ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd11g24 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT017257.1| Zea mays clone EL01N0308D08.c mRNA sequence Length = 718 Score = 357 bits (180), Expect = 3e-95 Identities = 363/420 (86%), Gaps = 3/420 (0%) Strand = Plus / Minus Query: 170 acaagacaccatcaccagtccaagcccctgaaaaactgtgtcacacgaggcccatcacac 229 |||||||||||||||||||||||||| |||||||| |||||| | ||||||||||||||| Sbjct: 492 acaagacaccatcaccagtccaagcctctgaaaaa-tgtgtcgc-cgaggcccatcacac 435 Query: 230 tgaaaggtctt-gataaatcatatgagaagcttctcgatggcatccttgagactctggat 288 |||||| |||| | ||||||| |||||||||||||| || | |||||||||| ||| || Sbjct: 434 tgaaagatcttaggtaaatcagatgagaagcttctcaatcgagtccttgagaccctgtat 375 Query: 289 cggctgcttcagttggctaccctcattgctggtcactgaacaagcaatgaccggcctagt 348 | | || ||||| |||||||||||||||||||||||||| ||||||||||| || || || Sbjct: 374 ctgttgtttcagctggctaccctcattgctggtcactgagcaagcaatgacgggtcttgt 315 Query: 349 cactccacaagcacgcccaagggcttgctttgaagggacaaagacatacggcacattctt 408 ||| ||||||||||| ||||| ||||| || || || ||||| ||||| || || ||||| Sbjct: 314 cacaccacaagcacggccaagagcttgtttcgatggaacaaatacatatgggacgttctt 255 Query: 409 gtcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgccat 468 ||||| || | ||| ||||||||||| ||||| ||||| ||||||||||| || ||||| Sbjct: 254 atcctcggctaacaaggggaggtggagcaggatctcgagaggctccgtgtccgccgccat 195 Query: 469 caccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctcccttctt 528 ||| |||||||||||||| ||||| || || || || ||||||||||| ||||||||||| Sbjct: 194 cacaacgaactccgatatccccctattcagggttttcgtcgcttcgttcgctcccttctt 135 Query: 529 gagctgcttgtagttggcggcctgctggacgatgtcgaggatcgttatcgtcagctgcgc 588 ||||||||||||||||||||||||||||| ||| |||||||| |||||||||||||| Sbjct: 134 gagctgcttgtagttggcggcctgctggatgatatcgaggatacccatcgtcagctgcgc 75
>gb|BT018105.1| Zea mays clone EL01N0553D01.c mRNA sequence Length = 791 Score = 309 bits (156), Expect = 6e-81 Identities = 357/420 (85%), Gaps = 3/420 (0%) Strand = Plus / Minus Query: 170 acaagacaccatcaccagtccaagcccctgaaaaactgtgtcacacgaggcccatcacac 229 |||||||||||||||||||||||||| |||||||| ||||| | |||||||||||||| Sbjct: 611 acaagacaccatcaccagtccaagcctctgaaaaaa-gtgtcgct-gaggcccatcacac 554 Query: 230 tgaaaggtctt-gataaatcatatgagaagcttctcgatggcatccttgagactctggat 288 ||||||||||| | | |||| |||||||||||||| |||| |||||||||| ||| || Sbjct: 553 tgaaaggtcttcggcagatcagatgagaagcttctcaatggagtccttgagaccctgtat 494 Query: 289 cggctgcttcagttggctaccctcattgctggtcactgaacaagcaatgaccggcctagt 348 | | | ||||| |||||||||||||| ||||||||||| |||||||| ||||| || || Sbjct: 493 ctgtagtttcagctggctaccctcattactggtcactgagcaagcaataaccggtcttgt 434 Query: 349 cactccacaagcacgcccaagggcttgctttgaagggacaaagacatacggcacattctt 408 ||| ||||||||||| ||||| |||||||| || || ||||| ||||| ||||| ||||| Sbjct: 433 cacaccacaagcacggccaagagcttgcttcgatggaacaaacacatatggcacgttctt 374 Query: 409 gtcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgccat 468 ||||| || | ||| ||||||||||| ||||| ||||| ||||| ||||| || ||||| Sbjct: 373 atcctcagctaacaaggggaggtggagcaggatctcgagaggctctgtgtccgccgccat 314 Query: 469 caccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctcccttctt 528 ||| || ||||||||||| ||||| || || ||||| |||||||| || ||||||||||| Sbjct: 313 cactacaaactccgatatgcccctattcagggtcttcgtcgcttcattcgctcccttctt 254 Query: 529 gagctgcttgtagttggcggcctgctggacgatgtcgaggatcgttatcgtcagctgcgc 588 ||||| |||||||||||||||||||||| ||| |||||||| |||||||||||||| Sbjct: 253 aagctgtttgtagttggcggcctgctggatgatatcgaggatacccatcgtcagctgcgc 194
>gb|AY103642.1| Zea mays PCO105720 mRNA sequence Length = 1169 Score = 309 bits (156), Expect = 6e-81 Identities = 357/420 (85%), Gaps = 3/420 (0%) Strand = Plus / Minus Query: 170 acaagacaccatcaccagtccaagcccctgaaaaactgtgtcacacgaggcccatcacac 229 |||||||||||||||||||||||||| |||||||| ||||| | |||||||||||||| Sbjct: 601 acaagacaccatcaccagtccaagcctctgaaaaaa-gtgtcg-atgaggcccatcacac 544 Query: 230 tgaaaggtctt-gataaatcatatgagaagcttctcgatggcatccttgagactctggat 288 ||||||||||| | | |||| |||||||||||||| |||| |||||||||| ||| || Sbjct: 543 tgaaaggtcttcggcagatcagatgagaagcttctcaatggagtccttgagaccctgtat 484 Query: 289 cggctgcttcagttggctaccctcattgctggtcactgaacaagcaatgaccggcctagt 348 | | | ||||| |||||||||||||| ||||||||||| |||||||| ||||| || || Sbjct: 483 ctgtagtttcagctggctaccctcattactggtcactgagcaagcaataaccggtcttgt 424 Query: 349 cactccacaagcacgcccaagggcttgctttgaagggacaaagacatacggcacattctt 408 ||| ||||||||||| ||||| |||||||| || || ||||| ||||| ||||| ||||| Sbjct: 423 cacaccacaagcacggccaagagcttgcttcgatggaacaaacacatatggcacgttctt 364 Query: 409 gtcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgccat 468 ||||| || | ||| ||||||||||| ||||| ||||| ||||| ||||| || ||||| Sbjct: 363 atcctcagctaacaaggggaggtggagcaggatctcgagaggctctgtgtccgccgccat 304 Query: 469 caccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctcccttctt 528 ||| || ||||||||||| ||||| || || ||||| |||||||| || ||||||||||| Sbjct: 303 cactacaaactccgatatgcccctattcagggtcttcgtcgcttcattcgctcccttctt 244 Query: 529 gagctgcttgtagttggcggcctgctggacgatgtcgaggatcgttatcgtcagctgcgc 588 ||||| |||||||||||||||||||||| ||| |||||||| |||||||||||||| Sbjct: 243 aagctgtttgtagttggcggcctgctggatgatatcgaggatacccatcgtcagctgcgc 184
>ref|NM_194676.1| Oryza sativa (japonica cultivar-group) putative ribosomal protein L7Ae-like (OSJNBa0056A20.5), mRNA Length = 381 Score = 214 bits (108), Expect = 2e-52 Identities = 210/244 (86%) Strand = Plus / Minus Query: 309 cctcattgctggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaa 368 |||||||||||||||| || || || || || ||||| ||||| ||||| ||||| || | Sbjct: 319 cctcattgctggtcaccgagcaggcgatcacgggcctcgtcaccccacatgcacggccga 260 Query: 369 gggcttgctttgaagggacaaagacatacggcacattcttgtcctccgcgagcaacggga 428 | ||||||||||| ||||||||||| || ||||||||||||||||| ||||| | || | Sbjct: 259 gagcttgctttgatgggacaaagacgtatggcacattcttgtcctcggcgaggaggggaa 200 Query: 429 ggtggaggaggatttcgagcggctccgtgtcagctgccatcaccacgaactccgatattc 488 ||||||| ||||| ||||| ||||| | ||| || ||||||||||||||||||| || | Sbjct: 199 ggtggagaaggatctcgaggggctcggcgtcggccgccatcaccacgaactccgcgatcc 140 Query: 489 ccctgttgagagtcttggtcgcttcgttggctcccttcttgagctgcttgtagttggcgg 548 | |||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 139 ctctgttgagcgtcttcgtcgcttcgttggcgcccttcttgagctgcttgtagttggcgg 80 Query: 549 cctg 552 |||| Sbjct: 79 cctg 76
>dbj|AK121991.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033109K13, full insert sequence Length = 675 Score = 214 bits (108), Expect = 2e-52 Identities = 210/244 (86%) Strand = Plus / Minus Query: 309 cctcattgctggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaa 368 |||||||||||||||| || || || || || ||||| ||||| ||||| ||||| || | Sbjct: 390 cctcattgctggtcaccgagcaggcgatcacgggcctcgtcaccccacatgcacggccga 331 Query: 369 gggcttgctttgaagggacaaagacatacggcacattcttgtcctccgcgagcaacggga 428 | ||||||||||| ||||||||||| || ||||||||||||||||| ||||| | || | Sbjct: 330 gagcttgctttgatgggacaaagacgtatggcacattcttgtcctcggcgaggaggggaa 271 Query: 429 ggtggaggaggatttcgagcggctccgtgtcagctgccatcaccacgaactccgatattc 488 ||||||| ||||| ||||| ||||| | ||| || ||||||||||||||||||| || | Sbjct: 270 ggtggagaaggatctcgaggggctcggcgtcggccgccatcaccacgaactccgcgatcc 211 Query: 489 ccctgttgagagtcttggtcgcttcgttggctcccttcttgagctgcttgtagttggcgg 548 | |||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct: 210 ctctgttgagcgtcttcgtcgcttcgttggcgcccttcttgagctgcttgtagttggcgg 151 Query: 549 cctg 552 |||| Sbjct: 150 cctg 147
>gb|AY389676.1| Hyacinthus orientalis ribosomal protein L7 (RPL7) mRNA, complete cds Length = 675 Score = 155 bits (78), Expect = 2e-34 Identities = 165/194 (85%) Strand = Plus / Minus Query: 365 ccaagggcttgctttgaagggacaaagacatacggcacattcttgtcctccgcgagcaac 424 ||||| ||||| || ||||| ||||||||||| ||||||||||||||||| || |||| Sbjct: 303 ccaagtgcttgtttggaaggaacaaagacatagggcacattcttgtcctcagcaagcaga 244 Query: 425 gggaggtggaggaggatttcgagcggctccgtgtcagctgccatcaccacgaactccgat 484 || ||||| || || |||||||| ||||| | ||| || |||||||| || |||||||| Sbjct: 243 ggaaggtgaagaagaatttcgaggggctcagcgtccgcagccatcacaacaaactccgag 184 Query: 485 attcccctgttgagagtcttggtcgcttcgttggctcccttcttgagctgcttgtagttg 544 ||||||||||| |||||||| |||||||| || || ||||| |||||||||||||| ||| Sbjct: 183 attcccctgttcagagtcttagtcgcttcattagcaccctttttgagctgcttgtaattg 124 Query: 545 gcggcctgctggac 558 || ||||||||||| Sbjct: 123 gccgcctgctggac 110
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 139 bits (70), Expect = 1e-29 Identities = 104/114 (91%), Gaps = 1/114 (0%) Strand = Plus / Minus Query: 163 ctagcagacaagacaccatcaccagtccaagcccctgaaaaactgtgtcacac-gaggcc 221 |||||| | |||||||||||||||||||||||| ||||||||||||||| | | |||||| Sbjct: 7447561 ctagcaaataagacaccatcaccagtccaagcctctgaaaaactgtgtcgctctgaggcc 7447502 Query: 222 catcacactgaaaggtcttgataaatcatatgagaagcttctcgatggcatcct 275 |||||||||||||||||||| ||||||| ||||| ||||||||||| ||||||| Sbjct: 7447501 catcacactgaaaggtcttggtaaatcaaatgaggagcttctcgatagcatcct 7447448 Score = 117 bits (59), Expect = 4e-23 Identities = 77/83 (92%) Strand = Plus / Minus Query: 510 cttcgttggctcccttcttgagctgcttgtagttggcggcctgctggacgatgtcgagga 569 |||||||||| |||||||||||||||||||| |||| |||||||||||||| |||||||| Sbjct: 7446242 cttcgttggcccccttcttgagctgcttgtaattggaggcctgctggacgaggtcgagga 7446183 Query: 570 tcgttatcgtcagctgcgcgtcc 592 | || |||||||||||||||||| Sbjct: 7446182 tggtcatcgtcagctgcgcgtcc 7446160 Score = 115 bits (58), Expect = 2e-22 Identities = 91/102 (89%) Strand = Plus / Minus Query: 410 tcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgccatc 469 ||||||||||||| ||||||||||| ||||| ||||||||||||||||| || |||||| Sbjct: 7446432 tcctccgcgagcagggggaggtggagaaggatctcgagcggctccgtgtcggccgccatc 7446373 Query: 470 accacgaactccgatattcccctgttgagagtcttggtcgct 511 ||||||||||| ||||| |||||||| || ||||| |||||| Sbjct: 7446372 accacgaactctgatatacccctgttcagggtcttcgtcgct 7446331 Score = 103 bits (52), Expect = 6e-19 Identities = 106/124 (85%) Strand = Plus / Minus Query: 273 ccttgagactctggatcggctgcttcagttggctaccctcattgctggtcactgaacaag 332 |||||||| |||| ||||| |||||| || || ||||| ||||||||||||||||||| Sbjct: 7447353 ccttgagattctgtatcggtgtcttcagctgactgccctcgttgctggtcactgaacaag 7447294 Query: 333 caatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaagggacaaaga 392 ||||||| || ||||| || ||||| || || |||||||||||||| ||||||||||| | Sbjct: 7447293 caatgacaggtctagtaacgccacatgcgcggccaagggcttgcttcgaagggacaaaaa 7447234 Query: 393 cata 396 |||| Sbjct: 7447233 cata 7447230
>gb|AC136136.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBb0071C04, from chromosome 3, complete sequence Length = 126078 Score = 139 bits (70), Expect = 1e-29 Identities = 104/114 (91%), Gaps = 1/114 (0%) Strand = Plus / Minus Query: 163 ctagcagacaagacaccatcaccagtccaagcccctgaaaaactgtgtcacac-gaggcc 221 |||||| | |||||||||||||||||||||||| ||||||||||||||| | | |||||| Sbjct: 86116 ctagcaaataagacaccatcaccagtccaagcctctgaaaaactgtgtcgctctgaggcc 86057 Query: 222 catcacactgaaaggtcttgataaatcatatgagaagcttctcgatggcatcct 275 |||||||||||||||||||| ||||||| ||||| ||||||||||| ||||||| Sbjct: 86056 catcacactgaaaggtcttggtaaatcaaatgaggagcttctcgatagcatcct 86003 Score = 117 bits (59), Expect = 4e-23 Identities = 77/83 (92%) Strand = Plus / Minus Query: 510 cttcgttggctcccttcttgagctgcttgtagttggcggcctgctggacgatgtcgagga 569 |||||||||| |||||||||||||||||||| |||| |||||||||||||| |||||||| Sbjct: 84797 cttcgttggcccccttcttgagctgcttgtaattggaggcctgctggacgaggtcgagga 84738 Query: 570 tcgttatcgtcagctgcgcgtcc 592 | || |||||||||||||||||| Sbjct: 84737 tggtcatcgtcagctgcgcgtcc 84715 Score = 115 bits (58), Expect = 2e-22 Identities = 91/102 (89%) Strand = Plus / Minus Query: 410 tcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgccatc 469 ||||||||||||| ||||||||||| ||||| ||||||||||||||||| || |||||| Sbjct: 84987 tcctccgcgagcagggggaggtggagaaggatctcgagcggctccgtgtcggccgccatc 84928 Query: 470 accacgaactccgatattcccctgttgagagtcttggtcgct 511 ||||||||||| ||||| |||||||| || ||||| |||||| Sbjct: 84927 accacgaactctgatatacccctgttcagggtcttcgtcgct 84886 Score = 103 bits (52), Expect = 6e-19 Identities = 106/124 (85%) Strand = Plus / Minus Query: 273 ccttgagactctggatcggctgcttcagttggctaccctcattgctggtcactgaacaag 332 |||||||| |||| ||||| |||||| || || ||||| ||||||||||||||||||| Sbjct: 85908 ccttgagattctgtatcggtgtcttcagctgactgccctcgttgctggtcactgaacaag 85849 Query: 333 caatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaagggacaaaga 392 ||||||| || ||||| || ||||| || || |||||||||||||| ||||||||||| | Sbjct: 85848 caatgacaggtctagtaacgccacatgcgcggccaagggcttgcttcgaagggacaaaaa 85789 Query: 393 cata 396 |||| Sbjct: 85788 cata 85785
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 139 bits (70), Expect = 1e-29 Identities = 104/114 (91%), Gaps = 1/114 (0%) Strand = Plus / Minus Query: 163 ctagcagacaagacaccatcaccagtccaagcccctgaaaaactgtgtcacac-gaggcc 221 |||||| | |||||||||||||||||||||||| ||||||||||||||| | | |||||| Sbjct: 7445396 ctagcaaataagacaccatcaccagtccaagcctctgaaaaactgtgtcgctctgaggcc 7445337 Query: 222 catcacactgaaaggtcttgataaatcatatgagaagcttctcgatggcatcct 275 |||||||||||||||||||| ||||||| ||||| ||||||||||| ||||||| Sbjct: 7445336 catcacactgaaaggtcttggtaaatcaaatgaggagcttctcgatagcatcct 7445283 Score = 117 bits (59), Expect = 4e-23 Identities = 77/83 (92%) Strand = Plus / Minus Query: 510 cttcgttggctcccttcttgagctgcttgtagttggcggcctgctggacgatgtcgagga 569 |||||||||| |||||||||||||||||||| |||| |||||||||||||| |||||||| Sbjct: 7444077 cttcgttggcccccttcttgagctgcttgtaattggaggcctgctggacgaggtcgagga 7444018 Query: 570 tcgttatcgtcagctgcgcgtcc 592 | || |||||||||||||||||| Sbjct: 7444017 tggtcatcgtcagctgcgcgtcc 7443995 Score = 115 bits (58), Expect = 2e-22 Identities = 91/102 (89%) Strand = Plus / Minus Query: 410 tcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgccatc 469 ||||||||||||| ||||||||||| ||||| ||||||||||||||||| || |||||| Sbjct: 7444267 tcctccgcgagcagggggaggtggagaaggatctcgagcggctccgtgtcggccgccatc 7444208 Query: 470 accacgaactccgatattcccctgttgagagtcttggtcgct 511 ||||||||||| ||||| |||||||| || ||||| |||||| Sbjct: 7444207 accacgaactctgatatacccctgttcagggtcttcgtcgct 7444166 Score = 103 bits (52), Expect = 6e-19 Identities = 106/124 (85%) Strand = Plus / Minus Query: 273 ccttgagactctggatcggctgcttcagttggctaccctcattgctggtcactgaacaag 332 |||||||| |||| ||||| |||||| || || ||||| ||||||||||||||||||| Sbjct: 7445188 ccttgagattctgtatcggtgtcttcagctgactgccctcgttgctggtcactgaacaag 7445129 Query: 333 caatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaagggacaaaga 392 ||||||| || ||||| || ||||| || || |||||||||||||| ||||||||||| | Sbjct: 7445128 caatgacaggtctagtaacgccacatgcgcggccaagggcttgcttcgaagggacaaaaa 7445069 Query: 393 cata 396 |||| Sbjct: 7445068 cata 7445065
>gb|DQ459071.1| Sorghum bicolor cultivar BTx623 clone BAC c0156b06, complete sequence Length = 112592 Score = 125 bits (63), Expect = 2e-25 Identities = 117/135 (86%) Strand = Plus / Plus Query: 273 ccttgagactctggatcggctgcttcagttggctaccctcattgctggtcactgaacaag 332 ||||||||| ||| ||| | || ||||| |||||||||||||||||||||||||| |||| Sbjct: 111956 ccttgagaccctgtatctgttgtttcagctggctaccctcattgctggtcactgagcaag 112015 Query: 333 caatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaagggacaaaga 392 ||||||||||||| ||||| |||||||| || ||||| ||||| ||||| || ||||| | Sbjct: 112016 caatgaccggccttgtcaccccacaagctcggccaagagcttgttttgatggaacaaata 112075 Query: 393 catacggcacattct 407 |||| ||||| |||| Sbjct: 112076 catatggcacgttct 112090 Score = 95.6 bits (48), Expect = 2e-16 Identities = 87/96 (90%), Gaps = 3/96 (3%) Strand = Plus / Plus Query: 170 acaagacaccatcaccagtccaagcccctgaaaaactgtgtcacacgaggcccatcacac 229 |||||||||||||||||||||||||| ||||||| |||||| | |||||||||||||| Sbjct: 111693 acaagacaccatcaccagtccaagcctctgaaaat-tgtgtccct-gaggcccatcacac 111750 Query: 230 tgaaaggtctt-gataaatcatatgagaagcttctc 264 ||||||||||| | ||||||| |||||||||||||| Sbjct: 111751 tgaaaggtcttcggtaaatcagatgagaagcttctc 111786
>emb|Z49911.1|CEM28 Caenorhabditis elegans Cosmid M28, complete sequence Length = 40265 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/59 (93%) Strand = Plus / Plus Query: 485 attcccctgttgagagtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 543 ||||| ||||||||||||||||| || ||||||||||||||||||||||| |||||||| Sbjct: 38927 attcctctgttgagagtcttggtggcctcgttggctcccttcttgagctgtttgtagtt 38985
>ref|NM_063899.3| Caenorhabditis elegans M28.5 (M28.5) mRNA, complete cds Length = 531 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/59 (93%) Strand = Plus / Minus Query: 485 attcccctgttgagagtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 543 ||||| ||||||||||||||||| || ||||||||||||||||||||||| |||||||| Sbjct: 161 attcctctgttgagagtcttggtggcctcgttggctcccttcttgagctgtttgtagtt 103
>gb|AC079128.2| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBa0056A20, complete sequence Length = 151163 Score = 77.8 bits (39), Expect = 4e-11 Identities = 84/99 (84%) Strand = Plus / Minus Query: 309 cctcattgctggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaa 368 |||||||||||||||| || || || || || ||||| ||||| ||||| ||||| || | Sbjct: 29362 cctcattgctggtcaccgagcaggcgatcacgggcctcgtcaccccacatgcacggccga 29303 Query: 369 gggcttgctttgaagggacaaagacatacggcacattct 407 | ||||||||||| ||||||||||| || |||||||||| Sbjct: 29302 gagcttgctttgatgggacaaagacgtatggcacattct 29264 Score = 77.8 bits (39), Expect = 4e-11 Identities = 42/43 (97%) Strand = Plus / Minus Query: 510 cttcgttggctcccttcttgagctgcttgtagttggcggcctg 552 |||||||||| |||||||||||||||||||||||||||||||| Sbjct: 28332 cttcgttggcgcccttcttgagctgcttgtagttggcggcctg 28290 Score = 67.9 bits (34), Expect = 4e-08 Identities = 88/106 (83%) Strand = Plus / Minus Query: 406 cttgtcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgc 465 ||||||||| ||||| | || |||||||| ||||| ||||| ||||| | ||| || || Sbjct: 28523 cttgtcctcggcgaggaggggaaggtggagaaggatctcgaggggctcggcgtcggccgc 28464 Query: 466 catcaccacgaactccgatattcccctgttgagagtcttggtcgct 511 ||||||||||||||||| || || |||||||| ||||| |||||| Sbjct: 28463 catcaccacgaactccgcgatccctctgttgagcgtcttcgtcgct 28418
>gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone Pseudo10p0.0-10p4.4, complete sequence Length = 2331000 Score = 77.8 bits (39), Expect = 4e-11 Identities = 84/99 (84%) Strand = Plus / Minus Query: 309 cctcattgctggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaa 368 |||||||||||||||| || || || || || ||||| ||||| ||||| ||||| || | Sbjct: 1510789 cctcattgctggtcaccgagcaggcgatcacgggcctcgtcaccccacatgcacggccga 1510730 Query: 369 gggcttgctttgaagggacaaagacatacggcacattct 407 | ||||||||||| ||||||||||| || |||||||||| Sbjct: 1510729 gagcttgctttgatgggacaaagacgtatggcacattct 1510691 Score = 77.8 bits (39), Expect = 4e-11 Identities = 42/43 (97%) Strand = Plus / Minus Query: 510 cttcgttggctcccttcttgagctgcttgtagttggcggcctg 552 |||||||||| |||||||||||||||||||||||||||||||| Sbjct: 1509759 cttcgttggcgcccttcttgagctgcttgtagttggcggcctg 1509717 Score = 67.9 bits (34), Expect = 4e-08 Identities = 88/106 (83%) Strand = Plus / Minus Query: 406 cttgtcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgc 465 ||||||||| ||||| | || |||||||| ||||| ||||| ||||| | ||| || || Sbjct: 1509950 cttgtcctcggcgaggaggggaaggtggagaaggatctcgaggggctcggcgtcggccgc 1509891 Query: 466 catcaccacgaactccgatattcccctgttgagagtcttggtcgct 511 ||||||||||||||||| || || |||||||| ||||| |||||| Sbjct: 1509890 catcaccacgaactccgcgatccctctgttgagcgtcttcgtcgct 1509845
>gb|AC131967.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNAa0049K09, complete sequence Length = 154181 Score = 77.8 bits (39), Expect = 4e-11 Identities = 84/99 (84%) Strand = Plus / Minus Query: 309 cctcattgctggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaa 368 |||||||||||||||| || || || || || ||||| ||||| ||||| ||||| || | Sbjct: 123543 cctcattgctggtcaccgagcaggcgatcacgggcctcgtcaccccacatgcacggccga 123484 Query: 369 gggcttgctttgaagggacaaagacatacggcacattct 407 | ||||||||||| ||||||||||| || |||||||||| Sbjct: 123483 gagcttgctttgatgggacaaagacgtatggcacattct 123445 Score = 77.8 bits (39), Expect = 4e-11 Identities = 42/43 (97%) Strand = Plus / Minus Query: 510 cttcgttggctcccttcttgagctgcttgtagttggcggcctg 552 |||||||||| |||||||||||||||||||||||||||||||| Sbjct: 122513 cttcgttggcgcccttcttgagctgcttgtagttggcggcctg 122471 Score = 67.9 bits (34), Expect = 4e-08 Identities = 88/106 (83%) Strand = Plus / Minus Query: 406 cttgtcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgc 465 ||||||||| ||||| | || |||||||| ||||| ||||| ||||| | ||| || || Sbjct: 122704 cttgtcctcggcgaggaggggaaggtggagaaggatctcgaggggctcggcgtcggccgc 122645 Query: 466 catcaccacgaactccgatattcccctgttgagagtcttggtcgct 511 ||||||||||||||||| || || |||||||| ||||| |||||| Sbjct: 122644 catcaccacgaactccgcgatccctctgttgagcgtcttcgtcgct 122599
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 77.8 bits (39), Expect = 4e-11 Identities = 84/99 (84%) Strand = Plus / Minus Query: 309 cctcattgctggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaa 368 |||||||||||||||| || || || || || ||||| ||||| ||||| ||||| || | Sbjct: 1510789 cctcattgctggtcaccgagcaggcgatcacgggcctcgtcaccccacatgcacggccga 1510730 Query: 369 gggcttgctttgaagggacaaagacatacggcacattct 407 | ||||||||||| ||||||||||| || |||||||||| Sbjct: 1510729 gagcttgctttgatgggacaaagacgtatggcacattct 1510691 Score = 77.8 bits (39), Expect = 4e-11 Identities = 42/43 (97%) Strand = Plus / Minus Query: 510 cttcgttggctcccttcttgagctgcttgtagttggcggcctg 552 |||||||||| |||||||||||||||||||||||||||||||| Sbjct: 1509759 cttcgttggcgcccttcttgagctgcttgtagttggcggcctg 1509717 Score = 67.9 bits (34), Expect = 4e-08 Identities = 88/106 (83%) Strand = Plus / Minus Query: 406 cttgtcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgc 465 ||||||||| ||||| | || |||||||| ||||| ||||| ||||| | ||| || || Sbjct: 1509950 cttgtcctcggcgaggaggggaaggtggagaaggatctcgaggggctcggcgtcggccgc 1509891 Query: 466 catcaccacgaactccgatattcccctgttgagagtcttggtcgct 511 ||||||||||||||||| || || |||||||| ||||| |||||| Sbjct: 1509890 catcaccacgaactccgcgatccctctgttgagcgtcttcgtcgct 1509845
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 77.8 bits (39), Expect = 4e-11 Identities = 84/99 (84%) Strand = Plus / Minus Query: 309 cctcattgctggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaa 368 |||||||||||||||| || || || || || ||||| ||||| ||||| ||||| || | Sbjct: 1510786 cctcattgctggtcaccgagcaggcgatcacgggcctcgtcaccccacatgcacggccga 1510727 Query: 369 gggcttgctttgaagggacaaagacatacggcacattct 407 | ||||||||||| ||||||||||| || |||||||||| Sbjct: 1510726 gagcttgctttgatgggacaaagacgtatggcacattct 1510688 Score = 77.8 bits (39), Expect = 4e-11 Identities = 42/43 (97%) Strand = Plus / Minus Query: 510 cttcgttggctcccttcttgagctgcttgtagttggcggcctg 552 |||||||||| |||||||||||||||||||||||||||||||| Sbjct: 1509756 cttcgttggcgcccttcttgagctgcttgtagttggcggcctg 1509714 Score = 67.9 bits (34), Expect = 4e-08 Identities = 88/106 (83%) Strand = Plus / Minus Query: 406 cttgtcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtgtcagctgc 465 ||||||||| ||||| | || |||||||| ||||| ||||| ||||| | ||| || || Sbjct: 1509947 cttgtcctcggcgaggaggggaaggtggagaaggatctcgaggggctcggcgtcggccgc 1509888 Query: 466 catcaccacgaactccgatattcccctgttgagagtcttggtcgct 511 ||||||||||||||||| || || |||||||| ||||| |||||| Sbjct: 1509887 catcaccacgaactccgcgatccctctgttgagcgtcttcgtcgct 1509842
>ref|XM_531713.2| PREDICTED: Canis familiaris similar to NHP2-like protein 1 (High mobility group-like nuclear protein 2 homolog 1) ([U4/U6.U5] tri-snRNP 15.5 kDa protein) (Sperm specific antigen 1) (Fertilization antigen 1) (FA-1) (LOC474484), mRNA Length = 1414 Score = 67.9 bits (34), Expect = 4e-08 Identities = 172/218 (78%) Strand = Plus / Minus Query: 326 gaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaaggg 385 ||||| |||||||| ||||| | ||| ||||| || ||||| ||||| ||||| || | Sbjct: 373 gaacaggcaatgacaggcctggacaccccacaggcccgcccgagggcctgcttggagcgc 314 Query: 386 acaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcg 445 ||||| || || ||||| ||||| || || |||| ||| ||||| |||| |||||| Sbjct: 313 acaaacacgtagggcacgttcttatcttcacacagcagcggaaggtgcaggatgatttcc 254 Query: 446 agcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttg 505 || ||||| | ||| || |||||||| | |||||| || || || |||||||| || ||| Sbjct: 253 agaggctcagcgtctgcagccatcacgatgaactcagagatgcctctgttgagggttttg 194 Query: 506 gtcgcttcgttggctcccttcttgagctgcttgtagtt 543 || |||||||||||||| ||| |||||||||||||| Sbjct: 193 gtggcttcgttggctcctttccgaagctgcttgtagtt 156
>ref|XM_571849.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 7 Length = 596 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Minus Query: 500 gtcttggtcgcttcgttggctcccttcttgagctgcttgta 540 |||||||| ||||||||||| |||||||||||||||||||| Sbjct: 236 gtcttggtggcttcgttggcacccttcttgagctgcttgta 196
>ref|NM_122023.2| Arabidopsis thaliana RNA binding / structural constituent of ribosome AT5G20160 transcript variant AT5G20160.1 mRNA, complete cds Length = 719 Score = 63.9 bits (32), Expect = 6e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 323 actgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaa 382 ||||||||||| || || || |||||||| ||||| || | || | ||||||||||||| Sbjct: 404 actgaacaagcgataacaggtctagtcacaccacaggctcttcccaaggcttgctttgaa 345 Query: 383 gggacaaagacatacggcacattcttgtcctc 414 || ||||||||||| || |||||||| ||||| Sbjct: 344 ggcacaaagacataaggaacattcttatcctc 313 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 497 agagtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 543 |||||||| || ||||| || || ||||||||||||||||||||||| Sbjct: 230 agagtcttcgtagcttcattagcacccttcttgagctgcttgtagtt 184
>ref|NM_180525.1| Arabidopsis thaliana RNA binding / structural constituent of ribosome AT5G20160 transcript variant AT5G20160.2 mRNA, complete cds Length = 815 Score = 63.9 bits (32), Expect = 6e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 323 actgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaa 382 ||||||||||| || || || |||||||| ||||| || | || | ||||||||||||| Sbjct: 500 actgaacaagcgataacaggtctagtcacaccacaggctcttcccaaggcttgctttgaa 441 Query: 383 gggacaaagacatacggcacattcttgtcctc 414 || ||||||||||| || |||||||| ||||| Sbjct: 440 ggcacaaagacataaggaacattcttatcctc 409 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 521 cccttcttgagctgcttgtagtt 543 ||||||||||||||||||||||| Sbjct: 206 cccttcttgagctgcttgtagtt 184
>gb|AY094018.1| Arabidopsis thaliana AT5g20160/F5O24_50 mRNA, complete cds Length = 387 Score = 63.9 bits (32), Expect = 6e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 323 actgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaa 382 ||||||||||| || || || |||||||| ||||| || | || | ||||||||||||| Sbjct: 311 actgaacaagcgataacaggtctagtcacaccacaggctcttcccaaggcttgctttgaa 252 Query: 383 gggacaaagacatacggcacattcttgtcctc 414 || ||||||||||| || |||||||| ||||| Sbjct: 251 ggcacaaagacataaggaacattcttatcctc 220 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 497 agagtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 543 |||||||| || ||||| || || ||||||||||||||||||||||| Sbjct: 137 agagtcttcgtagcttcattagcacccttcttgagctgcttgtagtt 91
>gb|AY048213.1| Arabidopsis thaliana AT5g20160/F5O24_50 mRNA, complete cds Length = 716 Score = 63.9 bits (32), Expect = 6e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 323 actgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaa 382 ||||||||||| || || || |||||||| ||||| || | || | ||||||||||||| Sbjct: 404 actgaacaagcgataacaggtctagtcacaccacaggctcttcccaaggcttgctttgaa 345 Query: 383 gggacaaagacatacggcacattcttgtcctc 414 || ||||||||||| || |||||||| ||||| Sbjct: 344 ggcacaaagacataaggaacattcttatcctc 313 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 497 agagtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 543 |||||||| || ||||| || || ||||||||||||||||||||||| Sbjct: 230 agagtcttcgtagcttcattagcacccttcttgagctgcttgtagtt 184
>gb|AY086996.1| Arabidopsis thaliana clone 30288 mRNA, complete sequence Length = 726 Score = 63.9 bits (32), Expect = 6e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 323 actgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaa 382 ||||||||||| || || || |||||||| ||||| || | || | ||||||||||||| Sbjct: 404 actgaacaagcgataacaggtctagtcacaccacaggctcttcccaaggcttgctttgaa 345 Query: 383 gggacaaagacatacggcacattcttgtcctc 414 || ||||||||||| || |||||||| ||||| Sbjct: 344 ggcacaaagacataaggaacattcttatcctc 313 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 497 agagtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 543 |||||||| || ||||| || || ||||||||||||||||||||||| Sbjct: 230 agagtcttcgtagcttcattagcacccttcttgagctgcttgtagtt 184
>ref|XM_757414.1| Ustilago maydis 521 hypothetical protein (UM06360.1) partial mRNA Length = 381 Score = 61.9 bits (31), Expect = 2e-06 Identities = 67/79 (84%) Strand = Plus / Minus Query: 493 gttgagagtcttggtcgcttcgttggctcccttcttgagctgcttgtagttggcggcctg 552 |||||| |||||||| || ||||| || |||||||||||||||||||||| | ||||| Sbjct: 135 gttgagcgtcttggtggcctcgttagcacccttcttgagctgcttgtagtgcgaagcctg 76 Query: 553 ctggacgatgtcgaggatc 571 ||| | || |||||||||| Sbjct: 75 ctgaatgaggtcgaggatc 57 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Minus Query: 380 gaagggacaaagacatacggcacattcttgtcctc 414 |||||||||||||| || ||||| ||||||||||| Sbjct: 248 gaagggacaaagacgtaaggcacgttcttgtcctc 214
>ref|NM_200312.1| Danio rerio zgc:56066 (zgc:56066), mRNA Length = 1751 Score = 60.0 bits (30), Expect = 9e-06 Identities = 135/170 (79%) Strand = Plus / Minus Query: 386 acaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcg 445 ||||| |||||||| || ||||||||||| |||| ||| || || |||| ||| || Sbjct: 402 acaaacacatacgggacgttcttgtcctcgcacagcagcggcagatgcaggatgatctcc 343 Query: 446 agcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttg 505 |||||||| | ||| || |||||||| | |||||| || ||||||| ||| || || || Sbjct: 342 agcggctctgcgtcggccgccatcacgatgaactctgagattccccggttcagggtttta 283 Query: 506 gtcgcttcgttggctcccttcttgagctgcttgtagttggcggcctgctg 555 || ||||||||||| || ||| | ||||| ||||| ||||| |||||||| Sbjct: 282 gtggcttcgttggcccctttcctcagctgtttgtaattggctgcctgctg 233
>ref|XM_505832.1| Yarrowia lipolytica CLIB122, YALI0F24497g predicted mRNA Length = 381 Score = 60.0 bits (30), Expect = 9e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 493 gttgagagtcttggtcgcttcgttggctcccttcttgagctg 534 |||||| |||||||| || ||||||||||||||||||||||| Sbjct: 135 gttgagggtcttggtggcctcgttggctcccttcttgagctg 94
>gb|BC050495.1| Danio rerio zgc:56066, mRNA (cDNA clone MGC:56066 IMAGE:3820656), complete cds Length = 1751 Score = 60.0 bits (30), Expect = 9e-06 Identities = 135/170 (79%) Strand = Plus / Minus Query: 386 acaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcg 445 ||||| |||||||| || ||||||||||| |||| ||| || || |||| ||| || Sbjct: 402 acaaacacatacgggacgttcttgtcctcgcacagcagcggcagatgcaggatgatctcc 343 Query: 446 agcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttg 505 |||||||| | ||| || |||||||| | |||||| || ||||||| ||| || || || Sbjct: 342 agcggctctgcgtcggccgccatcacgatgaactctgagattccccggttcagggtttta 283 Query: 506 gtcgcttcgttggctcccttcttgagctgcttgtagttggcggcctgctg 555 || ||||||||||| || ||| | ||||| ||||| ||||| |||||||| Sbjct: 282 gtggcttcgttggcccctttcctcagctgtttgtaattggctgcctgctg 233
>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica Length = 4003362 Score = 60.0 bits (30), Expect = 9e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 493 gttgagagtcttggtcgcttcgttggctcccttcttgagctg 534 |||||| |||||||| || ||||||||||||||||||||||| Sbjct: 3187548 gttgagggtcttggtggcctcgttggctcccttcttgagctg 3187507
>ref|XM_744631.1| Aspergillus fumigatus Af293 snRNP and snoRNP protein Snu13 (Afu2g05950) partial mRNA Length = 381 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 494 ttgagagtcttggtcgcttcgttggctcccttcttgagctg 534 |||||||||||||| || |||||||| |||||||||||||| Sbjct: 134 ttgagagtcttggtagcctcgttggcacccttcttgagctg 94
>dbj|AB226025.1| Aspergillus oryzae cDNA, contig sequence: AoEST2881 Length = 703 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 494 ttgagagtcttggtcgcttcgttggctcccttcttgagctg 534 ||||| ||||||||||||||||| ||||||||||| ||||| Sbjct: 207 ttgagtgtcttggtcgcttcgtttgctcccttcttcagctg 167
>dbj|AP007154.1| Aspergillus oryzae RIB40 genomic DNA, SC001 Length = 2005935 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 494 ttgagagtcttggtcgcttcgttggctcccttcttgagctg 534 ||||| ||||||||||||||||| ||||||||||| ||||| Sbjct: 1888685 ttgagtgtcttggtcgcttcgtttgctcccttcttcagctg 1888725
>gb|AF296825.1|F5O24 Arabidopsis thaliana BAC F5O24 Length = 101458 Score = 58.0 bits (29), Expect = 3e-05 Identities = 71/85 (83%) Strand = Plus / Plus Query: 323 actgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaa 382 ||||||||||| || || || |||||||| ||||| || | || | ||||||||||||| Sbjct: 8653 actgaacaagcgataacaggtctagtcacaccacaggctcttcccaaggcttgctttgaa 8712 Query: 383 gggacaaagacatacggcacattct 407 || ||||||||||| || ||||||| Sbjct: 8713 ggcacaaagacataaggaacattct 8737 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 521 cccttcttgagctgcttgtagtt 543 ||||||||||||||||||||||| Sbjct: 9273 cccttcttgagctgcttgtagtt 9295
>ref|NM_118364.1| Arabidopsis thaliana RNA binding / structural constituent of ribosome AT4G22380 mRNA, complete cds Length = 387 Score = 56.0 bits (28), Expect = 1e-04 Identities = 175/224 (78%) Strand = Plus / Minus Query: 320 gtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgcttt 379 ||||||||||||||||| || || || || |||||||| || | || | ||||| || Sbjct: 314 gtcactgaacaagcaataacaggtcttgttactccacatgctcttcccaatgcttgtttc 255 Query: 380 gaagggacaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggagg 439 ||||| ||||| ||||| ||||||||||| || || || ||||| || || || || || Sbjct: 254 gaaggtacaaacacatatggcacattcttatcttcggcaagcaaaggaagatgaagaaga 195 Query: 440 atttcgagcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgaga 499 || || || || || | ||||| ||||| || |||||||| || ||||| | ||| | Sbjct: 194 atctcaagtggttcagcatcagcagccataacaacgaactcagagattccacggttcaat 135 Query: 500 gtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 543 || ||||| ||||| || ||||||||||| |||||||||||||| Sbjct: 134 gttttggtagcttcattagctcccttcttaagctgcttgtagtt 91
>ref|XM_956324.1| Neurospora crassa OR74A probable 13 kD U4/U6.U5 snRNP associate protein [MIPS] (NCU01331.1) partial mRNA Length = 387 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Minus Query: 502 cttggtcgcttcgttggctcccttcttgagctgcttgtagttggcggcctgctggacgat 561 |||||| || |||||||| |||||||||||||| |||||| | ||||||||||||| Sbjct: 132 cttggtggcctcgttggcacccttcttgagctgtctgtagtggctggcctgctggacgca 73 Query: 562 gtcgagga 569 |||||||| Sbjct: 72 gtcgagga 65
>ref|XM_326823.1| Neurospora crassa OR74A probable 13 kD U4/U6.U5 snRNP associate protein [MIPS] (NCU01331.1) partial mRNA Length = 387 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Minus Query: 502 cttggtcgcttcgttggctcccttcttgagctgcttgtagttggcggcctgctggacgat 561 |||||| || |||||||| |||||||||||||| |||||| | ||||||||||||| Sbjct: 132 cttggtggcctcgttggcacccttcttgagctgtctgtagtggctggcctgctggacgca 73 Query: 562 gtcgagga 569 |||||||| Sbjct: 72 gtcgagga 65
>emb|AL451017.1|NC12F11 Neurospora crassa DNA linkage group V Cosmid contig 12F11 Length = 74317 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Plus Query: 502 cttggtcgcttcgttggctcccttcttgagctgcttgtagttggcggcctgctggacgat 561 |||||| || |||||||| |||||||||||||| |||||| | ||||||||||||| Sbjct: 35066 cttggtggcctcgttggcacccttcttgagctgtctgtagtggctggcctgctggacgca 35125 Query: 562 gtcgagga 569 |||||||| Sbjct: 35126 gtcgagga 35133
>gb|BT024580.1| Arabidopsis thaliana At4g22380 mRNA, complete cds Length = 387 Score = 56.0 bits (28), Expect = 1e-04 Identities = 175/224 (78%) Strand = Plus / Minus Query: 320 gtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgcttt 379 ||||||||||||||||| || || || || |||||||| || | || | ||||| || Sbjct: 314 gtcactgaacaagcaataacaggtcttgttactccacatgctcttcccaatgcttgtttc 255 Query: 380 gaagggacaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggagg 439 ||||| ||||| ||||| ||||||||||| || || || ||||| || || || || || Sbjct: 254 gaaggtacaaacacatatggcacattcttatcttcggcaagcaaaggaagatgaagaaga 195 Query: 440 atttcgagcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgaga 499 || || || || || | ||||| ||||| || |||||||| || ||||| | ||| | Sbjct: 194 atctcaagtggttcagcatcagcagccataacaacgaactcagagattccacggttcaat 135 Query: 500 gtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 543 || ||||| ||||| || ||||||||||| |||||||||||||| Sbjct: 134 gttttggtagcttcattagctcccttcttaagctgcttgtagtt 91
>gb|AY086674.1| Arabidopsis thaliana clone 2673 mRNA, complete sequence Length = 624 Score = 56.0 bits (28), Expect = 1e-04 Identities = 175/224 (78%) Strand = Plus / Minus Query: 320 gtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgcttt 379 ||||||||||||||||| || || || || |||||||| || | || | ||||| || Sbjct: 392 gtcactgaacaagcaataacaggtcttgttactccacatgctcttcccaatgcttgtttc 333 Query: 380 gaagggacaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggagg 439 ||||| ||||| ||||| ||||||||||| || || || ||||| || || || || || Sbjct: 332 gaaggtacaaacacatatggcacattcttatcttcggcaagcaaaggaagatgaagaaga 273 Query: 440 atttcgagcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgaga 499 || || || || || | ||||| ||||| || |||||||| || ||||| | ||| | Sbjct: 272 atctcaagtggttcagcatcagcagccataacaacgaactcagagattccacggttcaat 213 Query: 500 gtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 543 || ||||| ||||| || ||||||||||| |||||||||||||| Sbjct: 212 gttttggtagcttcattagctcccttcttaagctgcttgtagtt 169
>gb|AC160992.2| Mus musculus BAC clone RP23-147I23 from chromosome 9, complete sequence Length = 215980 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||| Sbjct: 84768 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 84709 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 84708 cctttccgaagctgcttgtagtt 84686
>ref|XM_509501.1| PREDICTED: Pan troglodytes similar to checkpoint with forkhead and ring finger domains (LOC452391), mRNA Length = 1923 Score = 54.0 bits (27), Expect = 5e-04 Identities = 78/95 (82%) Strand = Plus / Plus Query: 449 ggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttggtc 508 ||||| ||||| || |||||||| | |||||| || || |||||||| || || ||||| Sbjct: 179 ggctcggtgtctgcagccatcacgatgaactcagagatgcccctgttaagggttttggtg 238 Query: 509 gcttcgttggctcccttcttgagctgcttgtagtt 543 || |||||||||| |||| |||||||||||||| Sbjct: 239 gcctcgttggctcttttctgaagctgcttgtagtt 273
>ref|NM_011482.3| Mus musculus NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) (Nhp2l1), mRNA Length = 1259 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||| Sbjct: 284 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 225 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 224 cctttccgaagctgcttgtagtt 202
>ref|XM_992454.1| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome protein 2-like 1 (LOC434401), mRNA Length = 1274 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||| Sbjct: 283 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 224 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 223 cctttccgaagctgcttgtagtt 201
>ref|XM_486217.4| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome protein 2-like 1 (LOC434401), mRNA Length = 1274 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||| Sbjct: 283 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 224 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 223 cctttccgaagctgcttgtagtt 201
>gb|BC046579.1| Xenopus laevis NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae), mRNA (cDNA clone MGC:53430 IMAGE:5571836), complete cds Length = 812 Score = 54.0 bits (27), Expect = 5e-04 Identities = 168/215 (78%) Strand = Plus / Minus Query: 326 gaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaaggg 385 ||||||| ||| || ||||||| ||||||||||| | ||||| || ||||| ||| | Sbjct: 393 gaacaagaaatcactggcctagagactccacaagctcttccaagtgcctgcttggaacgc 334 Query: 386 acaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcg 445 ||||| ||||| || || ||||||||||| || | ||||||||| || | ||| || Sbjct: 333 acaaacacataggggacgttcttgtcctcacataggagcgggaggtgtagaatgatctcc 274 Query: 446 agcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttg 505 || || || | ||||||||||| || | |||||| ||||| || ||||| || ||||| Sbjct: 273 agaggttctgcatcagctgccatgactatgaactcagatatgcctctgtttagggtcttt 214 Query: 506 gtcgcttcgttggctcccttcttgagctgcttgta 540 || ||||||||||| ||||| |||||||||||| Sbjct: 213 gtagcttcgttggcacccttgcggagctgcttgta 179
>gb|BC083315.1| Mus musculus NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae), mRNA (cDNA clone MGC:101925 IMAGE:5714819), complete cds Length = 1201 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||| Sbjct: 204 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 145 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 144 cctttccgaagctgcttgtagtt 122
>gb|BC054450.1| Mus musculus NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae), mRNA (cDNA clone MGC:62619 IMAGE:6491298), complete cds Length = 1218 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||| Sbjct: 228 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 169 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 168 cctttccgaagctgcttgtagtt 146
>gb|BC026755.1| Mus musculus NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae), mRNA (cDNA clone MGC:25294 IMAGE:3154066), complete cds Length = 1226 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||| Sbjct: 228 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 169 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 168 cctttccgaagctgcttgtagtt 146
>gb|BC058493.1| Rattus norvegicus similar to NHP2-like protein 1 (High mobility group-like nuclear protein 2 homolog 1) ([U4/U6.U5] tri-snRNP 15.5 kDa protein) (OTK27), mRNA (cDNA clone MGC:72932 IMAGE:6887059), complete cds Length = 635 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||| Sbjct: 287 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 228 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 227 cctttccgaagctgcttgtagtt 205
>dbj|AK134943.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length enriched library, clone:6430523H23 product:sperm specific antigen 1, full insert sequence Length = 1763 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||| Sbjct: 220 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 161 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 160 cctttccgaagctgcttgtagtt 138
>dbj|AK145391.1| Mus musculus morula whole body morula cDNA, RIKEN full-length enriched library, clone:I0C0032L12 product:sperm specific antigen 1, full insert sequence Length = 1259 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||| Sbjct: 284 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 225 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 224 cctttccgaagctgcttgtagtt 202
>dbj|AK145608.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0021G14 product:sperm specific antigen 1, full insert sequence Length = 1244 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||| Sbjct: 264 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 205 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 204 cctttccgaagctgcttgtagtt 182
>dbj|AK168930.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched library, clone:I920065L05 product:sperm specific antigen 1, full insert sequence Length = 1210 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||| Sbjct: 235 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 176 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 175 cctttccgaagctgcttgtagtt 153
>dbj|AK168808.1| Mus musculus 17 days embryo stomach cDNA, RIKEN full-length enriched library, clone:I920056H18 product:NHP2-like protein 1 (High mobility group-like nuclear protein 2 homolog 1) ([U4/U6.U5] tri-snRNP 15.5 kDa protein) (OTK27) homolog [Homo sapiens], full insert sequence Length = 836 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||| Sbjct: 252 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 193 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 192 cctttccgaagctgcttgtagtt 170
>dbj|AK169103.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920080B21 product:sperm specific antigen 1, full insert sequence Length = 1247 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||| Sbjct: 266 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 207 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 206 cctttccgaagctgcttgtagtt 184
>gb|AC153579.10| Mus musculus 6 BAC RP23-21F2 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 228481 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || ||||||||||| ||| | ||||| ||||| Sbjct: 83437 gctgccatcacaatgaactcagagatgcctctgttgagagttttgctggcttcactggct 83378 Query: 521 cccttcttgagctgcttgtagtt 543 || |||| |||||||||||||| Sbjct: 83377 cctttctgaagctgcttgtagtt 83355
>gb|AC156559.3| Mus musculus BAC clone RP24-421K17 from chromosome 13, complete sequence Length = 151183 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Plus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 |||||| |||| | |||||| || || || ||||||||||| ||||| ||||| |||||| Sbjct: 65709 gctgccttcacaatgaactcagagatgcctctgttgagagttttggtggcttcattggct 65768 Query: 521 cccttcttgagctgcttgtagtt 543 || |||| |||| ||||||||| Sbjct: 65769 cctttctgaagcttcttgtagtt 65791
>dbj|AK004489.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1190005A22 product:sperm specific antigen 1, full insert sequence Length = 1210 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||| Sbjct: 230 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 171 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 170 cctttccgaagctgcttgtagtt 148
>gb|AC127070.10| Homo sapiens 12 BAC RP11-46H11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 181012 Score = 54.0 bits (27), Expect = 5e-04 Identities = 78/95 (82%) Strand = Plus / Plus Query: 449 ggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttggtc 508 ||||| ||||| || |||||||| | |||||| || || |||||||| || || ||||| Sbjct: 49648 ggctcggtgtctgcagccatcacgatgaactcagagatgcccctgttaagggttttggtg 49707 Query: 509 gcttcgttggctcccttcttgagctgcttgtagtt 543 || |||||||||| |||| |||||||||||||| Sbjct: 49708 gcctcgttggctcttttctgaagctgcttgtagtt 49742
>emb|CT030635.8| Mouse DNA sequence from clone RP23-94N7 on chromosome 9, complete sequence Length = 228508 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||| Sbjct: 209844 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 209785 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 209784 cctttccgaagctgcttgtagtt 209762
>ref|NM_212515.1| Rattus norvegicus similar to NHP2-like protein 1 (High mobility group-like nuclear protein 2 homolog 1) ([U4/U6.U5] tri-snRNP 15.5 kDa protein) (OTK27) (MGC72932), mRNA Length = 635 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||||| || ||||| ||||| |||||| Sbjct: 287 gctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggct 228 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 227 cctttccgaagctgcttgtagtt 205
>gb|BC061279.1| Xenopus tropicalis hypothetical protein MGC75724, mRNA (cDNA clone MGC:75724 IMAGE:5380980), complete cds Length = 848 Score = 52.0 bits (26), Expect = 0.002 Identities = 77/94 (81%) Strand = Plus / Minus Query: 318 tggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgct 377 |||| |||| ||||||||| || ||||||| ||||||||||| | ||||| ||||||| Sbjct: 421 tggtgactgcacaagcaatcactggcctagagactccacaagctcttccaagtgcttgct 362 Query: 378 ttgaagggacaaagacatacggcacattcttgtc 411 | || | ||||| ||||| || ||||||||||| Sbjct: 361 tggagcgcacaaacacataggggacattcttgtc 328
>gb|BC066453.1| Danio rerio zgc:56066, mRNA (cDNA clone MGC:77417 IMAGE:6970302), complete cds Length = 1786 Score = 52.0 bits (26), Expect = 0.002 Identities = 89/110 (80%) Strand = Plus / Minus Query: 446 agcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttg 505 |||||||| | ||| || |||||||| | |||||| || ||||||| ||| || || || Sbjct: 334 agcggctctgcgtcggccgccatcacgatgaactctgagattccccggttcagggtttta 275 Query: 506 gtcgcttcgttggctcccttcttgagctgcttgtagttggcggcctgctg 555 || ||||||||||| || ||| | ||||| ||||| ||||| |||||||| Sbjct: 274 gtggcttcgttggcccctttcctcagctgtttgtaattggctgcctgctg 225
>ref|XM_365765.1| Magnaporthe grisea 70-15 hypothetical protein (MG02467.4) partial mRNA Length = 381 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 497 agagtcttggtcgcttcgttggctcccttcttgagctg 534 ||||||||||| || ||||||||||||||||| ||||| Sbjct: 131 agagtcttggtagcctcgttggctcccttcttcagctg 94
>ref|XM_860169.1| PREDICTED: Canis familiaris similar to NHP2-like protein 1 (High mobility group-like nuclear protein 2 homolog 1) ([U4/U6.U5] tri-snRNP 15.5 kDa protein) (Sperm specific antigen 1) (Fertilization antigen 1) (FA-1), transcript variant 2 (LOC609886), mRNA Length = 1394 Score = 52.0 bits (26), Expect = 0.002 Identities = 170/218 (77%) Strand = Plus / Minus Query: 326 gaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaaggg 385 ||||| |||||||| ||||| | ||| ||||| || ||||| ||||| ||||| || | Sbjct: 350 gaacaggcaatgacaggcctggacaccccacaggcccgcccgagggcctgcttggagcgc 291 Query: 386 acaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcg 445 ||||| || || ||||| ||||| || || |||| ||| ||||| |||| |||||| Sbjct: 290 acaaacacgtagggcacgttcttatcttcacacagcagcggaaggtgcaggatgatttcc 231 Query: 446 agcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttg 505 || |||| | ||| || |||||||| | |||||| || || || |||||||| || || Sbjct: 230 agaggcttagcgtctgcagccatcacgatgaactcagagatgcctctgttgagggtttta 171 Query: 506 gtcgcttcgttggctcccttcttgagctgcttgtagtt 543 || |||||||||||||| ||| |||||||||||||| Sbjct: 170 gtggcttcgttggctcctttccgaagctgcttgtagtt 133
>ref|XM_847115.1| PREDICTED: Canis familiaris similar to NHP2-like protein 1 (High mobility group-like nuclear protein 2 homolog 1) ([U4/U6.U5] tri-snRNP 15.5 kDa protein) (Sperm specific antigen 1) (Fertilization antigen 1) (FA-1), transcript variant 1 (LOC609886), mRNA Length = 735 Score = 52.0 bits (26), Expect = 0.002 Identities = 170/218 (77%) Strand = Plus / Minus Query: 326 gaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaaggg 385 ||||| |||||||| ||||| | ||| ||||| || ||||| ||||| ||||| || | Sbjct: 322 gaacaggcaatgacaggcctggacaccccacaggcccgcccgagggcctgcttggagcgc 263 Query: 386 acaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcg 445 ||||| || || ||||| ||||| || || |||| ||| ||||| |||| |||||| Sbjct: 262 acaaacacgtagggcacgttcttatcttcacacagcagcggaaggtgcaggatgatttcc 203 Query: 446 agcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttg 505 || |||| | ||| || |||||||| | |||||| || || || |||||||| || || Sbjct: 202 agaggcttagcgtctgcagccatcacgatgaactcagagatgcctctgttgagggtttta 143 Query: 506 gtcgcttcgttggctcccttcttgagctgcttgtagtt 543 || |||||||||||||| ||| |||||||||||||| Sbjct: 142 gtggcttcgttggctcctttccgaagctgcttgtagtt 105
>ref|XR_004088.1| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome protein 2-like 1 (LOC636276), mRNA Length = 1155 Score = 52.0 bits (26), Expect = 0.002 Identities = 68/82 (82%) Strand = Plus / Minus Query: 462 ctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctc 521 |||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||| Sbjct: 172 ctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggctc 113 Query: 522 ccttcttgagctgcttgtagtt 543 | ||| |||||||||||||| Sbjct: 112 ctttccgaagctgcttgtagtt 91
>emb|AL161557.2|ATCHRIV57 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 57 Length = 199577 Score = 52.0 bits (26), Expect = 0.002 Identities = 71/86 (82%) Strand = Plus / Plus Query: 458 tcagctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttg 517 ||||| ||||| || |||||||| || ||||| | ||| | || ||||| ||||| || Sbjct: 49454 tcagcagccataacaacgaactcagagattccacggttcaatgttttggtagcttcatta 49513 Query: 518 gctcccttcttgagctgcttgtagtt 543 ||||||||||| |||||||||||||| Sbjct: 49514 gctcccttcttaagctgcttgtagtt 49539 Score = 40.1 bits (20), Expect = 8.1 Identities = 71/88 (80%) Strand = Plus / Plus Query: 320 gtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgcttt 379 ||||||||||||||||| || || || || |||||||| || | || | ||||| || Sbjct: 48821 gtcactgaacaagcaataacaggtcttgttactccacatgctcttcccaatgcttgtttc 48880 Query: 380 gaagggacaaagacatacggcacattct 407 ||||| ||||| ||||| |||||||||| Sbjct: 48881 gaaggtacaaacacatatggcacattct 48908
>emb|AL033545.2|ATF7K2 Arabidopsis thaliana DNA chromosome 4, BAC clone F7K2 (ESSA project) Length = 106702 Score = 52.0 bits (26), Expect = 0.002 Identities = 71/86 (82%) Strand = Plus / Plus Query: 458 tcagctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttg 517 ||||| ||||| || |||||||| || ||||| | ||| | || ||||| ||||| || Sbjct: 646 tcagcagccataacaacgaactcagagattccacggttcaatgttttggtagcttcatta 705 Query: 518 gctcccttcttgagctgcttgtagtt 543 ||||||||||| |||||||||||||| Sbjct: 706 gctcccttcttaagctgcttgtagtt 731 Score = 40.1 bits (20), Expect = 8.1 Identities = 71/88 (80%) Strand = Plus / Plus Query: 320 gtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgcttt 379 ||||||||||||||||| || || || || |||||||| || | || | ||||| || Sbjct: 13 gtcactgaacaagcaataacaggtcttgttactccacatgctcttcccaatgcttgtttc 72 Query: 380 gaagggacaaagacatacggcacattct 407 ||||| ||||| ||||| |||||||||| Sbjct: 73 gaaggtacaaacacatatggcacattct 100
>ref|XM_697178.1| PREDICTED: Danio rerio hypothetical protein LOC554671 (LOC554671), mRNA Length = 1702 Score = 52.0 bits (26), Expect = 0.002 Identities = 89/110 (80%) Strand = Plus / Minus Query: 446 agcggctccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttg 505 |||||||| | ||| || |||||||| | |||||| || ||||||| ||| || || || Sbjct: 332 agcggctctgcgtcggccgccatcacgatgaactctgagattccccggttcagggtttta 273 Query: 506 gtcgcttcgttggctcccttcttgagctgcttgtagttggcggcctgctg 555 || ||||||||||| || ||| | ||||| ||||| ||||| |||||||| Sbjct: 272 gtggcttcgttggcccctttcctcagctgtttgtaattggctgcctgctg 223
>ref|NM_203663.1| Xenopus tropicalis hypothetical protein MGC75724 (MGC75724), mRNA Length = 848 Score = 52.0 bits (26), Expect = 0.002 Identities = 77/94 (81%) Strand = Plus / Minus Query: 318 tggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgct 377 |||| |||| ||||||||| || ||||||| ||||||||||| | ||||| ||||||| Sbjct: 421 tggtgactgcacaagcaatcactggcctagagactccacaagctcttccaagtgcttgct 362 Query: 378 ttgaagggacaaagacatacggcacattcttgtc 411 | || | ||||| ||||| || ||||||||||| Sbjct: 361 tggagcgcacaaacacataggggacattcttgtc 328
>emb|CR760372.2| Xenopus tropicalis finished cDNA, clone TNeu005n20 Length = 789 Score = 52.0 bits (26), Expect = 0.002 Identities = 77/94 (81%) Strand = Plus / Minus Query: 318 tggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgct 377 |||| |||| ||||||||| || ||||||| ||||||||||| | ||||| ||||||| Sbjct: 377 tggtgactgcacaagcaatcactggcctagagactccacaagctcttccaagtgcttgct 318 Query: 378 ttgaagggacaaagacatacggcacattcttgtc 411 | || | ||||| ||||| || ||||||||||| Sbjct: 317 tggagcgcacaaacacataggggacattcttgtc 284
>emb|CR761482.2| Xenopus tropicalis finished cDNA, clone TGas123b15 Length = 808 Score = 52.0 bits (26), Expect = 0.002 Identities = 77/94 (81%) Strand = Plus / Minus Query: 318 tggtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgct 377 |||| |||| ||||||||| || ||||||| ||||||||||| | ||||| ||||||| Sbjct: 377 tggtgactgcacaagcaatcactggcctagagactccacaagctcttccaagtgcttgct 318 Query: 378 ttgaagggacaaagacatacggcacattcttgtc 411 | || | ||||| ||||| || ||||||||||| Sbjct: 317 tggagcgcacaaacacataggggacattcttgtc 284
>emb|AL929165.9| Mouse DNA sequence from clone RP23-446D4 on chromosome 2, complete sequence Length = 181326 Score = 52.0 bits (26), Expect = 0.002 Identities = 68/82 (82%) Strand = Plus / Plus Query: 462 ctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctc 521 |||||||||| | |||||| || || || |||||||| || ||||| ||||| ||||||| Sbjct: 39855 ctgccatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggctc 39914 Query: 522 ccttcttgagctgcttgtagtt 543 | ||| |||||||||||||| Sbjct: 39915 ctttccgaagctgcttgtagtt 39936
>ref|NM_117330.2| Arabidopsis thaliana RNA binding / structural constituent of ribosome AT4G12600 mRNA, complete cds Length = 754 Score = 48.1 bits (24), Expect = 0.033 Identities = 39/44 (88%) Strand = Plus / Minus Query: 365 ccaagggcttgctttgaagggacaaagacatacggcacattctt 408 ||||||||||| || || || ||||| ||||||||||||||||| Sbjct: 363 ccaagggcttgtttcgatggcacaaacacatacggcacattctt 320
>gb|AF361618.1| Arabidopsis thaliana AT4g12600/T1P17_190 mRNA, complete cds Length = 679 Score = 48.1 bits (24), Expect = 0.033 Identities = 39/44 (88%) Strand = Plus / Minus Query: 365 ccaagggcttgctttgaagggacaaagacatacggcacattctt 408 ||||||||||| || || || ||||| ||||||||||||||||| Sbjct: 339 ccaagggcttgtttcgatggcacaaacacatacggcacattctt 296
>gb|AY055095.1| Arabidopsis thaliana AT4g12600/T1P17_190 mRNA, complete cds Length = 387 Score = 48.1 bits (24), Expect = 0.033 Identities = 39/44 (88%) Strand = Plus / Minus Query: 365 ccaagggcttgctttgaagggacaaagacatacggcacattctt 408 ||||||||||| || || || ||||| ||||||||||||||||| Sbjct: 269 ccaagggcttgtttcgatggcacaaacacatacggcacattctt 226
>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V, complete sequence Length = 1519138 Score = 48.1 bits (24), Expect = 0.033 Identities = 30/32 (93%) Strand = Plus / Minus Query: 497 agagtcttggtcgcttcgttggctcccttctt 528 |||||||||||||| |||||||| |||||||| Sbjct: 497967 agagtcttggtcgcctcgttggcacccttctt 497936
>gb|AY087261.1| Arabidopsis thaliana clone 33381 mRNA, complete sequence Length = 715 Score = 48.1 bits (24), Expect = 0.033 Identities = 39/44 (88%) Strand = Plus / Minus Query: 365 ccaagggcttgctttgaagggacaaagacatacggcacattctt 408 ||||||||||| || || || ||||| ||||||||||||||||| Sbjct: 363 ccaagggcttgtttcgatggcacaaacacatacggcacattctt 320
>ref|NM_210145.1| Eremothecium gossypii AEL070Wp (AEL070W), mRNA Length = 384 Score = 48.1 bits (24), Expect = 0.033 Identities = 30/32 (93%) Strand = Plus / Minus Query: 497 agagtcttggtcgcttcgttggctcccttctt 528 |||||||||||||| |||||||| |||||||| Sbjct: 134 agagtcttggtcgcctcgttggcacccttctt 103
>ref|XM_924350.2| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome protein 2-like 1, transcript variant 2 (LOC637555), mRNA Length = 1274 Score = 46.1 bits (23), Expect = 0.13 Identities = 68/83 (81%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | ||||| || || || |||||||| || ||||| ||||| |||||| Sbjct: 282 gctgccatcacaattaactcagagatgcctctgttgagggttttggtggcttcattggct 223 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 222 cctttccgaagctgcttgtagtt 200
>ref|XR_004053.1| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome protein 2-like 1 (LOC672066), mRNA Length = 836 Score = 46.1 bits (23), Expect = 0.13 Identities = 68/83 (81%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||| | || ||||| ||||| |||||| Sbjct: 173 gctgccatcacaatgaactcagagatgcctctgttgggggttttggtggcttcattggct 114 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 113 cctttccgaagctgcttgtagtt 91
>ref|XM_001003565.1| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome protein 2-like 1 (LOC667539), mRNA Length = 897 Score = 46.1 bits (23), Expect = 0.13 Identities = 68/83 (81%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||| | || ||||| ||||| |||||| Sbjct: 173 gctgccatcacaatgaactcagagatgcctctgttgggggttttggtggcttcattggct 114 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 113 cctttccgaagctgcttgtagtt 91
>ref|XM_910204.2| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome protein 2-like 1 (LOC633304), mRNA Length = 897 Score = 46.1 bits (23), Expect = 0.13 Identities = 68/83 (81%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||| | || ||||| ||||| |||||| Sbjct: 173 gctgccatcacaatgaactcagagatgcctctgttgggggttttggtggcttcattggct 114 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 113 cctttccgaagctgcttgtagtt 91
>ref|XM_799370.1| Trypanosoma cruzi strain CL Brener ribosomal protein S6 (Tc00.1047053509943.30) partial mRNA Length = 381 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Minus Query: 380 gaagggacaaagacatacggcacattcttgtcctc 414 ||||| ||||| ||||||||||| ||||||||||| Sbjct: 251 gaaggcacaaaaacatacggcacgttcttgtcctc 217
>gb|AC133193.3| Mus musculus BAC clone RP23-396L1 from chromosome 2, complete sequence Length = 180931 Score = 46.1 bits (23), Expect = 0.13 Identities = 68/83 (81%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||| | || ||||| ||||| |||||| Sbjct: 64064 gctgccatcacaatgaactcagagatgcctctgttgggggttttggtggcttcattggct 64005 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 64004 cctttccgaagctgcttgtagtt 63982
>ref|XM_815179.1| Trypanosoma cruzi strain CL Brener ribosomal protein S6 (Tc00.1047053508277.120) partial mRNA Length = 381 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Minus Query: 380 gaagggacaaagacatacggcacattcttgtcctc 414 ||||| ||||| ||||||||||| ||||||||||| Sbjct: 251 gaaggcacaaaaacatacggcacgttcttgtcctc 217
>ref|XM_970157.1| PREDICTED: Tribolium castaneum similar to Nhp2 non-histone chromosome protein 2-like 1 (LOC664143), mRNA Length = 405 Score = 46.1 bits (23), Expect = 0.13 Identities = 68/83 (81%) Strand = Plus / Minus Query: 329 caagcaatgaccggcctagtcactccacaagcacgcccaagggcttgctttgaagggaca 388 ||||||||||||| ||| | || |||||||| ||||| || || || || || |||| Sbjct: 323 caagcaatgaccgaccttgagacgccacaagcgcgccccagtgcctgtttcgagcggacg 264 Query: 389 aagacatacggcacattcttgtc 411 || |||||||||||||||||||| Sbjct: 263 aaaacatacggcacattcttgtc 241
>emb|AL161534.2|ATCHRIV34 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 34 Length = 196107 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 365 ccaagggcttgctttgaagggacaaagacatacggcacattct 407 ||||||||||| || || || ||||| |||||||||||||||| Sbjct: 126217 ccaagggcttgtttcgatggcacaaacacatacggcacattct 126175
>emb|AL049730.2|ATT1P17 Arabidopsis thaliana DNA chromosome 4, BAC clone T1P17 (ESSA project) Length = 137519 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 365 ccaagggcttgctttgaagggacaaagacatacggcacattct 407 ||||||||||| || || || ||||| |||||||||||||||| Sbjct: 121685 ccaagggcttgtttcgatggcacaaacacatacggcacattct 121643
>ref|XM_345321.2| PREDICTED: Rattus norvegicus similar to NHP2-like protein 1 (High mobility group-like nuclear protein 2 homolog 1) ([U4/U6.U5] tri-snRNP 15.5 kDa protein) (Sperm specific antigen 1) (Fertilization antigen 1) (FA-1) (LOC365987), mRNA Length = 543 Score = 46.1 bits (23), Expect = 0.13 Identities = 68/83 (81%) Strand = Plus / Minus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || | || |||||||| || ||||| ||||| |||||| Sbjct: 380 gctgccatcacaatgaactcagagacacctctgttgagggttttggtggcttcattggct 321 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 320 cctttccgaagctgcttgtagtt 298
>emb|BX284624.4| Mouse DNA sequence from clone RP23-299A2 on chromosome 2, complete sequence Length = 209836 Score = 46.1 bits (23), Expect = 0.13 Identities = 68/83 (81%) Strand = Plus / Plus Query: 461 gctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggct 520 ||||||||||| | |||||| || || || |||||| | || ||||| ||||| |||||| Sbjct: 188827 gctgccatcacaatgaactcagagatgcctctgttgggggttttggtggcttcattggct 188886 Query: 521 cccttcttgagctgcttgtagtt 543 || ||| |||||||||||||| Sbjct: 188887 cctttccgaagctgcttgtagtt 188909
>ref|XM_515161.1| PREDICTED: Pan troglodytes similar to NHP2-like protein 1 (High mobility group-like nuclear protein 2 homolog 1) ([U4/U6.U5] tri-snRNP 15.5 kDa protein) (Sperm specific antigen 1) (Fertilization antigen 1) (FA-1) (LOC458869), mRNA Length = 912 Score = 44.1 bits (22), Expect = 0.52 Identities = 115/146 (78%) Strand = Plus / Minus Query: 398 ggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcgagcggctccgtg 457 |||||||||||||| || |||| ||||||||| || | ||| || || ||||| | | Sbjct: 629 ggcacattcttgtcttcacacagcagcgggaggtgcagaatgatctccagtggctcggcg 570 Query: 458 tcagctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttg 517 || || |||||||| | |||||| || || ||||||||||| || ||||| || || ||| Sbjct: 569 tctgcagccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattg 510 Query: 518 gctcccttcttgagctgcttgtagtt 543 ||||| ||| |||||||| ||||| Sbjct: 509 gctcctttccgaagctgcttatagtt 484
>gb|DQ214255.1| Taeniopygia guttata clone 0061P0016A06 NHP2 non-histone chromosome protein 2-like 1-like mRNA, complete sequence Length = 1118 Score = 44.1 bits (22), Expect = 0.52 Identities = 124/158 (78%) Strand = Plus / Minus Query: 368 agggcttgctttgaagggacaaagacatacggcacattcttgtcctccgcgagcaacggg 427 ||||||||||| || | ||||| ||||| || || ||||||||||| ||| | ||| Sbjct: 296 agggcttgcttggagcgcacaaacacatagggtacgttcttgtcctcgcagagaagaggg 237 Query: 428 aggtggaggaggatttcgagcggctccgtgtcagctgccatcaccacgaactccgatatt 487 ||||| |||| ||| || | ||||||| || ||||||||||| | |||||| | ||| Sbjct: 236 aggtgcaggatgatctccaagggctccgcatctgctgccatcacaatgaactctgctatc 177 Query: 488 cccctgttgagagtcttggtcgcttcgttggctccctt 525 || ||||| || || ||||| ||||| ||||||||||| Sbjct: 176 cctctgttcagtgttttggtggcttcattggctccctt 139
>ref|XM_001005500.1| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome protein 2-like 1 (LOC626361), mRNA Length = 1229 Score = 44.1 bits (22), Expect = 0.52 Identities = 67/82 (81%) Strand = Plus / Minus Query: 462 ctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctc 521 |||| ||||| | |||||| || || || |||||||| || ||||| ||||| ||||||| Sbjct: 237 ctgctatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggctc 178 Query: 522 ccttcttgagctgcttgtagtt 543 | ||| |||||||||||||| Sbjct: 177 ctttccgaagctgcttgtagtt 156
>ref|XM_904370.2| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome protein 2-like 1 (LOC630757), mRNA Length = 1228 Score = 44.1 bits (22), Expect = 0.52 Identities = 67/82 (81%) Strand = Plus / Minus Query: 462 ctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctc 521 |||| ||||| | |||||| || || || |||||||| || ||||| ||||| ||||||| Sbjct: 237 ctgctatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggctc 178 Query: 522 ccttcttgagctgcttgtagtt 543 | ||| |||||||||||||| Sbjct: 177 ctttccgaagctgcttgtagtt 156
>ref|XM_973339.1| PREDICTED: Mus musculus similar to Nhp2 non-histone chromosome protein 2-like 1 (LOC630757), mRNA Length = 1228 Score = 44.1 bits (22), Expect = 0.52 Identities = 67/82 (81%) Strand = Plus / Minus Query: 462 ctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctc 521 |||| ||||| | |||||| || || || |||||||| || ||||| ||||| ||||||| Sbjct: 237 ctgctatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggctc 178 Query: 522 ccttcttgagctgcttgtagtt 543 | ||| |||||||||||||| Sbjct: 177 ctttccgaagctgcttgtagtt 156
>gb|AC124909.3| Equus caballus clone CH241-91H15, complete sequence Length = 171421 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 cataacagtcttgcaaaatata 143 |||||||||||||||||||||| Sbjct: 32531 cataacagtcttgcaaaatata 32552
>ref|XM_317299.2| Anopheles gambiae str. PEST ENSANGP00000010500 (ENSANGG00000008011), partial mRNA Length = 384 Score = 44.1 bits (22), Expect = 0.52 Identities = 79/98 (80%) Strand = Plus / Minus Query: 386 acaaagacatacggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcg 445 ||||| || |||||||||||||||||||| |||| ||| || || || | ||||||| Sbjct: 245 acaaacacgtacggcacattcttgtcctcgcacagcagcggaagatgcagaatgatttcg 186 Query: 446 agcggctccgtgtcagctgccatcaccacgaactccga 483 | |||||||| || || |||||||| | ||||||||| Sbjct: 185 atcggctccgcatccgccgccatcacgatgaactccga 148 Score = 40.1 bits (20), Expect = 8.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 530 agctgcttgtagttggcggcctgctgga 557 ||||||||||||||| | |||||||||| Sbjct: 101 agctgcttgtagttgaccgcctgctgga 74
>emb|CR556713.11| Zebrafish DNA sequence from clone DKEY-28O14 in linkage group 11, complete sequence Length = 229692 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 197 ctgaaaaactgtgtcacacgag 218 |||||||||||||||||||||| Sbjct: 101736 ctgaaaaactgtgtcacacgag 101757
>emb|CT030166.8| Mouse DNA sequence from clone RP23-320I11 on chromosome 13, complete sequence Length = 222942 Score = 44.1 bits (22), Expect = 0.52 Identities = 67/82 (81%) Strand = Plus / Minus Query: 462 ctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctc 521 |||| ||||| | |||||| || || || |||||||| || ||||| ||||| ||||||| Sbjct: 176812 ctgctatcacaatgaactcagagatgcctctgttgagggttttggtggcttcattggctc 176753 Query: 522 ccttcttgagctgcttgtagtt 543 | ||| |||||||||||||| Sbjct: 176752 ctttccgaagctgcttgtagtt 176731
>gb|DP000020.1| Equus caballus target 1 genomic scaffold Length = 1907055 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 122 cataacagtcttgcaaaatata 143 |||||||||||||||||||||| Sbjct: 1045999 cataacagtcttgcaaaatata 1046020
>ref|XM_416225.1| PREDICTED: Gallus gallus similar to NHP2-like protein 1 (High mobility group-like nuclear protein 2 homolog 1) ([U4/U6.U5] tri-snRNP 15.5 kDa protein) (Sperm specific antigen 1) (Fertilization antigen 1) (FA-1) (LOC417986), mRNA Length = 782 Score = 42.1 bits (21), Expect = 2.0 Identities = 66/81 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| | |||||| | ||| || || ||||| |||||||||||||| Sbjct: 233 gccatcacgatgaactctgctattcctcggttcagtgttttggtggcttcgttggctcct 174 Query: 524 ttcttgagctgcttgtagttg 544 || ||||||||||||||| Sbjct: 173 ttgcgtagctgcttgtagttg 153
>ref|XM_976843.1| PREDICTED: Mus musculus hypothetical LOC544888 (LOC544888), mRNA Length = 1406 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 456 tgtcagctgccatcaccacga 476 ||||||||||||||||||||| Sbjct: 191 tgtcagctgccatcaccacga 171
>ref|XM_909635.2| PREDICTED: Mus musculus hypothetical LOC544888 (LOC544888), mRNA Length = 1406 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 456 tgtcagctgccatcaccacga 476 ||||||||||||||||||||| Sbjct: 191 tgtcagctgccatcaccacga 171
>ref|XM_619025.3| PREDICTED: Mus musculus hypothetical LOC544888 (LOC544888), mRNA Length = 1406 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 456 tgtcagctgccatcaccacga 476 ||||||||||||||||||||| Sbjct: 191 tgtcagctgccatcaccacga 171
>gb|DQ014842.1| Uncultured bacterium clone M1_d03_3 16S ribosomal RNA gene, partial sequence Length = 1341 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 544 ggcggcctgctggacgatgtc 564 ||||||||||||||||||||| Sbjct: 693 ggcggcctgctggacgatgtc 713
>emb|AL135751.1|SPAC607 S.pombe chromosome I cosmid c607 Length = 19559 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 386 acaaagacatacggcacattcttgtcctc 414 ||||| ||||| ||||||||||||||||| Sbjct: 3083 acaaaaacataaggcacattcttgtcctc 3111
>emb|BX950527.2| Gallus gallus finished cDNA, clone ChEST568g13 Length = 801 Score = 42.1 bits (21), Expect = 2.0 Identities = 66/81 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| | |||||| | ||| || || ||||| |||||||||||||| Sbjct: 252 gccatcacgatgaactctgctattcctcggttcagtgttttggtggcttcgttggctcct 193 Query: 524 ttcttgagctgcttgtagttg 544 || ||||||||||||||| Sbjct: 192 ttgcgtagctgcttgtagttg 172
>gb|AC160131.2| Mus musculus BAC clone RP23-226D9 from chromosome 12, complete sequence Length = 202807 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 456 tgtcagctgccatcaccacga 476 ||||||||||||||||||||| Sbjct: 126668 tgtcagctgccatcaccacga 126648
>ref|NM_001019023.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPAC607.03c), partial mRNA Length = 378 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Minus Query: 386 acaaagacatacggcacattcttgtcctc 414 ||||| ||||| ||||||||||||||||| Sbjct: 239 acaaaaacataaggcacattcttgtcctc 211
>emb|BX934076.2| Gallus gallus finished cDNA, clone ChEST55d24 Length = 1170 Score = 42.1 bits (21), Expect = 2.0 Identities = 66/81 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| | |||||| | ||| || || ||||| |||||||||||||| Sbjct: 267 gccatcacgatgaactctgctattcctcggttcagtgttttggtggcttcgttggctcct 208 Query: 524 ttcttgagctgcttgtagttg 544 || ||||||||||||||| Sbjct: 207 ttgcgtagctgcttgtagttg 187
>emb|BX932329.2| Gallus gallus finished cDNA, clone ChEST359i7 Length = 818 Score = 42.1 bits (21), Expect = 2.0 Identities = 66/81 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| | |||||| | ||| || || ||||| |||||||||||||| Sbjct: 341 gccatcacgatgaactctgctattcctcggttcagtgttttggtggcttcgttggctcct 282 Query: 524 ttcttgagctgcttgtagttg 544 || ||||||||||||||| Sbjct: 281 ttgcgtagctgcttgtagttg 261
>emb|BX931143.2| Gallus gallus finished cDNA, clone ChEST203b22 Length = 723 Score = 42.1 bits (21), Expect = 2.0 Identities = 66/81 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| | |||||| | ||| || || ||||| |||||||||||||| Sbjct: 246 gccatcacgatgaactctgctattcctcggttcagtgttttggtggcttcgttggctcct 187 Query: 524 ttcttgagctgcttgtagttg 544 || ||||||||||||||| Sbjct: 186 ttgcgtagctgcttgtagttg 166
>emb|CR352576.1| Gallus gallus finished cDNA, clone ChEST831m24 Length = 727 Score = 42.1 bits (21), Expect = 2.0 Identities = 66/81 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| | |||||| | ||| || || ||||| |||||||||||||| Sbjct: 250 gccatcacgatgaactctgctattcctcggttcagtgttttggtggcttcgttggctcct 191 Query: 524 ttcttgagctgcttgtagttg 544 || ||||||||||||||| Sbjct: 190 ttgcgtagctgcttgtagttg 170
>gb|AY950656.1| Acanthamoeba castellanii snu13p-like mRNA, complete cds Length = 619 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Minus Query: 530 agctgcttgtagttggcggcctgctggac 558 |||||||||||||||| ||||||||||| Sbjct: 227 agctgcttgtagttggtcgcctgctggac 199
>gb|AC007970.3| Homo sapiens BAC clone RP11-485G2 from 2, complete sequence Length = 138890 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 gagtccagggagaaaattcaa 44 ||||||||||||||||||||| Sbjct: 29819 gagtccagggagaaaattcaa 29839
>emb|BX936171.1| Gallus gallus finished cDNA, clone ChEST145m8 Length = 1144 Score = 42.1 bits (21), Expect = 2.0 Identities = 66/81 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| | |||||| | ||| || || ||||| |||||||||||||| Sbjct: 241 gccatcacgatgaactctgctattcctcggttcagtgttttggtggcttcgttggctcct 182 Query: 524 ttcttgagctgcttgtagttg 544 || ||||||||||||||| Sbjct: 181 ttgcgtagctgcttgtagttg 161
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 542 ttggcggcctgctggacgatgtcga 566 ||||||||||||||| ||||||||| Sbjct: 1971230 ttggcggcctgctgggcgatgtcga 1971206
>gb|AF087136.1|AF087136 Schizosaccharomyces pombe SNU13 snRNP subunit homolog (snu13) gene, complete cds Length = 725 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Minus Query: 386 acaaagacatacggcacattcttgtcctc 414 ||||| ||||| ||||||||||||||||| Sbjct: 442 acaaaaacataaggcacattcttgtcctc 414
>gb|U95114.1|MMU95114 Mus musculus fertilization antigen-1 mRNA, complete cds Length = 642 Score = 42.1 bits (21), Expect = 2.0 Identities = 45/53 (84%) Strand = Plus / Minus Query: 491 ctgttgagagtcttggtcgcttcgttggctcccttcttgagctgcttgtagtt 543 |||||||| || ||||| ||||| |||||||| ||| |||||||||||||| Sbjct: 224 ctgttgagggttttggtggcttcattggctcctttccgaagctgcttgtagtt 172
>gb|AE017347.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 7, complete sequence Length = 1347793 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 cccttcttgagctgcttgta 540 |||||||||||||||||||| Sbjct: 435028 cccttcttgagctgcttgta 435047
>gb|AE013216.1| Thermoanaerobacter tengcongensis MB4, section 243 of 244 of the complete genome Length = 10099 Score = 40.1 bits (20), Expect = 8.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 90 aagatggcagacataatggcagca 113 ||||||||||||||||| |||||| Sbjct: 588 aagatggcagacataattgcagca 611
>ref|XM_389646.1| Gibberella zeae PH-1 chromosome 4 predicted protein (FG09470.1) partial mRNA Length = 1089 Score = 40.1 bits (20), Expect = 8.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 258 gcttctcgatggcatccttgagac 281 |||||| ||||||||||||||||| Sbjct: 34 gcttcttgatggcatccttgagac 11
>gb|AC147031.2| Pan troglodytes BAC clone RP43-98M7 from 7, complete sequence Length = 175794 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 32 ggagaaaattcaactgccat 51 |||||||||||||||||||| Sbjct: 138572 ggagaaaattcaactgccat 138553
>ref|XM_848546.1| PREDICTED: Canis familiaris similar to NHP2-like protein 1 (High mobility group-like nuclear protein 2 homolog 1) ([U4/U6.U5] tri-snRNP 15.5 kDa protein) (Sperm specific antigen 1) (Fertilization antigen 1) (FA-1) (LOC610953), mRNA Length = 397 Score = 40.1 bits (20), Expect = 8.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 491 ctgttgagagtcttggtcgcttcgttggctcc 522 |||||||| || ||||| |||||||||||||| Sbjct: 152 ctgttgagggttttggtggcttcgttggctcc 121
>gb|AC004911.1| Homo sapiens PAC clone RP5-870F17 from 7, complete sequence Length = 155382 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 105 atggcagcatgatttaacat 124 |||||||||||||||||||| Sbjct: 151798 atggcagcatgatttaacat 151779
>emb|AL591916.8| Human DNA sequence from clone RP11-168B8 on chromosome 1 Contains the 5' end of a novel gene (FLJ36179), complete sequence Length = 159159 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 tcttgagtccagggagaaaa 39 |||||||||||||||||||| Sbjct: 16045 tcttgagtccagggagaaaa 16026
>emb|AL353661.41| Human DNA sequence from clone RP3-445O1 on chromosome 6, complete sequence Length = 61334 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 260 ttctcgatggcatccttgag 279 |||||||||||||||||||| Sbjct: 15632 ttctcgatggcatccttgag 15613
>emb|CR541725.1| Homo sapiens full open reading frame cDNA clone RZPDo834A1029D for gene NHP2L1, NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae); complete cds, incl. stopcodon Length = 387 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 170 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 111 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 110 ttccgaagctgcttatagtt 91
>gb|AY991238.1| Uncultured bacterium clone C13_O06 16S ribosomal RNA gene, partial sequence Length = 1283 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 541 gttggcggcctgctggacga 560 |||||||||||||||||||| Sbjct: 654 gttggcggcctgctggacga 673
>emb|AL021712.2|ATT10I14 Arabidopsis thaliana DNA chromosome 4, BAC clone T10I14 (ESSA project) Length = 82891 Score = 40.1 bits (20), Expect = 8.1 Identities = 71/88 (80%) Strand = Plus / Plus Query: 320 gtcactgaacaagcaatgaccggcctagtcactccacaagcacgcccaagggcttgcttt 379 ||||||||||||||||| || || || || |||||||| || | || | ||||| || Sbjct: 82726 gtcactgaacaagcaataacaggtcttgttactccacatgctcttcccaatgcttgtttc 82785 Query: 380 gaagggacaaagacatacggcacattct 407 ||||| ||||| ||||| |||||||||| Sbjct: 82786 gaaggtacaaacacatatggcacattct 82813
>emb|AJ292371.1|EMU292371 Echinococcus multilocularis mRNA for putative high mobility group-like nuclear protein 2 (hmg2 gene) Length = 483 Score = 40.1 bits (20), Expect = 8.1 Identities = 38/44 (86%) Strand = Plus / Minus Query: 497 agagtcttggtcgcttcgttggctcccttcttgagctgcttgta 540 |||| |||||| || || ||||| ||||| |||||||||||||| Sbjct: 167 agagccttggtagcctcattggcaccctttttgagctgcttgta 124
>gb|BC095439.1| Homo sapiens NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae), transcript variant 1, mRNA (cDNA clone MGC:111142 IMAGE:30719732), complete cds Length = 1499 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 252 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 193 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 192 ttccgaagctgcttatagtt 173
>gb|AC069079.11| Homo sapiens chromosome 10 clone RP11-539E19, complete sequence Length = 216006 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 140 tatagctgaaaaacataaaa 159 |||||||||||||||||||| Sbjct: 154314 tatagctgaaaaacataaaa 154333
>gb|AC099063.2| Homo sapiens chromosome 1 clone RP4-620F22, complete sequence Length = 110724 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 482 gatattcccctgttgagagt 501 |||||||||||||||||||| Sbjct: 13547 gatattcccctgttgagagt 13566
>ref|NM_005008.2| Homo sapiens NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) (NHP2L1), transcript variant 1, mRNA Length = 1601 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 364 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 305 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 304 ttccgaagctgcttatagtt 285
>ref|NM_001003796.1| Homo sapiens NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) (NHP2L1), transcript variant 2, mRNA Length = 1520 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 283 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 224 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 223 ttccgaagctgcttatagtt 204
>emb|CR623311.1| full-length cDNA clone CS0DE011YM23 of Placenta of Homo sapiens (human) Length = 1382 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 173 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 114 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 113 ttccgaagctgcttatagtt 94
>emb|CR623174.1| full-length cDNA clone CS0DA009YE02 of Neuroblastoma of Homo sapiens (human) Length = 1092 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 208 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 149 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 148 ttccgaagctgcttatagtt 129
>emb|CR616994.1| full-length cDNA clone CS0DK010YK23 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 1366 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 211 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 152 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 151 ttccgaagctgcttatagtt 132
>emb|CR616990.1| full-length cDNA clone CS0DH007YI19 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1413 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 202 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 143 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 142 ttccgaagctgcttatagtt 123
>emb|CR614137.1| full-length cDNA clone CS0DJ005YB10 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 1353 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 173 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 114 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 113 ttccgaagctgcttatagtt 94
>emb|CR613725.1| full-length cDNA clone CS0DC017YM06 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1459 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 251 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 192 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 191 ttccgaagctgcttatagtt 172
>emb|CR612873.1| full-length cDNA clone CS0DC024YJ07 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1659 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 476 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 417 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 416 ttccgaagctgcttatagtt 397
>emb|CR605954.1| full-length cDNA clone CS0DC024YA08 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1626 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 442 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 383 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 382 ttccgaagctgcttatagtt 363
>emb|CR602484.1| full-length cDNA clone CS0DJ008YG20 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 1481 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 267 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 208 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 207 ttccgaagctgcttatagtt 188
>emb|CR600974.1| full-length cDNA clone CS0DB009YP18 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 1358 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 162 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 103 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 102 ttccgaagctgcttatagtt 83
>emb|CR600000.1| full-length cDNA clone CS0DJ012YD12 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 991 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 248 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 189 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 188 ttccgaagctgcttatagtt 169
>emb|CR595064.1| full-length cDNA clone CS0DN001YL05 of Adult brain of Homo sapiens (human) Length = 1349 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 173 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 114 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 113 ttccgaagctgcttatagtt 94
>emb|CR593477.1| full-length cDNA clone CS0DC025YF02 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1424 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 270 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 211 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 210 ttccgaagctgcttatagtt 191
>emb|CR593383.1| full-length cDNA clone CS0DK007YN07 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 1449 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 261 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 202 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 201 ttccgaagctgcttatagtt 182
>emb|CR593004.1| full-length cDNA clone CS0DC023YC02 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1659 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 476 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 417 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 416 ttccgaagctgcttatagtt 397
>emb|CR591470.1| full-length cDNA clone CS0DB003YC24 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 1630 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 434 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 375 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 374 ttccgaagctgcttatagtt 355
>gb|AC012049.8| Homo sapiens chromosome 10 clone RP11-76F22, complete sequence Length = 142656 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 140 tatagctgaaaaacataaaa 159 |||||||||||||||||||| Sbjct: 53447 tatagctgaaaaacataaaa 53466
>ref|NM_079975.2| Drosophila melanogaster hoi-polloi CG3949-RA (hoip), mRNA Length = 570 Score = 40.1 bits (20), Expect = 8.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 494 ttgagagtcttggtcgcttcgttggctccctt 525 ||||| |||||||| || |||||||||||||| Sbjct: 238 ttgagggtcttggtggcctcgttggctccctt 207
>gb|AC022537.8| Homo sapiens chromosome 10 clone RP11-40C11, complete sequence Length = 154939 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 140 tatagctgaaaaacataaaa 159 |||||||||||||||||||| Sbjct: 4433 tatagctgaaaaacataaaa 4452
>dbj|AB169618.1| Macaca fascicularis brain cDNA, clone: QtrA-11204, similar to human NHP2 non-histone chromosome protein 2-like 1 (S.cerevisiae) (NHP2L1), mRNA, RefSeq: NM_005008.1 Length = 1534 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 277 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 218 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 217 ttccgaagctgcttatagtt 198
>gb|BC103317.2| Bos taurus cDNA clone MGC:129115 IMAGE:8122031, complete cds Length = 1438 Score = 40.1 bits (20), Expect = 8.1 Identities = 119/152 (78%) Strand = Plus / Minus Query: 392 acatacggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcgagcggc 451 ||||| ||||| ||||||||||| |||| ||||||||| |||| ||| || | ||| Sbjct: 300 acatagggcacgttcttgtcctcacacagcagcgggaggtgcaggatgatctccaagggc 241 Query: 452 tccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgct 511 |||| || || |||||||| | |||||| || || || |||||||| || ||||| || Sbjct: 240 tccgcatctgcggccatcacaatgaactcagagatgcctctgttgagggttttggtggcc 181 Query: 512 tcgttggctcccttcttgagctgcttgtagtt 543 || |||||||| || |||||||||||||| Sbjct: 180 tcattggctccttttcgaagctgcttgtagtt 149
>ref|NM_001026666.1| Caenorhabditis elegans Glucose-6-Phosphate Isomerase family member (gpi-1) (gpi-1) mRNA, complete cds Length = 1708 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 250 tatgagaagcttctcgatgg 269 |||||||||||||||||||| Sbjct: 923 tatgagaagcttctcgatgg 942
>ref|NM_001026667.1| Caenorhabditis elegans Glucose-6-Phosphate Isomerase family member (gpi-1) (gpi-1) mRNA, complete cds Length = 1914 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 250 tatgagaagcttctcgatgg 269 |||||||||||||||||||| Sbjct: 976 tatgagaagcttctcgatgg 995
>emb|AL115549.1|CNS01CHX Botrytis cinerea strain T4 cDNA library Length = 636 Score = 40.1 bits (20), Expect = 8.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 493 gttgagagtcttggtcgcttcgttggctcccttctt 528 |||||| |||||||| | ||||||||||||||||| Sbjct: 223 gttgagggtcttggtggtctcgttggctcccttctt 188
>gb|AF129858.1|AF129858 Zea mays CENPCB protein (CenpcB) mRNA, partial cds Length = 1495 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 520 tcccttcttgagctgcttgt 539 |||||||||||||||||||| Sbjct: 912 tcccttcttgagctgcttgt 893
>gb|AC007291.24|AC007291 Drosophila melanogaster, chromosome 2L, region 30B-, BAC clone BACR02I05, complete sequence Length = 176075 Score = 40.1 bits (20), Expect = 8.1 Identities = 29/32 (90%) Strand = Plus / Plus Query: 494 ttgagagtcttggtcgcttcgttggctccctt 525 ||||| |||||||| || |||||||||||||| Sbjct: 120131 ttgagggtcttggtggcctcgttggctccctt 120162
>gb|BC019282.2| Homo sapiens NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae), mRNA (cDNA clone IMAGE:2823291), partial cds Length = 1408 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 171 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 112 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 111 ttccgaagctgcttatagtt 92
>gb|AC104809.5| Homo sapiens BAC clone RP11-637O3 from 2, complete sequence Length = 167196 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 tcttgagtccagggagaaaa 39 |||||||||||||||||||| Sbjct: 117542 tcttgagtccagggagaaaa 117523
>gb|AF208396.1|AF208396 Drosophila melanogaster Hoi-polloi (hoip) mRNA, complete cds Length = 566 Score = 40.1 bits (20), Expect = 8.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 494 ttgagagtcttggtcgcttcgttggctccctt 525 ||||| |||||||| || |||||||||||||| Sbjct: 222 ttgagggtcttggtggcctcgttggctccctt 191
>gb|AF175919.1|AF175919 Drosophila melanogaster hoip[k07104] P element insertion region Length = 394 Score = 40.1 bits (20), Expect = 8.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 494 ttgagagtcttggtcgcttcgttggctccctt 525 ||||| |||||||| || |||||||||||||| Sbjct: 253 ttgagggtcttggtggcctcgttggctccctt 222
>gb|BT003523.1| Drosophila melanogaster RE22964 full insert cDNA Length = 3782 Score = 40.1 bits (20), Expect = 8.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 494 ttgagagtcttggtcgcttcgttggctccctt 525 ||||| |||||||| || |||||||||||||| Sbjct: 238 ttgagggtcttggtggcctcgttggctccctt 207
>ref|XM_234480.3| PREDICTED: Rattus norvegicus similar to RIKEN cDNA A830059I20 (predicted) (LOC299265), mRNA Length = 1213 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 456 tgtcagctgccatcaccacg 475 |||||||||||||||||||| Sbjct: 346 tgtcagctgccatcaccacg 327
>gb|AY893533.1| Synthetic construct Homo sapiens clone FLH130980.01X NHP2 non-histone chromosome protein 2-like 1 (NHP2L1) mRNA, complete cds Length = 387 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 170 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 111 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 110 ttccgaagctgcttatagtt 91
>emb|AL357614.5|HS367B10 Homo sapiens chromosome 9 BAC RP11-367B10, complete sequence Length = 182378 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 132 ttgcaaaatatagctgaaaa 151 |||||||||||||||||||| Sbjct: 127144 ttgcaaaatatagctgaaaa 127125
>gb|AF155235.1|AF155235 Homo sapiens 15.5 kD RNA binding protein mRNA, complete cds Length = 596 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 246 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 187 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 186 ttccgaagctgcttatagtt 167
>gb|AC007257.9|AC007257 Drosophila melanogaster, chromosome 2L, region 30B-, BAC clone BACR24A22, complete sequence Length = 183007 Score = 40.1 bits (20), Expect = 8.1 Identities = 29/32 (90%) Strand = Plus / Plus Query: 494 ttgagagtcttggtcgcttcgttggctccctt 525 ||||| |||||||| || |||||||||||||| Sbjct: 3984 ttgagggtcttggtggcctcgttggctccctt 4015
>emb|CR456531.1| Homo sapiens NHP2L1 full length open reading frame (ORF) cDNA clone (cDNA clone C22ORF:pGEM.NHP2L1) Length = 630 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 199 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 140 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 139 ttccgaagctgcttatagtt 120
>emb|AL110500.1|CEY87G2A Caenorhabditis elegans YAC Y87G2A, complete sequence Length = 123091 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 250 tatgagaagcttctcgatgg 269 |||||||||||||||||||| Sbjct: 88178 tatgagaagcttctcgatgg 88197
>gb|AE003625.3| Drosophila melanogaster chromosome 2L, section 34 of 83 of the complete sequence Length = 271507 Score = 40.1 bits (20), Expect = 8.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 494 ttgagagtcttggtcgcttcgttggctccctt 525 ||||| |||||||| || |||||||||||||| Sbjct: 262721 ttgagggtcttggtggcctcgttggctccctt 262690
>gb|AF091076.1|AF091076 Homo sapiens clone 557 OTK27 mRNA, complete cds Length = 554 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 185 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 126 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 125 ttccgaagctgcttatagtt 106
>gb|AY609481.1| Sus scrofa clone Clu_13005.scr.msk.p1.Contig3, mRNA sequence Length = 1436 Score = 40.1 bits (20), Expect = 8.1 Identities = 119/152 (78%) Strand = Plus / Minus Query: 392 acatacggcacattcttgtcctccgcgagcaacgggaggtggaggaggatttcgagcggc 451 ||||| ||||| ||||||||||| |||| |||||||| |||| || || || ||| Sbjct: 326 acatagggcacgttcttgtcctcacacagcagtgggaggtgcaggataatctccaggggc 267 Query: 452 tccgtgtcagctgccatcaccacgaactccgatattcccctgttgagagtcttggtcgct 511 |||| ||| || |||||||| | |||||| || || || |||||||| || ||||| || Sbjct: 266 tccgcgtctgcagccatcacaatgaactcagagatgcctctgttgagggttttggtggcc 207 Query: 512 tcgttggctcccttcttgagctgcttgtagtt 543 || |||||||| || |||||||||||||| Sbjct: 206 tcattggctccttttcgaagctgcttgtagtt 175
>gb|AC136008.5| Mus musculus BAC clone RP24-68J1 from 6, complete sequence Length = 181220 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 343 cctagtcactccacaagcac 362 |||||||||||||||||||| Sbjct: 141123 cctagtcactccacaagcac 141104
>gb|BC005358.1| Homo sapiens NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae), mRNA (cDNA clone MGC:12461 IMAGE:3681386), complete cds Length = 589 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 221 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 162 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 161 ttccgaagctgcttatagtt 142
>dbj|AP006388.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT39K18, TM0252d, complete sequence Length = 35261 Score = 40.1 bits (20), Expect = 8.1 Identities = 29/32 (90%) Strand = Plus / Plus Query: 449 ggctccgtgtcagctgccatcaccacgaactc 480 ||||| ||||| ||||||||||| |||||||| Sbjct: 29057 ggctcagtgtctgctgccatcacaacgaactc 29088
>dbj|AB036925.1| Citrus unshiu Cit-VATP B-1 gene for vacuolar H+-ATPase B subunit, partial cds Length = 2644 Score = 40.1 bits (20), Expect = 8.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 157 aaagacctagcagacaagacacca 180 |||||||| ||||||||||||||| Sbjct: 686 aaagacctggcagacaagacacca 663
>dbj|D50420.1| Homo sapiens mRNA for OTK27, complete cds Length = 1475 Score = 40.1 bits (20), Expect = 8.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 464 gccatcaccacgaactccgatattcccctgttgagagtcttggtcgcttcgttggctccc 523 |||||||| | |||||| || || ||||||||||| || ||||| || || |||||||| Sbjct: 264 gccatcacgatgaactcagagatgcccctgttgagggttttggtggcctcattggctcct 205 Query: 524 ttcttgagctgcttgtagtt 543 ||| |||||||| ||||| Sbjct: 204 ttccgaagctgcttatagtt 185 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,209,161 Number of Sequences: 3902068 Number of extensions: 5209161 Number of successful extensions: 105270 Number of sequences better than 10.0: 184 Number of HSP's better than 10.0 without gapping: 174 Number of HSP's successfully gapped in prelim test: 10 Number of HSP's that attempted gapping in prelim test: 104622 Number of HSP's gapped (non-prelim): 626 length of query: 592 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 569 effective length of database: 17,143,297,704 effective search space: 9754536393576 effective search space used: 9754536393576 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
