ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd11d23
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X56136.1|HVASPROT Barley mRNA for aspartic proteinase 1193 0.0
2dbj|AB219968.1| Triticum aestivum WAP1 mRNA for aspartic protein... 603 e-169
3dbj|AK104838.1| Oryza sativa (japonica cultivar-group) cDNA clon... 345 1e-91
4dbj|AK103421.1| Oryza sativa (japonica cultivar-group) cDNA clon... 345 1e-91
5dbj|AK100749.1| Oryza sativa (japonica cultivar-group) cDNA clon... 345 1e-91
6dbj|AK098911.1| Oryza sativa (japonica cultivar-group) cDNA clon... 345 1e-91
7dbj|AK098906.1| Oryza sativa (japonica cultivar-group) cDNA clon... 345 1e-91
8dbj|AK067742.1| Oryza sativa (japonica cultivar-group) cDNA clon... 345 1e-91
9dbj|AK066453.1| Oryza sativa (japonica cultivar-group) cDNA clon... 345 1e-91
10dbj|D32144.1|RICAPA Rice mRNA for aspartic protease, complete cds 337 3e-89
11gb|AY112455.1| Zea mays CL6331_1 mRNA sequence 272 1e-69
12gb|BT017963.1| Zea mays clone EL01N0523D02.c mRNA sequence 252 1e-63
13gb|AF285164.1| Oryza sativa subsp. japonica aspartic protease mR... 236 7e-59
14ref|NM_192504.1| Oryza sativa (japonica cultivar-group), predic... 232 1e-57
15dbj|AK072283.1| Oryza sativa (japonica cultivar-group) cDNA clon... 232 1e-57
16dbj|AK072645.1| Oryza sativa (japonica cultivar-group) cDNA clon... 224 3e-55
17gb|AC120986.2| Oryza sativa (japonica cultivar-group) chromosome... 151 3e-33
18dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 151 3e-33
19dbj|D32165.1|RICAP Rice gene for aspartic protease, complete cds 151 3e-33
20dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 119 1e-23
21dbj|AP003284.3| Oryza sativa (japonica cultivar-group) genomic D... 119 1e-23
22dbj|AB002695.1| Pumpkin mRNA for aspartic endopeptidase, complet... 98 4e-17
23emb|AJ313385.1|TCA313385 Theobroma cacao mRNA for aspartic prote... 94 7e-16
24emb|Y09123.1|CCY09123 C.calcitrapa mRNA for aspartic proteinase 68 4e-08
25emb|AJ313384.1|TCA313384 Theobroma cacao mRNA for aspartic prote... 68 4e-08
26gb|L46681.1|TOMAPP Lycopersicon esculentum aspartic protease pre... 66 2e-07
27gb|AY792822.1| Sus scrofa cathepsin D protein mRNA, partial cds 64 6e-07
28dbj|AB219969.1| Triticum aestivum WAP2 mRNA for aspartic protein... 64 6e-07
29gb|DQ018729.1|DQ018728S2 Sus scrofa cathepsin D (CTSD) gene, exo... 64 6e-07
30gb|DQ018727.1| Sus scrofa cathepsin D mRNA, complete cds 64 6e-07
31ref|NM_001037721.1| Sus scrofa cathepsin D (CTSD), mRNA 64 6e-07
32dbj|AB045892.1| Nepenthes alata NaAP2 mRNA for aspartic proteina... 64 6e-07
33ref|NM_205177.1| Gallus gallus cathepsin D (lysosomal aspartyl p... 62 2e-06
34gb|BT020155.1| Homo sapiens cathepsin D (lysosomal aspartyl prot... 62 2e-06
35ref|NM_001909.3| Homo sapiens cathepsin D (lysosomal aspartyl pe... 62 2e-06
36gb|BC001574.1| Homo sapiens cathepsin D (lysosomal aspartyl pept... 62 2e-06
37gb|BC016320.2| Homo sapiens cathepsin D (lysosomal aspartyl pept... 62 2e-06
38emb|X05344.1|HSCATDC Human mRNA for cathepsin D from oestrogen r... 62 2e-06
39emb|CR456947.1| Homo sapiens full open reading frame cDNA clone ... 62 2e-06
40gb|BT007637.1| Synthetic construct Homo sapiens cathepsin D (lys... 62 2e-06
41gb|BT006910.1| Homo sapiens cathepsin D (lysosomal aspartyl prot... 62 2e-06
42emb|CR858646.1| Pongo pygmaeus mRNA; cDNA DKFZp469J0315 (from cl... 62 2e-06
43emb|CR623521.1| full-length cDNA clone CS0DI064YA16 of Placenta ... 62 2e-06
44emb|CR613410.1| full-length cDNA clone CS0DE003YB18 of Placenta ... 62 2e-06
45emb|CR612133.1| full-length cDNA clone CS0DF002YC21 of Fetal bra... 62 2e-06
46emb|CR609839.1| full-length cDNA clone CS0DI057YH09 of Placenta ... 62 2e-06
47emb|CR597228.1| full-length cDNA clone CS0DN004YA05 of Adult bra... 62 2e-06
48dbj|AB169854.1| Macaca fascicularis brain cDNA, clone: QccE-1124... 62 2e-06
49gb|S49650.1| prepro-cathepsin D [chickens, follicles, mRNA, 1448... 62 2e-06
50ref|NM_213873.1| Sus scrofa pepsin (LOC396892), mRNA 62 2e-06
51gb|AC068580.23| Homo sapiens chromosome 11, clone RP11-295K3, co... 62 2e-06
52gb|AY892734.1| Synthetic construct Homo sapiens clone FLH024310.... 62 2e-06
53gb|AY890251.1| Synthetic construct Homo sapiens clone FLH024315.... 62 2e-06
54gb|AY890417.1| Synthetic construct Homo sapiens clone FLH031241.... 62 2e-06
55gb|AY888315.1| Synthetic construct Homo sapiens clone FLH008539.... 62 2e-06
56dbj|AK130178.1| Homo sapiens cDNA FLJ26668 fis, clone MPG03026, ... 62 2e-06
57gb|AY893487.1| Synthetic construct Homo sapiens clone FLH127809.... 62 2e-06
58gb|AY892880.1| Synthetic construct Homo sapiens clone FLH031237.... 62 2e-06
59gb|AC160647.1| Gallus gallus BAC clone CH261-14N23 from chromoso... 62 2e-06
60gb|M11233.1|HUMCTHD Human cathepsin D mRNA, complete cds 62 2e-06
61gb|M63138.1|HUMCATD5 Human cathepsin D (catD) gene, exons 7, 8, ... 62 2e-06
62gb|J04601.1|PIGPEPA Pig pepsinogen A mRNA, complete cds 62 2e-06
63gb|M20920.1|PIGPEP Swine pepsinogen A mRNA, complete cds 62 2e-06
64ref|NM_001025621.1| Canis familiaris cathepsin D (lysosomal aspa... 60 9e-06
65ref|XM_863994.1| PREDICTED: Bos taurus cathepsin D (lysosomal as... 60 9e-06
66ref|XM_609913.2| PREDICTED: Bos taurus cathepsin D (lysosomal as... 60 9e-06
67ref|XM_871709.1| PREDICTED: Bos taurus cathepsin D (lysosomal as... 60 9e-06
68ref|XM_871611.1| PREDICTED: Bos taurus cathepsin D (lysosomal as... 60 9e-06
69ref|XM_871531.1| PREDICTED: Bos taurus cathepsin D (lysosomal as... 60 9e-06
70gb|BT013775.1| Lycopersicon esculentum clone 132663F, mRNA sequence 60 9e-06
71emb|AM048627.1| Canis familiaris mRNA for cathepsin D (ctsd gene) 60 9e-06
72dbj|AB055312.1| Bos taurus cat-D mRNA for cathepsin D, partial cds 60 9e-06
73ref|NM_101062.2| Arabidopsis thaliana aspartic-type endopeptidas... 58 4e-05
74gb|AY063974.1| Arabidopsis thaliana putative aspartic proteinase... 58 4e-05
75gb|AY056403.1| Arabidopsis thaliana At1g11910/F12F1_24 mRNA, com... 58 4e-05
76gb|AY056387.1| Arabidopsis thaliana At1g11910/F12F1_24 mRNA, com... 58 4e-05
77dbj|AK221098.1| Arabidopsis thaliana mRNA for putative aspartic ... 58 4e-05
78dbj|AK221202.1| Arabidopsis thaliana mRNA for putative aspartic ... 58 4e-05
79gb|AY088657.1| Arabidopsis thaliana clone 8972 mRNA, complete se... 58 4e-05
80gb|BT001980.1| Arabidopsis thaliana clone U11602 putative aspart... 58 4e-05
81gb|U51036.1|ATU51036 Arabidopsis thaliana aspartic proteinase mR... 58 4e-05
82gb|AY672651.1| Solanum tuberosum Asp mRNA, complete cds 58 4e-05
83gb|DQ241852.1| Solanum tuberosum clone 188C11 aspartic protease ... 58 4e-05
84emb|CR662614.2|CNS0FA8S Tetraodon nigroviridis full-length cDNA 56 1e-04
85emb|CR660862.2|CNS0F8W4 Tetraodon nigroviridis full-length cDNA 56 1e-04
86emb|X88774.1|BORNAPAP B.oleracea mRNA for putative aspartic prot... 56 1e-04
87gb|U61396.2| Vigna unguiculata aspartic proteinase mRNA, complet... 56 1e-04
88gb|AF082029.1|AF082029 Hemerocallis hybrid cultivar senescence-a... 56 1e-04
89gb|AY389666.1| Hyacinthus orientalis aspartic proteinase mRNA, p... 54 6e-04
90emb|X77260.1|BOASPR B. oleracea L. gene for aspartic protease (p... 54 6e-04
91dbj|AB045891.1| Nepenthes alata NaAP1 mRNA for aspartic proteina... 54 6e-04
92gb|AF156788.1| Pleuronectes americanus pepsinogen A form IIb pre... 52 0.002
93dbj|AB120129.1| Paralichthys olivaceus pep mRNA for pepsinogen, ... 52 0.002
94emb|X81984.1|CCCYPRSN C.cardunculus mRNA for cyprosin 50 0.009
95gb|AY103665.1| Zea mays PCO108960 mRNA sequence 50 0.009
96gb|AY826351.2| Fagopyrum esculentum aspartic proteinase 9 mRNA, ... 48 0.036
97emb|X69193.1|VCCYNA V.cardunculus mRNA for cynarase 48 0.036
98dbj|AB091762.1| Glycine max soyAP4 mRNA for aspartic proteinase ... 48 0.036
99emb|AJ550951.1|TBE550951 Trematomus bernacchii mRNA for pepsin A3 46 0.14
100emb|AJ131678.1|CDR131678 Camelus dromedarius mRNA for pepsin 46 0.14
101dbj|AB089792.1| Oryctolagus cuniculus mRNA for pepsinogen III, c... 46 0.14
102dbj|AB089791.1| Oryctolagus cuniculus mRNA for pepsinogen II-4, ... 46 0.14
103dbj|AB089790.1| Oryctolagus cuniculus mRNA for pepsinogen II-1, ... 46 0.14
104gb|M59237.1|RABPEPIII Rabbit pepsinogen III mRNA, complete cds 46 0.14
105gb|M59235.1|RABPEPII23 Rabbit pepsinogen 11-2/3 mRNA, complete cds 46 0.14
106dbj|AB047245.1| Rhinolophus ferrumequinum pgnA mRNA for pepsinog... 46 0.14
107dbj|AB047244.1| Sorex unguiculatus pgnA mRNA for pepsinogen A, c... 46 0.14
108ref|XM_475576.1| Oryza sativa (japonica cultivar-group), predic... 44 0.56
109gb|BT018637.1| Zea mays clone EL01N0504C03.d mRNA sequence 44 0.56
110ref|XM_545694.2| PREDICTED: Canis familiaris similar to cathepsi... 44 0.56
111gb|AC161241.18| Medicago truncatula clone mth2-193c3, complete s... 44 0.56
112emb|AL450337.24| Human DNA sequence from clone RP11-51B10 on chr... 44 0.56
113emb|AJ579366.1|CRE579366 Chlamydomonas reinhardtii mRNA for aspa... 44 0.56
114gb|AC169788.4| Medicago truncatula clone mth2-28c18, complete se... 44 0.56
115gb|AC134967.20| Medicago truncatula clone mth2-26b8, complete se... 44 0.56
116emb|AJ550949.2|TBE550949 Trematomus bernacchii mRNA for pepsin A1 44 0.56
117emb|AJ550950.1|TBE550950 Trematomus bernacchii partial mRNA for ... 44 0.56
118ref|NM_205054.1| Gallus gallus pepsinogen (LOC395926), mRNA 44 0.56
119gb|AF164143.1|AF164143 Ovis aries cathepsin D (CTSD) mRNA, parti... 44 0.56
120dbj|AK065206.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.56
121gb|AY103982.1| Zea mays PCO140262 mRNA sequence 44 0.56
122dbj|D12777.1|RICASPPRO Oryza sativa (japonica cultivar-group) mR... 44 0.56
123dbj|D00215.1|CHKPSN Gallus gallus mRNA for pepsinogen, complete cds 44 0.56
124dbj|AB028888.1| Oryza sativa RAP mRNA for aspartic proteinase, p... 44 0.56
125dbj|AB047243.1| Suncus murinus pgnA mRNA for pepsinogen A, compl... 44 0.56
126ref|NM_116684.3| Arabidopsis thaliana aspartic-type endopeptidas... 42 2.2
127ref|XM_657624.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 2.2
128gb|AC157650.2| Mus musculus BAC clone RP24-573N21 from chromosom... 42 2.2
129emb|AL603831.23| Human DNA sequence from clone RP11-486H9 on chr... 42 2.2
130emb|AL365502.57| Human DNA sequence from clone RP11-48C7 on chro... 42 2.2
131emb|AL118509.9|HSJ770C23 Human DNA sequence from clone RP4-770C2... 42 2.2
132emb|AJ009838.1|PSI9838 Podarcis sicula mRNA for ovarian Cathepsin D 42 2.2
133emb|AL832856.1|HSM804167 Homo sapiens mRNA; cDNA DKFZp667P1625 (... 42 2.2
134dbj|AK221179.1| Arabidopsis thaliana mRNA for putative aspartic ... 42 2.2
135gb|AF372974.1|AF372974 Arabidopsis thaliana AT4g04460/T26N6_7 mR... 42 2.2
136dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.2
137emb|BX827174.1|CNS0A2UE Arabidopsis thaliana Full-length cDNA Co... 42 2.2
138emb|BX829292.1|CNS0A2OQ Arabidopsis thaliana Full-length cDNA Co... 42 2.2
139dbj|AP005632.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.2
140dbj|AK024443.1| Homo sapiens mRNA for FLJ00033 protein, partial cds 42 2.2
141gb|AY961419.1| Phytophthora infestans clone PB005D3 aspartic pro... 42 2.2
142gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome 42 2.2
143gb|AF036319.1|AF036319 Sparus aurata cathepsin D mRNA, complete cds 42 2.2
144gb|AE017139.1| Yersinia pestis biovar Medievalis str. 91001 sect... 40 8.7
145gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome 40 8.7
146gb|AE009952.1| Yersinia pestis KIM, complete genome 40 8.7
147gb|AY168570.1| Leishmania tarentolae 6-phosphogluconate dehydrog... 40 8.7
148gb|AC005105.3| Homo sapiens BAC clone CTA-491N20 from 7, complet... 40 8.7
149gb|AY528719.1| Homo sapiens estrogen-related receptor gamma (ESR... 40 8.7
150emb|CT009567.9| Mouse DNA sequence from clone RP23-50H13 on chro... 40 8.7
151gb|AC123938.3| Mus musculus BAC clone RP23-412I12 from chromosom... 40 8.7
152gb|AC122434.2| Mus musculus BAC clone RP24-198G2 from chromosome... 40 8.7
153emb|AL389888.8| Human DNA sequence from clone RP11-389K14 on chr... 40 8.7
154gb|AC102705.10| Mus musculus, clone RP24-400C16, complete sequence 40 8.7
155emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, comp... 40 8.7
156emb|AJ414160.1| Yersinia pestis strain CO92 complete genome; seg... 40 8.7
157gb|AC092211.7| Oryza sativa chromosome 10 P0031G09 genomic sequ... 40 8.7
158gb|AC153567.6| Mus musculus 10 BAC RP23-187C5 (Roswell Park Canc... 40 8.7
159gb|AF149806.1| Oryza sativa hypothetical protein, fertilin alpha... 40 8.7
160gb|AC096635.2| Homo sapiens chromosome 1 clone RP11-75H16, compl... 40 8.7
161dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
162dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
163emb|AL662997.3|OSJN00205 Oryza sativa genomic DNA, chromosome 4,... 40 8.7
164gb|AC159380.8| Mus musculus 10 BAC RP24-460M18 (Roswell Park Can... 40 8.7
165dbj|AB080684.1| Xenopus laevis CE1 mRNA for cathepsin E1, comple... 40 8.7
166dbj|AB179551.1| Takifugu rubripes NTS mRNA for nothepsin, comple... 40 8.7
167dbj|AB179548.1| Takifugu rubripes CTSD1 mRNA for cathepsin D1, c... 40 8.7
168gb|AC154228.1| Mus musculus BAC clone RP24-143I4 from chromosome... 40 8.7
169dbj|AP001129.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
170dbj|AB091763.1| Glycine max soyAP5 mRNA for aspartic proteinase ... 40 8.7
171dbj|AB069959.1| Glycine max soyAP1 mRNA for aspartic proteinase ... 40 8.7
172dbj|AB028607.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 8.7
173gb|AC102466.11| Mus musculus chromosome 3, clone RP24-337A2, com... 40 8.7
174gb|AC107453.14| Mus musculus chromosome 15, clone RP23-315F3, co... 40 8.7
175gb|AC002131.1|F12F1 Arabidopsis thaliana chromosome 1 BAC F12F1 ... 40 8.7
176gb|U55032.1|BNU55032 Brassica napus aspartic protease gene, comp... 40 8.7
177emb|AL844486.12| Mouse DNA sequence from clone RP23-249P4 on chr... 40 8.7

>emb|X56136.1|HVASPROT Barley mRNA for aspartic proteinase
          Length = 1800

 Score = 1193 bits (602), Expect = 0.0
 Identities = 602/602 (100%)
 Strand = Plus / Minus

                                                                        
Query: 40   actagaaggcaaacgttgtttatcacatactaattcgacaacatcttaggggcaaacgtc 99
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1800 actagaaggcaaacgttgtttatcacatactaattcgacaacatcttaggggcaaacgtc 1741

                                                                        
Query: 100  cagaaacagtcttgccatcttaggaaccaacccttggtcatgtcaggcagggtctttgaa 159
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1740 cagaaacagtcttgccatcttaggaaccaacccttggtcatgtcaggcagggtctttgaa 1681

                                                                        
Query: 160  aagcagcatgcagcatatatacacaacacacatcaccggtcaaattcggagtaaaaagct 219
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1680 aagcagcatgcagcatatatacacaacacacatcaccggtcaaattcggagtaaaaagct 1621

                                                                        
Query: 220  aagctctctcccggcgcaagtgtccgcctccacgatggggcgctcgctcgaccacccttc 279
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1620 aagctctctcccggcgcaagtgtccgcctccacgatggggcgctcgctcgaccacccttc 1561

                                                                        
Query: 280  aggccgccttggcaaagccaatacgcagcttgccgtagtcaaagacggtgtggtacgggc 339
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1560 aggccgccttggcaaagccaatacgcagcttgccgtagtcaaagacggtgtggtacgggc 1501

                                                                        
Query: 340  ccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatggctg 399
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1500 ccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatggctg 1441

                                                                        
Query: 400  tgaatccactgatgcactgggcagcagctccttcaccaaccttcaggatatactcttctg 459
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1440 tgaatccactgatgcactgggcagcagctccttcaccaaccttcaggatatactcttctg 1381

                                                                        
Query: 460  gtttcagcgcaaacttcttgccaccaatggtgaactcaatgtcaggcatggacccaaggc 519
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1380 gtttcagcgcaaacttcttgccaccaatggtgaactcaatgtcaggcatggacccaaggc 1321

                                                                        
Query: 520  tgccgcagtccacggctgattctcccatgggacttgggagacggttgcacagctggttaa 579
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1320 tgccgcagtccacggctgattctcccatgggacttgggagacggttgcacagctggttaa 1261

                                                                        
Query: 580  cgtaatctagtatgagatcctgggtcttgttctgtgcaagttggttctgcatccatacaa 639
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1260 cgtaatctagtatgagatcctgggtcttgttctgtgcaagttggttctgcatccatacaa 1201

              
Query: 640  ca 641
            ||
Sbjct: 1200 ca 1199



to top

>dbj|AB219968.1| Triticum aestivum WAP1 mRNA for aspartic proteinase, complete cds
          Length = 1527

 Score =  603 bits (304), Expect = e-169
 Identities = 349/364 (95%)
 Strand = Plus / Minus

                                                                        
Query: 278  tcaggccgccttggcaaagccaatacgcagcttgccgtagtcaaagacggtgtggtacgg 337
            ||||||||||||||| ||||| | |||||||||||||||||| |||||||||||||| ||
Sbjct: 1527 tcaggccgccttggcgaagccgacacgcagcttgccgtagtcgaagacggtgtggtaggg 1468

                                                                        
Query: 338  gcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatggc 397
            ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1467 gcccatgaaaacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatggc 1408

                                                                        
Query: 398  tgtgaatccactgatgcactgggcagcagctccttcaccaaccttcaggatatactcttc 457
            |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 1407 tgtgaatccactgatgcactgggcagcagctccttcgccaaccttcaggatatactcttc 1348

                                                                        
Query: 458  tggtttcagcgcaaacttcttgccaccaatggtgaactcaatgtcaggcatggacccaag 517
            |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||
Sbjct: 1347 tggtttcagcgcaaacttcttgccactaatggtgaactcaatgtcaggcatggatccaag 1288

                                                                        
Query: 518  gctgccgcagtccacggctgattctcccatgggacttgggagacggttgcacagctggtt 577
            |||| | |||||||| ||||||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 1287 gctggcacagtccacagctgattctcccatggggcttggcagacggttgcacagctggtt 1228

                                                                        
Query: 578  aacgtaatctagtatgagatcctgggtcttgttctgtgcaagttggttctgcatccatac 637
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1227 aacgtaatctagtatgagatcctgggtcttgttctgtgcaagttggttctgcatccacac 1168

                
Query: 638  aaca 641
            ||||
Sbjct: 1167 aaca 1164



to top

>dbj|AK104838.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-E12, full
            insert sequence
          Length = 1777

 Score =  345 bits (174), Expect = 1e-91
 Identities = 294/334 (88%)
 Strand = Plus / Minus

                                                                        
Query: 308  cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            |||||||||||| || ||||| ||||| |  |||||||| ||||| ||||||||||||||
Sbjct: 1563 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatccagag 1504

                                                                        
Query: 368  aggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagc 427
            |||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1503 aggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggcagcagc 1444

                                                                        
Query: 428  tccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaat 487
            |||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 1443 tccttcaccaaccttcagaatatactcttctggcttcagtgcaaactttttgcctccaat 1384

                                                                        
Query: 488  ggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccat 547
            ||||||   ||| |||||||||||  |||||||||| |||||||| | ||||||||||||
Sbjct: 1383 ggtgaatgaaatctcaggcatggatgcaaggctgccacagtccacagatgattctcccat 1324

                                                                        
Query: 548  gggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtctt 607
             |||||||||||   ||  || ||||| |||| ||| |  |  ||||||||||| |||||
Sbjct: 1323 tggacttgggagcttgtcacagagctgattaatgtagttcaagatgagatcctgagtctt 1264

                                              
Query: 608  gttctgtgcaagttggttctgcatccatacaaca 641
            ||||||||||||||||||||||||||||||||||
Sbjct: 1263 gttctgtgcaagttggttctgcatccatacaaca 1230



to top

>dbj|AK103421.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033128K05, full
            insert sequence
          Length = 1818

 Score =  345 bits (174), Expect = 1e-91
 Identities = 294/334 (88%)
 Strand = Plus / Minus

                                                                        
Query: 308  cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            |||||||||||| || ||||| ||||| |  |||||||| ||||| ||||||||||||||
Sbjct: 1564 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatccagag 1505

                                                                        
Query: 368  aggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagc 427
            |||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1504 aggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggcagcagc 1445

                                                                        
Query: 428  tccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaat 487
            |||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 1444 tccttcaccaaccttcagaatatactcttctggcttcagtgcaaactttttgcctccaat 1385

                                                                        
Query: 488  ggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccat 547
            ||||||   ||| |||||||||||  |||||||||| |||||||| | ||||||||||||
Sbjct: 1384 ggtgaatgaaatctcaggcatggatgcaaggctgccacagtccacagatgattctcccat 1325

                                                                        
Query: 548  gggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtctt 607
             |||||||||||   ||  || ||||| |||| ||| |  |  ||||||||||| |||||
Sbjct: 1324 tggacttgggagcttgtcacagagctgattaatgtagttcaagatgagatcctgagtctt 1265

                                              
Query: 608  gttctgtgcaagttggttctgcatccatacaaca 641
            ||||||||||||||||||||||||||||||||||
Sbjct: 1264 gttctgtgcaagttggttctgcatccatacaaca 1231



to top

>dbj|AK100749.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023118K01, full
           insert sequence
          Length = 1086

 Score =  345 bits (174), Expect = 1e-91
 Identities = 294/334 (88%)
 Strand = Plus / Minus

                                                                       
Query: 308 cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
           |||||||||||| || ||||| ||||| |  |||||||| ||||| ||||||||||||||
Sbjct: 772 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatccagag 713

                                                                       
Query: 368 aggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagc 427
           |||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 712 aggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggcagcagc 653

                                                                       
Query: 428 tccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaat 487
           |||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 652 tccttcaccaaccttcagaatatactcttctggcttcagtgcaaactttttgcctccaat 593

                                                                       
Query: 488 ggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccat 547
           ||||||   ||| |||||||||||  |||||||||| |||||||| | ||||||||||||
Sbjct: 592 ggtgaatgaaatctcaggcatggatgcaaggctgccacagtccacagatgattctcccat 533

                                                                       
Query: 548 gggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtctt 607
            |||||||||||   ||  || ||||| |||| ||| |  |  ||||||||||| |||||
Sbjct: 532 tggacttgggagcttgtcacagagctgattaatgtagttcaagatgagatcctgagtctt 473

                                             
Query: 608 gttctgtgcaagttggttctgcatccatacaaca 641
           ||||||||||||||||||||||||||||||||||
Sbjct: 472 gttctgtgcaagttggttctgcatccatacaaca 439



to top

>dbj|AK098911.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002H22, full
            insert sequence
          Length = 1844

 Score =  345 bits (174), Expect = 1e-91
 Identities = 294/334 (88%)
 Strand = Plus / Minus

                                                                        
Query: 308  cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            |||||||||||| || ||||| ||||| |  |||||||| ||||| ||||||||||||||
Sbjct: 1566 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatccagag 1507

                                                                        
Query: 368  aggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagc 427
            |||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1506 aggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggcagcagc 1447

                                                                        
Query: 428  tccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaat 487
            |||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 1446 tccttcaccaaccttcagaatatactcttctggcttcagtgcaaactttttgcctccaat 1387

                                                                        
Query: 488  ggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccat 547
            ||||||   ||| |||||||||||  |||||||||| |||||||| | ||||||||||||
Sbjct: 1386 ggtgaatgaaatctcaggcatggatgcaaggctgccacagtccacagatgattctcccat 1327

                                                                        
Query: 548  gggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtctt 607
             |||||||||||   ||  || ||||| |||| ||| |  |  ||||||||||| |||||
Sbjct: 1326 tggacttgggagcttgtcacagagctgattaatgtagttcaagatgagatcctgagtctt 1267

                                              
Query: 608  gttctgtgcaagttggttctgcatccatacaaca 641
            ||||||||||||||||||||||||||||||||||
Sbjct: 1266 gttctgtgcaagttggttctgcatccatacaaca 1233



to top

>dbj|AK098906.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002D14, full
            insert sequence
          Length = 1843

 Score =  345 bits (174), Expect = 1e-91
 Identities = 294/334 (88%)
 Strand = Plus / Minus

                                                                        
Query: 308  cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            |||||||||||| || ||||| ||||| |  |||||||| ||||| ||||||||||||||
Sbjct: 1561 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatccagag 1502

                                                                        
Query: 368  aggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagc 427
            |||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1501 aggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggcagcagc 1442

                                                                        
Query: 428  tccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaat 487
            |||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 1441 tccttcaccaaccttcagaatatactcttctggcttcagtgcaaactttttgcctccaat 1382

                                                                        
Query: 488  ggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccat 547
            ||||||   ||| |||||||||||  |||||||||| |||||||| | ||||||||||||
Sbjct: 1381 ggtgaatgaaatctcaggcatggatgcaaggctgccacagtccacagatgattctcccat 1322

                                                                        
Query: 548  gggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtctt 607
             |||||||||||   ||  || ||||| |||| ||| |  |  ||||||||||| |||||
Sbjct: 1321 tggacttgggagcttgtcacagagctgattaatgtagttcaagatgagatcctgagtctt 1262

                                              
Query: 608  gttctgtgcaagttggttctgcatccatacaaca 641
            ||||||||||||||||||||||||||||||||||
Sbjct: 1261 gttctgtgcaagttggttctgcatccatacaaca 1228



to top

>dbj|AK067742.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116C15, full
            insert sequence
          Length = 1869

 Score =  345 bits (174), Expect = 1e-91
 Identities = 294/334 (88%)
 Strand = Plus / Minus

                                                                        
Query: 308  cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            |||||||||||| || ||||| ||||| |  |||||||| ||||| ||||||||||||||
Sbjct: 1564 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatccagag 1505

                                                                        
Query: 368  aggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagc 427
            |||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1504 aggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggcagcagc 1445

                                                                        
Query: 428  tccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaat 487
            |||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 1444 tccttcaccaaccttcagaatatactcttctggcttcagtgcaaactttttgcctccaat 1385

                                                                        
Query: 488  ggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccat 547
            ||||||   ||| |||||||||||  |||||||||| |||||||| | ||||||||||||
Sbjct: 1384 ggtgaatgaaatctcaggcatggatgcaaggctgccacagtccacagatgattctcccat 1325

                                                                        
Query: 548  gggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtctt 607
             |||||||||||   ||  || ||||| |||| ||| |  |  ||||||||||| |||||
Sbjct: 1324 tggacttgggagcttgtcacagagctgattaatgtagttcaagatgagatcctgagtctt 1265

                                              
Query: 608  gttctgtgcaagttggttctgcatccatacaaca 641
            ||||||||||||||||||||||||||||||||||
Sbjct: 1264 gttctgtgcaagttggttctgcatccatacaaca 1231



to top

>dbj|AK066453.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013059L24, full
            insert sequence
          Length = 2543

 Score =  345 bits (174), Expect = 1e-91
 Identities = 294/334 (88%)
 Strand = Plus / Minus

                                                                        
Query: 308  cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            |||||||||||| || ||||| ||||| |  |||||||| ||||| ||||||||||||||
Sbjct: 2195 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatccagag 2136

                                                                        
Query: 368  aggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagc 427
            |||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2135 aggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggcagcagc 2076

                                                                        
Query: 428  tccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaat 487
            |||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 2075 tccttcaccaaccttcagaatatactcttctggcttcagtgcaaactttttgcctccaat 2016

                                                                        
Query: 488  ggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccat 547
            ||||||   ||| |||||||||||  |||||||||| |||||||| | ||||||||||||
Sbjct: 2015 ggtgaatgaaatctcaggcatggatgcaaggctgccacagtccacagatgattctcccat 1956

                                                                        
Query: 548  gggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtctt 607
             |||||||||||   ||  || ||||| |||| ||| |  |  ||||||||||| |||||
Sbjct: 1955 tggacttgggagcttgtcacagagctgattaatgtagttcaagatgagatcctgagtctt 1896

                                              
Query: 608  gttctgtgcaagttggttctgcatccatacaaca 641
            ||||||||||||||||||||||||||||||||||
Sbjct: 1895 gttctgtgcaagttggttctgcatccatacaaca 1862



to top

>dbj|D32144.1|RICAPA Rice mRNA for aspartic protease, complete cds
          Length = 2030

 Score =  337 bits (170), Expect = 3e-89
 Identities = 293/334 (87%)
 Strand = Plus / Minus

                                                                        
Query: 308  cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            |||||||||||| || ||||| ||||| |  |||||||| ||||| ||||||||||||||
Sbjct: 1553 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatccagag 1494

                                                                        
Query: 368  aggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagc 427
            |||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1493 aggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggcagcagc 1434

                                                                        
Query: 428  tccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaat 487
            |||||||||||||||||| |||||||||||||| ||||| |||||||| ||| | |||||
Sbjct: 1433 tccttcaccaaccttcagaatatactcttctggcttcagtgcaaactttttggctccaat 1374

                                                                        
Query: 488  ggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccat 547
            ||||||   ||| |||||||||||  |||||||||| |||||||| | ||||||||||||
Sbjct: 1373 ggtgaatgaaatctcaggcatggatgcaaggctgccacagtccacagatgattctcccat 1314

                                                                        
Query: 548  gggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtctt 607
             |||||||||||   ||  || ||||| |||| ||| |  |  ||||||||||| |||||
Sbjct: 1313 tggacttgggagcttgtcacagagctgattaatgtagttcaagatgagatcctgagtctt 1254

                                              
Query: 608  gttctgtgcaagttggttctgcatccatacaaca 641
            ||||||||||||||||||||||||||||||||||
Sbjct: 1253 gttctgtgcaagttggttctgcatccatacaaca 1220



to top

>gb|AY112455.1| Zea mays CL6331_1 mRNA sequence
          Length = 1071

 Score =  272 bits (137), Expect = 1e-69
 Identities = 284/333 (85%)
 Strand = Plus / Minus

                                                                       
Query: 305 cagcttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcca 364
           ||||||||| ||||| ||||||||||||||    |||||||| || || |||| ||||||
Sbjct: 753 cagcttgccatagtcgaagacggtgtggtagactcccatgaaaacatcacccaagatcca 694

                                                                       
Query: 365 gagaggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagc 424
           |||||| || || || || ||||| ||||| ||||||||||| |||||||||||||||||
Sbjct: 693 gagagggccacggggtggtgggatatccatagctgtgaatccgctgatgcactgggcagc 634

                                                                       
Query: 425 agctccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccacc 484
              |||||||||||||||||| || ||||  ||||||||||||   ||||| ||||| ||
Sbjct: 633 ctgtccttcaccaaccttcagaatgtactgctctggtttcagcttgaacttattgcctcc 574

                                                                       
Query: 485 aatggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcc 544
           |||||||||| ||||||||||||||||| |||| ||||| ||||||||||||||||||||
Sbjct: 573 aatggtgaacgcaatgtcaggcatggacgcaagactgccacagtccacggctgattctcc 514

                                                                       
Query: 545 catgggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggt 604
           ||| ||||| || ||||| | ||| ||||| |||| ||| |  || ||||| ||||| ||
Sbjct: 513 cattggactcggaagacgctcgcaaagctgattaatgtagttcaggatgagctcctgtgt 454

                                            
Query: 605 cttgttctgtgcaagttggttctgcatccatac 637
           ||||||||| |||||||||||||||||||||||
Sbjct: 453 cttgttctgggcaagttggttctgcatccatac 421



to top

>gb|BT017963.1| Zea mays clone EL01N0523D02.c mRNA sequence
          Length = 1169

 Score =  252 bits (127), Expect = 1e-63
 Identities = 256/299 (85%)
 Strand = Plus / Minus

                                                                       
Query: 339 cccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatggct 398
           |||||||| || || |||| |||||||||||| || || || || ||||| ||||| |||
Sbjct: 814 cccatgaaaacatcacccaagatccagagagggccacggggtggtgggatatccatagct 755

                                                                       
Query: 399 gtgaatccactgatgcactgggcagcagctccttcaccaaccttcaggatatactcttct 458
           |||||||| |||||||||||||||||   |||||||||||||||||| || ||||  |||
Sbjct: 754 gtgaatccgctgatgcactgggcagcctgtccttcaccaaccttcagaatgtactgctct 695

                                                                       
Query: 459 ggtttcagcgcaaacttcttgccaccaatggtgaactcaatgtcaggcatggacccaagg 518
           |||||||||   ||||| ||||| |||||||||||| ||||||||||||||||| |||| 
Sbjct: 694 ggtttcagcttgaacttattgcctccaatggtgaacgcaatgtcaggcatggacgcaaga 635

                                                                       
Query: 519 ctgccgcagtccacggctgattctcccatgggacttgggagacggttgcacagctggtta 578
           ||||| ||||||||||||||||||||||| ||||| || ||||| | ||| ||||| |||
Sbjct: 634 ctgccacagtccacggctgattctcccattggactcggaagacgctcgcaaagctgatta 575

                                                                      
Query: 579 acgtaatctagtatgagatcctgggtcttgttctgtgcaagttggttctgcatccatac 637
           | ||| |  || ||||| ||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 574 atgtagttcaggatgagctcctgtgtcttgttctgggcaagttggttctgcatccatac 516



to top

>gb|AF285164.1| Oryza sativa subsp. japonica aspartic protease mRNA, partial cds
          Length = 562

 Score =  236 bits (119), Expect = 7e-59
 Identities = 218/251 (86%)
 Strand = Plus / Minus

                                                                       
Query: 308 cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
           |||||||||||| || ||||| ||||| |  |||||||| ||||| ||||||||||||||
Sbjct: 327 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatccagag 268

                                                                       
Query: 368 aggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagc 427
           |||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 267 aggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggcagcagc 208

                                                                       
Query: 428 tccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaat 487
           | ||| |||||||||||| |||||||||||||| ||||| |||||||| ||| |  ||||
Sbjct: 207 ttctttaccaaccttcagaatatactcttctggcttcagtgcaaactttttggcttcaat 148

                                                                       
Query: 488 ggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccat 547
           ||||||   ||| |||||||||||  |||||||| | |||||||| | ||| ||| ||||
Sbjct: 147 ggtgaatgaaatctcaggcatggatgcaaggctggcacagtccacagatgaatcttccat 88

                      
Query: 548 gggacttggga 558
            ||||||||||
Sbjct: 87  tggacttggga 77



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 591 atgagatcctgggtcttgttctgtgcaagttggttctgcatcc 633
           ||||||||||| |||||| ||||||||||| ||||||| ||||
Sbjct: 44  atgagatcctgagtcttggtctgtgcaagtgggttctggatcc 2



to top

>ref|NM_192504.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1560

 Score =  232 bits (117), Expect = 1e-57
 Identities = 279/333 (83%)
 Strand = Plus / Minus

                                                                        
Query: 309  ttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagaga 368
            ||||| |||||||| ||||| ||||| |  ||||| ||||| ||||||| ||||||||||
Sbjct: 1529 ttgccatagtcaaacacggtatggtaggctcccataaagacatctcccaagatccagaga 1470

                                                                        
Query: 369  ggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagct 428
            ||||| |||||||| || |||||||| ||||||||||||||||||||||||| ||||| |
Sbjct: 1469 ggaccacgaggaggaggaatgtccatagctgtgaatccactgatgcactgggtagcagtt 1410

                                                                        
Query: 429  ccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaatg 488
            || ||||||||||||||||| || | ||||||||| ||  ||||||| |||||||| || 
Sbjct: 1409 ccctcaccaaccttcaggatgtattgttctggtttgagaacaaacttgttgccaccgatt 1350

                                                                        
Query: 489  gtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccatg 548
            |||||  ||||||||||||||||  ||||||||| |||||| || | |||||||||||| 
Sbjct: 1349 gtgaaggcaatgtcaggcatggatgcaaggctgctgcagtcaacagatgattctcccata 1290

                                                                        
Query: 549  ggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtcttg 608
            ||||| || |||||||  || ||||| | || ||| |  | || ||||||||| || |  
Sbjct: 1289 ggactaggaagacggtcacatagctgatcaatgtactgcaatacgagatcctgagtttga 1230

                                             
Query: 609  ttctgtgcaagttggttctgcatccatacaaca 641
            || |||||||||||| | |||||||||||||||
Sbjct: 1229 ttttgtgcaagttgggtatgcatccatacaaca 1197



to top

>dbj|AK072283.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023016B15, full
            insert sequence
          Length = 1862

 Score =  232 bits (117), Expect = 1e-57
 Identities = 279/333 (83%)
 Strand = Plus / Minus

                                                                        
Query: 309  ttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagaga 368
            ||||| |||||||| ||||| ||||| |  ||||| ||||| ||||||| ||||||||||
Sbjct: 1654 ttgccatagtcaaacacggtatggtaggctcccataaagacatctcccaagatccagaga 1595

                                                                        
Query: 369  ggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagct 428
            ||||| |||||||| || |||||||| ||||||||||||||||||||||||| ||||| |
Sbjct: 1594 ggaccacgaggaggaggaatgtccatagctgtgaatccactgatgcactgggtagcagtt 1535

                                                                        
Query: 429  ccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaatg 488
            || ||||||||||||||||| || | ||||||||| ||  ||||||| |||||||| || 
Sbjct: 1534 ccctcaccaaccttcaggatgtattgttctggtttgagaacaaacttgttgccaccgatt 1475

                                                                        
Query: 489  gtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccatg 548
            |||||  ||||||||||||||||  ||||||||| |||||| || | |||||||||||| 
Sbjct: 1474 gtgaaggcaatgtcaggcatggatgcaaggctgctgcagtcaacagatgattctcccata 1415

                                                                        
Query: 549  ggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtcttg 608
            ||||| || |||||||  || ||||| | || ||| |  | || ||||||||| || |  
Sbjct: 1414 ggactaggaagacggtcacatagctgatcaatgtactgcaatacgagatcctgagtttga 1355

                                             
Query: 609  ttctgtgcaagttggttctgcatccatacaaca 641
            || |||||||||||| | |||||||||||||||
Sbjct: 1354 ttttgtgcaagttgggtatgcatccatacaaca 1322



to top

>dbj|AK072645.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023131B07, full
            insert sequence
          Length = 1576

 Score =  224 bits (113), Expect = 3e-55
 Identities = 278/333 (83%)
 Strand = Plus / Minus

                                                                        
Query: 309  ttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagaga 368
            ||||| |||||||| ||||| ||||| |  ||||| ||||| ||||||| ||||||||||
Sbjct: 1308 ttgccatagtcaaacacggtatggtaggctcccataaagacatctcccaagatccagaga 1249

                                                                        
Query: 369  ggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagct 428
            ||||| |||||||| || |||||||| ||||||||||||||||||||||||| ||||| |
Sbjct: 1248 ggaccacgaggaggaggaatgtccatagctgtgaatccactgatgcactgggtagcagtt 1189

                                                                        
Query: 429  ccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaatg 488
            || ||||||||||||||||| || | ||||||||| ||  ||||||| |||||||| || 
Sbjct: 1188 ccctcaccaaccttcaggatgtattgttctggtttgagaacaaacttgttgccaccgatt 1129

                                                                        
Query: 489  gtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccatg 548
            |||||  ||||||||||||||||  ||||||||| |||||| || | |||||||||||| 
Sbjct: 1128 gtgaaggcaatgtcaggcatggatgcaaggctgctgcagtcaacagatgattctcccata 1069

                                                                        
Query: 549  ggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtcttg 608
            ||||| || |||||||  || || || | || ||| |  | || ||||||||| || |  
Sbjct: 1068 ggactaggaagacggtcacatagttgatcaatgtactgcaatacgagatcctgagtttga 1009

                                             
Query: 609  ttctgtgcaagttggttctgcatccatacaaca 641
            || |||||||||||| | |||||||||||||||
Sbjct: 1008 ttttgtgcaagttgggtatgcatccatacaaca 976



to top

>gb|AC120986.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1781_H11,
             complete sequence
          Length = 204649

 Score =  151 bits (76), Expect = 3e-33
 Identities = 88/92 (95%)
 Strand = Plus / Minus

                                                                         
Query: 362   ccagagaggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggc 421
             |||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 96701 ccagagaggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggc 96642

                                             
Query: 422   agcagctccttcaccaaccttcaggatatact 453
             |||||||||||||||||||||||| |||||||
Sbjct: 96641 agcagctccttcaccaaccttcagaatatact 96610



 Score =  103 bits (52), Expect = 7e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                         
Query: 452   ctcttctggtttcagcgcaaacttcttgccaccaatggtgaactcaatgtcaggcatgga 511
             ||||||||| ||||| |||||||| ||||| |||||||||||   ||| |||||||||||
Sbjct: 96451 ctcttctggcttcagtgcaaactttttgcctccaatggtgaatgaaatctcaggcatgga 96392

                                                             
Query: 512   cccaaggctgccgcagtccacggctgattctcccatgggacttgggag 559
               |||||||||| |||||||| | |||||||||||| |||||||||||
Sbjct: 96391 tgcaaggctgccacagtccacagatgattctcccattggacttgggag 96344



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                                
Query: 591   atgagatcctgggtcttgttctgtgcaagttggttctgcatccatacaaca 641
             ||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 96229 atgagatcctgagtcttgttctgtgcaagttggttctgcatccatacaaca 96179



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                     
Query: 308   cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcc 363
             |||||||||||| || ||||| ||||| |  |||||||| ||||| ||||||||||
Sbjct: 96850 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatcc 96795



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  151 bits (76), Expect = 3e-33
 Identities = 88/92 (95%)
 Strand = Plus / Minus

                                                                            
Query: 362      ccagagaggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggc 421
                |||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 28016536 ccagagaggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggc 28016477

                                                
Query: 422      agcagctccttcaccaaccttcaggatatact 453
                |||||||||||||||||||||||| |||||||
Sbjct: 28016476 agcagctccttcaccaaccttcagaatatact 28016445



 Score =  103 bits (52), Expect = 7e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                            
Query: 452      ctcttctggtttcagcgcaaacttcttgccaccaatggtgaactcaatgtcaggcatgga 511
                ||||||||| ||||| |||||||| ||||| |||||||||||   ||| |||||||||||
Sbjct: 28016286 ctcttctggcttcagtgcaaactttttgcctccaatggtgaatgaaatctcaggcatgga 28016227

                                                                
Query: 512      cccaaggctgccgcagtccacggctgattctcccatgggacttgggag 559
                  |||||||||| |||||||| | |||||||||||| |||||||||||
Sbjct: 28016226 tgcaaggctgccacagtccacagatgattctcccattggacttgggag 28016179



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                                   
Query: 591      atgagatcctgggtcttgttctgtgcaagttggttctgcatccatacaaca 641
                ||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 28016064 atgagatcctgagtcttgttctgtgcaagttggttctgcatccatacaaca 28016014



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                        
Query: 308      cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcc 363
                |||||||||||| || ||||| ||||| |  |||||||| ||||| ||||||||||
Sbjct: 28016685 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatcc 28016630



to top

>dbj|D32165.1|RICAP Rice gene for aspartic protease, complete cds
          Length = 6782

 Score =  151 bits (76), Expect = 3e-33
 Identities = 88/92 (95%)
 Strand = Plus / Minus

                                                                        
Query: 362  ccagagaggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggc 421
            |||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 6065 ccagagaggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggc 6006

                                            
Query: 422  agcagctccttcaccaaccttcaggatatact 453
            |||||||||||||||||||||||| |||||||
Sbjct: 6005 agcagctccttcaccaaccttcagaatatact 5974



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                        
Query: 452  ctcttctggtttcagcgcaaacttcttgccaccaatggtgaactcaatgtcaggcatgga 511
            ||||||||| ||||| |||||||| ||| | |||||||||||   ||| |||||||||||
Sbjct: 5815 ctcttctggcttcagtgcaaactttttggctccaatggtgaatgaaatctcaggcatgga 5756

                                                            
Query: 512  cccaaggctgccgcagtccacggctgattctcccatgggacttgggag 559
              |||||||||| |||||||| | |||||||||||| |||||||||||
Sbjct: 5755 tgcaaggctgccacagtccacagatgattctcccattggacttgggag 5708



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 591  atgagatcctgggtcttgttctgtgcaagttggttctgcatccatacaaca 641
            ||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 5593 atgagatcctgagtcttgttctgtgcaagttggttctgcatccatacaaca 5543



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 308  cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcc 363
            |||||||||||| || ||||| ||||| |  |||||||| ||||| ||||||||||
Sbjct: 6214 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatcc 6159



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  119 bits (60), Expect = 1e-23
 Identities = 84/92 (91%)
 Strand = Plus / Plus

                                                                            
Query: 362      ccagagaggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggc 421
                |||||||||||| |||||||| || |||||||| ||||||||||||||||||||||||| 
Sbjct: 27079661 ccagagaggaccacgaggaggaggaatgtccatagctgtgaatccactgatgcactgggt 27079720

                                                
Query: 422      agcagctccttcaccaaccttcaggatatact 453
                ||||| ||| ||||||||||||||||| ||||
Sbjct: 27079721 agcagttccctcaccaaccttcaggatgtact 27079752



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                            
Query: 455      ttctggtttcagcgcaaacttcttgccaccaatggtgaactcaatgtcaggcatggaccc 514
                ||||||||| ||  ||||||| |||||||| || |||||  ||||||||||||||||  |
Sbjct: 27080543 ttctggtttgagaacaaacttgttgccaccgattgtgaaggcaatgtcaggcatggatgc 27080602

                                                                  
Query: 515      aaggctgccgcagtccacggctgattctcccatgggacttgggagacggt 564
                |||||||| |||||| || | |||||||||||| ||||| || |||||||
Sbjct: 27080603 aaggctgctgcagtcaacagatgattctcccataggactaggaagacggt 27080652



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                              
Query: 612      tgtgcaagttggttctgcatccatacaaca 641
                |||||||||||| | |||||||||||||||
Sbjct: 27080778 tgtgcaagttgggtatgcatccatacaaca 27080807



to top

>dbj|AP003284.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0671D01
          Length = 163006

 Score =  119 bits (60), Expect = 1e-23
 Identities = 84/92 (91%)
 Strand = Plus / Plus

                                                                          
Query: 362    ccagagaggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggc 421
              |||||||||||| |||||||| || |||||||| ||||||||||||||||||||||||| 
Sbjct: 138492 ccagagaggaccacgaggaggaggaatgtccatagctgtgaatccactgatgcactgggt 138551

                                              
Query: 422    agcagctccttcaccaaccttcaggatatact 453
              ||||| ||| ||||||||||||||||| ||||
Sbjct: 138552 agcagttccctcaccaaccttcaggatgtact 138583



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                          
Query: 455    ttctggtttcagcgcaaacttcttgccaccaatggtgaactcaatgtcaggcatggaccc 514
              ||||||||| ||  ||||||| |||||||| || |||||  ||||||||||||||||  |
Sbjct: 139374 ttctggtttgagaacaaacttgttgccaccgattgtgaaggcaatgtcaggcatggatgc 139433

                                                                
Query: 515    aaggctgccgcagtccacggctgattctcccatgggacttgggagacggt 564
              |||||||| |||||| || | |||||||||||| ||||| || |||||||
Sbjct: 139434 aaggctgctgcagtcaacagatgattctcccataggactaggaagacggt 139483



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 612    tgtgcaagttggttctgcatccatacaaca 641
              |||||||||||| | |||||||||||||||
Sbjct: 139609 tgtgcaagttgggtatgcatccatacaaca 139638



to top

>dbj|AB002695.1| Pumpkin mRNA for aspartic endopeptidase, complete cds
          Length = 1776

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 130/157 (82%)
 Strand = Plus / Minus

                                                                        
Query: 305  cagcttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcca 364
            |||||||||  | |||||||||||||||||  | ||||||||||| ||||||| ||||||
Sbjct: 1593 cagcttgccaaaatcaaagacggtgtggtagcgacccatgaagacatctcccaagatcca 1534

                                                                        
Query: 365  gagaggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagc 424
            ||| || || |||||||| ||||| || |  || || |||||||| |||||||| ||  |
Sbjct: 1533 gaggggtccacgaggaggagggatatcaaatgcagtaaatccacttatgcactgagctac 1474

                                                 
Query: 425  agctccttcaccaaccttcaggatatactcttctggt 461
            ||  || ||||||||||| || |||||||||||||||
Sbjct: 1473 aggaccctcaccaaccttgagtatatactcttctggt 1437



to top

>emb|AJ313385.1|TCA313385 Theobroma cacao mRNA for aspartic proteinase (ap2 gene)
          Length = 1828

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 119/143 (83%)
 Strand = Plus / Minus

                                                                        
Query: 318  tcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcga 377
            |||||||||||||||||  | ||||||||||  |||||||| ||||||||||| || |||
Sbjct: 1566 tcaaagacggtgtggtagcgacccatgaagatatctcccagaatccagagaggtccacga 1507

                                                                        
Query: 378  ggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcacca 437
            ||||| || || ||||  || || || |||||||||||||| ||  |||  |||||||| 
Sbjct: 1506 ggaggaggaatatccaaagcagtaaagccactgatgcactgtgcttcagaaccttcaccc 1447

                                   
Query: 438  accttcaggatatactcttctgg 460
            ||||| || ||||||||||||||
Sbjct: 1446 accttgagaatatactcttctgg 1424



to top

>emb|Y09123.1|CCY09123 C.calcitrapa mRNA for aspartic proteinase
          Length = 1721

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                        
Query: 351  tctcccaggatccagagaggaccgcgaggaggcgggatgtccatggctgtgaatccactg 410
            ||||||| |||||| ||||| || |||||||| | ||  ||||| |||||||||||||||
Sbjct: 1491 tctcccaagatccatagaggtccacgaggaggggcgacatccatagctgtgaatccactg 1432

                                                              
Query: 411  atgcactgggcagcagctccttcaccaaccttcaggatatactcttctgg 460
            ||||| || || ||  |||| |||||||  |||||||| |||| ||||||
Sbjct: 1431 atgcattgtgcggcttctccctcaccaattttcaggatgtactgttctgg 1382



to top

>emb|AJ313384.1|TCA313384 Theobroma cacao mRNA for aspartic proteinase (ap1 gene)
          Length = 1784

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 121/150 (80%)
 Strand = Plus / Minus

                                                                        
Query: 304  gcagcttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcc 363
            |||| ||||| |||||||| || || ||| || ||||||| |||||||| |||| |||||
Sbjct: 1581 gcaggttgccatagtcaaatactgtatggaactggcccataaagacgtcgcccaagatcc 1522

                                                                        
Query: 364  agagaggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcag 423
            ||||||| || |||||||| || |  ||||  || ||||||||||||| ||| || ||  
Sbjct: 1521 agagaggtccacgaggaggtggcacatccagagcagtgaatccactgaggcattgagcta 1462

                                          
Query: 424  cagctccttcaccaaccttcaggatatact 453
            || |||| ||||| || ||||||| |||||
Sbjct: 1461 catctccctcacccactttcaggacatact 1432



to top

>gb|L46681.1|TOMAPP Lycopersicon esculentum aspartic protease precursor mRNA, complete
            cds
          Length = 1740

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                        
Query: 315  tagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccg 374
            ||||||||||| ||||| ||||| |||||||| || ||||| || ||||| |||||||||
Sbjct: 1502 tagtcaaagacagtgtgatacggccccatgaatacatctccaagaatccaaagaggaccg 1443

                 
Query: 375  cgagg 379
            |||||
Sbjct: 1442 cgagg 1438



to top

>gb|AY792822.1| Sus scrofa cathepsin D protein mRNA, partial cds
          Length = 1894

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 324  acggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggc 383
            ||||||| |||  |||| ||||| |||||||||||||||||||| || ||||  || |||
Sbjct: 1136 acggtgtagtagcggccgatgaaaacgtctcccaggatccagagcggcccgccgggcggc 1077

                        
Query: 384  gggatgtccatg 395
            ||||||||||||
Sbjct: 1076 gggatgtccatg 1065



to top

>dbj|AB219969.1| Triticum aestivum WAP2 mRNA for aspartic proteinase, complete cds
          Length = 1560

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                        
Query: 308  cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            ||||||| |||| || ||||||||||| | |||||||||||| || || || ||||||||
Sbjct: 1489 cttgccgaagtcgaacacggtgtggtaagcgcccatgaagacatccccaagaatccagag 1430

                                    
Query: 368  aggaccgcgaggaggcgggatgtc 391
            |||||| || || ||||| |||||
Sbjct: 1429 aggaccacgtgggggcggtatgtc 1406



to top

>gb|DQ018729.1|DQ018728S2 Sus scrofa cathepsin D (CTSD) gene, exons 7 through 9 and partial
           cds
          Length = 1274

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                       
Query: 324 acggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggc 383
           ||||||| |||  |||| ||||| |||||||||||||||||||| || ||||  || |||
Sbjct: 535 acggtgtagtagcggccgatgaaaacgtctcccaggatccagagcggcccgccgggcggc 476

                       
Query: 384 gggatgtccatg 395
           ||||||||||||
Sbjct: 475 gggatgtccatg 464



to top

>gb|DQ018727.1| Sus scrofa cathepsin D mRNA, complete cds
          Length = 2032

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 324  acggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggc 383
            ||||||| |||  |||| ||||| |||||||||||||||||||| || ||||  || |||
Sbjct: 1274 acggtgtagtagcggccgatgaaaacgtctcccaggatccagagcggcccgccgggcggc 1215

                        
Query: 384  gggatgtccatg 395
            ||||||||||||
Sbjct: 1214 gggatgtccatg 1203



to top

>ref|NM_001037721.1| Sus scrofa cathepsin D (CTSD), mRNA
          Length = 2032

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                        
Query: 324  acggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggc 383
            ||||||| |||  |||| ||||| |||||||||||||||||||| || ||||  || |||
Sbjct: 1274 acggtgtagtagcggccgatgaaaacgtctcccaggatccagagcggcccgccgggcggc 1215

                        
Query: 384  gggatgtccatg 395
            ||||||||||||
Sbjct: 1214 gggatgtccatg 1203



to top

>dbj|AB045892.1| Nepenthes alata NaAP2 mRNA for aspartic proteinase 2, complete cds
          Length = 1839

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                        
Query: 312  ccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagagga 371
            |||||||| || |||||||||||  | |||||||| | |||||||| ||||||||| || 
Sbjct: 1577 ccgtagtcgaacacggtgtggtattgacccatgaaaatgtctcccaagatccagaggggt 1518

                                                                        
Query: 372  ccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctcct 431
            || |||||||| |  ||||| |  ||| |||||||||| ||||| || |||||| | |||
Sbjct: 1517 ccacgaggaggggcaatgtctaaagctatgaatccactaatgcattgtgcagcaacacct 1458

                    
Query: 432  tcaccaac 439
            || |||||
Sbjct: 1457 tcgccaac 1450



to top

>ref|NM_205177.1| Gallus gallus cathepsin D (lysosomal aspartyl peptidase) (CTSD), mRNA
          Length = 1448

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                               
Query: 317  gtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            ||||||||| |||| ||| ||||| |||||||| |||||||||||||||||
Sbjct: 1283 gtcaaagacagtgtagtaggggccaatgaagacatctcccaggatccagag 1233



to top

>gb|BT020155.1| Homo sapiens cathepsin D (lysosomal aspartyl protease) mRNA, complete
            cds
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116



to top

>ref|NM_001909.3| Homo sapiens cathepsin D (lysosomal aspartyl peptidase) (CTSD), mRNA
          Length = 2205

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1307 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1249



to top

>gb|BC001574.1| Homo sapiens cathepsin D (lysosomal aspartyl peptidase), mRNA (cDNA
           clone IMAGE:3455250)
          Length = 1494

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 337 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
           |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 646 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 588



to top

>gb|BC016320.2| Homo sapiens cathepsin D (lysosomal aspartyl peptidase), mRNA (cDNA
            clone MGC:2311 IMAGE:3506977), complete cds
          Length = 2117

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1219 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1161



to top

>emb|X05344.1|HSCATDC Human mRNA for cathepsin D from oestrogen responsive breast cancer
            cells
          Length = 1988

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1176 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1118



to top

>emb|CR456947.1| Homo sapiens full open reading frame cDNA clone RZPDo834E1218D for
            gene CTSD, cathepsin D (lysosomal aspartyl protease);
            complete cds, incl. stopcodon
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116



to top

>gb|BT007637.1| Synthetic construct Homo sapiens cathepsin D (lysosomal aspartyl
            protease) mRNA, partial cds
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116



to top

>gb|BT006910.1| Homo sapiens cathepsin D (lysosomal aspartyl protease) mRNA, complete
            cds
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116



to top

>emb|CR858646.1| Pongo pygmaeus mRNA; cDNA DKFZp469J0315 (from clone DKFZp469J0315)
          Length = 2023

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1191 ggccgatgaagacgtcgcccaggatccagagtggtccgctgggtggcgggatgtccatg 1133



to top

>emb|CR623521.1| full-length cDNA clone CS0DI064YA16 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 2032

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1255 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1197



to top

>emb|CR613410.1| full-length cDNA clone CS0DE003YB18 of Placenta of Homo sapiens
            (human)
          Length = 2061

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1273 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1215



to top

>emb|CR612133.1| full-length cDNA clone CS0DF002YC21 of Fetal brain of Homo sapiens
            (human)
          Length = 2006

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1213 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1155



to top

>emb|CR609839.1| full-length cDNA clone CS0DI057YH09 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 2026

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1280 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1222



to top

>emb|CR597228.1| full-length cDNA clone CS0DN004YA05 of Adult brain of Homo sapiens
            (human)
          Length = 2051

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1273 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1215



to top

>dbj|AB169854.1| Macaca fascicularis brain cDNA, clone: QccE-11243, similar to human
            cathepsin D (lysosomal aspartyl protease) (CTSD), mRNA,
            RefSeq: NM_001909.3
          Length = 2199

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1311 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1253



to top

>gb|S49650.1| prepro-cathepsin D [chickens, follicles, mRNA, 1448 nt]
          Length = 1448

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                               
Query: 317  gtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            ||||||||| |||| ||| ||||| |||||||| |||||||||||||||||
Sbjct: 1283 gtcaaagacagtgtagtaggggccaatgaagacatctcccaggatccagag 1233



to top

>ref|NM_213873.1| Sus scrofa pepsin (LOC396892), mRNA
          Length = 1398

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                               
Query: 317  gtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            |||||||||||||| |||| |||  ||||||||||| ||||||||||||||
Sbjct: 1194 gtcaaagacggtgtagtactggcggatgaagacgtcacccaggatccagag 1144



to top

>gb|AC068580.23| Homo sapiens chromosome 11, clone RP11-295K3, complete sequence
          Length = 120298

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                        
Query: 337   ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
             |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 53774 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 53716



to top

>gb|AY892734.1| Synthetic construct Homo sapiens clone FLH024310.01L cathepsin D
            (CTSD) mRNA, partial cds
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116



to top

>gb|AY890251.1| Synthetic construct Homo sapiens clone FLH024315.01X cathepsin D
            (CTSD) mRNA, complete cds
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116



to top

>gb|AY890417.1| Synthetic construct Homo sapiens clone FLH031241.01X cathepsin D
            (CTSD) mRNA, complete cds
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116



to top

>gb|AY888315.1| Synthetic construct Homo sapiens clone FLH008539.01X cathepsin D
            (CTSD) mRNA, complete cds
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116



to top

>dbj|AK130178.1| Homo sapiens cDNA FLJ26668 fis, clone MPG03026, highly similar to
            Cathepsin D precursor (EC 3.4.23.5)
          Length = 1906

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1199 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1141



to top

>gb|AY893487.1| Synthetic construct Homo sapiens clone FLH127809.01X cathepsin D
            (CTSD) mRNA, complete cds
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116



to top

>gb|AY892880.1| Synthetic construct Homo sapiens clone FLH031237.01L cathepsin D
            (CTSD) mRNA, partial cds
          Length = 1239

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116



to top

>gb|AC160647.1| Gallus gallus BAC clone CH261-14N23 from chromosome unknown, complete
              sequence
          Length = 237526

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                                 
Query: 317    gtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
              ||||||||| |||| ||| ||||| |||||||| |||||||||||||||||
Sbjct: 132663 gtcaaagacagtgtagtaggggccaatgaagacatctcccaggatccagag 132613



to top

>gb|M11233.1|HUMCTHD Human cathepsin D mRNA, complete cds
          Length = 2038

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 337  ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 1225 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1167



to top

>gb|M63138.1|HUMCATD5 Human cathepsin D (catD) gene, exons 7, 8, and 9
          Length = 2062

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 337 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
           |||| ||||||||||| |||||||||||||| || ||||  || |||||||||||||||
Sbjct: 820 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 762



to top

>gb|J04601.1|PIGPEPA Pig pepsinogen A mRNA, complete cds
          Length = 1363

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                               
Query: 317  gtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            |||||||||||||| |||| |||  ||||||||||| ||||||||||||||
Sbjct: 1155 gtcaaagacggtgtagtactggcggatgaagacgtcacccaggatccagag 1105



to top

>gb|M20920.1|PIGPEP Swine pepsinogen A mRNA, complete cds
          Length = 1398

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                               
Query: 317  gtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            |||||||||||||| |||| |||  ||||||||||| ||||||||||||||
Sbjct: 1194 gtcaaagacggtgtagtactggcggatgaagacgtcacccaggatccagag 1144



to top

>ref|NM_001025621.1| Canis familiaris cathepsin D (lysosomal aspartyl peptidase) (CTSD),
            mRNA
          Length = 1524

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                  
Query: 342  atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||||||| || ||||||||||||||||| |||| ||| || ||||||||||||
Sbjct: 1232 atgaagacatcacccaggatccagagaggcccgccaggtggggggatgtccatg 1179



to top

>ref|XM_863994.1| PREDICTED: Bos taurus cathepsin D (lysosomal aspartyl protease),
            transcript variant 2 (CTSD), mRNA
          Length = 1907

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                  
Query: 342  atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            ||||||||||| |||||||||||||| || |||| ||| || ||||||||||||
Sbjct: 1185 atgaagacgtcgcccaggatccagagcggcccgccaggcggggggatgtccatg 1132



to top

>ref|XM_609913.2| PREDICTED: Bos taurus cathepsin D (lysosomal aspartyl protease),
            transcript variant 1 (CTSD), mRNA
          Length = 1901

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                  
Query: 342  atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            ||||||||||| |||||||||||||| || |||| ||| || ||||||||||||
Sbjct: 1179 atgaagacgtcgcccaggatccagagcggcccgccaggcggggggatgtccatg 1126



to top

>ref|XM_871709.1| PREDICTED: Bos taurus cathepsin D (lysosomal aspartyl protease),
            transcript variant 5 (CTSD), mRNA
          Length = 1919

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                  
Query: 342  atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            ||||||||||| |||||||||||||| || |||| ||| || ||||||||||||
Sbjct: 1197 atgaagacgtcgcccaggatccagagcggcccgccaggcggggggatgtccatg 1144



to top

>ref|XM_871611.1| PREDICTED: Bos taurus cathepsin D (lysosomal aspartyl protease),
            transcript variant 4 (CTSD), mRNA
          Length = 1910

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                  
Query: 342  atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            ||||||||||| |||||||||||||| || |||| ||| || ||||||||||||
Sbjct: 1188 atgaagacgtcgcccaggatccagagcggcccgccaggcggggggatgtccatg 1135



to top

>ref|XM_871531.1| PREDICTED: Bos taurus cathepsin D (lysosomal aspartyl protease),
            transcript variant 3 (CTSD), mRNA
          Length = 1955

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                  
Query: 342  atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            ||||||||||| |||||||||||||| || |||| ||| || ||||||||||||
Sbjct: 1233 atgaagacgtcgcccaggatccagagcggcccgccaggcggggggatgtccatg 1180



to top

>gb|BT013775.1| Lycopersicon esculentum clone 132663F, mRNA sequence
          Length = 1929

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 595  gatcctgggtcttgttctgtgcaagttggttctgcatccatacaac 640
            ||||||| |||| |||||||  ||||||||||||||||||||||||
Sbjct: 1417 gatcctgagtctggttctgtctaagttggttctgcatccatacaac 1372



to top

>emb|AM048627.1| Canis familiaris mRNA for cathepsin D (ctsd gene)
          Length = 1524

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                  
Query: 342  atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            |||||||| || ||||||||||||||||| |||| ||| || ||||||||||||
Sbjct: 1232 atgaagacatcacccaggatccagagaggcccgccaggtggggggatgtccatg 1179



to top

>dbj|AB055312.1| Bos taurus cat-D mRNA for cathepsin D, partial cds
          Length = 1578

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                  
Query: 342  atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            ||||||||||| |||||||||||||| || |||| ||| || ||||||||||||
Sbjct: 1092 atgaagacgtcgcccaggatccagagcggcccgccaggcggggggatgtccatg 1039



to top

>ref|NM_101062.2| Arabidopsis thaliana aspartic-type endopeptidase/ pepsin A AT1G11910
            mRNA, complete cds
          Length = 1898

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                        
Query: 316  agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 375
            ||||||| |||||||||||   ||||||||| || ||||||| |||||||||||| || |
Sbjct: 1532 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatccagagaggtccac 1473

                                                                        
Query: 376  gaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcac 435
            |||| || |  | ||| |  ||  | || |||||||||||||| ||  ||| ||| ||||
Sbjct: 1472 gaggtggagcaacgtcaagagcaataaaaccactgatgcactgtgccacaggtccctcac 1413

                                     
Query: 436  caaccttcaggatatactcttctgg 460
            |||| ||||| | ||||||||||||
Sbjct: 1412 caactttcagaacatactcttctgg 1388



to top

>gb|AY063974.1| Arabidopsis thaliana putative aspartic proteinase (At1g11910) mRNA,
            complete cds
          Length = 1830

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                        
Query: 316  agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 375
            ||||||| |||||||||||   ||||||||| || ||||||| |||||||||||| || |
Sbjct: 1532 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatccagagaggtccac 1473

                                                                        
Query: 376  gaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcac 435
            |||| || |  | ||| |  ||  | || |||||||||||||| ||  ||| ||| ||||
Sbjct: 1472 gaggtggagcaacgtcaagagcaataaaaccactgatgcactgtgccacaggtccctcac 1413

                                     
Query: 436  caaccttcaggatatactcttctgg 460
            |||| ||||| | ||||||||||||
Sbjct: 1412 caactttcagaacatactcttctgg 1388



to top

>gb|AY056403.1| Arabidopsis thaliana At1g11910/F12F1_24 mRNA, complete cds
          Length = 1820

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                        
Query: 316  agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 375
            ||||||| |||||||||||   ||||||||| || ||||||| |||||||||||| || |
Sbjct: 1532 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatccagagaggtccac 1473

                                                                        
Query: 376  gaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcac 435
            |||| || |  | ||| |  ||  | || |||||||||||||| ||  ||| ||| ||||
Sbjct: 1472 gaggtggagcaacgtcaagagcaataaaaccactgatgcactgtgccacaggtccctcac 1413

                                     
Query: 436  caaccttcaggatatactcttctgg 460
            |||| ||||| | ||||||||||||
Sbjct: 1412 caactttcagaacatactcttctgg 1388



to top

>gb|AY056387.1| Arabidopsis thaliana At1g11910/F12F1_24 mRNA, complete cds
          Length = 1874

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                        
Query: 316  agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 375
            ||||||| |||||||||||   ||||||||| || ||||||| |||||||||||| || |
Sbjct: 1532 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatccagagaggtccac 1473

                                                                        
Query: 376  gaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcac 435
            |||| || |  | ||| |  ||  | || |||||||||||||| ||  ||| ||| ||||
Sbjct: 1472 gaggtggagcaacgtcaagagcaataaaaccactgatgcactgtgccacaggtccctcac 1413

                                     
Query: 436  caaccttcaggatatactcttctgg 460
            |||| ||||| | ||||||||||||
Sbjct: 1412 caactttcagaacatactcttctgg 1388



to top

>dbj|AK221098.1| Arabidopsis thaliana mRNA for putative aspartic proteinase,
           complete cds, clone: RAFL22-84-P18
          Length = 721

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                       
Query: 316 agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 375
           ||||||| |||||||||||   ||||||||| || ||||||| |||||||||||| || |
Sbjct: 428 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatccagagaggtccac 369

                                                                       
Query: 376 gaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcac 435
           |||| || |  | ||| |  ||  | || |||||||||||||| ||  ||| ||| ||||
Sbjct: 368 gaggtggagcaacgtcaagagcaataaaaccactgatgcactgtgccacaggtccctcac 309

                                    
Query: 436 caaccttcaggatatactcttctgg 460
           |||| ||||| | ||||||||||||
Sbjct: 308 caactttcagaacatactcttctgg 284



to top

>dbj|AK221202.1| Arabidopsis thaliana mRNA for putative aspartic proteinase,
           complete cds, clone: RAFL23-06-J05
          Length = 1039

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                       
Query: 316 agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 375
           ||||||| |||||||||||   ||||||||| || ||||||| |||||||||||| || |
Sbjct: 656 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatccagagaggtccac 597

                                                                       
Query: 376 gaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcac 435
           |||| || |  | ||| |  ||  | || |||||||||||||| ||  ||| ||| ||||
Sbjct: 596 gaggtggagcaacgtcaagagcaataaaaccactgatgcactgtgccacaggtccctcac 537

                                    
Query: 436 caaccttcaggatatactcttctgg 460
           |||| ||||| | ||||||||||||
Sbjct: 536 caactttcagaacatactcttctgg 512



to top

>gb|AY088657.1| Arabidopsis thaliana clone 8972 mRNA, complete sequence
          Length = 1814

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                        
Query: 316  agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 375
            ||||||| |||||||||||   ||||||||| || ||||||| |||||||||||| || |
Sbjct: 1532 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatccagagaggtccac 1473

                                                                        
Query: 376  gaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcac 435
            |||| || |  | ||| |  ||  | || |||||||||||||| ||  ||| ||| ||||
Sbjct: 1472 gaggtggagcaacgtcaagagcaataaaaccactgatgcactgtgccacaggtccctcac 1413

                                     
Query: 436  caaccttcaggatatactcttctgg 460
            |||| ||||| | ||||||||||||
Sbjct: 1412 caactttcagaacatactcttctgg 1388



to top

>gb|BT001980.1| Arabidopsis thaliana clone U11602 putative aspartic proteinase
            (At1g11910) mRNA, complete cds
          Length = 1552

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                        
Query: 316  agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 375
            ||||||| |||||||||||   ||||||||| || ||||||| |||||||||||| || |
Sbjct: 1483 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatccagagaggtccac 1424

                                                                        
Query: 376  gaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcac 435
            |||| || |  | ||| |  ||  | || |||||||||||||| ||  ||| ||| ||||
Sbjct: 1423 gaggtggagcaacgtcaagagcaataaaaccactgatgcactgtgccacaggtccctcac 1364

                                     
Query: 436  caaccttcaggatatactcttctgg 460
            |||| ||||| | ||||||||||||
Sbjct: 1363 caactttcagaacatactcttctgg 1339



to top

>gb|U51036.1|ATU51036 Arabidopsis thaliana aspartic proteinase mRNA, partial cds
          Length = 1722

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                        
Query: 316  agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 375
            ||||||| |||||||||||   ||||||||| || ||||||| |||||||||||| || |
Sbjct: 1424 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatccagagaggtccac 1365

                                                                        
Query: 376  gaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcac 435
            |||| || |  | ||| |  ||  | || |||||||||||||| ||  ||| ||| ||||
Sbjct: 1364 gaggtggagcaacgtcaagagcaataaaaccactgatgcactgtgccacaggtccctcac 1305

                                     
Query: 436  caaccttcaggatatactcttctgg 460
            |||| ||||| | ||||||||||||
Sbjct: 1304 caactttcagaacatactcttctgg 1280



to top

>gb|AY672651.1| Solanum tuberosum Asp mRNA, complete cds
          Length = 1680

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 327  gtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgagg 379
            ||||||||||| |||||||| || ||||| || ||||| ||||||||||||||
Sbjct: 1443 gtgtggtacggccccatgaatacatctccaagaatccaaagaggaccgcgagg 1391



to top

>gb|DQ241852.1| Solanum tuberosum clone 188C11 aspartic protease precursor-like mRNA,
            complete cds
          Length = 1764

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 315  tagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccg 374
            |||||||| || ||||| ||||| |||||||| || ||||| || ||||| |||||||||
Sbjct: 1508 tagtcaaacacagtgtgatacggccccatgaatacatctccaagaatccaaagaggaccg 1449

                 
Query: 375  cgagg 379
            |||||
Sbjct: 1448 cgagg 1444



to top

>emb|CR662614.2|CNS0FA8S Tetraodon nigroviridis full-length cDNA
          Length = 629

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 321 aagacggtgtggtacgggcccatgaagacgtctcccaggatcca 364
           |||||||||| |||| | || |||||||||||||||||||||||
Sbjct: 244 aagacggtgtagtactgaccgatgaagacgtctcccaggatcca 201



to top

>emb|CR660862.2|CNS0F8W4 Tetraodon nigroviridis full-length cDNA
          Length = 626

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 321 aagacggtgtggtacgggcccatgaagacgtctcccaggatcca 364
           |||||||||| |||| | || |||||||||||||||||||||||
Sbjct: 245 aagacggtgtagtactgaccgatgaagacgtctcccaggatcca 202



to top

>emb|X88774.1|BORNAPAP B.oleracea mRNA for putative aspartic protease (partial)
          Length = 431

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 316 agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 375
           ||||||| |||||||||||   ||||||||| || ||||| |||||||||||||| || |
Sbjct: 238 agtcaaacacggtgtggtatttgcccatgaacacatctccaaggatccagagaggtccac 179

               
Query: 376 gagg 379
           ||||
Sbjct: 178 gagg 175



to top

>gb|U61396.2| Vigna unguiculata aspartic proteinase mRNA, complete cds
          Length = 1842

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 339  cccatgaagacgtctcccaggatccagagaggaccgcgaggagg 382
            |||||||||||||| || |||||||||||||| || ||||||||
Sbjct: 1604 cccatgaagacgtccccaaggatccagagagggccacgaggagg 1561



to top

>gb|AF082029.1|AF082029 Hemerocallis hybrid cultivar senescence-associated protein 4 (SA4)
            mRNA, complete cds
          Length = 1970

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 89/108 (82%), Gaps = 1/108 (0%)
 Strand = Plus / Minus

                                                                        
Query: 387  atgtccatggctgtgaatccact-gatgcactgggcagcagctccttcaccaaccttcag 445
            ||||||| ||| ||||||||||| ||| ||||| || |||| ||||||||||||||||| 
Sbjct: 1502 atgtccaaggcagtgaatccacttgatacactgagctgcaggtccttcaccaaccttcaa 1443

                                                            
Query: 446  gatatactcttctggtttcagcgcaaacttcttgccaccaatggtgaa 493
             | |||||  |||| | | ||  |||||| |||||||||||| |||||
Sbjct: 1442 aacatactgctctgctgtaaggtcaaactgcttgccaccaatagtgaa 1395



to top

>gb|AY389666.1| Hyacinthus orientalis aspartic proteinase mRNA, partial cds
          Length = 585

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 81/99 (81%)
 Strand = Plus / Minus

                                                                       
Query: 341 catgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatggctgt 400
           ||||||||| || ||||  |||||||||||||| || || ||||| |  |||| ||| ||
Sbjct: 364 catgaagacatcacccaaaatccagagaggaccccgcggtggcggtacatccaaggccgt 305

                                                  
Query: 401 gaatccactgatgcactgggcagcagctccttcaccaac 439
           |||||| |||||||| || || |||||||| || |||||
Sbjct: 304 gaatccgctgatgcattgtgctgcagctccctccccaac 266



to top

>emb|X77260.1|BOASPR B. oleracea L. gene for aspartic protease (partial)
          Length = 1121

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 316 agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagagg 370
           ||||||| |||||||||||   ||||||||| || ||||||| ||||||||||||
Sbjct: 841 agtcaaacacggtgtggtatttgcccatgaatacatctcccaagatccagagagg 787



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 405 ccactgatgcactgggcagcagctccttcaccaaccttcaggatatactc 454
           |||||||||||||| || ||||| || |||||||||||||| | ||||||
Sbjct: 752 ccactgatgcactgtgctgcagcgccctcaccaaccttcagaacatactc 703



to top

>dbj|AB045891.1| Nepenthes alata NaAP1 mRNA for aspartic proteinase 1, complete cds
          Length = 1802

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 111/139 (79%)
 Strand = Plus / Minus

                                                                        
Query: 315  tagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccg 374
            |||||||| || ||||| ||| | |||||||| | |||||||| |||||||||||| || 
Sbjct: 1596 tagtcaaacacagtgtgatactgacccatgaaaatgtctcccaagatccagagaggtcca 1537

                                                                        
Query: 375  cgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttca 434
             ||||||| |  | ||| | ||||||||| || |||||||| || |  ||| ||||||| 
Sbjct: 1536 agaggaggggccacgtctaaggctgtgaagccgctgatgcattgagttgcaactccttcg 1477

                               
Query: 435  ccaaccttcaggatatact 453
            ||||| |  ||||||||||
Sbjct: 1476 ccaacttgaaggatatact 1458



to top

>gb|AF156788.1| Pleuronectes americanus pepsinogen A form IIb precursor (pep2b) mRNA,
            complete cds
          Length = 1280

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 342  atgaagacgtctcccaggatccagag 367
            ||||||||||||||||||||||||||
Sbjct: 1099 atgaagacgtctcccaggatccagag 1074



to top

>dbj|AB120129.1| Paralichthys olivaceus pep mRNA for pepsinogen, complete cds
          Length = 1307

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 342  atgaagacgtctcccaggatccagag 367
            ||||||||||||||||||||||||||
Sbjct: 1104 atgaagacgtctcccaggatccagag 1079



to top

>emb|X81984.1|CCCYPRSN C.cardunculus mRNA for cyprosin
          Length = 1757

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                        
Query: 327  gtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcggg 386
            ||||||||  ||||||| || || ||||||| |||||| ||||| || |||||||| |  
Sbjct: 1531 gtgtggtatcggcccataaaaacatctcccaagatccatagaggtccacgaggaggggcc 1472

                                         
Query: 387  atgtccatggctgtgaatccactgatgca 415
            |  ||||| || |||||||||||||||||
Sbjct: 1471 acatccatagcagtgaatccactgatgca 1443



to top

>gb|AY103665.1| Zea mays PCO108960 mRNA sequence
          Length = 1413

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                        
Query: 309  ttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagaga 368
            |||||| |||| || || |||||||| |  |||||||||||||| || || |||||||||
Sbjct: 1092 ttgccgaagtcgaacaccgtgtggtaagctcccatgaagacgtccccaagaatccagaga 1033

                 
Query: 369  ggacc 373
            |||||
Sbjct: 1032 ggacc 1028



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 567 cacagctggttaacgtaatctagtatgagatcctgggtcttgtt 610
           |||||||||||| |||| |  |||||||| |||| |||||||||
Sbjct: 834 cacagctggttagcgtactgcagtatgagctccttggtcttgtt 791



to top

>gb|AY826351.2| Fagopyrum esculentum aspartic proteinase 9 mRNA, complete cds
          Length = 1900

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 327  gtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgaggagg 382
            ||||||||| | |||||||||| ||| ||||  |||||||||||||| || |||||
Sbjct: 1609 gtgtggtactgacccatgaagatgtcgcccaatatccagagaggaccacgtggagg 1554



to top

>emb|X69193.1|VCCYNA V.cardunculus mRNA for cynarase
          Length = 1603

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                        
Query: 390  tccatggctgtgaatccactgatgcactgggcagcagctccttcaccaaccttcaggata 449
            |||||||| ||||||||||| ||||| || || |  |||||||| ||||| ||||||| |
Sbjct: 1315 tccatggcggtgaatccacttatgcattgtgctgttgctccttccccaactttcaggaca 1256

                
Query: 450  tact 453
            ||||
Sbjct: 1255 tact 1252



to top

>dbj|AB091762.1| Glycine max soyAP4 mRNA for aspartic proteinase 4, partial cds
          Length = 664

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 339 cccatgaagacgtctcccaggatccagagaggaccgcgaggagg 382
           ||||||||||| ||||| |||||||| ||||| || ||||||||
Sbjct: 450 cccatgaagacatctccaaggatccatagagggccacgaggagg 407



to top

>emb|AJ550951.1|TBE550951 Trematomus bernacchii mRNA for pepsin A3
          Length = 1298

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 342  atgaagacgtctcccaggatcca 364
            |||||||||||||||||||||||
Sbjct: 1098 atgaagacgtctcccaggatcca 1076



to top

>emb|AJ131678.1|CDR131678 Camelus dromedarius mRNA for pepsin
          Length = 1221

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 321  aagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            |||||||||  |||| |||  ||||||||||| ||||||||||||||
Sbjct: 1155 aagacggtgaagtactggcggatgaagacgtcacccaggatccagag 1109



to top

>dbj|AB089792.1| Oryctolagus cuniculus mRNA for pepsinogen III, complete cds
          Length = 1364

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 321  aagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            |||||||||  |||| |||  ||||||||||| ||||||||||||||
Sbjct: 1145 aagacggtgaagtactggcggatgaagacgtcacccaggatccagag 1099



to top

>dbj|AB089791.1| Oryctolagus cuniculus mRNA for pepsinogen II-4, complete cds
          Length = 1268

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 321  aagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            |||||||||  |||| |||  ||||||||||| ||||||||||||||
Sbjct: 1155 aagacggtgaagtactggcggatgaagacgtcacccaggatccagag 1109



to top

>dbj|AB089790.1| Oryctolagus cuniculus mRNA for pepsinogen II-1, complete cds
          Length = 1454

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 321  aagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            |||||||||  |||| |||  ||||||||||| ||||||||||||||
Sbjct: 1246 aagacggtgaagtactggcggatgaagacgtcacccaggatccagag 1200



to top

>gb|M59237.1|RABPEPIII Rabbit pepsinogen III mRNA, complete cds
          Length = 1371

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 321  aagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            |||||||||  |||| |||  ||||||||||| ||||||||||||||
Sbjct: 1150 aagacggtgaagtactggcggatgaagacgtcacccaggatccagag 1104



to top

>gb|M59235.1|RABPEPII23 Rabbit pepsinogen 11-2/3 mRNA, complete cds
          Length = 1266

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 321  aagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            |||||||||  |||| |||  ||||||||||| ||||||||||||||
Sbjct: 1153 aagacggtgaagtactggcggatgaagacgtcacccaggatccagag 1107



to top

>dbj|AB047245.1| Rhinolophus ferrumequinum pgnA mRNA for pepsinogen A, complete cds
          Length = 1161

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 317  gtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            |||||||||||||  |||| | |  ||||||||||| ||||||||||||||
Sbjct: 1122 gtcaaagacggtgaagtactgacgaatgaagacgtcgcccaggatccagag 1072



to top

>dbj|AB047244.1| Sorex unguiculatus pgnA mRNA for pepsinogen A, complete cds
          Length = 1381

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 321  aagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 367
            |||||||||  |||| |||  ||||||||||| ||||||||||||||
Sbjct: 1143 aagacggtgaagtactggcggatgaagacgtcgcccaggatccagag 1097



to top

>ref|XM_475576.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1491

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 339  cccatgaagacgtctcccaggatccagagaggaccgcg 376
            ||||||||||| ||||| || ||||| |||||||||||
Sbjct: 1430 cccatgaagacatctccaagaatccaaagaggaccgcg 1393



to top

>gb|BT018637.1| Zea mays clone EL01N0504C03.d mRNA sequence
          Length = 1568

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 360  atccagagaggaccgcgaggaggcgg 385
            |||||||||||||| |||||||||||
Sbjct: 1198 atccagagaggaccacgaggaggcgg 1173



to top

>ref|XM_545694.2| PREDICTED: Canis familiaris similar to cathepsin E isoform a
            preproprotein (LOC488577), mRNA
          Length = 1287

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 342  atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtc 391
            |||||||| || ||||||||||||||||| |||   |||||| |||||||
Sbjct: 1220 atgaagacatcgcccaggatccagagaggcccggctggaggctggatgtc 1171



to top

>gb|AC161241.18| Medicago truncatula clone mth2-193c3, complete sequence
          Length = 125129

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 483   ccaatggtgaactcaatgtcag 504
             ||||||||||||||||||||||
Sbjct: 96054 ccaatggtgaactcaatgtcag 96033



to top

>emb|AL450337.24| Human DNA sequence from clone RP11-51B10 on chromosome 10 Contains the 5'
              end of the PARD3 gene for par-3 partitioning defective 3
              homolog (C.elegans), a novel gene, a pseudogene similar to
              part of synovial sarcoma translocation, chromosome 18
              protein (SS18), a peroxiredoxin 2 (PRDX2) pseudogene and a
              CpG island, complete sequence
          Length = 173987

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 390    tccatggctgtgaatccactgatgca 415
              ||||||| ||||||||||||||||||
Sbjct: 124262 tccatggatgtgaatccactgatgca 124237



to top

>emb|AJ579366.1|CRE579366 Chlamydomonas reinhardtii mRNA for aspartic proteinase (chlapsin
            gene)
          Length = 2443

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 311  gccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcca 364
            ||||||||| || |||||||| || | ||||| ||| | |||||||||||||||
Sbjct: 1847 gccgtagtcgaacacggtgtgataggcgcccaggaatatgtctcccaggatcca 1794



to top

>gb|AC169788.4| Medicago truncatula clone mth2-28c18, complete sequence
          Length = 122876

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                            
Query: 318    tcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcc 363
              |||||||| ||||||||  ||||||||||||  ||||| |||||||
Sbjct: 115443 tcaaagactgtgtggtaacggcccatgaagatatctccaaggatcc 115488



to top

>gb|AC134967.20| Medicago truncatula clone mth2-26b8, complete sequence
          Length = 133030

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                          
Query: 318  tcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcc 363
            |||||||| ||||||||  ||||||||||||  ||||| |||||||
Sbjct: 6263 tcaaagactgtgtggtaacggcccatgaagatatctccaaggatcc 6218



to top

>emb|AJ550949.2|TBE550949 Trematomus bernacchii mRNA for pepsin A1
          Length = 1270

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 342  atgaagacgtctcccaggatccagag 367
            |||||||| |||||||||||||||||
Sbjct: 1066 atgaagacatctcccaggatccagag 1041



to top

>emb|AJ550950.1|TBE550950 Trematomus bernacchii partial mRNA for pepsin A2
          Length = 1259

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 342  atgaagacgtctcccaggatccagag 367
            |||||||| |||||||||||||||||
Sbjct: 1059 atgaagacatctcccaggatccagag 1034



to top

>ref|NM_205054.1| Gallus gallus pepsinogen (LOC395926), mRNA
          Length = 1276

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 342  atgaagacgtctcccaggatccagag 367
            |||||||||||||||| |||||||||
Sbjct: 1104 atgaagacgtctcccaagatccagag 1079



to top

>gb|AF164143.1|AF164143 Ovis aries cathepsin D (CTSD) mRNA, partial cds
          Length = 1095

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 342  atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 395
            ||||| ||||| |||||||||||||| || ||||  || || ||||||||||||
Sbjct: 1088 atgaacacgtcgcccaggatccagagcggcccgccgggcggggggatgtccatg 1035



to top

>dbj|AK065206.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002F13, full
            insert sequence
          Length = 1900

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 339  cccatgaagacgtctcccaggatccagagaggaccgcg 376
            ||||||||||| ||||| || ||||| |||||||||||
Sbjct: 1582 cccatgaagacatctccaagaatccaaagaggaccgcg 1545



to top

>gb|AY103982.1| Zea mays PCO140262 mRNA sequence
          Length = 1929

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 360  atccagagaggaccgcgaggaggcgg 385
            |||||||||||||| |||||||||||
Sbjct: 1573 atccagagaggaccacgaggaggcgg 1548



to top

>dbj|D12777.1|RICASPPRO Oryza sativa (japonica cultivar-group) mRNA for aspartic proteinase,
            complete cds
          Length = 1774

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 339  cccatgaagacgtctcccaggatccagagaggaccgcg 376
            ||||||||||| ||||| || ||||| |||||||||||
Sbjct: 1511 cccatgaagacatctccaagaatccaaagaggaccgcg 1474



to top

>dbj|D00215.1|CHKPSN Gallus gallus mRNA for pepsinogen, complete cds
          Length = 1276

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 342  atgaagacgtctcccaggatccagag 367
            |||||||||||||||| |||||||||
Sbjct: 1104 atgaagacgtctcccaagatccagag 1079



to top

>dbj|AB028888.1| Oryza sativa RAP mRNA for aspartic proteinase, partial cds
          Length = 492

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 339 cccatgaagacgtctcccaggatccagagaggaccgcg 376
           ||||||||||| ||||| || ||||| |||||||||||
Sbjct: 218 cccatgaagacatctccaagaatccaaagaggaccgcg 181



to top

>dbj|AB047243.1| Suncus murinus pgnA mRNA for pepsinogen A, complete cds
          Length = 1362

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 342  atgaagacgtctcccaggatccagag 367
            ||||||||||| ||||||||||||||
Sbjct: 1169 atgaagacgtcacccaggatccagag 1144



to top

>ref|NM_116684.3| Arabidopsis thaliana aspartic-type endopeptidase/ pepsin A AT4G04460
            mRNA, complete cds
          Length = 1712

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                 
Query: 327  gtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgagg 379
            |||||||| || ||||||||||  || |||| |||||||||||| || |||||
Sbjct: 1535 gtgtggtatggtcccatgaagatatcacccaagatccagagaggtccacgagg 1483



to top

>ref|XM_657624.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5112.2), mRNA
          Length = 2349

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 366  agaggaccgcgaggaggcggg 386
            |||||||||||||||||||||
Sbjct: 2247 agaggaccgcgaggaggcggg 2267



to top

>gb|AC157650.2| Mus musculus BAC clone RP24-573N21 from chromosome 14, complete
             sequence
          Length = 186859

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 138   catgtcaggcagggtctttga 158
             |||||||||||||||||||||
Sbjct: 45832 catgtcaggcagggtctttga 45812



to top

>emb|AL603831.23| Human DNA sequence from clone RP11-486H9 on chromosome 10 Contains the
             3' end of the gene for adenovirus 5 E1A binding protein
             (BS69), the gene for a novel protein (KIAA0934) and four
             CpG islands, complete sequence
          Length = 179755

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 170   cagcatatatacacaacacac 190
             |||||||||||||||||||||
Sbjct: 54099 cagcatatatacacaacacac 54119



to top

>emb|AL365502.57| Human DNA sequence from clone RP11-48C7 on chromosome 9q34.2-34.3
             Contains the gene for nasal embryonic luteinizing
             hormone-releasing hormone factor (DKFZP586J1624), a novel
             gene (FLJ31318), the MRPL41 gene for mitochondrial
             ribosomal protein L41 (RPML27, MRP-L270), a novel gene
             (LOC9271), the gene for melanin-concentrating hormone
             receptor 1 interacting zinc-finger protein (ZMYND17)
             (MIZIP), a novel gene (MGC40555), a novel protein and
             eleven CpG islands, complete sequence
          Length = 174995

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 340   ccatgaagacgtctcccagga 360
             |||||||||||||||||||||
Sbjct: 15785 ccatgaagacgtctcccagga 15805



to top

>emb|AL118509.9|HSJ770C23 Human DNA sequence from clone RP4-770C23 on chromosome 20 Contains part
             of the C20orf23 gene for a novel protein similar to KIF1
             type and other kinesin-like proteins, complete sequence
          Length = 81487

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 590   tatgagatcctgggtcttgtt 610
             |||||||||||||||||||||
Sbjct: 13775 tatgagatcctgggtcttgtt 13755



to top

>emb|AJ009838.1|PSI9838 Podarcis sicula mRNA for ovarian Cathepsin D
          Length = 1442

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 342  atgaagacgtctcccaggatccagagagg 370
            |||||||| |||||||||||||| |||||
Sbjct: 1268 atgaagacatctcccaggatccaaagagg 1240



to top

>emb|AL832856.1|HSM804167 Homo sapiens mRNA; cDNA DKFZp667P1625 (from clone DKFZp667P1625)
          Length = 5327

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 340  ccatgaagacgtctcccagga 360
            |||||||||||||||||||||
Sbjct: 4335 ccatgaagacgtctcccagga 4315



to top

>dbj|AK221179.1| Arabidopsis thaliana mRNA for putative aspartic protease, complete
           cds, clone: RAFL22-98-B11
          Length = 536

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 327 gtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgagg 379
           |||||||| || ||||||||||  || |||| |||||||||||| || |||||
Sbjct: 355 gtgtggtatggtcccatgaagatatcacccaagatccagagaggtccacgagg 303



to top

>gb|AF372974.1|AF372974 Arabidopsis thaliana AT4g04460/T26N6_7 mRNA, complete cds
          Length = 1677

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                 
Query: 327  gtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgagg 379
            |||||||| || ||||||||||  || |||| |||||||||||| || |||||
Sbjct: 1519 gtgtggtatggtcccatgaagatatcacccaagatccagagaggtccacgagg 1467



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 174     atatatacacaacacacatca 194
               |||||||||||||||||||||
Sbjct: 2859077 atatatacacaacacacatca 2859097



to top

>emb|BX827174.1|CNS0A2UE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS1ZB10 of Adult vegetative tissue of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1688

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                 
Query: 327  gtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgagg 379
            |||||||| || ||||||||||  || |||| |||||||||||| || |||||
Sbjct: 1535 gtgtggtatggtcccatgaagatatcacccaagatccagagaggtccacgagg 1483



to top

>emb|BX829292.1|CNS0A2OQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTSIL89ZE03 of Silique of strain col-0 of Arabidopsis
            thaliana (thale cress)
          Length = 1593

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                 
Query: 327  gtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgagg 379
            |||||||| || ||||||||||  || |||| |||||||||||| || |||||
Sbjct: 1486 gtgtggtatggtcccatgaagatatcacccaagatccagagaggtccacgagg 1434



to top

>dbj|AP005632.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBb0050B07
          Length = 142134

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 174   atatatacacaacacacatca 194
             |||||||||||||||||||||
Sbjct: 29364 atatatacacaacacacatca 29384



to top

>dbj|AK024443.1| Homo sapiens mRNA for FLJ00033 protein, partial cds
          Length = 4150

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 340  ccatgaagacgtctcccagga 360
            |||||||||||||||||||||
Sbjct: 3176 ccatgaagacgtctcccagga 3156



to top

>gb|AY961419.1| Phytophthora infestans clone PB005D3 aspartic protease mRNA, complete
            cds
          Length = 1312

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 316  agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcca 364
            |||||||||| |||| || |  || |||||||||||| |||||||||||
Sbjct: 1151 agtcaaagactgtgtagtgcttgcgcatgaagacgtcgcccaggatcca 1103



to top

>gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome
          Length = 5411809

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 603     gtcttgttctgtgcaagttgg 623
               |||||||||||||||||||||
Sbjct: 2791025 gtcttgttctgtgcaagttgg 2791045



to top

>gb|AF036319.1|AF036319 Sparus aurata cathepsin D mRNA, complete cds
          Length = 1837

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                        
Query: 317  gtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcg 376
            ||||||||| |||| ||||   || ||||| || |||||||||||||| || || ||   
Sbjct: 1236 gtcaaagacagtgtagtacttcccgatgaatacatctcccaggatccacagggggcctgc 1177

                                 
Query: 377  aggaggcgggatgtccatggc 397
            |||||| ||||||||||||||
Sbjct: 1176 aggaggagggatgtccatggc 1156



to top

>gb|AE017139.1| Yersinia pestis biovar Medievalis str. 91001 section 13 of 16 of the
              complete genome
          Length = 294253

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 177    tatacacaacacacatcacc 196
              ||||||||||||||||||||
Sbjct: 284374 tatacacaacacacatcacc 284355



to top

>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome
          Length = 2467205

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 244    cgcctccacgatggggcgct 263
              ||||||||||||||||||||
Sbjct: 288303 cgcctccacgatggggcgct 288284



to top

>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 177     tatacacaacacacatcacc 196
               ||||||||||||||||||||
Sbjct: 4255647 tatacacaacacacatcacc 4255666



to top

>gb|AY168570.1| Leishmania tarentolae 6-phosphogluconate dehydrogenase gene,
           partial cds
          Length = 822

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 243 ccgcctccacgatggggcgc 262
           ||||||||||||||||||||
Sbjct: 193 ccgcctccacgatggggcgc 174



to top

>gb|AC005105.3| Homo sapiens BAC clone CTA-491N20 from 7, complete sequence
          Length = 177206

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 410    gatgcactgggcagcagctc 429
              ||||||||||||||||||||
Sbjct: 119877 gatgcactgggcagcagctc 119896



to top

>gb|AY528719.1| Homo sapiens estrogen-related receptor gamma (ESRRG) gene, complete cds
          Length = 590284

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 78     caacatcttaggggcaaacg 97
              ||||||||||||||||||||
Sbjct: 393555 caacatcttaggggcaaacg 393574



to top

>emb|CT009567.9| Mouse DNA sequence from clone RP23-50H13 on chromosome 16, complete
            sequence
          Length = 213704

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 612  tgtgcaagttggttctgcat 631
            ||||||||||||||||||||
Sbjct: 6905 tgtgcaagttggttctgcat 6886



to top

>gb|AC123938.3| Mus musculus BAC clone RP23-412I12 from chromosome 8, complete
            sequence
          Length = 193352

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 173  catatatacacaacacacat 192
            ||||||||||||||||||||
Sbjct: 5837 catatatacacaacacacat 5818



to top

>gb|AC122434.2| Mus musculus BAC clone RP24-198G2 from chromosome 8, complete
            sequence
          Length = 168940

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 173  catatatacacaacacacat 192
            ||||||||||||||||||||
Sbjct: 8973 catatatacacaacacacat 8992



to top

>emb|AL389888.8| Human DNA sequence from clone RP11-389K14 on chromosome 9 Contains two
              olfactory receptor pseudogenes and the 3' end of a novel
              gene, complete sequence
          Length = 202874

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    agcagcatgcagcatatatacaca 184
              ||||| ||||||||||||||||||
Sbjct: 168294 agcaggatgcagcatatatacaca 168271



to top

>gb|AC102705.10| Mus musculus, clone RP24-400C16, complete sequence
          Length = 135473

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 148   agggtctttgaaaagcagca 167
             ||||||||||||||||||||
Sbjct: 24515 agggtctttgaaaagcagca 24534



to top

>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 177     tatacacaacacacatcacc 196
               ||||||||||||||||||||
Sbjct: 4589305 tatacacaacacacatcacc 4589286



to top

>emb|AJ414160.1| Yersinia pestis strain CO92 complete genome; segment 20/20
          Length = 203728

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 177   tatacacaacacacatcacc 196
             ||||||||||||||||||||
Sbjct: 63478 tatacacaacacacatcacc 63459



to top

>gb|AC092211.7| Oryza sativa chromosome 10  P0031G09 genomic sequence, complete
             sequence
          Length = 17072

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 396   gctgtgaatccactgatgca 415
             ||||||||||||||||||||
Sbjct: 12155 gctgtgaatccactgatgca 12136



to top

>gb|AC153567.6| Mus musculus 10 BAC RP23-187C5 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 226945

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 150    ggtctttgaaaagcagcatg 169
              ||||||||||||||||||||
Sbjct: 222625 ggtctttgaaaagcagcatg 222644



to top

>gb|AF149806.1| Oryza sativa hypothetical protein, fertilin alpha subunit, membrane
            protein homolog, and Myb-related protein genes, complete
            cds; and unknown gene
          Length = 33178

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  tctttgaaaagcagcatgca 171
            ||||||||||||||||||||
Sbjct: 5386 tctttgaaaagcagcatgca 5367



to top

>gb|AC096635.2| Homo sapiens chromosome 1 clone RP11-75H16, complete sequence
          Length = 173256

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 78    caacatcttaggggcaaacg 97
             ||||||||||||||||||||
Sbjct: 51055 caacatcttaggggcaaacg 51036



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 165      gcatgcagcatatatacaca 184
                ||||||||||||||||||||
Sbjct: 19532023 gcatgcagcatatatacaca 19532004



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
              complete sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 152    tctttgaaaagcagcatgca 171
              ||||||||||||||||||||
Sbjct: 379557 tctttgaaaagcagcatgca 379538



to top

>emb|AL662997.3|OSJN00205 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0039F02,
             complete sequence
          Length = 122499

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 165   gcatgcagcatatatacaca 184
             ||||||||||||||||||||
Sbjct: 52670 gcatgcagcatatatacaca 52651



to top

>gb|AC159380.8| Mus musculus 10 BAC RP24-460M18 (Roswell Park Cancer Institute
            (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 196877

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 150  ggtctttgaaaagcagcatg 169
            ||||||||||||||||||||
Sbjct: 7462 ggtctttgaaaagcagcatg 7481



to top

>dbj|AB080684.1| Xenopus laevis CE1 mRNA for cathepsin E1, complete cd
          Length = 1604

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 351  tctcccaggatccagagagg 370
            ||||||||||||||||||||
Sbjct: 1124 tctcccaggatccagagagg 1105



to top

>dbj|AB179551.1| Takifugu rubripes NTS mRNA for nothepsin, complete cds
          Length = 1245

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                            
Query: 317  gtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcca 364
            |||||||||| ||| |||| ||  || ||| |||||||||||||||||
Sbjct: 1191 gtcaaagacgctgtagtactgggtcaggaacacgtctcccaggatcca 1144



to top

>dbj|AB179548.1| Takifugu rubripes CTSD1 mRNA for cathepsin D1, complete cds
          Length = 1191

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 321  aagacggtgtggtacgggcccatgaagacgtctcccaggatcca 364
            |||||||||| |||| | || || ||||||||||| ||||||||
Sbjct: 1148 aagacggtgtagtactgaccaataaagacgtctccaaggatcca 1105



to top

>gb|AC154228.1| Mus musculus BAC clone RP24-143I4 from chromosome 14, complete sequence
          Length = 164697

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 173   catatatacacaacacacat 192
             ||||||||||||||||||||
Sbjct: 55258 catatatacacaacacacat 55277



to top

>dbj|AP001129.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0644B06
          Length = 194509

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 152   tctttgaaaagcagcatgca 171
             ||||||||||||||||||||
Sbjct: 89510 tctttgaaaagcagcatgca 89491



to top

>dbj|AB091763.1| Glycine max soyAP5 mRNA for aspartic proteinase 5, partial cds
          Length = 636

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 288 ttggcaaagccaatacgcagcttgccgtagtcaaagacggtgtg 331
           |||||||| ||||  || || ||||| |||||||||||||||||
Sbjct: 518 ttggcaaaaccaactcggagattgccatagtcaaagacggtgtg 475



to top

>dbj|AB069959.1| Glycine max soyAP1 mRNA for aspartic proteinase 1, complete cds
          Length = 1719

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 339  cccatgaagacgtctcccaggatccagagagg 370
            ||||||||||| || || ||||||||||||||
Sbjct: 1484 cccatgaagacatcaccaaggatccagagagg 1453



to top

>dbj|AB028607.1| Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K13N2
          Length = 77483

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 165   gcatgcagcatatatacaca 184
             ||||||||||||||||||||
Sbjct: 56273 gcatgcagcatatatacaca 56292



to top

>gb|AC102466.11| Mus musculus chromosome 3, clone RP24-337A2, complete sequence
          Length = 164455

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 110   cttgccatcttaggaaccaa 129
             ||||||||||||||||||||
Sbjct: 21809 cttgccatcttaggaaccaa 21790



to top

>gb|AC107453.14| Mus musculus chromosome 15, clone RP23-315F3, complete sequence
          Length = 193381

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 173   catatatacacaacacacat 192
             ||||||||||||||||||||
Sbjct: 38488 catatatacacaacacacat 38469



to top

>gb|AC002131.1|F12F1 Arabidopsis thaliana chromosome 1 BAC F12F1 sequence, complete sequence
          Length = 123386

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                             
Query: 316   agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcc 363
             ||||||| |||||||||||   ||||||||| || ||||||| |||||
Sbjct: 97468 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatcc 97421



to top

>gb|U55032.1|BNU55032 Brassica napus aspartic protease gene, complete cds
          Length = 5381

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                            
Query: 316  agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcc 363
            ||||||| |||||||||||   ||||||||| || ||||| |||||||
Sbjct: 4813 agtcaaacacggtgtggtatttgcccatgaacacatctccaaggatcc 4766



to top

>emb|AL844486.12| Mouse DNA sequence from clone RP23-249P4 on chromosome 2, complete
             sequence
          Length = 118787

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 148   agggtctttgaaaagcagca 167
             ||||||||||||||||||||
Sbjct: 75067 agggtctttgaaaagcagca 75086


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,886,998
Number of Sequences: 3902068
Number of extensions: 4886998
Number of successful extensions: 92406
Number of sequences better than 10.0: 177
Number of HSP's better than 10.0 without gapping: 175
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 91944
Number of HSP's gapped (non-prelim): 460
length of query: 641
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 618
effective length of database: 17,143,297,704
effective search space: 10594557981072
effective search space used: 10594557981072
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top