ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd11d06
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_474229.1| Oryza sativa (japonica cultivar-group), predic... 80 1e-11
2dbj|AK061921.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 1e-11
3dbj|AK099504.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 1e-11
4dbj|AK065171.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 1e-11
5emb|AL606999.3|OSJN00127 Oryza sativa genomic DNA, chromosome 4,... 70 1e-08
6dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 70 1e-08
7gb|BC102224.1| Bos taurus similar to MAF1 protein, mRNA (cDNA cl... 56 2e-04
8ref|NM_001034424.1| Bos taurus similar to MAF1 protein (MGC12727... 56 2e-04
9gb|BC096891.1| Danio rerio zgc:112356, mRNA (cDNA clone MGC:1123... 54 6e-04
10ref|NM_001030239.1| Danio rerio zgc:112356 (zgc:112356), mRNA 54 6e-04
11ref|XM_852645.1| PREDICTED: Canis familiaris similar to MAF1 pro... 54 6e-04
12ref|XM_539208.2| PREDICTED: Canis familiaris similar to MAF1 pro... 54 6e-04
13emb|BX929817.2| Gallus gallus finished cDNA, clone ChEST549o13 52 0.002
14ref|NM_026859.2| Mus musculus MAF1 homolog (S. cerevisiae) (Maf1... 50 0.009
15gb|BC016260.1| Mus musculus MAF1 homolog (S. cerevisiae), mRNA (... 50 0.009
16dbj|AK154047.1| Mus musculus 2 days neonate thymus thymic cells ... 50 0.009
17dbj|AK042913.1| Mus musculus 7 days neonate cerebellum cDNA, RIK... 50 0.009
18dbj|AK004406.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 50 0.009
19dbj|AK196909.1| Mus musculus cDNA, clone:Y1G0123G09, strand:plus... 50 0.009
20dbj|AK189875.1| Mus musculus cDNA, clone:Y1G0101A22, strand:plus... 50 0.009
21ref|NM_032272.3| Homo sapiens MAF1 homolog (S. cerevisiae) (MAF1... 48 0.037
22gb|BC031273.1| Homo sapiens MAF1 homolog (S. cerevisiae), mRNA (... 48 0.037
23gb|BC014082.2| Homo sapiens MAF1 homolog (S. cerevisiae), mRNA (... 48 0.037
24emb|AL136937.1|HSM801901 Homo sapiens mRNA; cDNA DKFZp586G1123 (... 48 0.037
25emb|CR621223.1| full-length cDNA clone CS0DF003YD16 of Fetal bra... 48 0.037
26emb|CR600048.1| full-length cDNA clone CS0DH001YI22 of T cells (... 48 0.037
27emb|CR533463.1| Homo sapiens full open reading frame cDNA clone ... 48 0.037
28gb|BC018714.1| Homo sapiens MAF1 homolog (S. cerevisiae), mRNA (... 48 0.037
29emb|CR847961.12| Zebrafish DNA sequence from clone DKEY-154B7 in... 46 0.15
30gb|BC004909.1| Homo sapiens aldehyde dehydrogenase 6 family, mem... 44 0.58
31ref|XM_821979.1| Trypanosoma brucei TREU927 hypothetical protein... 44 0.58
32gb|BC083712.1| Rattus norvegicus MAF1 homolog (S. cerevisiae), m... 44 0.58
33ref|NM_001014085.1| Rattus norvegicus MAF1 homolog (S. cerevisia... 44 0.58
34gb|AF130089.1|AF130089 Homo sapiens clone FLB9440 PRO2550 mRNA, ... 44 0.58
35gb|AC124416.4| Mus musculus BAC clone RP24-308I2 from chromosome... 42 2.3
36emb|Z82202.1|HS34P24 Human DNA sequence from clone RP1-34P24 on ... 42 2.3
37emb|AL136109.11| Human DNA sequence from clone RP5-924G13 on chr... 42 2.3
38gb|AC091873.2| Homo sapiens chromosome 5 clone CTD-2577N22, comp... 42 2.3
39gb|AC140171.3| Homo sapiens chromosome 5 clone RP11-804N13, comp... 42 2.3
40gb|AC091869.4| Homo sapiens chromosome 5 clone CTD-2381F15, comp... 42 2.3
41emb|AL844608.18| Mouse DNA sequence from clone RP23-27L22 on chr... 42 2.3
42dbj|AP003043.2| Homo sapiens genomic DNA, chromosome 11q clone:R... 42 2.3
43gb|AC158308.4| Mus musculus chromosome 3, clone RP23-182M12, com... 40 9.1
44gb|AE006222.1| Pasteurella multocida subsp. multocida str. Pm70 ... 40 9.1
45ref|XM_924200.2| PREDICTED: Mus musculus alpha-kinase 1, transcr... 40 9.1
46gb|AC124488.3| Mus musculus BAC clone RP23-452K20 from chromosom... 40 9.1
47gb|AC114569.7| Mus musculus chromosome 6, clone RP23-139J6, comp... 40 9.1
48emb|AL021329.1|HS239K6 Human DNA sequence from clone RP1-239K6 o... 40 9.1
49gb|AC087530.8| Homo sapiens chromosome 17, clone RP11-313F15, co... 40 9.1
50gb|AC114322.2| Homo sapiens chromosome 5 clone RP11-74D3, comple... 40 9.1
51gb|AC067718.20| Homo sapiens 3 BAC RP11-198M8 (Roswell Park Canc... 40 9.1
52gb|AE017340.1| Idiomarina loihiensis L2TR, complete genome 40 9.1
53gb|AC133012.5| Homo sapiens chromosome 17, clone RP11-582A10, co... 40 9.1
54gb|AC019317.9| Homo sapiens chromosome , clone RP11-206L19, comp... 40 9.1
55gb|U18923.1|MGPITS2 Meleagris gallopavo transcription factor Pit... 40 9.1
56gb|AC073538.5|AC073538 Homo sapiens chromosome 5 clone CTD-2338P... 40 9.1
57gb|AC102600.11| Mus musculus chromosome 3, clone RP23-376E16, co... 40 9.1
58gb|AC010722.2|AC010722 Homo sapiens BAC clone RP11-122L9 from Y,... 40 9.1
59gb|AC133638.7| Homo sapiens chromosome 17, clone CTD-2125J20, co... 40 9.1
60gb|AC131935.7| Homo sapiens chromosome 11, clone RP11-756D7, com... 40 9.1
61dbj|AK173191.1| Mus musculus mRNA for mKIAA1527 protein 40 9.1
62emb|BX649310.6| Sminthopsis DNA sequence from clone RZPD668-281H... 40 9.1
63gb|AY746497.1| Enterobacteria phage JS98 contig9 genomic sequence 40 9.1
64gb|AC000106.1|F7G19 Sequence of BAC F7G19 from Arabidopsis thali... 40 9.1
65emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 40 9.1
66gb|M63149.1|TOVM1P Ustilago maydis virus P1 (M1) gene, complete cds 40 9.1 
>ref|XM_474229.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 675

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 124/152 (81%)
 Strand = Plus / Minus

                                                                       
Query: 230 atatgtccatgtcgatcaacgcatcttcctcctcgccatccgagagcgcaccagcaagga 289
           ||||||||||||| ||||  ||||||||||| || ||||| ||  | ||||  | |||||
Sbjct: 673 atatgtccatgtctatcagtgcatcttcctcttcaccatcggatggtgcactggtaagga 614

                                                                       
Query: 290 aatcatcccctgcaaatttgctagtacagcagcagcgaaagctcactacccgcttgagct 349
           | ||||| ||||  | ||||||  |||| | ||| ||||||||||| || ||||| ||||
Sbjct: 613 agtcatctcctgatattttgcttatacaactgcaacgaaagctcacaactcgctttagct 554

                                           
Query: 350 tccggtggtagaagaaaaagttgaccgaccat 381
           |||| | ||||||||||||||||| |||||||
Sbjct: 553 tccgattgtagaagaaaaagttgatcgaccat 522



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 493 agaaatggatctccatcagagtctgggttgtagctgtagatgtcacactccctgattttg 552
           |||||||||||||||||   |||||| || ||||||||||||||| |||| | |||||||
Sbjct: 506 agaaatggatctccatcttggtctggattatagctgtagatgtcagactctccgattttg 447

                  
Query: 553 ataacct 559
           |||||||
Sbjct: 446 ataacct 440
to top
>dbj|AK061921.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-B09, full
           insert sequence
          Length = 1237

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 124/152 (81%)
 Strand = Plus / Minus

                                                                       
Query: 230 atatgtccatgtcgatcaacgcatcttcctcctcgccatccgagagcgcaccagcaagga 289
           ||||||||||||| ||||  ||||||||||| || ||||| ||  | ||||  | |||||
Sbjct: 920 atatgtccatgtctatcagtgcatcttcctcttcaccatcggatggtgcactggtaagga 861

                                                                       
Query: 290 aatcatcccctgcaaatttgctagtacagcagcagcgaaagctcactacccgcttgagct 349
           | ||||| ||||  | ||||||  |||| | ||| ||||||||||| || ||||| ||||
Sbjct: 860 agtcatctcctgatattttgcttatacaactgcaacgaaagctcacaactcgctttagct 801

                                           
Query: 350 tccggtggtagaagaaaaagttgaccgaccat 381
           |||| | ||||||||||||||||| |||||||
Sbjct: 800 tccgattgtagaagaaaaagttgatcgaccat 769



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 493 agaaatggatctccatcagagtctgggttgtagctgtagatgtcacactccctgattttg 552
           |||||||||||||||||   |||||| || ||||||||||||||| |||| | |||||||
Sbjct: 753 agaaatggatctccatcttggtctggattatagctgtagatgtcagactctccgattttg 694

                  
Query: 553 ataacct 559
           |||||||
Sbjct: 693 ataacct 687
to top
>dbj|AK099504.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013028O12, full
           insert sequence
          Length = 1243

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 124/152 (81%)
 Strand = Plus / Minus

                                                                       
Query: 230 atatgtccatgtcgatcaacgcatcttcctcctcgccatccgagagcgcaccagcaagga 289
           ||||||||||||| ||||  ||||||||||| || ||||| ||  | ||||  | |||||
Sbjct: 928 atatgtccatgtctatcagtgcatcttcctcttcaccatcggatggtgcactggtaagga 869

                                                                       
Query: 290 aatcatcccctgcaaatttgctagtacagcagcagcgaaagctcactacccgcttgagct 349
           | ||||| ||||  | ||||||  |||| | ||| ||||||||||| || ||||| ||||
Sbjct: 868 agtcatctcctgatattttgcttatacaactgcaacgaaagctcacaactcgctttagct 809

                                           
Query: 350 tccggtggtagaagaaaaagttgaccgaccat 381
           |||| | ||||||||||||||||| |||||||
Sbjct: 808 tccgattgtagaagaaaaagttgatcgaccat 777



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 493 agaaatggatctccatcagagtctgggttgtagctgtagatgtcacactccctgattttg 552
           |||||||||||||||||   |||||| || || |||||||||||| |||| | |||||||
Sbjct: 761 agaaatggatctccatcttggtctggattataactgtagatgtcagactctccgattttg 702

                  
Query: 553 ataacct 559
           |||||||
Sbjct: 701 ataacct 695
to top
>dbj|AK065171.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002C20, full
           insert sequence
          Length = 1244

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 124/152 (81%)
 Strand = Plus / Minus

                                                                       
Query: 230 atatgtccatgtcgatcaacgcatcttcctcctcgccatccgagagcgcaccagcaagga 289
           ||||||||||||| ||||  ||||||||||| || ||||| ||  | ||||  | |||||
Sbjct: 927 atatgtccatgtctatcagtgcatcttcctcttcaccatcggatggtgcactggtaagga 868

                                                                       
Query: 290 aatcatcccctgcaaatttgctagtacagcagcagcgaaagctcactacccgcttgagct 349
           | ||||| ||||  | ||||||  |||| | ||| ||||||||||| || ||||| ||||
Sbjct: 867 agtcatctcctgatattttgcttatacaactgcaacgaaagctcacaactcgctttagct 808

                                           
Query: 350 tccggtggtagaagaaaaagttgaccgaccat 381
           |||| | ||||||||||||||||| |||||||
Sbjct: 807 tccgattgtagaagaaaaagttgatcgaccat 776



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                       
Query: 493 agaaatggatctccatcagagtctgggttgtagctgtagatgtcacactccctgattttg 552
           |||||||||||||||||   |||||| || ||||||||||||||| |||| | |||||||
Sbjct: 760 agaaatggatctccatcttggtctggattatagctgtagatgtcagactctccgattttg 701

                  
Query: 553 ataacct 559
           |||||||
Sbjct: 700 ataacct 694
to top
>emb|AL606999.3|OSJN00127 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K01,
             complete sequence
          Length = 163448

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 59/67 (88%)
 Strand = Plus / Plus

                                                                         
Query: 493   agaaatggatctccatcagagtctgggttgtagctgtagatgtcacactccctgattttg 552
             |||||||||||||||||   |||||| || ||||||||||||||| |||| | |||||||
Sbjct: 75307 agaaatggatctccatcttggtctggattatagctgtagatgtcagactctccgattttg 75366

                    
Query: 553   ataacct 559
             |||||||
Sbjct: 75367 ataacct 75373



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                        
Query: 325   cgaaagctcactacccgcttgagcttccggtggtagaagaaaaagttgaccgaccatct 383
             ||||||||||| || ||||| |||||||| | ||||||||||||||||| |||||||||
Sbjct: 75153 cgaaagctcacaactcgctttagcttccgattgtagaagaaaaagttgatcgaccatct 75211



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                     
Query: 230   atatgtccatgtcgatcaacgcatcttcctcctcgccatc 269
             ||||||||||||| ||||  ||||||||||| || |||||
Sbjct: 74968 atatgtccatgtctatcagtgcatcttcctcttcaccatc 75007
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 59/67 (88%)
 Strand = Plus / Plus

                                                                            
Query: 493      agaaatggatctccatcagagtctgggttgtagctgtagatgtcacactccctgattttg 552
                |||||||||||||||||   |||||| || ||||||||||||||| |||| | |||||||
Sbjct: 33863408 agaaatggatctccatcttggtctggattatagctgtagatgtcagactctccgattttg 33863467

                       
Query: 553      ataacct 559
                |||||||
Sbjct: 33863468 ataacct 33863474



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                           
Query: 325      cgaaagctcactacccgcttgagcttccggtggtagaagaaaaagttgaccgaccatct 383
                ||||||||||| || ||||| |||||||| | ||||||||||||||||| |||||||||
Sbjct: 33863254 cgaaagctcacaactcgctttagcttccgattgtagaagaaaaagttgatcgaccatct 33863312



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                        
Query: 230      atatgtccatgtcgatcaacgcatcttcctcctcgccatc 269
                ||||||||||||| ||||  ||||||||||| || |||||
Sbjct: 33863069 atatgtccatgtctatcagtgcatcttcctcttcaccatc 33863108
to top
>gb|BC102224.1| Bos taurus similar to MAF1 protein, mRNA (cDNA clone MGC:127274
           IMAGE:7946591), complete cds
          Length = 1523

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 512 agtctgggttgtagctgtagatgtcaca 539
           ||||||||||||||||||||||||||||
Sbjct: 899 agtctgggttgtagctgtagatgtcaca 872
to top
>ref|NM_001034424.1| Bos taurus similar to MAF1 protein (MGC127274), mRNA
          Length = 1523

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 512 agtctgggttgtagctgtagatgtcaca 539
           ||||||||||||||||||||||||||||
Sbjct: 899 agtctgggttgtagctgtagatgtcaca 872
to top
>gb|BC096891.1| Danio rerio zgc:112356, mRNA (cDNA clone MGC:112356 IMAGE:7286091),
           complete cds
          Length = 2717

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 513 gtctgggttgtagctgtagatgtcaca 539
           |||||||||||||||||||||||||||
Sbjct: 993 gtctgggttgtagctgtagatgtcaca 967
to top
>ref|NM_001030239.1| Danio rerio zgc:112356 (zgc:112356), mRNA
          Length = 2717

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 513 gtctgggttgtagctgtagatgtcaca 539
           |||||||||||||||||||||||||||
Sbjct: 993 gtctgggttgtagctgtagatgtcaca 967
to top
>ref|XM_852645.1| PREDICTED: Canis familiaris similar to MAF1 protein, transcript
           variant 2 (LOC482087), mRNA
          Length = 1507

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 512 agtctgggttgtagctgtagatgtcacactc 542
           ||||||||||||| |||||||||||||||||
Sbjct: 844 agtctgggttgtaactgtagatgtcacactc 814
to top
>ref|XM_539208.2| PREDICTED: Canis familiaris similar to MAF1 protein, transcript
           variant 1 (LOC482087), mRNA
          Length = 1545

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 512 agtctgggttgtagctgtagatgtcacactc 542
           ||||||||||||| |||||||||||||||||
Sbjct: 882 agtctgggttgtaactgtagatgtcacactc 852
to top
>emb|BX929817.2| Gallus gallus finished cDNA, clone ChEST549o13
          Length = 768

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 513 gtctgggttgtagctgtagatgtcacactc 542
           |||||||||||||||||||||||| |||||
Sbjct: 2   gtctgggttgtagctgtagatgtcgcactc 31
to top
>ref|NM_026859.2| Mus musculus MAF1 homolog (S. cerevisiae) (Maf1), mRNA
          Length = 1702

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 514 tctgggttgtagctgtagatgtcacactc 542
           |||||||| ||||||||||||||||||||
Sbjct: 916 tctgggttatagctgtagatgtcacactc 888
to top
>gb|BC016260.1| Mus musculus MAF1 homolog (S. cerevisiae), mRNA (cDNA clone
           MGC:28902 IMAGE:4914167), complete cds
          Length = 1702

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 514 tctgggttgtagctgtagatgtcacactc 542
           |||||||| ||||||||||||||||||||
Sbjct: 916 tctgggttatagctgtagatgtcacactc 888
to top
>dbj|AK154047.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430029D09
           product:MAF1 homolog (yeast), full insert sequence
          Length = 1640

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 514 tctgggttgtagctgtagatgtcacactc 542
           |||||||| ||||||||||||||||||||
Sbjct: 871 tctgggttatagctgtagatgtcacactc 843
to top
>dbj|AK042913.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:A730038N03 product:HOMOLOG OF
           YEAST MAF1 homolog [Homo sapiens], full insert sequence
          Length = 1597

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 514 tctgggttgtagctgtagatgtcacactc 542
           |||||||| ||||||||||||||||||||
Sbjct: 822 tctgggttatagctgtagatgtcacactc 794
to top
>dbj|AK004406.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1110068E11 product:MAF1 homolog
           (yeast), full insert sequence
          Length = 1370

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 514 tctgggttgtagctgtagatgtcacactc 542
           |||||||| ||||||||||||||||||||
Sbjct: 601 tctgggttatagctgtagatgtcacactc 573
to top
>dbj|AK196909.1| Mus musculus cDNA, clone:Y1G0123G09, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000023212, based on BLAT search
          Length = 240

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 514 tctgggttgtagctgtagatgtcacactc 542
           |||||||| ||||||||||||||||||||
Sbjct: 140 tctgggttatagctgtagatgtcacactc 112
to top
>dbj|AK189875.1| Mus musculus cDNA, clone:Y1G0101A22, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000023212, based on BLAT search
          Length = 239

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 514 tctgggttgtagctgtagatgtcacactc 542
           |||||||| ||||||||||||||||||||
Sbjct: 140 tctgggttatagctgtagatgtcacactc 112
to top
>ref|NM_032272.3| Homo sapiens MAF1 homolog (S. cerevisiae) (MAF1), mRNA
          Length = 1766

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 512  agtctgggttgtagctgtagatgtcaca 539
            |||||||||| |||||||||||||||||
Sbjct: 1002 agtctgggttatagctgtagatgtcaca 975
to top
>gb|BC031273.1| Homo sapiens MAF1 homolog (S. cerevisiae), mRNA (cDNA clone
           MGC:39758 IMAGE:5288176), complete cds
          Length = 1705

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 512 agtctgggttgtagctgtagatgtcaca 539
           |||||||||| |||||||||||||||||
Sbjct: 917 agtctgggttatagctgtagatgtcaca 890
to top
>gb|BC014082.2| Homo sapiens MAF1 homolog (S. cerevisiae), mRNA (cDNA clone
           MGC:20332 IMAGE:4304506), complete cds
          Length = 1691

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 512 agtctgggttgtagctgtagatgtcaca 539
           |||||||||| |||||||||||||||||
Sbjct: 907 agtctgggttatagctgtagatgtcaca 880
to top
>emb|AL136937.1|HSM801901 Homo sapiens mRNA; cDNA DKFZp586G1123 (from clone DKFZp586G1123)
          Length = 1674

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 512 agtctgggttgtagctgtagatgtcaca 539
           |||||||||| |||||||||||||||||
Sbjct: 906 agtctgggttatagctgtagatgtcaca 879
to top
>emb|CR621223.1| full-length cDNA clone CS0DF003YD16 of Fetal brain of Homo sapiens
           (human)
          Length = 1659

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 512 agtctgggttgtagctgtagatgtcaca 539
           |||||||||| |||||||||||||||||
Sbjct: 913 agtctgggttatagctgtagatgtcaca 886
to top
>emb|CR600048.1| full-length cDNA clone CS0DH001YI22 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 1661

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 512 agtctgggttgtagctgtagatgtcaca 539
           |||||||||| |||||||||||||||||
Sbjct: 912 agtctgggttatagctgtagatgtcaca 885
to top
>emb|CR533463.1| Homo sapiens full open reading frame cDNA clone RZPDo834C0317D for
           gene MAF1, homolog of yeast MAF1; complete cds, incl.
           stopcodon
          Length = 787

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 512 agtctgggttgtagctgtagatgtcaca 539
           |||||||||| |||||||||||||||||
Sbjct: 514 agtctgggttatagctgtagatgtcaca 487
to top
>gb|BC018714.1| Homo sapiens MAF1 homolog (S. cerevisiae), mRNA (cDNA clone
           MGC:31779 IMAGE:5014952), complete cds
          Length = 1727

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 512 agtctgggttgtagctgtagatgtcaca 539
           |||||||||| |||||||||||||||||
Sbjct: 914 agtctgggttatagctgtagatgtcaca 887
to top
>emb|CR847961.12| Zebrafish DNA sequence from clone DKEY-154B7 in linkage group 5, complete
              sequence
          Length = 237051

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 599    ctgacttttcaggactaaacatt 621
              |||||||||||||||||||||||
Sbjct: 164533 ctgacttttcaggactaaacatt 164555
to top
>gb|BC004909.1| Homo sapiens aldehyde dehydrogenase 6 family, member A1, mRNA (cDNA
            clone MGC:4657 IMAGE:3530715), complete cds
          Length = 1854

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 103  aaagtttctacagggaactgcc 124
            ||||||||||||||||||||||
Sbjct: 1784 aaagtttctacagggaactgcc 1805
to top
>ref|XM_821979.1| Trypanosoma brucei TREU927 hypothetical protein (Tb09.160.5230)
           partial mRNA
          Length = 618

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 237 catgtcgatcaacgcatcttcc 258
           ||||||||||||||||||||||
Sbjct: 216 catgtcgatcaacgcatcttcc 195
to top
>gb|BC083712.1| Rattus norvegicus MAF1 homolog (S. cerevisiae), mRNA (cDNA clone
           MGC:94603 IMAGE:7190634), complete cds
          Length = 1649

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 514 tctgggttgtagctgtagatgtcaca 539
           |||||||| |||||||||||||||||
Sbjct: 867 tctgggttatagctgtagatgtcaca 842
to top
>ref|NM_001014085.1| Rattus norvegicus MAF1 homolog (S. cerevisiae) (Maf1), mRNA
          Length = 1649

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 514 tctgggttgtagctgtagatgtcaca 539
           |||||||| |||||||||||||||||
Sbjct: 867 tctgggttatagctgtagatgtcaca 842
to top
>gb|AF130089.1|AF130089 Homo sapiens clone FLB9440 PRO2550 mRNA, complete cds
          Length = 2144

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 103  aaagtttctacagggaactgcc 124
            ||||||||||||||||||||||
Sbjct: 1450 aaagtttctacagggaactgcc 1429
to top
>gb|AC124416.4| Mus musculus BAC clone RP24-308I2 from chromosome 9, complete sequence
          Length = 184879

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 612   actaaacatttactgaatgca 632
             |||||||||||||||||||||
Sbjct: 73198 actaaacatttactgaatgca 73218
to top
>emb|Z82202.1|HS34P24 Human DNA sequence from clone RP1-34P24 on chromosome 22, complete
             sequence
          Length = 105357

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 585   aatataggactctgctgacttttca 609
             ||||||||||||| |||||||||||
Sbjct: 82981 aatataggactctcctgacttttca 82957
to top
>emb|AL136109.11| Human DNA sequence from clone RP5-924G13 on chromosome 1 Contains a
             novel gene (KIAA1221) and a ribosomal protein L5 (RPL5)
             pseudogene, complete sequence
          Length = 126367

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 615   aaacatttactgaatgcacac 635
             |||||||||||||||||||||
Sbjct: 66804 aaacatttactgaatgcacac 66824
to top
>gb|AC091873.2| Homo sapiens chromosome 5 clone CTD-2577N22, complete sequence
          Length = 166885

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 600    tgacttttcaggactaaacat 620
              |||||||||||||||||||||
Sbjct: 136578 tgacttttcaggactaaacat 136598
to top
>gb|AC140171.3| Homo sapiens chromosome 5 clone RP11-804N13, complete sequence
          Length = 158091

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 600   tgacttttcaggactaaacat 620
             |||||||||||||||||||||
Sbjct: 96323 tgacttttcaggactaaacat 96343
to top
>gb|AC091869.4| Homo sapiens chromosome 5 clone CTD-2381F15, complete sequence
          Length = 156441

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 600   tgacttttcaggactaaacat 620
             |||||||||||||||||||||
Sbjct: 86021 tgacttttcaggactaaacat 86001
to top
>emb|AL844608.18| Mouse DNA sequence from clone RP23-27L22 on chromosome 2, complete
              sequence
          Length = 207035

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 74     tctccaaacagacaaacaaagtcac 98
              |||||||||| ||||||||||||||
Sbjct: 201622 tctccaaacaaacaaacaaagtcac 201646
to top
>dbj|AP003043.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-617B3, complete
              sequence
          Length = 180648

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 73     ctctccaaacagacaaacaaa 93
              |||||||||||||||||||||
Sbjct: 145184 ctctccaaacagacaaacaaa 145204
to top
>gb|AC158308.4| Mus musculus chromosome 3, clone RP23-182M12, complete sequence
          Length = 176856

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 73     ctctccaaacagacaaacaa 92
              ||||||||||||||||||||
Sbjct: 121878 ctctccaaacagacaaacaa 121897
to top
>gb|AE006222.1| Pasteurella multocida subsp. multocida str. Pm70 section 189 of 204
            of the complete genome
          Length = 10085

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 539  actccctgattttgataacc 558
            ||||||||||||||||||||
Sbjct: 8364 actccctgattttgataacc 8345
to top
>ref|XM_924200.2| PREDICTED: Mus musculus alpha-kinase 1, transcript variant 6 (Alpk1),
            mRNA
          Length = 6505

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 73   ctctccaaacagacaaacaa 92
            ||||||||||||||||||||
Sbjct: 6322 ctctccaaacagacaaacaa 6303
to top
>gb|AC124488.3| Mus musculus BAC clone RP23-452K20 from chromosome 1, complete sequence
          Length = 178446

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 493    agaaatggatctccatcaga 512
              ||||||||||||||||||||
Sbjct: 129588 agaaatggatctccatcaga 129569
to top
>gb|AC114569.7| Mus musculus chromosome 6, clone RP23-139J6, complete sequence
          Length = 179927

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 592    gactctgctgacttttcagg 611
              ||||||||||||||||||||
Sbjct: 102356 gactctgctgacttttcagg 102337
to top
>emb|AL021329.1|HS239K6 Human DNA sequence from clone RP1-239K6 on chromosome 6p22.3-23
             Contains a novel gene, complete sequence
          Length = 105162

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 524   agctgtagatgtcacactccctgatttt 551
             ||||| |||| |||||||||||||||||
Sbjct: 83186 agctggagatatcacactccctgatttt 83159
to top
>gb|AC087530.8| Homo sapiens chromosome 17, clone RP11-313F15, complete sequence
          Length = 170507

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 277    gcaccagcaaggaaatcatc 296
              ||||||||||||||||||||
Sbjct: 119397 gcaccagcaaggaaatcatc 119416
to top
>gb|AC114322.2| Homo sapiens chromosome 5 clone RP11-74D3, complete sequence
          Length = 133348

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 536    cacactccctgattttgataacctgttacaaa 567
              |||||||||||||||||| ||| || ||||||
Sbjct: 112861 cacactccctgattttgaaaacttgctacaaa 112892
to top
>gb|AC067718.20| Homo sapiens 3 BAC RP11-198M8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 97995

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 390   aaaataaaatgccatttaca 409
             ||||||||||||||||||||
Sbjct: 44312 aaaataaaatgccatttaca 44331
to top
>gb|AE017340.1| Idiomarina loihiensis L2TR, complete genome
          Length = 2839318

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 237     catgtcgatcaacgcatcttcctc 260
               |||||||||| |||||||||||||
Sbjct: 1987228 catgtcgatcgacgcatcttcctc 1987251
to top
>gb|AC133012.5| Homo sapiens chromosome 17, clone RP11-582A10, complete sequence
          Length = 153014

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 277   gcaccagcaaggaaatcatc 296
             ||||||||||||||||||||
Sbjct: 52689 gcaccagcaaggaaatcatc 52670
to top
>gb|AC019317.9| Homo sapiens chromosome , clone RP11-206L19, complete sequence
          Length = 146836

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 390   aaaataaaatgccatttaca 409
             ||||||||||||||||||||
Sbjct: 43677 aaaataaaatgccatttaca 43696
to top
>gb|U18923.1|MGPITS2 Meleagris gallopavo transcription factor Pit1 (pit1) gene, exon 2
          Length = 1246

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 394 taaaatgccatttacacatt 413
           ||||||||||||||||||||
Sbjct: 518 taaaatgccatttacacatt 499
to top
>gb|AC073538.5|AC073538 Homo sapiens chromosome 5 clone CTD-2338P8, complete sequence
          Length = 98291

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 536 cacactccctgattttgataacctgttacaaa 567
           |||||||||||||||||| ||| || ||||||
Sbjct: 636 cacactccctgattttgaaaacttgctacaaa 667
to top
>gb|AC102600.11| Mus musculus chromosome 3, clone RP23-376E16, complete sequence
          Length = 131703

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 73    ctctccaaacagacaaacaa 92
             ||||||||||||||||||||
Sbjct: 79231 ctctccaaacagacaaacaa 79212
to top
>gb|AC010722.2|AC010722 Homo sapiens BAC clone RP11-122L9 from Y, complete sequence
          Length = 160723

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 544    ctgattttgataacctgtta 563
              ||||||||||||||||||||
Sbjct: 115270 ctgattttgataacctgtta 115289
to top
>gb|AC133638.7| Homo sapiens chromosome 17, clone CTD-2125J20, complete sequence
          Length = 139560

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 277   gcaccagcaaggaaatcatc 296
             ||||||||||||||||||||
Sbjct: 85950 gcaccagcaaggaaatcatc 85931
to top
>gb|AC131935.7| Homo sapiens chromosome 11, clone RP11-756D7, complete sequence
          Length = 184254

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 390   aaaataaaatgccatttaca 409
             ||||||||||||||||||||
Sbjct: 34287 aaaataaaatgccatttaca 34268
to top
>dbj|AK173191.1| Mus musculus mRNA for mKIAA1527 protein
          Length = 6402

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 73   ctctccaaacagacaaacaa 92
            ||||||||||||||||||||
Sbjct: 6308 ctctccaaacagacaaacaa 6289
to top
>emb|BX649310.6| Sminthopsis DNA sequence from clone RZPD668-281H15, complete sequence
          Length = 67497

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 589   taggactctgctgacttttc 608
             ||||||||||||||||||||
Sbjct: 63967 taggactctgctgacttttc 63948
to top
>gb|AY746497.1| Enterobacteria phage JS98 contig9 genomic sequence
          Length = 48675

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 5     tggcagactgaagttaaatc 24
             ||||||||||||||||||||
Sbjct: 34683 tggcagactgaagttaaatc 34702
to top
>gb|AC000106.1|F7G19 Sequence of BAC F7G19 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 110514

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 380   atctgcaagcaaaataaaat 399
             ||||||||||||||||||||
Sbjct: 66547 atctgcaagcaaaataaaat 66566
to top
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 184    gtcacactggttggttggtcatgt 207
              ||||||||||||||||| ||||||
Sbjct: 906541 gtcacactggttggttgctcatgt 906518
to top
>gb|M63149.1|TOVM1P Ustilago maydis virus P1 (M1) gene, complete cds
          Length = 1504

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 95  tcacgctaaaagtttctaca 114
           ||||||||||||||||||||
Sbjct: 187 tcacgctaaaagtttctaca 168


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,420,122
Number of Sequences: 3902068
Number of extensions: 6420122
Number of successful extensions: 117284
Number of sequences better than 10.0: 66
Number of HSP's better than 10.0 without gapping: 66
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 117106
Number of HSP's gapped (non-prelim): 174
length of query: 665
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 642
effective length of database: 17,143,297,704
effective search space: 11005997125968
effective search space used: 11005997125968
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top