct: 30107 ttgatggtagacttggcgagtgaggttggctttaggacgctcttcgggttcaaggcctgc 30166 Query: 365 cggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagcccttcg 424 || | ||||||||| |||||||| || ||||| ||||| ||||| ||||| | |||||| Sbjct: 30167 cgaatcttgaacactgcccatgctgtcccgattgcgtggcctgctgcatccatcccttca 30226 Query: 425 ttggtcgccgcagcagctttctctccata 453 |||||||| || || |||||||| ||||| Sbjct: 30227 ttggtcgcagccgcggctttctccccata 30255
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 105 bits (53), Expect = 1e-19 Identities = 125/149 (83%) Strand = Plus / Plus Query: 305 ttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgcctgc 364 |||||| | ||||||||||| || || || || ||||||||||| |||||||| |||||| Sbjct: 29949407 ttgatggtagacttggcgagtgaggttggctttaggacgctcttcgggttcaaggcctgc 29949466 Query: 365 cggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagcccttcg 424 || | ||||||||| |||||||| || ||||| ||||| ||||| ||||| | |||||| Sbjct: 29949467 cgaatcttgaacactgcccatgctgtcccgattgcgtggcctgctgcatccatcccttca 29949526 Query: 425 ttggtcgccgcagcagctttctctccata 453 |||||||| || || |||||||| ||||| Sbjct: 29949527 ttggtcgcagccgcggctttctccccata 29949555
>dbj|AP003769.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0541C02 Length = 150660 Score = 105 bits (53), Expect = 1e-19 Identities = 125/149 (83%) Strand = Plus / Plus Query: 305 ttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgcctgc 364 |||||| | ||||||||||| || || || || ||||||||||| |||||||| |||||| Sbjct: 25555 ttgatggtagacttggcgagtgaggttggctttaggacgctcttcgggttcaaggcctgc 25614 Query: 365 cggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagcccttcg 424 || | ||||||||| |||||||| || ||||| ||||| ||||| ||||| | |||||| Sbjct: 25615 cgaatcttgaacactgcccatgctgtcccgattgcgtggcctgctgcatccatcccttca 25674 Query: 425 ttggtcgccgcagcagctttctctccata 453 |||||||| || || |||||||| ||||| Sbjct: 25675 ttggtcgcagccgcggctttctccccata 25703
>dbj|AP003614.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0481E08 Length = 171965 Score = 105 bits (53), Expect = 1e-19 Identities = 125/149 (83%) Strand = Plus / Plus Query: 305 ttgatgctggacttggcgagcgacgtgggtttgaggacgctctttgggttcaatgcctgc 364 |||||| | ||||||||||| || || || || ||||||||||| |||||||| |||||| Sbjct: 144920 ttgatggtagacttggcgagtgaggttggctttaggacgctcttcgggttcaaggcctgc 144979 Query: 365 cggagcttgaacacagcccatgccgttccgatggcgtgccctgccgcatcgagcccttcg 424 || | ||||||||| |||||||| || ||||| ||||| ||||| ||||| | |||||| Sbjct: 144980 cgaatcttgaacactgcccatgctgtcccgattgcgtggcctgctgcatccatcccttca 145039 Query: 425 ttggtcgccgcagcagctttctctccata 453 |||||||| || || |||||||| ||||| Sbjct: 145040 ttggtcgcagccgcggctttctccccata 145068
>ref|NM_127337.2| Arabidopsis thaliana ERD7 (EARLY-RESPONSIVE TO DEHYDRATION 7) AT2G17840 (ERD7) mRNA, complete cds Length = 1731 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 404 cctgccgcatcgagcccttcgttggtcgccgcagcagctttctctccatacttgtga 460 ||||| ||||||||||||||||| |||||| |||| ||||| | |||||||||||| Sbjct: 1286 cctgctgcatcgagcccttcgtttgtcgcctcagccgctttaccaccatacttgtga 1230
>gb|AY081319.1| Arabidopsis thaliana putative senescence-related protein (At2g17840) mRNA, complete cds Length = 1643 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 404 cctgccgcatcgagcccttcgttggtcgccgcagcagctttctctccatacttgtga 460 ||||| ||||||||||||||||| |||||| |||| ||||| | |||||||||||| Sbjct: 1286 cctgctgcatcgagcccttcgtttgtcgcctcagccgctttaccaccatacttgtga 1230
>gb|AF428331.1|AF428331 Arabidopsis thaliana probable senescence related protein mRNA, complete cds Length = 1617 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 404 cctgccgcatcgagcccttcgttggtcgccgcagcagctttctctccatacttgtga 460 ||||| ||||||||||||||||| |||||| |||| ||||| | |||||||||||| Sbjct: 1282 cctgctgcatcgagcccttcgtttgtcgcctcagccgctttaccaccatacttgtga 1226
>gb|AF325067.1|AF325067 Arabidopsis thaliana putative senescence-related protein (At2g17840) mRNA, complete cds Length = 1359 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 404 cctgccgcatcgagcccttcgttggtcgccgcagcagctttctctccatacttgtga 460 ||||| ||||||||||||||||| |||||| |||| ||||| | |||||||||||| Sbjct: 1232 cctgctgcatcgagcccttcgtttgtcgcctcagccgctttaccaccatacttgtga 1176
>emb|BX820190.1|CNS0AAG9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS8ZE01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1586 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 404 cctgccgcatcgagcccttcgttggtcgccgcagcagctttctctccatacttgtga 460 ||||| ||||||||||||||||| |||||| |||| ||||| | |||||||||||| Sbjct: 1282 cctgctgcatcgagcccttcgtttgtcgcctcagccgctttaccaccatacttgtga 1226
>gb|AY088062.1| Arabidopsis thaliana clone 40806 mRNA, complete sequence Length = 1646 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 404 cctgccgcatcgagcccttcgttggtcgccgcagcagctttctctccatacttgtga 460 ||||| ||||||||||||||||| |||||| |||| ||||| | |||||||||||| Sbjct: 1282 cctgctgcatcgagcccttcgtttgtcgcctcagccgctttaccaccatacttgtga 1226
>dbj|AB039929.1| Arabidopsis thaliana mRNA for ERD7 protein, partial cds Length = 1485 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 404 cctgccgcatcgagcccttcgttggtcgccgcagcagctttctctccatacttgtga 460 ||||| ||||||||||||||||| |||||| |||| ||||| | |||||||||||| Sbjct: 1188 cctgctgcatcgagcccttcgtttgtcgcctcagccgctttaccaccatacttgtga 1132
>gb|BT001230.1| Arabidopsis thaliana putative senescence-related protein (At2g17840) mRNA, complete cds Length = 1406 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 404 cctgccgcatcgagcccttcgttggtcgccgcagcagctttctctccatacttgtga 460 ||||| ||||||||||||||||| |||||| |||| ||||| | |||||||||||| Sbjct: 1232 cctgctgcatcgagcccttcgtttgtcgcctcagccgctttaccaccatacttgtga 1176
>gb|AC003952.2|AC003952 Arabidopsis thaliana chromosome II section 104 of 255 of the complete sequence. Sequence from clones T13L16 Length = 42009 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 404 cctgccgcatcgagcccttcgttggtcgccgcagcagcttt 444 ||||| ||||||||||||||||| |||||| |||| ||||| Sbjct: 13746 cctgctgcatcgagcccttcgtttgtcgcctcagccgcttt 13786
>gb|AC169128.2| Mus musculus BAC clone RP23-306C13 from chromosome 13, complete sequence Length = 185965 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 455 ttgtgagatacaaggccggt 474 |||||||||||||||||||| Sbjct: 32644 ttgtgagatacaaggccggt 32625
>ref|XM_517590.1| PREDICTED: Pan troglodytes similar to FAT gene product (LOC461671), mRNA Length = 8879 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 tgttctctgtttccagcaca 197 |||||||||||||||||||| Sbjct: 6371 tgttctctgtttccagcaca 6390
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 236 tgcggcaaagacggcttcga 255 |||||||||||||||||||| Sbjct: 21294 tgcggcaaagacggcttcga 21275
>ref|XM_459696.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0E09515g) partial mRNA Length = 810 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 177 ttgttctctgtttccagcac 196 |||||||||||||||||||| Sbjct: 27 ttgttctctgtttccagcac 8
>ref|NM_005245.3| Homo sapiens FAT tumor suppressor homolog 1 (Drosophila) (FAT), mRNA Length = 14773 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 tgttctctgtttccagcaca 197 |||||||||||||||||||| Sbjct: 10954 tgttctctgtttccagcaca 10973
>gb|AC163721.4| Mus musculus BAC clone RP23-446B19 from chromosome 13, complete sequence Length = 184728 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 455 ttgtgagatacaaggccggt 474 |||||||||||||||||||| Sbjct: 147349 ttgtgagatacaaggccggt 147330
>emb|AL358777.12| Human DNA sequence from clone RP11-421M1 on chromosome 6 Contains the gene for a novel glucosaminyl (N-acetyl) transferase family protein, the 3' end of the GCNT2 gene for glucosaminyl (N-acetyl) transferase 2 I-branching enzyme, the gene for a novel protein similar to GCNT2, a novel gene, the gene for PAK/PLC-interacting protein 1, the gene for a novel protein similar to PTD011 and four CpG islands, complete sequence Length = 155359 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 448 tccatacttgtgagatacaaggcc 471 ||||||||||||||| |||||||| Sbjct: 48780 tccatacttgtgagacacaaggcc 48803
>ref|XM_965408.1| PREDICTED: Tribolium castaneum similar to CG2974-PA (LOC659075), mRNA Length = 893 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 328 cgtgggtttgaggacgctct 347 |||||||||||||||||||| Sbjct: 791 cgtgggtttgaggacgctct 810
>emb|X87241.1|HSHFATPRO H.sapiens mRNA for hFat protein Length = 14756 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 tgttctctgtttccagcaca 197 |||||||||||||||||||| Sbjct: 10958 tgttctctgtttccagcaca 10977
>emb|CR382137.1| Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii Length = 2037969 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 177 ttgttctctgtttccagcac 196 |||||||||||||||||||| Sbjct: 694847 ttgttctctgtttccagcac 694866
>gb|AC110761.3| Homo sapiens BAC clone RP11-45C13 from 4, complete sequence Length = 153458 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 tgttctctgtttccagcaca 197 |||||||||||||||||||| Sbjct: 104565 tgttctctgtttccagcaca 104546
>gb|AC096757.3| Homo sapiens BAC clone RP11-543H9 from 4, complete sequence Length = 188464 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 166 gagaggcagggttgttctctgttt 189 |||||||||||| ||||||||||| Sbjct: 58994 gagaggcagggtagttctctgttt 58971
>gb|AC011740.7| Homo sapiens BAC clone RP11-106G13 from 2, complete sequence Length = 168991 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 257 ccctacttgctcttgctgctcttc 280 |||||||||||||||| ||||||| Sbjct: 46027 ccctacttgctcttgcagctcttc 46050
>emb|AL954173.8| Zebrafish DNA sequence from clone CH211-272N13, complete sequence Length = 154587 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 313 ggacttggcgagcgacgtgggttt 336 |||||||||||||||| ||||||| Sbjct: 133570 ggacttggcgagcgacttgggttt 133593
>gb|DQ304649.1| Homo sapiens anaphase promoting complex subunit 10 (ANAPC10) gene, complete cds Length = 106979 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 gagaggcagggttgttctctgttt 189 |||||||||||| ||||||||||| Sbjct: 8098 gagaggcagggtagttctctgttt 8121 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,952,113 Number of Sequences: 3902068 Number of extensions: 3952113 Number of successful extensions: 73304 Number of sequences better than 10.0: 51 Number of HSP's better than 10.0 without gapping: 51 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 73176 Number of HSP's gapped (non-prelim): 128 length of query: 500 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 478 effective length of database: 17,147,199,772 effective search space: 8196361491016 effective search space used: 8196361491016 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)