ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd11a02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA 702 0.0
2emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene 624 e-176
3gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt... 624 e-176
4emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene 622 e-175
5emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid tra... 547 e-152
6gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer prote... 484 e-133
7emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA 398 e-108
8gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid... 377 e-101
9gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipi... 377 e-101
10emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non sp... 365 1e-97
11emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific l... 357 3e-95
12emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non sp... 349 7e-93
13emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for ... 345 1e-91
14gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipi... 327 3e-86
15gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein ... 238 2e-59
16emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non sp... 238 2e-59
17gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) g... 230 4e-57
18gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein ... 230 4e-57
19gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) m... 226 7e-56
20gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) m... 226 7e-56
21gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4)... 218 2e-53
22gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid... 210 4e-51
23emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid tr... 206 6e-50
24emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA 190 4e-45
25gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome... 119 1e-23
26dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 119 1e-23
27dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 1e-23
28dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 1e-23
29gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 119 1e-23
30emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA 117 5e-23
31dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 115 2e-22
32emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 115 2e-22
33dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 2e-22
34gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 115 2e-22
35emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136... 115 2e-22
36gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid tran... 107 4e-20
37emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein 107 4e-20
38dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 4e-20
39dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 4e-20
40emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa... 107 4e-20
41gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) m... 107 4e-20
42gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT I... 100 1e-17
43gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT I... 100 1e-17
44gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid tran... 88 4e-14
45emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, comp... 88 4e-14
46emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA 88 4e-14
47emb|X71667.1|SVLTP1 S.vulgare ltp1 gene 88 4e-14
48emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 88 4e-14
49dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 4e-14
50dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 4e-14
51gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT I... 88 4e-14
52emb|X71668.1|SVLTP2 S.vulgare ltp2 gene 84 6e-13
53dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 84 6e-13
54dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic D... 84 6e-13
55gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA,... 80 1e-11
56gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA... 80 1e-11
57gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transf... 80 1e-11
58gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfe... 80 1e-11
59gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transf... 80 1e-11
60gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholi... 80 1e-11
61gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholip... 80 1e-11
62gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transf... 80 1e-11
63gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfe... 80 1e-11
64gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transf... 80 1e-11
65gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfe... 80 1e-11
66gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfe... 80 1e-11
67gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfe... 80 1e-11
68gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transf... 80 1e-11
69gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transf... 80 1e-11
70gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfe... 80 1e-11
71gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transf... 80 1e-11
72gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transf... 80 1e-11
73gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholi... 80 1e-11
74gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholi... 80 1e-11
75gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholi... 80 1e-11
76gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phosphol... 80 1e-11
77gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholi... 80 1e-11
78gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholip... 80 1e-11
79gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholip... 80 1e-11
80gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholi... 80 1e-11
81gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholi... 80 1e-11
82gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholip... 80 1e-11
83gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholip... 80 1e-11
84gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholip... 80 1e-11
85dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 4e-11
86dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 2e-10
87dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 2e-10
88dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 2e-10
89dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 2e-10
90gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence 72 2e-09
91gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precurs... 72 2e-09
92gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfe... 72 2e-09
93gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholi... 72 2e-09
94gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholi... 72 2e-09
95gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholi... 72 2e-09
96gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phosphol... 72 2e-09
97gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholip... 72 2e-09
98gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholip... 72 2e-09
99gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholip... 72 2e-09
100gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholip... 72 2e-09
101gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholip... 72 2e-09
102gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phosphol... 72 2e-09
103gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholip... 72 2e-09
104gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3... 72 2e-09
105gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, co... 72 2e-09
106gb|AF051369.1|AF051369 Oryza sativa lipid transfer protein mRNA,... 68 4e-08
107gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholip... 64 6e-07
108gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholip... 64 6e-07
109dbj|D10955.1|RIC323PTP Oryza sativa mRNA for phospholipid trasfe... 62 2e-06
110gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid... 58 4e-05
111gb|AY057932.1| Bromus inermis nonspecific lipid transfer protein... 46 0.14
112dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 44 0.55
113gb|AY212102.1| Papio cynocephalus isolate mk_3 NADH dehydrogenas... 42 2.2
114gb|AY212101.1| Papio cynocephalus isolate mk_2 NADH dehydrogenas... 42 2.2
115gb|AY212100.1| Papio cynocephalus isolate mk_1 NADH dehydrogenas... 42 2.2
116gb|AY212099.1| Papio anubis isolate gil4_A6 NADH dehydrogenase s... 42 2.2
117gb|AY212098.1| Papio anubis isolate gil2_A4 NADH dehydrogenase s... 42 2.2
118gb|AY212097.1| Papio anubis isolate gil_3 NADH dehydrogenase sub... 42 2.2
119gb|AY212096.1| Papio anubis isolate RC233 NADH dehydrogenase sub... 42 2.2
120gb|AY212095.1| Papio anubis isolate KenyanA2SW76 NADH dehydrogen... 42 2.2
121gb|AY212094.1| Papio anubis isolate KenyanA1SW331 NADH dehydroge... 42 2.2
122gb|AY212093.1| Papio anubis isolate BE93090 NADH dehydrogenase s... 42 2.2
123gb|AY212092.1| Papio anubis isolate BE93089 NADH dehydrogenase s... 42 2.2
124gb|AY212091.1| Papio anubis isolate BE73138 NADH dehydrogenase s... 42 2.2
125gb|AY212089.1| Papio anubis isolate BE73005 NADH dehydrogenase s... 42 2.2
126gb|AY212088.1| Papio anubis isolate BE73165 NADH dehydrogenase s... 42 2.2
127gb|AY212087.1| Papio anubis isolate BE73076 NADH dehydrogenase s... 42 2.2
128gb|AY212086.1| Papio anubis isolate BE73142 NADH dehydrogenase s... 42 2.2
129gb|AY212085.1| Papio hamadryas isolate BE94003 NADH dehydrogenas... 42 2.2
130gb|AY212084.1| Papio hamadryas isolate BE73274 NADH dehydrogenas... 42 2.2
131gb|AY212081.1| Papio hamadryas isolate BE73360 NADH dehydrogenas... 42 2.2
132gb|AY212080.1| Papio hamadryas isolate BE73275 NADH dehydrogenas... 42 2.2
133gb|AY212079.1| Papio hamadryas isolate BE73222 NADH dehydrogenas... 42 2.2
134gb|AY212072.1| Papio hamadryas isolate BE97070 NADH dehydrogenas... 42 2.2
135gb|AY212071.1| Papio hamadryas isolate BE97119 NADH dehydrogenas... 42 2.2
136gb|AY212061.1| Papio hamadryas isolate dw37 NADH dehydrogenase s... 42 2.2
137gb|AC159631.2| Mus musculus BAC clone RP24-177F21 from chromosom... 42 2.2
138emb|AL590822.36| Human DNA sequence from clone RP11-181G12 on ch... 42 2.2
139gb|AC161418.4| Mus musculus BAC clone RP23-325K2 from chromosome... 42 2.2
140gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 42 2.2
141dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.2
142gb|AY212048.1| Papio cynocephalus isolate C6 NADH dehydrogenase ... 42 2.2
143gb|AY212047.1| Papio cynocephalus isolate C5 NADH dehydrogenase ... 42 2.2
144gb|AY212046.1| Papio cynocephalus isolate C4 NADH dehydrogenase ... 42 2.2
145gb|AY212045.1| Papio cynocephalus isolate C3 NADH dehydrogenase ... 42 2.2
146gb|AY212044.1| Papio cynocephalus isolate C2 NADH dehydrogenase ... 42 2.2
147gb|AY212043.1| Papio cynocephalus isolate C1 NADH dehydrogenase ... 42 2.2
148gb|AY212042.1| Papio anubis isolate A3 NADH dehydrogenase subuni... 42 2.2
149gb|AY212041.1| Papio anubis isolate A2 NADH dehydrogenase subuni... 42 2.2
150gb|AY212040.1| Papio anubis isolate A1 NADH dehydrogenase subuni... 42 2.2
151gb|AY212039.1| Papio anubis isolate A5 NADH dehydrogenase subuni... 42 2.2
152dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.2
153dbj|AP004694.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.2
154dbj|AP005640.2| Oryza sativa (japonica cultivar-group) genomic D... 42 2.2
155dbj|AK119692.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.2
156dbj|AK119677.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.2
157dbj|AK100917.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.2
158gb|AY109327.1| Zea mays CL468_1 mRNA sequence 42 2.2
159gb|AC132475.4| Mus musculus BAC clone RP23-114P16 from 3, comple... 42 2.2
160gb|AC005222.1| Homo sapiens chromosome 16, cosmid clone RT163 (L... 40 8.6
161gb|BC001740.1| Homo sapiens golgi phosphoprotein 2, transcript v... 40 8.6
162gb|AY212083.1| Papio hamadryas isolate BE73498 NADH dehydrogenas... 40 8.6
163gb|AY212082.1| Papio hamadryas isolate BE73357 NADH dehydrogenas... 40 8.6
164gb|AY212078.1| Papio hamadryas isolate ta23 NADH dehydrogenase s... 40 8.6
165gb|AY212077.1| Papio hamadryas isolate ta03 NADH dehydrogenase s... 40 8.6
166gb|AY212076.1| Papio hamadryas isolate ba23 NADH dehydrogenase s... 40 8.6
167gb|AY212075.1| Papio hamadryas isolate ba01 NADH dehydrogenase s... 40 8.6
168gb|AY212074.1| Papio hamadryas isolate ab31 NADH dehydrogenase s... 40 8.6
169gb|AY212073.1| Papio hamadryas isolate ab21 NADH dehydrogenase s... 40 8.6
170gb|AY212070.1| Papio hamadryas isolate BE97122 NADH dehydrogenas... 40 8.6
171gb|AY212069.1| Papio hamadryas isolate dw158 NADH dehydrogenase ... 40 8.6
172gb|AY212068.1| Papio hamadryas isolate dw157 NADH dehydrogenase ... 40 8.6
173gb|AY212067.1| Papio hamadryas isolate dw152 NADH dehydrogenase ... 40 8.6
174gb|AY212066.1| Papio hamadryas isolate dw106 NADH dehydrogenase ... 40 8.6
175gb|AY212065.1| Papio hamadryas isolate dw58 NADH dehydrogenase s... 40 8.6
176gb|AY212064.1| Papio hamadryas isolate dw57 NADH dehydrogenase s... 40 8.6
177gb|AY212063.1| Papio hamadryas isolate dw55 NADH dehydrogenase s... 40 8.6
178gb|AY212062.1| Papio hamadryas isolate dw104 NADH dehydrogenase ... 40 8.6
179gb|CP000352.1| Ralstonia metallidurans CH34, complete genome 40 8.6
180gb|AY358593.1| Homo sapiens clone DNA62808 GOLPH2 (UNQ686) mRNA,... 40 8.6
181gb|AC121237.19| Medicago truncatula clone mth2-22g11, complete s... 40 8.6
182emb|AL358372.11| Human DNA sequence from clone RP11-350E19 on ch... 40 8.6
183emb|AL161447.20| Human DNA sequence from clone RP11-379P1 on chr... 40 8.6
184emb|AL121777.39|HSJ1057D4 Human DNA sequence from clone RP5-1057... 40 8.6
185gb|AC069528.10| Homo sapiens 3 BAC RP11-329N15 (Roswell Park Can... 40 8.6
186emb|Y18001.1|PHA18001 Papio hamadryas mitochondrial DNA, complet... 40 8.6
187emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete ... 40 8.6
188emb|AL939105.1|SCO939105 Streptomyces coelicolor A3(2) complete ... 40 8.6
189emb|AJ277892.2|HSA277892 Homo sapiens partial TTN gene for titin 40 8.6
190emb|AJ224512.2|SNO224512 Streptomyces nogalater nogalamycin bios... 40 8.6
191gb|BC070113.1| Homo sapiens cDNA clone IMAGE:5268363 40 8.6
192gb|BC041357.1| Homo sapiens cDNA clone IMAGE:5272988 40 8.6
193dbj|AK092943.1| Homo sapiens cDNA FLJ35624 fis, clone SPLEN20110... 40 8.6
194dbj|AK075557.1| Homo sapiens cDNA PSEC0257 fis, clone NT2RP30036... 40 8.6
195dbj|AK075542.1| Homo sapiens cDNA PSEC0242 fis, clone NT2RP30002... 40 8.6
196dbj|AK027717.1| Homo sapiens cDNA FLJ14811 fis, clone NT2RP40019... 40 8.6
197gb|AC012676.5| Homo sapiens chromosome 16 clone RP11-295D4, comp... 40 8.6
198emb|CR457201.1| Homo sapiens full open reading frame cDNA clone ... 40 8.6
199gb|AY212038.1| Papio hamadryas isolate H5 NADH dehydrogenase sub... 40 8.6
200gb|AY212037.1| Papio hamadryas isolate H4 NADH dehydrogenase sub... 40 8.6
201gb|AY212036.1| Papio hamadryas isolate H3 NADH dehydrogenase sub... 40 8.6
202gb|AC010680.10| Homo sapiens BAC clone RP11-171I2 from 2, comple... 40 8.6
203gb|AE004829.1| Pseudomonas aeruginosa PAO1, section 390 of 529 o... 40 8.6
204ref|NM_177937.1| Homo sapiens golgi phosphoprotein 2 (GOLPH2), t... 40 8.6
205ref|NM_016548.2| Homo sapiens golgi phosphoprotein 2 (GOLPH2), t... 40 8.6
206gb|AF236056.1|AF236056 Homo sapiens golgi membrane protein GP73 ... 40 8.6
207dbj|AK073363.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.6
208dbj|AK070192.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.6
209dbj|AK062690.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.6
210dbj|AK061182.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.6
211dbj|AK059737.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.6
212dbj|AK059714.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.6
213gb|AF171094.1|AF171094 Lilium longiflorum lipid transfer protein... 40 8.6
214gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 40 8.6
215emb|AL138783.6| Human DNA sequence from clone RP5-1165D20 on chr... 40 8.6
216dbj|D85290.1| Hamadryas baboon mitochondrial DNA for NADH dehydr... 40 8.6

>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA
          Length = 705

 Score =  702 bits (354), Expect = 0.0
 Identities = 380/386 (98%), Gaps = 2/386 (0%)
 Strand = Plus / Minus

                                                                       
Query: 242 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 301
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 416 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 357

                                                                       
Query: 302 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 361
           |||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 356 gacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccagcagcgct 297

                                                                       
Query: 362 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtct 421
           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 296 cttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggccagtct 237

                                                                       
Query: 422 cttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagat 481
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 236 cttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagat 177

                                                                       
Query: 482 gcaggggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacga 541
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 176 gcaggggctcaaggcagagctcacctgaccgcaggagatgg-ccgcgtcggcggctacga 118

                                                                       
Query: 542 ggagcatggcggccaccagggcgaccagcacgagctgagtagctgcagcgcgagccatcc 601
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 117 ggagcatggcggccaccagggcgaccagcacgagctgactagctgcagcgcgagccatcc 58

                                     
Query: 602 ctaatgagttttggaatagtagcgca 627
           |||||||| |||||||||||||||||
Sbjct: 57  ctaatgag-tttggaatagtagcgca 33



to top

>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene
          Length = 1567

 Score =  624 bits (315), Expect = e-176
 Identities = 358/371 (96%), Gaps = 1/371 (0%)
 Strand = Plus / Minus

                                                                        
Query: 242  agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 301
            |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||
Sbjct: 1021 agtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgct 962

                                                                        
Query: 302  gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 361
            ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 961  gacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgct 902

                                                                        
Query: 362  cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtct 421
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 901  cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtct 842

                                                                        
Query: 422  cttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagat 481
            |||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 841  cttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagat 782

                                                                        
Query: 482  gcaggggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacga 541
            ||||||||||||||||||||||||||||||||||||||||| |||||||||  |||||||
Sbjct: 781  gcaggggctcaaggcagagctcacctgaccgcaggagatgg-ccgcgtcggtagctacga 723

                                                                        
Query: 542  ggagcatggcggccaccagggcgaccagcacgagctgagtagctgcagcgcgagccatcc 601
             ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 722  tgagcatggcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccatcc 663

                       
Query: 602  ctaatgagttt 612
            |||| ||||||
Sbjct: 662  ctaaggagttt 652



to top

>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds
          Length = 3238

 Score =  624 bits (315), Expect = e-176
 Identities = 358/371 (96%), Gaps = 1/371 (0%)
 Strand = Plus / Minus

                                                                        
Query: 242  agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 301
            |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||
Sbjct: 2417 agtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgct 2358

                                                                        
Query: 302  gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 361
            ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 2357 gacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgct 2298

                                                                        
Query: 362  cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtct 421
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 2297 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtct 2238

                                                                        
Query: 422  cttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagat 481
            |||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 2237 cttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagat 2178

                                                                        
Query: 482  gcaggggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacga 541
            ||||||||||||||||||||||||||||||||||||||||| |||||||||  |||||||
Sbjct: 2177 gcaggggctcaaggcagagctcacctgaccgcaggagatgg-ccgcgtcggtagctacga 2119

                                                                        
Query: 542  ggagcatggcggccaccagggcgaccagcacgagctgagtagctgcagcgcgagccatcc 601
             ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 2118 tgagcatggcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccatcc 2059

                       
Query: 602  ctaatgagttt 612
            |||| ||||||
Sbjct: 2058 ctaaggagttt 2048



to top

>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene
          Length = 1862

 Score =  622 bits (314), Expect = e-175
 Identities = 348/358 (97%), Gaps = 1/358 (0%)
 Strand = Plus / Minus

                                                                        
Query: 242  agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 301
            |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1386 agtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 1327

                                                                        
Query: 302  gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 361
            ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 1326 gacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgct 1267

                                                                        
Query: 362  cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtct 421
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1266 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtct 1207

                                                                        
Query: 422  cttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagat 481
            |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 1206 cttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagat 1147

                                                                        
Query: 482  gcaggggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacga 541
            ||| ||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||
Sbjct: 1146 gcaagggctcaaggcagagctcacctgaccgcaggagatgg-ccgcgtcggtggctacga 1088

                                                                      
Query: 542  ggagcatggcggccaccagggcgaccagcacgagctgagtagctgcagcgcgagccat 599
            ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 1087 ggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccat 1030



to top

>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor
          Length = 691

 Score =  547 bits (276), Expect = e-152
 Identities = 331/348 (95%), Gaps = 1/348 (0%)
 Strand = Plus / Minus

                                                                       
Query: 242 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 301
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 371 agtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 312

                                                                       
Query: 302 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 361
           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 311 gacgccgcacatggaggggatgccggcggccttgccagcgtttagcccacccgcagcgct 252

                                                                       
Query: 362 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtct 421
           |||||||||||||||||||||||||||||||||||||||||| || |||||||||| |||
Sbjct: 251 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgcgctgcgccggccaatct 192

                                                                       
Query: 422 cttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagat 481
           ||||||||||||||||||||||| |||| |  || |||||||||||| ||||||||| ||
Sbjct: 191 cttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggcataggaaat 132

                                                                       
Query: 482 gcaggggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacga 541
           |||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||
Sbjct: 131 gcaggggcgcaaggcagagctcacctgaccgcaggagatgg-ctgcgtcggcggctacga 73

                                                           
Query: 542 ggagcatggcggccaccagggcgaccagcacgagctgagtagctgcag 589
           ||||||| |||||||||| |||||||||||||||||||||||||||||
Sbjct: 72  ggagcatagcggccaccatggcgaccagcacgagctgagtagctgcag 25



to top

>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene,
           complete cds
          Length = 573

 Score =  484 bits (244), Expect = e-133
 Identities = 323/348 (92%), Gaps = 1/348 (0%)
 Strand = Plus / Minus

                                                                       
Query: 242 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 301
           |||||| |||||| |||||||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 442 agtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtaggggacgct 383

                                                                       
Query: 302 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 361
           |||||||||| ||||||||||||||||||||||||||||||| | |||| | ||||||||
Sbjct: 382 gacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcggcagcgct 323

                                                                       
Query: 362 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtct 421
           |||||||||||||||| ||||||||||||||||||||||||| || |||||||||| |||
Sbjct: 322 cttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccggccaatct 263

                                                                       
Query: 422 cttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagat 481
           ||||||||||||||||||||||| |||| |  || |||||||||||| ||||||||| ||
Sbjct: 262 cttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggcataggaaat 203

                                                                       
Query: 482 gcaggggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacga 541
           |||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||
Sbjct: 202 gcaggggcgcaaggcagagctcacctgaccgcaggagatgg-ctgcgtcggcggctacga 144

                                                           
Query: 542 ggagcatggcggccaccagggcgaccagcacgagctgagtagctgcag 589
           ||||||| |||||||||| |||||||||||||||||||||||||||||
Sbjct: 143 ggagcatagcggccaccatggcgaccagcacgagctgagtagctgcag 96



to top

>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA
          Length = 660

 Score =  398 bits (201), Expect = e-108
 Identities = 232/241 (96%), Gaps = 1/241 (0%)
 Strand = Plus / Minus

                                                                       
Query: 359 gctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccag 418
           |||||||| |||| |||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 285 gctcttgaggcacctgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 226

                                                                       
Query: 419 tctcttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcatagga 478
           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 225 tctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 166

                                                                       
Query: 479 gatgcaggggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggcggcta 538
           |||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |||||
Sbjct: 165 gatgcaagggctcaaggcagagctcacctgaccgcaggagatgg-ccgcgtcggtggcta 107

                                                                       
Query: 539 cgaggagcatggcggccaccagggcgaccagcacgagctgagtagctgcagcgcgagcca 598
           |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 106 cgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagcca 47

            
Query: 599 t 599
           |
Sbjct: 46  t 46



to top

>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  377 bits (190), Expect = e-101
 Identities = 296/330 (89%), Gaps = 1/330 (0%)
 Strand = Plus / Minus

                                                                       
Query: 251 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 310
           |||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 311 catggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgca 370
           | | | ||||||||| ||||||||||||||||| |||||| | |||||||||||||| ||
Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229

                                                                       
Query: 371 cttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacgcc 430
           ||||||||||||||||||||||||||||||| |||| | || ||| || ||| | |||||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169

                                                                       
Query: 431 gctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcaggggct 490
           ||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 491 caaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacgaggagcatgg 550
           |||||||||||||||||||||||| || | || |||| || | |||| |||||||||| |
Sbjct: 108 caaggcagagctcacctgaccgcacgatacgg-ccgcctccgtggctgcgaggagcatag 50

                                         
Query: 551 cggccaccagggcgaccagcacgagctgag 580
           ||||||||| |||||| ||||||| |||||
Sbjct: 49  cggccaccacggcgacgagcacgacctgag 20



to top

>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  377 bits (190), Expect = e-101
 Identities = 296/330 (89%), Gaps = 1/330 (0%)
 Strand = Plus / Minus

                                                                       
Query: 251 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 310
           |||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 311 catggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgca 370
           | | | ||||||||| ||||||||||||||||| |||||| | |||||||||||||| ||
Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229

                                                                       
Query: 371 cttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacgcc 430
           ||||||||||||||||||||||||||||||| |||| | || ||| || ||| | |||||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169

                                                                       
Query: 431 gctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcaggggct 490
           ||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 491 caaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacgaggagcatgg 550
           |||||||||||||||||||||||| || | || |||| || | |||| |||||||||| |
Sbjct: 108 caaggcagagctcacctgaccgcacgatacgg-ccgcctccgtggctgcgaggagcatag 50

                                         
Query: 551 cggccaccagggcgaccagcacgagctgag 580
           ||||||||| |||||| ||||||| |||||
Sbjct: 49  cggccaccacggcgacgagcacgacctgag 20



to top

>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2122

 Score =  365 bits (184), Expect = 1e-97
 Identities = 296/332 (89%), Gaps = 1/332 (0%)
 Strand = Plus / Minus

                                                                        
Query: 249  gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 308
            |||||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||
Sbjct: 1619 gatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccg 1560

                                                                        
Query: 309  cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 368
            ||| | | ||||||||||||||||||||||||||| |||||| | |||||||||||||||
Sbjct: 1559 cactttgtggggatgccggcggccttgccagcgttgagcccagcagcagcgctcttgatg 1500

                                                                        
Query: 369  cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 428
            ||||||||||||||||||||||||||||||||| |||| | || ||| || ||| | |||
Sbjct: 1499 cacttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacg 1440

                                                                        
Query: 429  ccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcagggg 488
            |||||||||||||||||||  ||  |||||||||||||||| ||||||||||||||||||
Sbjct: 1439 ccgctgcagcaggccgcagatgggctggcgccgttgccgcgtgcataggagatgcagggg 1380

                                                                        
Query: 489  ctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacgaggagcat 548
            |||||||||||||||||||||||||| || |  | |||| || | | || ||||||||||
Sbjct: 1379 ctcaaggcagagctcacctgaccgcacgatacag-ccgcctccgtgactgcgaggagcat 1321

                                            
Query: 549  ggcggccaccagggcgaccagcacgagctgag 580
             |||||||||| |||||| ||||||| |||||
Sbjct: 1320 agcggccaccacggcgacgagcacgacctgag 1289



to top

>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer
           protein precursor (ltp9.2 gene)
          Length = 708

 Score =  357 bits (180), Expect = 3e-95
 Identities = 295/332 (88%), Gaps = 1/332 (0%)
 Strand = Plus / Minus

                                                                       
Query: 249 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 308
           |||||||||||||||||||||||||| |||| ||||||||||||||||| ||| ||||||
Sbjct: 416 gatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggatgctaacgccg 357

                                                                       
Query: 309 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 368
           ||| | | ||||||||||||||||||||||||||| |||||| | |||||||||||||| 
Sbjct: 356 cactttgtggggatgccggcggccttgccagcgttgagcccagcagcagcgctcttgata 297

                                                                       
Query: 369 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 428
           ||||||||||||||||||||||||||||||||| |||| | || ||| || ||| | |||
Sbjct: 296 cacttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacg 237

                                                                       
Query: 429 ccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcagggg 488
           ||||||||||||||||||| |||  |||||||||||||||| ||||||||||||||||||
Sbjct: 236 ccgctgcagcaggccgcagacgggctggcgccgttgccgcgtgcataggagatgcagggg 177

                                                                       
Query: 489 ctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacgaggagcat 548
           |||||||||||||||||||||||||| || |  | |||| || | | || ||||||||||
Sbjct: 176 ctcaaggcagagctcacctgaccgcacgatacag-ccgcctccgtgactgcgaggagcat 118

                                           
Query: 549 ggcggccaccagggcgaccagcacgagctgag 580
            |||||||||| |||||| ||||||| |||||
Sbjct: 117 agcggccaccacggcgacgagcacgacctgag 86



to top

>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2087

 Score =  349 bits (176), Expect = 7e-93
 Identities = 294/332 (88%), Gaps = 1/332 (0%)
 Strand = Plus / Minus

                                                                        
Query: 249  gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 308
            |||||| ||||||||||||||||||| |||| ||||||||||||||||||||| ||||||
Sbjct: 1607 gatcagtgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccg 1548

                                                                        
Query: 309  cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 368
            ||| | | |||||||||||||||||||||||| || |||||| | |||||||||||||||
Sbjct: 1547 cactttgtggggatgccggcggccttgccagcattgagcccagcagcagcgctcttgatg 1488

                                                                        
Query: 369  cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 428
            ||||||||| ||||||||||||||||||||||| |||| | || ||| || ||| | |||
Sbjct: 1487 cacttgcacaccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacg 1428

                                                                        
Query: 429  ccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcagggg 488
            |||||||||||||||||||  ||  |||||||||||||||| ||||||||||||||||||
Sbjct: 1427 ccgctgcagcaggccgcagatgggctggcgccgttgccgcgtgcataggagatgcagggg 1368

                                                                        
Query: 489  ctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacgaggagcat 548
            |||||||||||||||||||||||||| || | || |||| || | | || ||||||||||
Sbjct: 1367 ctcaaggcagagctcacctgaccgcacgatacgg-ccgcctccgtgactgcgaggagcat 1309

                                            
Query: 549  ggcggccaccagggcgaccagcacgagctgag 580
             |||||||||| |||||| ||||||| |||||
Sbjct: 1308 agcggccaccacggcgacgagcacgacctgag 1277



to top

>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific
           lipid transfer protein precursor (ltp9.2 gene)
          Length = 604

 Score =  345 bits (174), Expect = 1e-91
 Identities = 243/266 (91%)
 Strand = Plus / Minus

                                                                       
Query: 249 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 308
           |||||||||||||||||||||||||| |||| |||||||||||| |||||||| ||||||
Sbjct: 315 gatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaagggacgctaacgccg 256

                                                                       
Query: 309 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 368
           ||| | | ||||||||||||||||||||||||||| |||||| | |||||||||||||||
Sbjct: 255 cactttgtggggatgccggcggccttgccagcgttgagcccagcagcagcgctcttgatg 196

                                                                       
Query: 369 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 428
           ||||||||||||||||||||||||||||||||| |||| | || ||| || ||| | |||
Sbjct: 195 cacttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacg 136

                                                                       
Query: 429 ccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcagggg 488
           |||||||||||||||||||  ||  |||||||||||||||| ||||||||||||||||||
Sbjct: 135 ccgctgcagcaggccgcagatgggctggcgccgttgccgcgtgcataggagatgcagggg 76

                                     
Query: 489 ctcaaggcagagctcacctgaccgca 514
           ||||||||||||||||||||||||||
Sbjct: 75  ctcaaggcagagctcacctgaccgca 50



to top

>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  327 bits (165), Expect = 3e-86
 Identities = 304/349 (87%), Gaps = 1/349 (0%)
 Strand = Plus / Minus

                                                                       
Query: 251 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 310
           ||||||||||||||||||||| ||||| | ||| ||||||||||||| ||||||||||||
Sbjct: 348 tcagcgaatcttagagcagtccacggatgagctaatggcgtaggggatgctgacgccgca 289

                                                                       
Query: 311 catggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgca 370
           | ||||||||||||| |||||||| |||||||| |||||||| ||||| ||||| |||||
Sbjct: 288 cttggaggggatgcctgcggcctttccagcgttgagcccaccagcagcactcttaatgca 229

                                                                       
Query: 371 cttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacgcc 430
           ||||||||||||||||||||||||||||||| | || ||||||||||| ||| |||| ||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgcgctgcgccggccagactcctgacacc 169

                                                                       
Query: 431 gctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcaggggct 490
            ||||||||||||||||| ||  ||| |||| ||||||| ||||||||||||||||||||
Sbjct: 168 actgcagcaggccgcaggtgggctggagccgctgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 491 caaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacgaggagcatgg 550
           |||||||||||||||||| || |||||||| | | ||||| | ||||  ||||| ||| |
Sbjct: 108 caaggcagagctcacctggccacaggagattg-cagcgtctgtggctgtgaggaccattg 50

                                                            
Query: 551 cggccaccagggcgaccagcacgagctgagtagctgcagcgcgagccat 599
           | ||||| |||| || || |||||| |||| ||||||||| || |||||
Sbjct: 49  ctgccacgagggtgaacaacacgagttgagcagctgcagcacgggccat 1



to top

>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA,
           complete cds
          Length = 730

 Score =  238 bits (120), Expect = 2e-59
 Identities = 295/352 (83%), Gaps = 1/352 (0%)
 Strand = Plus / Minus

                                                                       
Query: 249 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 308
           |||||| | |||||||||||||| ||||| |||||||| | |||||||||||||||||||
Sbjct: 429 gatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccg 370

                                                                       
Query: 309 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 368
           ||| ||||||| ||||| |||||||||   | ||| ||||| || ||| | ||||||| |
Sbjct: 369 cacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttgagg 310

                                                                       
Query: 369 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 428
           ||| |||| |  ||||||||||| ||||||||| | ||   |||||||| | || |||||
Sbjct: 309 cacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacg 250

                                                                       
Query: 429 ccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcagggg 488
           ||||||||||||||| ||| |||  |||  ||| ||||    ||||||| || |||||||
Sbjct: 249 ccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggg 190

                                                                       
Query: 489 ctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacgaggagcat 548
            ||||||||||||||||||| ||||||  ||||||| ||||||| |||| |||||| |||
Sbjct: 189 gtcaaggcagagctcacctggccgcagctgatggcc-gcgtcggaggctgcgaggatcat 131

                                                               
Query: 549 ggcggccaccagggcgaccagcacgagctgagtagctgcagcgcgagccatc 600
            || ||||||||||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 130 tgccgccaccagggcgaccagcacgagcttagtagctgcagtgcgagccatc 79



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 150 ctcacatggagatcagatcagagcgtttattcatatatat 189
           ||||||||||||||| |||||||| ||||||||| |||||
Sbjct: 550 ctcacatggagatcatatcagagcatttattcatgtatat 511



to top

>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid
           transfer protein precursor
          Length = 496

 Score =  238 bits (120), Expect = 2e-59
 Identities = 295/352 (83%), Gaps = 1/352 (0%)
 Strand = Plus / Minus

                                                                       
Query: 249 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 308
           |||||| | |||||||||||||| ||||| |||||||| | |||||||||||||||||||
Sbjct: 370 gatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccg 311

                                                                       
Query: 309 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 368
           ||| ||||||| ||||| |||||||||   | ||| ||||| || ||| | ||||||| |
Sbjct: 310 cacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttgagg 251

                                                                       
Query: 369 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 428
           ||| |||| |  ||||||||||| ||||||||| | ||   |||||||| | || |||||
Sbjct: 250 cacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacg 191

                                                                       
Query: 429 ccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcagggg 488
           ||||||||||||||| ||| |||  |||  ||| ||||    ||||||| || |||||||
Sbjct: 190 ccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggg 131

                                                                       
Query: 489 ctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacgaggagcat 548
            ||||||||||||||||||| ||||||  ||||||| ||||||| |||| |||||| |||
Sbjct: 130 gtcaaggcagagctcacctggccgcagctgatggcc-gcgtcggaggctgcgaggatcat 72

                                                               
Query: 549 ggcggccaccagggcgaccagcacgagctgagtagctgcagcgcgagccatc 600
            || ||||||||||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 71  tgccgccaccagggcgaccagcacgagcttagtagctgcagtgcgagccatc 20



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 150 ctcacatggagatcagatcagagcgtttattcatatatat 189
           ||||||||||||||| |||||||| ||||||||| |||||
Sbjct: 491 ctcacatggagatcatatcagagcatttattcatgtatat 452



to top

>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds
          Length = 3448

 Score =  230 bits (116), Expect = 4e-57
 Identities = 294/352 (83%), Gaps = 1/352 (0%)
 Strand = Plus / Minus

                                                                        
Query: 249  gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 308
            |||||| | |||||||||||||| ||||| |||||||||| |||||||| ||||||||||
Sbjct: 3206 gatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccg 3147

                                                                        
Query: 309  cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 368
            ||| |||||||||| |  || ||||| || | ||| |||||||| ||||| |||||||||
Sbjct: 3146 cacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgatg 3087

                                                                        
Query: 369  cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 428
            ||| |||| |||||||||||||| ||||||||| | ||   |||||||| |||| | || 
Sbjct: 3086 cacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaact 3027

                                                                        
Query: 429  ccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcagggg 488
            |||   ||||||||| |||||||  |||| ||| ||||    || ||||||| ||||| |
Sbjct: 3026 ccggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggag 2967

                                                                        
Query: 489  ctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacgaggagcat 548
              || ||||||| ||||||||||||||||||| | ||||||||| |||||| ||||||||
Sbjct: 2966 gccagggcagagttcacctgaccgcaggagatcg-ccgcgtcggaggctaccaggagcat 2908

                                                                
Query: 549  ggcggccaccagggcgaccagcacgagctgagtagctgcagcgcgagccatc 600
             || |||||||||||||||||||||||||  || ||||||| ||||||||||
Sbjct: 2907 tgccgccaccagggcgaccagcacgagctttgttgctgcagtgcgagccatc 2856



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 150  ctcacatggagatcagatcagagcgtttattcatatatat 189
            ||||||||||||||| |||||||| ||||||||| |||||
Sbjct: 3341 ctcacatggagatcatatcagagcatttattcatgtatat 3302



to top

>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA,
           complete cds
          Length = 737

 Score =  230 bits (116), Expect = 4e-57
 Identities = 294/352 (83%), Gaps = 1/352 (0%)
 Strand = Plus / Minus

                                                                       
Query: 249 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 308
           |||||| | |||||||||||||| ||||| |||||||||| |||||||| ||||||||||
Sbjct: 410 gatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccg 351

                                                                       
Query: 309 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 368
           ||| |||||||||| |  || ||||| || | ||| |||||||| ||||| |||||||||
Sbjct: 350 cacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgatg 291

                                                                       
Query: 369 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 428
           ||| |||| |||||||||||||| ||||||||| | ||   |||||||| |||| | || 
Sbjct: 290 cacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaact 231

                                                                       
Query: 429 ccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcagggg 488
           |||   ||||||||| |||||||  |||| ||| ||||    || ||||||| ||||| |
Sbjct: 230 ccggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggag 171

                                                                       
Query: 489 ctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacgaggagcat 548
             || ||||||| ||||||||||||||||||| | ||||||||| |||||| ||||||||
Sbjct: 170 gccagggcagagttcacctgaccgcaggagatcg-ccgcgtcggaggctaccaggagcat 112

                                                               
Query: 549 ggcggccaccagggcgaccagcacgagctgagtagctgcagcgcgagccatc 600
            || |||||||||||||||||||||||||  || ||||||| ||||||||||
Sbjct: 111 tgccgccaccagggcgaccagcacgagctttgttgctgcagtgcgagccatc 60



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 150 ctcacatggagatcagatcagagcgtttattcatatatat 189
           ||||||||||||||| |||||||| ||||||||| |||||
Sbjct: 545 ctcacatggagatcatatcagagcatttattcatgtatat 506



to top

>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds
          Length = 348

 Score =  226 bits (114), Expect = 7e-56
 Identities = 286/342 (83%), Gaps = 1/342 (0%)
 Strand = Plus / Minus

                                                                       
Query: 258 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 317
           |||||||||||||| ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 318 gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 377
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222

                                                                       
Query: 378 gccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacgccgctgcag 437
           |||||||||||||| ||||||||| | ||   |||||||| |||| | || |||   |||
Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162

                                                                       
Query: 438 caggccgcaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggca 497
           |||||| |||||||  |||| ||| ||||    || ||||||| ||||| |  || ||||
Sbjct: 161 caggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggaggccagggca 102

                                                                       
Query: 498 gagctcacctgaccgcaggagatggcccgcgtcggcggctacgaggagcatggcggccac 557
           ||| ||||||||||||||||||| | ||||||||| |||||| |||||||| || |||||
Sbjct: 101 gagttcacctgaccgcaggagatcg-ccgcgtcggaggctaccaggagcattgccgccac 43

                                                     
Query: 558 cagggcgaccagcacgagctgagtagctgcagcgcgagccat 599
           ||||||||||||||||||||  || ||||||| |||||||||
Sbjct: 42  cagggcgaccagcacgagctttgttgctgcagtgcgagccat 1



to top

>gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) mRNA, complete cds
          Length = 348

 Score =  226 bits (114), Expect = 7e-56
 Identities = 286/342 (83%), Gaps = 1/342 (0%)
 Strand = Plus / Minus

                                                                       
Query: 258 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 317
           |||||||||||||| ||||| |||||||| | |||||||||||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttggag 282

                                                                       
Query: 318 gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 377
           || ||||| |||||||||   | ||| ||||| || ||| | ||||||| |||| |||| 
Sbjct: 281 ggaatgcctgcggccttgttggggttgagccctccggcaacactcttgaggcacctgcat 222

                                                                       
Query: 378 gccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacgccgctgcag 437
           |  ||||||||||| ||||||||| | ||   |||||||| | || ||||||||||||||
Sbjct: 221 gtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacgccgctgcag 162

                                                                       
Query: 438 caggccgcaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggca 497
           |||||| ||| |||  |||  ||| ||||    ||||||| || ||||||| ||||||||
Sbjct: 161 caggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggggtcaaggca 102

                                                                       
Query: 498 gagctcacctgaccgcaggagatggcccgcgtcggcggctacgaggagcatggcggccac 557
           ||||||||||| ||||||  ||||| ||||||||| |||| |||||| ||| || |||||
Sbjct: 101 gagctcacctggccgcagctgatgg-ccgcgtcggaggctgcgaggatcattgccgccac 43

                                                     
Query: 558 cagggcgaccagcacgagctgagtagctgcagcgcgagccat 599
           |||||||||||||||||| | ||||||||||| |||||||||
Sbjct: 42  cagggcgaccagcacgagtttagtagctgcagtgcgagccat 1



to top

>gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4) mRNA, complete
           cds
          Length = 345

 Score =  218 bits (110), Expect = 2e-53
 Identities = 261/310 (84%), Gaps = 1/310 (0%)
 Strand = Plus / Minus

                                                                       
Query: 290 gtaggggacgctgacgccgcacatggaggggatgccggcggccttgccagcgttaagccc 349
           ||||||||||||||||| |||| ||||||||||  | |||||| ||||  | || | |||
Sbjct: 309 gtaggggacgctgacgcggcacttggaggggatctctgcggccgtgccttctttgacccc 250

                                                                       
Query: 350 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagc 409
           ||| ||||| ||||||||||||  ||||||||||| |||||||||||   ||||  |   
Sbjct: 249 accggcagcactcttgatgcacaggcacgccgctttcttgtcagcggcagtctgcacttg 190

                                                                       
Query: 410 gccggccagtctcttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcg 469
           |||||||| |||| |||||||||||||||||||||||| |||  ||||||||||||||||
Sbjct: 189 gccggccaatctcctgacgccgctgcagcaggccgcagacgggctggcgccgttgccgcg 130

                                                                       
Query: 470 ggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatggcccgcgt 529
            |||||||| | ||| ||||  | ||| ||||||||||| ||||||||||| | ||||||
Sbjct: 129 tgcataggaaaggcacgggccaagggcggagctcacctggccgcaggagattg-ccgcgt 71

                                                                       
Query: 530 cggcggctacgaggagcatggcggccaccagggcgaccagcacgagctgagtagctgcag 589
           ||| |||||| ||||| |  || ||||||||||||||||||||||||| |||||||| ||
Sbjct: 70  cggaggctacaaggaggagtgccgccaccagggcgaccagcacgagcttagtagctgtag 11

                     
Query: 590 cgcgagccat 599
            |||||||||
Sbjct: 10  tgcgagccat 1



to top

>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  210 bits (106), Expect = 4e-51
 Identities = 284/342 (83%), Gaps = 1/342 (0%)
 Strand = Plus / Minus

                                                                       
Query: 258 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 317
           ||||||||||| || ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcaatccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 318 gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 377
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222

                                                                       
Query: 378 gccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacgccgctgcag 437
           |||||||||||||| ||||||||| | ||   |||||||| |||| | || |||   |||
Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162

                                                                       
Query: 438 caggccgcaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggca 497
           |||||| |||||||  |||| ||| ||||    || ||||||| ||||| |  || ||||
Sbjct: 161 caggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggaggccagggca 102

                                                                       
Query: 498 gagctcacctgaccgcaggagatggcccgcgtcggcggctacgaggagcatggcggccac 557
           ||| ||||||||||||||| ||| | ||||||||| |||||| |||||||| || |||||
Sbjct: 101 gagttcacctgaccgcaggggatcg-ccgcgtcggaggctaccaggagcattgccgccac 43

                                                     
Query: 558 cagggcgaccagcacgagctgagtagctgcagcgcgagccat 599
           ||||||||||||||||||||  || ||||||| |||||||||
Sbjct: 42  cagggcgaccagcacgagctttgttgctgcagtgcgagccat 1



to top

>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor
          Length = 627

 Score =  206 bits (104), Expect = 6e-50
 Identities = 291/352 (82%), Gaps = 1/352 (0%)
 Strand = Plus / Minus

                                                                       
Query: 249 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 308
           |||||| | ||||| |||||||||||    |||||||| | |||||||||||||||||||
Sbjct: 352 gatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgacgccg 293

                                                                       
Query: 309 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 368
           ||| ||||||||||||| |||||| |||| |||||   | | || ||  | ||||||| |
Sbjct: 292 cacctggaggggatgcctgcggccctgccggcgttgtacgcgccggcgacactcttgagg 233

                                                                       
Query: 369 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 428
           ||| ||||||  ||||||||||| ||||||||| | ||   |||||||| ||||||||| 
Sbjct: 232 cacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttgact 173

                                                                       
Query: 429 ccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcagggg 488
           ||||| |||||| ||||||  ||  ||| |||| ||||    || |||| |  |||||||
Sbjct: 172 ccgctacagcagcccgcagaagggctggtgccgctgccttttgcgtaggcggcgcagggg 113

                                                                       
Query: 489 ctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacgaggagcat 548
           | |||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||||
Sbjct: 112 cccaaggcagagctcacctggccgcaggtgatggcc-gcgtcggcggctacgaggagcat 54

                                                               
Query: 549 ggcggccaccagggcgaccagcacgagctgagtagctgcagcgcgagccatc 600
            || |||||||||||||||||| ||||||  || ||||||| ||||||||||
Sbjct: 53  tgccgccaccagggcgaccagcgcgagcttggttgctgcagtgcgagccatc 2



to top

>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA
          Length = 732

 Score =  190 bits (96), Expect = 4e-45
 Identities = 289/352 (82%), Gaps = 1/352 (0%)
 Strand = Plus / Minus

                                                                       
Query: 249 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 308
           |||||| | ||||| |||||||||||    |||||||| | ||||||||||||||| |||
Sbjct: 423 gatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgaccccg 364

                                                                       
Query: 309 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 368
           ||| ||||||||||||| |||||| | || |||||   | | || ||  | ||||||| |
Sbjct: 363 cacctggaggggatgcctgcggcccttccggcgttgtacgcgccggcgacactcttgagg 304

                                                                       
Query: 369 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 428
           ||| ||||||  ||||||||||| ||||||||| | ||   |||||||| ||||||||| 
Sbjct: 303 cacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttgact 244

                                                                       
Query: 429 ccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcagggg 488
           ||||| |||||| ||||||  ||  ||| |||| ||||    || |||| |  |||||||
Sbjct: 243 ccgctacagcagcccgcagaagggctggtgccgctgccttttgcgtaggcggcgcagggg 184

                                                                       
Query: 489 ctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacgaggagcat 548
           | |||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||||
Sbjct: 183 cccaaggcagagctcacctggccgcaggtgatggcc-gcgtcggcggctacgaggagcat 125

                                                               
Query: 549 ggcggccaccagggcgaccagcacgagctgagtagctgcagcgcgagccatc 600
            || |||||||||||||||||| ||||||  || ||||||| ||||||||||
Sbjct: 124 tgccgccaccagggcgaccagcgcgagcttggttgctgcagtgcgagccatc 73



to top

>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0086N07 map S790A, complete sequence
          Length = 178523

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Plus

                                                                         
Query: 262   tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 321
             |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 94021 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 94080

                                         
Query: 322   tgccggcggccttgccagcgttaagccc 349
             ||| |||||| ||||| ||||| |||||
Sbjct: 94081 tgctggcggcgttgccggcgttgagccc 94108



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 80/99 (80%)
 Strand = Plus / Plus

                                                                         
Query: 426   acgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcag 485
             |||||| ||||||||||||| |  ||   |||||||  ||||||||| |||| || ||||
Sbjct: 94194 acgccgttgcagcaggccgcggaagggccggcgccgccgccgcgggcgtaggtgaggcag 94253

                                                    
Query: 486   gggctcaaggcagagctcacctgaccgcaggagatggcc 524
             ||||  | ||| ||| ||||||| ||||||| |||||||
Sbjct: 94254 gggccaacggctgagttcacctggccgcaggtgatggcc 94292



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                            
Query: 262      tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 321
                |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13090059 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13090000

                                            
Query: 322      tgccggcggccttgccagcgttaagccc 349
                ||| |||||| ||||| ||||| |||||
Sbjct: 13089999 tgctggcggcgttgccggcgttgagccc 13089972



 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                          
Query: 264    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
              |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                        
Query: 324    ccggcggccttgccagcgttaagccc 349
              | |||||| ||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                          
Query: 264    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

                                  
Query: 324    ccggcggccttgccagcgtt 343
              | |||||| ||||| |||||
Sbjct: 692704 ctggcggcattgccggcgtt 692685



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 264    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
              |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410

                    
Query: 324    ccggcg 329
              ||||||
Sbjct: 679409 ccggcg 679404



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 80/99 (80%)
 Strand = Plus / Minus

                                                                            
Query: 426      acgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcag 485
                |||||| ||||||||||||| |  ||   |||||||  ||||||||| |||| || ||||
Sbjct: 13089886 acgccgttgcagcaggccgcggaagggccggcgccgccgccgcgggcgtaggtgaggcag 13089827

                                                       
Query: 486      gggctcaaggcagagctcacctgaccgcaggagatggcc 524
                ||||  | ||| ||| ||||||| ||||||| |||||||
Sbjct: 13089826 gggccaacggctgagttcacctggccgcaggtgatggcc 13089788



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 424    tgacgccgctgcagcaggccgc 445
              ||||||||||||||||||||||
Sbjct: 692595 tgacgccgctgcagcaggccgc 692574



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 296    gacgctgacgccgcacatggaggggatgccggcggc 331
              |||| ||||||||||| ||  |||||||||||||||
Sbjct: 714845 gacgttgacgccgcacttgccggggatgccggcggc 714810



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 426    acgccgctgcagcaggccgc 445
              ||||||||||||||||||||
Sbjct: 702270 acgccgctgcagcaggccgc 702251



to top

>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full
           insert sequence
          Length = 843

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                       
Query: 262 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 321
           |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 459 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 400

                                       
Query: 322 tgccggcggccttgccagcgttaagccc 349
           ||| |||||| ||||| ||||| |||||
Sbjct: 399 tgctggcggcgttgccggcgttgagccc 372



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 80/99 (80%)
 Strand = Plus / Minus

                                                                       
Query: 426 acgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcag 485
           |||||| ||||||||||||| |  ||   |||||||  ||||||||| |||| || ||||
Sbjct: 286 acgccgttgcagcaggccgcggaagggccggcgccgccgccgcgggcgtaggtgaggcag 227

                                                  
Query: 486 gggctcaaggcagagctcacctgaccgcaggagatggcc 524
           ||||  | ||| ||| ||||||| ||||||| |||||||
Sbjct: 226 gggccaacggctgagttcacctggccgcaggtgatggcc 188



to top

>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full
           insert sequence
          Length = 846

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                       
Query: 262 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 321
           |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 458 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 399

                                       
Query: 322 tgccggcggccttgccagcgttaagccc 349
           ||| |||||| ||||| ||||| |||||
Sbjct: 398 tgctggcggcgttgccggcgttgagccc 371



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 80/99 (80%)
 Strand = Plus / Minus

                                                                       
Query: 426 acgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcag 485
           |||||| ||||||||||||| |  ||   |||||||  ||||||||| |||| || ||||
Sbjct: 285 acgccgttgcagcaggccgcggaagggccggcgccgccgccgcgggcgtaggtgaggcag 226

                                                  
Query: 486 gggctcaaggcagagctcacctgaccgcaggagatggcc 524
           ||||  | ||| ||| ||||||| ||||||| |||||||
Sbjct: 225 gggccaacggctgagttcacctggccgcaggtgatggcc 187



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                            
Query: 262      tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 321
                |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13170238 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13170179

                                            
Query: 322      tgccggcggccttgccagcgttaagccc 349
                ||| |||||| ||||| ||||| |||||
Sbjct: 13170178 tgctggcggcgttgccggcgttgagccc 13170151



 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                          
Query: 264    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
              |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                        
Query: 324    ccggcggccttgccagcgttaagccc 349
              | |||||| ||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                          
Query: 264    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

                                  
Query: 324    ccggcggccttgccagcgtt 343
              | |||||| ||||| |||||
Sbjct: 692704 ctggcggcattgccggcgtt 692685



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 264    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
              |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410

                    
Query: 324    ccggcg 329
              ||||||
Sbjct: 679409 ccggcg 679404



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 80/99 (80%)
 Strand = Plus / Minus

                                                                            
Query: 426      acgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcag 485
                |||||| ||||||||||||| |  ||   |||||||  ||||||||| |||| || ||||
Sbjct: 13170065 acgccgttgcagcaggccgcggaagggccggcgccgccgccgcgggcgtaggtgaggcag 13170006

                                                       
Query: 486      gggctcaaggcagagctcacctgaccgcaggagatggcc 524
                ||||  | ||| ||| ||||||| ||||||| |||||||
Sbjct: 13170005 gggccaacggctgagttcacctggccgcaggtgatggcc 13169967



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 424    tgacgccgctgcagcaggccgc 445
              ||||||||||||||||||||||
Sbjct: 692595 tgacgccgctgcagcaggccgc 692574



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 296    gacgctgacgccgcacatggaggggatgccggcggc 331
              |||| ||||||||||| ||  |||||||||||||||
Sbjct: 714845 gacgttgacgccgcacttgccggggatgccggcggc 714810



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 426    acgccgctgcagcaggccgc 445
              ||||||||||||||||||||
Sbjct: 702270 acgccgctgcagcaggccgc 702251



to top

>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA
          Length = 724

 Score =  117 bits (59), Expect = 5e-23
 Identities = 165/199 (82%), Gaps = 1/199 (0%)
 Strand = Plus / Minus

                                                                       
Query: 249 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 308
           |||||| | |||||||||||||||||    |||||||| | |||||||||||||||||||
Sbjct: 420 gatcagtggatcttagagcagtcgacactggcgctgatcgtgtaggggacgctgacgccg 361

                                                                       
Query: 309 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 368
           ||| ||||||||||||| |||||| |||| |||||   | | || ||| | ||||||| |
Sbjct: 360 cacctggaggggatgcctgcggccctgccggcgttgtacgcgccggca-cactcttgagg 302

                                                                       
Query: 369 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 428
           ||| ||||||  ||||||||||| ||||||||| | ||   |||||||| ||||||||| 
Sbjct: 301 cacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttgact 242

                              
Query: 429 ccgctgcagcaggccgcag 447
           ||||| |||||| ||||||
Sbjct: 241 ccgctacagcagcccgcag 223



 Score =  113 bits (57), Expect = 7e-22
 Identities = 104/119 (87%), Gaps = 3/119 (2%)
 Strand = Plus / Minus

                                                                       
Query: 482 gcaggggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggcggctacga 541
           |||||||| |||||||||||||||||| ||||||| ||||   |||||||||||||||||
Sbjct: 189 gcaggggcccaaggcagagctcacctggccgcaggtgatg---cgcgtcggcggctacga 133

                                                                      
Query: 542 ggagcatggcggccaccagggcgaccagcacgagctgagtagctgcagcgcgagccatc 600
           ||||||| || ||||||||||  |||||| ||||||  || ||||||| ||||||||||
Sbjct: 132 ggagcattgccgccaccaggggcaccagcgcgagcttggttgctgcagtgcgagccatc 74



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12,
              complete sequence
          Length = 27566993

 Score =  115 bits (58), Expect = 2e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                          
Query: 264    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
              |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                        
Query: 324    ccggcggccttgccagcgttaagccc 349
              | |||||| ||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                          
Query: 264    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

                                  
Query: 324    ccggcggccttgccagcgtt 343
              | |||||| ||||| |||||
Sbjct: 732556 ctggcggcattgccggcgtt 732537



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 264    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
              |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668

                    
Query: 324    ccggcg 329
              ||||||
Sbjct: 722667 ccggcg 722662



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 424    tgacgccgctgcagcaggccgc 445
              ||||||||||||||||||||||
Sbjct: 732447 tgacgccgctgcagcaggccgc 732426



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 296    gacgctgacgccgcacatggaggggatgccggcggc 331
              |||| ||||||||||| ||  |||||||||||||||
Sbjct: 745555 gacgttgacgccgcacttgccggggatgccggcggc 745520



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 426    acgccgctgcagcaggccgc 445
              ||||||||||||||||||||
Sbjct: 736572 acgccgctgcagcaggccgc 736553



to top

>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15
          Length = 511

 Score =  115 bits (58), Expect = 2e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 413 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 354

                                     
Query: 324 ccggcggccttgccagcgttaagccc 349
           | |||||| ||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgttgagccc 328



to top

>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full
           insert sequence
          Length = 995

 Score =  115 bits (58), Expect = 2e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 670 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 611

                                     
Query: 324 ccggcggccttgccagcgttaagccc 349
           | |||||| ||||| ||||| |||||
Sbjct: 610 ctggcggcgttgccggcgttgagccc 585



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 426 acgccgctgcagcaggccgc 445
           ||||||||||||||||||||
Sbjct: 499 acgccgctgcagcaggccgc 480



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  115 bits (58), Expect = 2e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                          
Query: 264    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
              |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                        
Query: 324    ccggcggccttgccagcgttaagccc 349
              | |||||| ||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                          
Query: 264    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

                                  
Query: 324    ccggcggccttgccagcgtt 343
              | |||||| ||||| |||||
Sbjct: 732556 ctggcggcattgccggcgtt 732537



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 264    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
              |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668

                    
Query: 324    ccggcg 329
              ||||||
Sbjct: 722667 ccggcg 722662



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 424    tgacgccgctgcagcaggccgc 445
              ||||||||||||||||||||||
Sbjct: 732447 tgacgccgctgcagcaggccgc 732426



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 296    gacgctgacgccgcacatggaggggatgccggcggc 331
              |||| ||||||||||| ||  |||||||||||||||
Sbjct: 745555 gacgttgacgccgcacttgccggggatgccggcggc 745520



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 426    acgccgctgcagcaggccgc 445
              ||||||||||||||||||||
Sbjct: 736572 acgccgctgcagcaggccgc 736553



to top

>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118211

 Score =  115 bits (58), Expect = 2e-22
 Identities = 79/86 (91%)
 Strand = Plus / Plus

                                                                         
Query: 264   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
             |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 42391 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 42450

                                       
Query: 324   ccggcggccttgccagcgttaagccc 349
             | |||||| ||||| ||||| |||||
Sbjct: 42451 ctggcggcgttgccggcgttgagccc 42476



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                         
Query: 264   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
             |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 46518 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 46577

                                 
Query: 324   ccggcggccttgccagcgtt 343
             | |||||| ||||| |||||
Sbjct: 46578 ctggcggcattgccggcgtt 46597



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                         
Query: 264   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
             |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 56407 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 56466

                   
Query: 324   ccggcg 329
             ||||||
Sbjct: 56467 ccggcg 56472



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 424   tgacgccgctgcagcaggccgc 445
             ||||||||||||||||||||||
Sbjct: 46687 tgacgccgctgcagcaggccgc 46708



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 426   acgccgctgcagcaggccgc 445
             ||||||||||||||||||||
Sbjct: 42562 acgccgctgcagcaggccgc 42581



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 296   gacgctgacgccgcacatggaggggatgccggcggc 331
             |||| ||||||||||| ||  |||||||||||||||
Sbjct: 33579 gacgttgacgccgcacttgccggggatgccggcggc 33614



to top

>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1
           mRNA, complete cds
          Length = 530

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 426 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 367

                                     
Query: 324 ccggcggccttgccagcgttaagccc 349
           | |||||| ||||| ||||| |||||
Sbjct: 366 ctggcggcgttgccggcgttgagccc 341



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 426 acgccgctgcagcaggccgc 445
           ||||||||||||||||||||
Sbjct: 255 acgccgctgcagcaggccgc 236



to top

>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein
          Length = 799

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

                                     
Query: 324 ccggcggccttgccagcgttaagccc 349
           | |||||| ||||| ||||| |||||
Sbjct: 378 ctggcggcgttgccggcgttgagccc 353



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 426 acgccgctgcagcaggccgc 445
           ||||||||||||||||||||
Sbjct: 267 acgccgctgcagcaggccgc 248



to top

>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full
            insert sequence
          Length = 2882

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                        
Query: 264  gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
            |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 2445 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 2386

                                      
Query: 324  ccggcggccttgccagcgttaagccc 349
            | |||||| ||||| ||||| |||||
Sbjct: 2385 ctggcggcgttgccggcgttgagccc 2360



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 426  acgccgctgcagcaggccgc 445
            ||||||||||||||||||||
Sbjct: 2274 acgccgctgcagcaggccgc 2255



to top

>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full
           insert sequence
          Length = 551

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 322 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 263

                                     
Query: 324 ccggcggccttgccagcgttaagccc 349
           | |||||| ||||| ||||| |||||
Sbjct: 262 ctggcggcgttgccggcgttgagccc 237



to top

>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from
             chromosome 11 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 181322

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Plus

                                                                         
Query: 264   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
             |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 40531 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 40590

                                       
Query: 324   ccggcggccttgccagcgttaagccc 349
             | |||||| ||||| ||||| |||||
Sbjct: 40591 ctggcggcgttgccggcgttgagccc 40616



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                         
Query: 264   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
             |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 50208 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 50267

                                 
Query: 324   ccggcggccttgccagcgtt 343
             | |||||| ||||| |||||
Sbjct: 50268 ctggcggcattgccggcgtt 50287



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                         
Query: 264   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
             |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 63503 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 63562

                   
Query: 324   ccggcg 329
             ||||||
Sbjct: 63563 ccggcg 63568



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 424   tgacgccgctgcagcaggccgc 445
             ||||||||||||||||||||||
Sbjct: 50377 tgacgccgctgcagcaggccgc 50398



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 426   acgccgctgcagcaggccgc 445
             ||||||||||||||||||||
Sbjct: 40702 acgccgctgcagcaggccgc 40721



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 296   gacgctgacgccgcacatggaggggatgccggcggc 331
             |||| ||||||||||| ||  |||||||||||||||
Sbjct: 28127 gacgttgacgccgcacttgccggggatgccggcggc 28162



to top

>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds
          Length = 799

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

                                     
Query: 324 ccggcggccttgccagcgttaagccc 349
           | |||||| ||||| ||||| |||||
Sbjct: 378 ctggcggcgttgccggcgttgagccc 353



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 426 acgccgctgcagcaggccgc 445
           ||||||||||||||||||||
Sbjct: 267 acgccgctgcagcaggccgc 248



to top

>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds
          Length = 507

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           ||||||| || |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 373 gagcagtggatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 314

                                     
Query: 324 ccggcggccttgccagcgttaagccc 349
           | |||||| ||||| ||||| |||||
Sbjct: 313 ctggcggcgttgccggcgttgagccc 288



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 426 acgccgctgcagcaggccgc 445
           ||||||||||||||||||||
Sbjct: 202 acgccgctgcagcaggccgc 183



to top

>gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT III mRNA, complete cds
          Length = 805

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 78/86 (90%), Gaps = 1/86 (1%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||| |||||||||||||| |||||| ||||||||||||||| |||||||||||
Sbjct: 412 gagcagtcgatggaagcgctgatggtgtaggg-acgctgacgccgcacttggaggggatg 354

                                     
Query: 324 ccggcggccttgccagcgttaagccc 349
           | |||||| ||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgttgagccc 328



to top

>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1
           mRNA, complete cds
          Length = 647

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 469 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 410

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 409 ctggcggcattgccggcgtt 390



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 424 tgacgccgctgcagcaggccgc 445
           ||||||||||||||||||||||
Sbjct: 300 tgacgccgctgcagcaggccgc 279



to top

>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS
          Length = 1485

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 701 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 642

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 641 ctggcggcattgccggcgtt 622



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 424 tgacgccgctgcagcaggccgc 445
           ||||||||||||||||||||||
Sbjct: 532 tgacgccgctgcagcaggccgc 511



to top

>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA
          Length = 717

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 294 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 235

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 234 ctggcggcgttgccggcgtt 215



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 498 gagctcacctgaccgcaggagatggcc 524
           ||||||||||| |||||||||||||||
Sbjct: 54  gagctcacctgcccgcaggagatggcc 28



to top

>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene
          Length = 1499

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 997 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 938

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 937 ctggcggcgttgccggcgtt 918



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 498 gagctcacctgaccgcaggagatggcc 524
           ||||||||||| |||||||||||||||
Sbjct: 754 gagctcacctgcccgcaggagatggcc 728



to top

>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1
          Length = 692

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 331 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 272

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 271 ctggcggcattgccggcgtt 252



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 424 tgacgccgctgcagcaggccgc 445
           ||||||||||||||||||||||
Sbjct: 162 tgacgccgctgcagcaggccgc 141



to top

>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full
           insert sequence
          Length = 1003

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 654 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 595

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 594 ctggcggcattgccggcgtt 575



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 424 tgacgccgctgcagcaggccgc 445
           ||||||||||||||||||||||
Sbjct: 485 tgacgccgctgcagcaggccgc 464



to top

>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full
           insert sequence
          Length = 840

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 437 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 378

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 377 ctggcggcattgccggcgtt 358



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 424 tgacgccgctgcagcaggccgc 445
           ||||||||||||||||||||||
Sbjct: 268 tgacgccgctgcagcaggccgc 247



to top

>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds
          Length = 845

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 419 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 360

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 359 ctggcggcattgccggcgtt 340



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 424 tgacgccgctgcagcaggccgc 445
           ||||||||||||||||||||||
Sbjct: 250 tgacgccgctgcagcaggccgc 229



to top

>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene
          Length = 1800

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 965 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 906

                         
Query: 324 ccggcggccttgcc 337
           | ||||||||||||
Sbjct: 905 ctggcggccttgcc 892



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 60/66 (90%)
 Strand = Plus / Minus

                                                                            
Query: 264      gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
                |||||||||  ||||| ||||||||||||||||| | ||||||||||| |||||||||||
Sbjct: 14437064 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 14437005

                      
Query: 324      ccggcg 329
                ||||||
Sbjct: 14437004 ccggcg 14436999



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 151      tcacatggagatcagatcaga 171
                |||||||||||||||||||||
Sbjct: 22847882 tcacatggagatcagatcaga 22847902



to top

>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1116_C12
          Length = 116758

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 60/66 (90%)
 Strand = Plus / Minus

                                                                         
Query: 264   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
             |||||||||  ||||| ||||||||||||||||| | ||||||||||| |||||||||||
Sbjct: 45562 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 45503

                   
Query: 324   ccggcg 329
             ||||||
Sbjct: 45502 ccggcg 45497



to top

>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 695

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 276 gaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcggccttg 335
           |||| |||||||| |||||||| ||||||||||||| |||||||||||| |||||| |||
Sbjct: 325 gaagggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattg 266

                   
Query: 336 ccagcgtt 343
           || |||||
Sbjct: 265 ccggcgtt 258



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 424 tgacgccgctgcagcaggccgc 445
           ||||||||||||||||||||||
Sbjct: 168 tgacgccgctgcagcaggccgc 147



to top

>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds
          Length = 770

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 423 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 364

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 363 ctggcggcgttgccggcgtt 344



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 215 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 156

            
Query: 523 c 523
           |
Sbjct: 155 c 155



to top

>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 698

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 333 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 274

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 273 ctggcggcgttgccggcgtt 254



to top

>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 514

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 265 ctggcggcgttgccggcgtt 246



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 420 ctcttgacgccgctgcagcag 440
           |||||||||||||||||||||
Sbjct: 160 ctcttgacgccgctgcagcag 140



to top

>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 514

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 265 ctggcggcgttgccggcgtt 246



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 420 ctcttgacgccgctgcagcag 440
           |||||||||||||||||||||
Sbjct: 160 ctcttgacgccgctgcagcag 140



to top

>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 804

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 374 ctggcggcgttgccggcgtt 355



to top

>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 391 ctggcggcgttgccggcgtt 372



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 420 ctcttgacgccgctgcagcag 440
           |||||||||||||||||||||
Sbjct: 286 ctcttgacgccgctgcagcag 266



to top

>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 523 c 523
           |
Sbjct: 76  c 76



to top

>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 523 c 523
           |
Sbjct: 76  c 76



to top

>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 523 c 523
           |
Sbjct: 76  c 76



to top

>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 523 c 523
           |
Sbjct: 76  c 76



to top

>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 523 c 523
           |
Sbjct: 76  c 76



to top

>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 635

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 523 c 523
           |
Sbjct: 76  c 76



to top

>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 523 c 523
           |
Sbjct: 76  c 76



to top

>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 523 c 523
           |
Sbjct: 76  c 76



to top

>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 523 c 523
           |
Sbjct: 76  c 76



to top

>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 613

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 110 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 51

            
Query: 523 c 523
           |
Sbjct: 50  c 50



to top

>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2)
           gene, partial cds
          Length = 613

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 110 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 51

            
Query: 523 c 523
           |
Sbjct: 50  c 50



to top

>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 523 c 523
           |
Sbjct: 147 c 147



to top

>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 523 c 523
           |
Sbjct: 147 c 147



to top

>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 829

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 414 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 355

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 354 ctggcggcgttgccggcgtt 335



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 206 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 147

            
Query: 523 c 523
           |
Sbjct: 146 c 146



to top

>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 816

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 523 c 523
           |
Sbjct: 147 c 147



to top

>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 523 c 523
           |
Sbjct: 147 c 147



to top

>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 523 c 523
           |
Sbjct: 147 c 147



to top

>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 818

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 523 c 523
           |
Sbjct: 147 c 147



to top

>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 523 c 523
           |
Sbjct: 147 c 147



to top

>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 523 c 523
           |
Sbjct: 147 c 147



to top

>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 832

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 523 c 523
           |
Sbjct: 147 c 147



to top

>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 820

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 523 c 523
           |
Sbjct: 147 c 147



to top

>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 523 c 523
           |
Sbjct: 147 c 147



to top

>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full
           insert sequence
          Length = 718

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Plus

                                                                       
Query: 281 gctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcggccttgccagc 340
           |||||||| |||||||| ||||||||||||| |||||||||||| |||||| ||||| ||
Sbjct: 97  gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggc 156

              
Query: 341 gtt 343
           |||
Sbjct: 157 gtt 159



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 424 tgacgccgctgcagcaggccgc 445
           ||||||||||||||||||||||
Sbjct: 249 tgacgccgctgcagcaggccgc 270



to top

>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full
           insert sequence
          Length = 793

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 430 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 371

                 
Query: 324 ccggcg 329
           ||||||
Sbjct: 370 ccggcg 365



to top

>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full
            insert sequence
          Length = 3876

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                        
Query: 264  gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
            |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 3516 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 3457

                  
Query: 324  ccggcg 329
            ||||||
Sbjct: 3456 ccggcg 3451



to top

>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full
           insert sequence
          Length = 792

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 432 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 373

                 
Query: 324 ccggcg 329
           ||||||
Sbjct: 372 ccggcg 367



to top

>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full
           insert sequence
          Length = 745

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 434 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 375

                 
Query: 324 ccggcg 329
           ||||||
Sbjct: 374 ccggcg 369



to top

>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence
          Length = 827

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375

                   
Query: 324 ccggcggc 331
           | ||||||
Sbjct: 374 ctggcggc 367



to top

>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete
           cds
          Length = 840

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||| ||| | |||||||| ||||||||   ||||||||||| |||||||||||
Sbjct: 414 gagcagtcgatggaggggctgatggtgtaggggatcgtgacgccgcacttggaggggatg 355

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 354 ctggcggcattgccggcgtt 335



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 424 tgacgccgctgcagcaggccgc 445
           ||||||||||||||||||||||
Sbjct: 245 tgacgccgctgcagcaggccgc 224



to top

>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 699

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| ||||||| |||
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggagggtatg 259

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239



to top

>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 780

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 416 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 357

                   
Query: 324 ccggcggc 331
           | ||||||
Sbjct: 356 ctggcggc 349



to top

>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 714

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 341 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 282

                   
Query: 324 ccggcggc 331
           | ||||||
Sbjct: 281 ctggcggc 274



to top

>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 648

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 440 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 381

                   
Query: 324 ccggcggc 331
           | ||||||
Sbjct: 380 ctggcggc 373



to top

>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 829

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394

                   
Query: 324 ccggcggc 331
           | ||||||
Sbjct: 393 ctggcggc 386



to top

>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 455 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 396

                   
Query: 324 ccggcggc 331
           | ||||||
Sbjct: 395 ctggcggc 388



to top

>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 821

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 324 ccggcggc 331
           | ||||||
Sbjct: 390 ctggcggc 383



to top

>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 832

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394

                   
Query: 324 ccggcggc 331
           | ||||||
Sbjct: 393 ctggcggc 386



to top

>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 835

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 324 ccggcggc 331
           | ||||||
Sbjct: 390 ctggcggc 383



to top

>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 814

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 324 ccggcggc 331
           | ||||||
Sbjct: 390 ctggcggc 383



to top

>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||| ||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 523 c 523
           |
Sbjct: 147 c 147



to top

>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||| ||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356

                               
Query: 324 ccggcggccttgccagcgtt 343
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 522
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 523 c 523
           |
Sbjct: 147 c 147



to top

>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end
          Length = 677

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 264 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 205

                   
Query: 324 ccggcggc 331
           | ||||||
Sbjct: 204 ctggcggc 197



to top

>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone
           9C2
          Length = 813

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392

                   
Query: 324 ccggcggc 331
           | ||||||
Sbjct: 391 ctggcggc 384



to top

>gb|AF051369.1|AF051369 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 766

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||||| |||||| |||||||||| | |||| |||||| |||||||||||
Sbjct: 384 gagcagtcggtggaagggctgatagcgtaggggatgttgaccccgcacttggaggggatg 325

                 
Query: 324 ccggcg 329
           ||||||
Sbjct: 324 ccggcg 319



to top

>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 709

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | ||||||||  ||||||| ||||||||||||| |||||||||||
Sbjct: 319 gagcagtcggtggaggtgctgatggtataggggatgctgacgccgcacttggaggggatg 260

                   
Query: 324 ccggcggc 331
           | ||||||
Sbjct: 259 ctggcggc 252



to top

>gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 686

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||| | |||||||| |||||||| ||||||||| ||| |||||||||||
Sbjct: 320 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccacacttggaggggatg 261

                   
Query: 324 ccggcggc 331
           | ||||||
Sbjct: 260 ctggcggc 253



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 420 ctcttgacgccgctgcagcag 440
           |||||||||||||||||||||
Sbjct: 155 ctcttgacgccgctgcagcag 135



to top

>dbj|D10955.1|RIC323PTP Oryza sativa mRNA for phospholipid trasfer protein
          Length = 372

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 264 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 323
           |||||||||  ||||| ||||||| ||||||||| | ||||| ||||| |||||||||||
Sbjct: 141 gagcagtcggtggaagggctgatgccgtaggggatgttgacgtcgcacttggaggggatg 82

              
Query: 324 ccg 326
           |||
Sbjct: 81  ccg 79



to top

>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6
            (Ltp6) gene, promoter and complete cds
          Length = 3257

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 281  gctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcg 329
            ||||||||||||||||| | ||||||||||| ||  |||||||||||||
Sbjct: 2770 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 2722



to top

>gb|AY057932.1| Bromus inermis nonspecific lipid transfer protein (BG14) mRNA,
           complete cds
          Length = 841

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 283 tgatggcgtaggggacgctgacgccgcacatggaggggatgccggcg 329
           |||||||||||||||   ||||||||||| ||  |||||||||||||
Sbjct: 401 tgatggcgtaggggatattgacgccgcacttgctggggatgccggcg 355



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 552     ggccaccagggcgaccagcacg 573
               ||||||||||||||||||||||
Sbjct: 4508691 ggccaccagggcgaccagcacg 4508670



to top

>gb|AY212102.1| Papio cynocephalus isolate mk_3 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212101.1| Papio cynocephalus isolate mk_2 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212100.1| Papio cynocephalus isolate mk_1 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212099.1| Papio anubis isolate gil4_A6 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212098.1| Papio anubis isolate gil2_A4 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212097.1| Papio anubis isolate gil_3 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212096.1| Papio anubis isolate RC233 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212095.1| Papio anubis isolate KenyanA2SW76 NADH dehydrogenase subunit 4
           gene, partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu
           genes, complete sequence; and NADH dehydrogenase subunit
           5 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212094.1| Papio anubis isolate KenyanA1SW331 NADH dehydrogenase subunit 4
           gene, partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu
           genes, complete sequence; and NADH dehydrogenase subunit
           5 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212093.1| Papio anubis isolate BE93090 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212092.1| Papio anubis isolate BE93089 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212091.1| Papio anubis isolate BE73138 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212089.1| Papio anubis isolate BE73005 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212088.1| Papio anubis isolate BE73165 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212087.1| Papio anubis isolate BE73076 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212086.1| Papio anubis isolate BE73142 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212085.1| Papio hamadryas isolate BE94003 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212084.1| Papio hamadryas isolate BE73274 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212081.1| Papio hamadryas isolate BE73360 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212080.1| Papio hamadryas isolate BE73275 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212079.1| Papio hamadryas isolate BE73222 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212072.1| Papio hamadryas isolate BE97070 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212071.1| Papio hamadryas isolate BE97119 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212061.1| Papio hamadryas isolate dw37 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AC159631.2| Mus musculus BAC clone RP24-177F21 from chromosome 12, complete
             sequence
          Length = 171538

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 489   ctcaaggcagagctcacctgaccgc 513
             |||||||||||| ||||||||||||
Sbjct: 24731 ctcaaggcagagatcacctgaccgc 24755



to top

>emb|AL590822.36| Human DNA sequence from clone RP11-181G12 on chromosome 1 Contains the 3'
              end of the PRKCZ gene for protein kinase C zeta, a novel
              gene, a novel gene (FLJ31031), the SKI gene for v-ski
              sarcoma viral oncogene homolog (avian) and five CpG
              islands, complete sequence
          Length = 179836

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 496    cagagctcacctgaccgcagg 516
              |||||||||||||||||||||
Sbjct: 113726 cagagctcacctgaccgcagg 113706



to top

>gb|AC161418.4| Mus musculus BAC clone RP23-325K2 from chromosome 3, complete sequence
          Length = 202765

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 77    aaagtaaaaaacaaccatagt 97
             |||||||||||||||||||||
Sbjct: 67013 aaagtaaaaaacaaccatagt 67033



to top

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 521     ggcccgcgtcggcggctacga 541
               |||||||||||||||||||||
Sbjct: 1402722 ggcccgcgtcggcggctacga 1402742



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 387      ttgtcagcggtgctctgggca 407
                |||||||||||||||||||||
Sbjct: 11569463 ttgtcagcggtgctctgggca 11569483



to top

>gb|AY212048.1| Papio cynocephalus isolate C6 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212047.1| Papio cynocephalus isolate C5 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212046.1| Papio cynocephalus isolate C4 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212045.1| Papio cynocephalus isolate C3 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212044.1| Papio cynocephalus isolate C2 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212043.1| Papio cynocephalus isolate C1 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212042.1| Papio anubis isolate A3 NADH dehydrogenase subunit 4 gene, partial
           cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes, complete
           sequence; and NADH dehydrogenase subunit 5 gene, partial
           cds; mitochondrial genes for mitochondrial products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212041.1| Papio anubis isolate A2 NADH dehydrogenase subunit 4 gene, partial
           cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes, complete
           sequence; and NADH dehydrogenase subunit 5 gene, partial
           cds; mitochondrial genes for mitochondrial products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212040.1| Papio anubis isolate A1 NADH dehydrogenase subunit 4 gene, partial
           cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes, complete
           sequence; and NADH dehydrogenase subunit 5 gene, partial
           cds; mitochondrial genes for mitochondrial products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>gb|AY212039.1| Papio anubis isolate A5 NADH dehydrogenase subunit 4 gene, partial
           cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes, complete
           sequence; and NADH dehydrogenase subunit 5 gene, partial
           cds; mitochondrial genes for mitochondrial products
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 15  tataatggaagtgtacatggt 35
           |||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatggt 661



to top

>dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1034_C08
          Length = 154441

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 387    ttgtcagcggtgctctgggca 407
              |||||||||||||||||||||
Sbjct: 123597 ttgtcagcggtgctctgggca 123617



to top

>dbj|AP004694.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0467G09
          Length = 158204

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 387   ttgtcagcggtgctctgggca 407
             |||||||||||||||||||||
Sbjct: 29734 ttgtcagcggtgctctgggca 29754



to top

>dbj|AP005640.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0006O15
          Length = 139723

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 151   tcacatggagatcagatcaga 171
             |||||||||||||||||||||
Sbjct: 81220 tcacatggagatcagatcaga 81240



to top

>dbj|AK119692.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-B12, full
           insert sequence
          Length = 685

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 258 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 310
           ||||| |||||||||||||| | |||||||| | ||| ||||  |||||||||
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgca 397



to top

>dbj|AK119677.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-156-H07, full
           insert sequence
          Length = 654

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 258 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 310
           ||||| |||||||||||||| | |||||||| | ||| ||||  |||||||||
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgca 397



to top

>dbj|AK100917.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023133E20, full
            insert sequence
          Length = 5035

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 151  tcacatggagatcagatcaga 171
            |||||||||||||||||||||
Sbjct: 4798 tcacatggagatcagatcaga 4818



to top

>gb|AY109327.1| Zea mays CL468_1 mRNA sequence
          Length = 2907

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 420  ctcttgacgccgctgcagcag 440
            |||||||||||||||||||||
Sbjct: 2805 ctcttgacgccgctgcagcag 2785



to top

>gb|AC132475.4| Mus musculus BAC clone RP23-114P16 from 3, complete sequence
          Length = 215899

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 77     aaagtaaaaaacaaccatagt 97
              |||||||||||||||||||||
Sbjct: 210967 aaagtaaaaaacaaccatagt 210987



to top

>gb|AC005222.1| Homo sapiens chromosome 16, cosmid clone RT163 (LANL), complete
             sequence
          Length = 40619

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 227   gcgcccatggtgggcagtgg 246
             ||||||||||||||||||||
Sbjct: 25417 gcgcccatggtgggcagtgg 25398



to top

>gb|BC001740.1| Homo sapiens golgi phosphoprotein 2, transcript variant 1, mRNA
           (cDNA clone MGC:850 IMAGE:3351316), complete cds
          Length = 3031

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 552 ggccaccagggcgaccagcacgag 575
           ||||||||||||| ||||||||||
Sbjct: 190 ggccaccagggcggccagcacgag 167



to top

>gb|AY212083.1| Papio hamadryas isolate BE73498 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|AY212082.1| Papio hamadryas isolate BE73357 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|AY212078.1| Papio hamadryas isolate ta23 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|AY212077.1| Papio hamadryas isolate ta03 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|AY212076.1| Papio hamadryas isolate ba23 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|AY212075.1| Papio hamadryas isolate ba01 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|AY212074.1| Papio hamadryas isolate ab31 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 879

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 664 tataatggaagtgtacatgg 645



to top

>gb|AY212073.1| Papio hamadryas isolate ab21 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|AY212070.1| Papio hamadryas isolate BE97122 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|AY212069.1| Papio hamadryas isolate dw158 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|AY212068.1| Papio hamadryas isolate dw157 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|AY212067.1| Papio hamadryas isolate dw152 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|AY212066.1| Papio hamadryas isolate dw106 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|AY212065.1| Papio hamadryas isolate dw58 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|AY212064.1| Papio hamadryas isolate dw57 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|AY212063.1| Papio hamadryas isolate dw55 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|AY212062.1| Papio hamadryas isolate dw104 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 543     gagcatggcggccaccaggg 562
               ||||||||||||||||||||
Sbjct: 1401567 gagcatggcggccaccaggg 1401586



to top

>gb|AY358593.1| Homo sapiens clone DNA62808 GOLPH2 (UNQ686) mRNA, complete cds
          Length = 1429

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 552 ggccaccagggcgaccagcacgag 575
           ||||||||||||| ||||||||||
Sbjct: 180 ggccaccagggcggccagcacgag 157



to top

>gb|AC121237.19| Medicago truncatula clone mth2-22g11, complete sequence
          Length = 127731

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 64     tcaaaagggagagaaagtaaaaaa 87
              |||||||||||||| |||||||||
Sbjct: 124911 tcaaaagggagagagagtaaaaaa 124934



to top

>emb|AL358372.11| Human DNA sequence from clone RP11-350E19 on chromosome 1 Contains a
              rodent farnesoid X receptor beta (Fxrb) pseudogene and the
              5' end of the SYCP1 gene for synaptonemal complex protein
              1, complete sequence
          Length = 155819

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 66     aaaagggagagaaagtaaaa 85
              ||||||||||||||||||||
Sbjct: 106216 aaaagggagagaaagtaaaa 106235



to top

>emb|AL161447.20| Human DNA sequence from clone RP11-379P1 on chromosome 9 Contains the 3'
              end of a novel gene (FLJ21613) similar to rat corneal wound
              healing related protein (includes FLJ22634), the GOLPH2
              gene for golgi phosphoprotein 2 (GP73), a novel pseudogene
              and a CpG island, complete sequence
          Length = 160115

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 552    ggccaccagggcgaccagcacgag 575
              ||||||||||||| ||||||||||
Sbjct: 100489 ggccaccagggcggccagcacgag 100512



to top

>emb|AL121777.39|HSJ1057D4 Human DNA sequence from clone RP5-1057D4 on chromosome 20 Contains the
             SRMP1 gene for spermidine synthase pseudogene 1, the 5'
             end of the gene for a novel protein similar to
             glucosamine-6-sulfatases (SULF2) (sulfatase 2, H-SULF2,
             KIAA1247) and a CpG island, complete sequence
          Length = 131888

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 137   gactcctttctccctcacat 156
             ||||||||||||||||||||
Sbjct: 88928 gactcctttctccctcacat 88909



to top

>gb|AC069528.10| Homo sapiens 3 BAC RP11-329N15 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 163163

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 68     aagggagagaaagtaaaaaa 87
              ||||||||||||||||||||
Sbjct: 126180 aagggagagaaagtaaaaaa 126161



to top

>emb|Y18001.1|PHA18001 Papio hamadryas mitochondrial DNA, complete genome
          Length = 16521

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 15    tataatggaagtgtacatgg 34
             ||||||||||||||||||||
Sbjct: 11784 tataatggaagtgtacatgg 11765



to top

>emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete genome; segment 11/29
          Length = 313800

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 553    gccaccagggcgaccagcacgagc 576
              ||||||||||||||||| ||||||
Sbjct: 187958 gccaccagggcgaccaggacgagc 187981



to top

>emb|AL939105.1|SCO939105 Streptomyces coelicolor A3(2) complete genome; segment 2/29
          Length = 291000

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 513   caggagatggcccgcgtcggcggc 536
             ||||||||||||||||||| ||||
Sbjct: 15662 caggagatggcccgcgtcgacggc 15639



to top

>emb|AJ277892.2|HSA277892 Homo sapiens partial TTN gene for titin
          Length = 294540

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 60     ctcctcaaaagggagagaaagtaa 83
              |||||||||||||| |||||||||
Sbjct: 219918 ctcctcaaaagggacagaaagtaa 219941



to top

>emb|AJ224512.2|SNO224512 Streptomyces nogalater nogalamycin biosynthesis genes
          Length = 19632

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 526   gcgtcggcggctacgaggag 545
             ||||||||||||||||||||
Sbjct: 13630 gcgtcggcggctacgaggag 13611



to top

>gb|BC070113.1| Homo sapiens cDNA clone IMAGE:5268363
          Length = 4610

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 60   ctcctcaaaagggagagaaagtaa 83
            |||||||||||||| |||||||||
Sbjct: 3813 ctcctcaaaagggacagaaagtaa 3790



to top

>gb|BC041357.1| Homo sapiens cDNA clone IMAGE:5272988
          Length = 4615

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 60   ctcctcaaaagggagagaaagtaa 83
            |||||||||||||| |||||||||
Sbjct: 3818 ctcctcaaaagggacagaaagtaa 3795



to top

>dbj|AK092943.1| Homo sapiens cDNA FLJ35624 fis, clone SPLEN2011018, highly similar
           to Homo sapiens golgi membrane protein GP73 mRNA
          Length = 2962

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 552 ggccaccagggcgaccagcacgag 575
           ||||||||||||| ||||||||||
Sbjct: 215 ggccaccagggcggccagcacgag 192



to top

>dbj|AK075557.1| Homo sapiens cDNA PSEC0257 fis, clone NT2RP3003642, highly similar
           to golgi phosphoprotein 2
          Length = 2986

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 552 ggccaccagggcgaccagcacgag 575
           ||||||||||||| ||||||||||
Sbjct: 179 ggccaccagggcggccagcacgag 156



to top

>dbj|AK075542.1| Homo sapiens cDNA PSEC0242 fis, clone NT2RP3000266, highly similar
           to golgi phosphoprotein 2
          Length = 3017

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 552 ggccaccagggcgaccagcacgag 575
           ||||||||||||| ||||||||||
Sbjct: 209 ggccaccagggcggccagcacgag 186



to top

>dbj|AK027717.1| Homo sapiens cDNA FLJ14811 fis, clone NT2RP4001975, highly similar
           to Homo sapiens golgi membrane protein GP73 mRNA
          Length = 3045

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 552 ggccaccagggcgaccagcacgag 575
           ||||||||||||| ||||||||||
Sbjct: 238 ggccaccagggcggccagcacgag 215



to top

>gb|AC012676.5| Homo sapiens chromosome 16 clone RP11-295D4, complete sequence
          Length = 172071

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 227   gcgcccatggtgggcagtgg 246
             ||||||||||||||||||||
Sbjct: 84403 gcgcccatggtgggcagtgg 84384



to top

>emb|CR457201.1| Homo sapiens full open reading frame cDNA clone RZPDo834G0112D for
           gene GOLPH2, golgi phosphoprotein 2; complete cds, incl.
           stopcodon
          Length = 1203

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 552 ggccaccagggcgaccagcacgag 575
           ||||||||||||| ||||||||||
Sbjct: 66  ggccaccagggcggccagcacgag 43



to top

>gb|AY212038.1| Papio hamadryas isolate H5 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|AY212037.1| Papio hamadryas isolate H4 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|AY212036.1| Papio hamadryas isolate H3 NADH dehydrogenase subunit 4 gene,
           partial cds; tRNA-His, tRNA-Ser, and tRNA-Leu genes,
           complete sequence; and NADH dehydrogenase subunit 5
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662



to top

>gb|AC010680.10| Homo sapiens BAC clone RP11-171I2 from 2, complete sequence
          Length = 177476

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 60    ctcctcaaaagggagagaaagtaa 83
             |||||||||||||| |||||||||
Sbjct: 34521 ctcctcaaaagggacagaaagtaa 34498



to top

>gb|AE004829.1| Pseudomonas aeruginosa PAO1, section 390 of 529 of the complete
            genome
          Length = 10201

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 314  ggaggggatgccggcggccttgcc 337
            |||| |||||||||||||||||||
Sbjct: 4301 ggagaggatgccggcggccttgcc 4278



to top

>ref|NM_177937.1| Homo sapiens golgi phosphoprotein 2 (GOLPH2), transcript variant 2,
           mRNA
          Length = 3047

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 552 ggccaccagggcgaccagcacgag 575
           ||||||||||||| ||||||||||
Sbjct: 234 ggccaccagggcggccagcacgag 211



to top

>ref|NM_016548.2| Homo sapiens golgi phosphoprotein 2 (GOLPH2), transcript variant 1,
           mRNA
          Length = 3080

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 552 ggccaccagggcgaccagcacgag 575
           ||||||||||||| ||||||||||
Sbjct: 267 ggccaccagggcggccagcacgag 244



to top

>gb|AF236056.1|AF236056 Homo sapiens golgi membrane protein GP73 mRNA, complete cds
          Length = 3042

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 552 ggccaccagggcgaccagcacgag 575
           ||||||||||||| ||||||||||
Sbjct: 216 ggccaccagggcggccagcacgag 193



to top

>dbj|AK073363.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033030A16, full
           insert sequence
          Length = 760

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 296 gacgctgacgccgcacatggaggggatgccggcggc 331
           |||| ||||||||||| ||  |||||||||||||||
Sbjct: 400 gacgttgacgccgcacttgccggggatgccggcggc 365



to top

>dbj|AK070192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023041I08, full
            insert sequence
          Length = 2914

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 296  gacgctgacgccgcacatggaggggatgccggcggc 331
            |||| ||||||||||| ||  |||||||||||||||
Sbjct: 2487 gacgttgacgccgcacttgccggggatgccggcggc 2452



to top

>dbj|AK062690.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-A02, full
           insert sequence
          Length = 646

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 296 gacgctgacgccgcacatggaggggatgccggcggc 331
           |||| ||||||||||| ||  |||||||||||||||
Sbjct: 394 gacgttgacgccgcacttgccggggatgccggcggc 359



to top

>dbj|AK061182.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-209-D09, full
           insert sequence
          Length = 928

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 296 gacgctgacgccgcacatggaggggatgccggcggc 331
           |||| ||||||||||| ||  |||||||||||||||
Sbjct: 399 gacgttgacgccgcacttgccggggatgccggcggc 364



to top

>dbj|AK059737.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-D08, full
           insert sequence
          Length = 853

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 296 gacgctgacgccgcacatggaggggatgccggcggc 331
           |||| ||||||||||| ||  |||||||||||||||
Sbjct: 394 gacgttgacgccgcacttgccggggatgccggcggc 359



to top

>dbj|AK059714.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-F09, full
           insert sequence
          Length = 773

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 296 gacgctgacgccgcacatggaggggatgccggcggc 331
           |||| ||||||||||| ||  |||||||||||||||
Sbjct: 399 gacgttgacgccgcacttgccggggatgccggcggc 364



to top

>gb|AF171094.1|AF171094 Lilium longiflorum lipid transfer protein precursor (LTP) mRNA,
           complete cds
          Length = 650

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 290 gtaggggacgctgacgccgcacatggaggggatgccggcg 329
           |||||||| | ||||||||||| ||  |||||||||||||
Sbjct: 349 gtaggggatgttgacgccgcacttgccggggatgccggcg 310



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 554     ccaccagggcgaccagcacg 573
               ||||||||||||||||||||
Sbjct: 3738782 ccaccagggcgaccagcacg 3738801



to top

>emb|AL138783.6| Human DNA sequence from clone RP5-1165D20 on chromosome 1p13.1-13.3,
             complete sequence
          Length = 118065

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 66    aaaagggagagaaagtaaaa 85
             ||||||||||||||||||||
Sbjct: 88582 aaaagggagagaaagtaaaa 88601



to top

>dbj|D85290.1| Hamadryas baboon mitochondrial DNA for NADH dehydrogenase subunit
           4, subunit 5, partial cds
          Length = 896

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 15  tataatggaagtgtacatgg 34
           ||||||||||||||||||||
Sbjct: 681 tataatggaagtgtacatgg 662


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,827,487
Number of Sequences: 3902068
Number of extensions: 4827487
Number of successful extensions: 95996
Number of sequences better than 10.0: 216
Number of HSP's better than 10.0 without gapping: 219
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 94805
Number of HSP's gapped (non-prelim): 1161
length of query: 629
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 606
effective length of database: 17,143,297,704
effective search space: 10388838408624
effective search space used: 10388838408624
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top