ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags9o13
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK061752.1| Oryza sativa (japonica cultivar-group) cDNA clon... 680 0.0
2gb|AF155333.2|AF155333 Oryza sativa NADP-specific isocitrate deh... 680 0.0
3ref|NM_192424.1| Oryza sativa (japonica cultivar-group), predic... 670 0.0
4gb|AY105031.1| Zea mays PCO072845 mRNA sequence 615 e-173
5gb|BT019016.1| Zea mays clone Contig512.F mRNA sequence 438 e-120
6gb|AF155334.1|AF155334 Oryza sativa NADP-specific isocitrate deh... 375 e-100
7gb|AF176669.1|AF176669 Citrus limon NADP-isocitrate dehydrogenas... 252 1e-63
8gb|AF367443.1| Prunus persica clone Icdh1 NADP-dependent isocitr... 240 4e-60
9dbj|AB019327.1| Daucus carota mRNA for NADP specific isocitrate ... 240 4e-60
10gb|BT017177.1| Zea mays clone EL01N0369B08.c mRNA sequence 222 9e-55
11gb|U80912.1|EGU80912 Eucalyptus globulus NADP-isocitrate dehydro... 208 1e-50
12gb|AY107138.1| Zea mays PCO115488 mRNA sequence 198 1e-47
13ref|NM_105265.2| Arabidopsis thaliana isocitrate dehydrogenase (... 196 5e-47
14emb|AJ437268.1|ATH437268 Arabidopsis thaliana mRNA for isocitrat... 196 5e-47
15gb|AY093091.1| Arabidopsis thaliana similar to NADP-specific iso... 196 5e-47
16gb|AF419575.1|AF419575 Arabidopsis thaliana At1g65930/F12P19_10 ... 196 5e-47
17gb|AY045631.1| Arabidopsis thaliana At1g65930/F12P19_10 mRNA, co... 196 5e-47
18gb|BT002400.1| Arabidopsis thaliana isocitrate dehydrogenase, pu... 196 5e-47
19gb|AY088129.1| Arabidopsis thaliana clone 41544 mRNA, complete s... 194 2e-46
20gb|AY112639.1| Zea mays CL62576_1 mRNA sequence 194 2e-46
21gb|AY509880.1| Pisum sativum NADP-dependent isocitrate dehydroge... 192 8e-46
22emb|AJ437269.1|CSA437269 Cucumis sativus mRNA for isocitrate deh... 192 8e-46
23gb|AY097340.1| Arabidopsis thaliana At1g65930/F12P19_10 mRNA, co... 192 8e-46
24dbj|AB243085.1| Codonopsis lanceolata mRNA for NADP-isocitrate d... 182 8e-43
25gb|L12157.1|SOYIDH Glycine max NADP-specific isocitrate dehydrog... 182 8e-43
26dbj|D21069.1|RICAK88B Oryza sativa mRNA for isocitrate dehydroge... 180 3e-42
27emb|Y12540.1|AGIDHC A.graveolens mRNA for isocitrate dehydrogena... 178 1e-41
28ref|NM_104312.2| Arabidopsis thaliana ICDH (isocitrate dehydroge... 174 2e-40
29gb|AF316501.1|AF316501 Arabidopsis thaliana NADP-specific isocit... 174 2e-40
30dbj|AB109114.1| Lupinus albus LaICDH1;2 mRNA for NADP-specific i... 168 1e-38
31dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 149 1e-32
32dbj|AP003212.4| Oryza sativa (japonica cultivar-group) genomic D... 149 1e-32
33dbj|AP003709.2| Oryza sativa (japonica cultivar-group) genomic D... 149 1e-32
34emb|X75638.1|STNICD S.tuberosum mRNA for NADP-dependent isocitr... 135 2e-28
35dbj|AK072762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 2e-28
36emb|X77944.1|NTNIDH N.tabacum (Xanthi) NADP-dependent Isocitrate... 129 1e-26
37gb|M93672.1|ALFISDHYA Medicago sativa isocitrate dehydrogenase m... 129 1e-26
38ref|NM_188785.1| Oryza sativa (japonica cultivar-group), predic... 125 2e-25
39gb|AF095445.1|AF095445 Glycine max NADP-dependent isocitrate deh... 123 6e-25
40gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome... 103 6e-19
41dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 103 6e-19
42dbj|AB109113.1| Lupinus albus LaICDH1;1 mRNA for NADP-specific i... 96 1e-16
43gb|AC009513.2|F12P19 Sequence of BAC F12P19 from Arabidopsis tha... 92 2e-15
44ref|NM_121463.3| Arabidopsis thaliana isocitrate dehydrogenase (... 88 4e-14
45gb|BT000276.1| Arabidopsis thaliana isocitrate dehydrogenase-lik... 88 4e-14
46gb|AY099683.1| Arabidopsis thaliana isocitrate dehydrogenase-lik... 88 4e-14
47gb|AF173666.1|AF173666 Beta vulgaris clone ISORT isocitrate dehy... 84 6e-13
48gb|AC005287.4| Arabidopsis thaliana chromosome I BAC F20D21 geno... 82 2e-12
49dbj|AP004491.1| Lotus japonicus genomic DNA, chromosome 1, clone... 82 2e-12
50ref|XM_963757.1| PREDICTED: Tribolium castaneum similar to CG717... 78 3e-11
51gb|AC007789.1| Oryza sativa BAC OSJNBa0049B20 genomic sequence, ... 76 1e-10
52dbj|AP002865.1| Oryza sativa (japonica cultivar-group) genomic D... 76 1e-10
53dbj|AB019328.1| Daucus carota mRNA for NADP specific isocitrate ... 76 1e-10
54gb|AC132565.28| Medicago truncatula clone mth2-4a8, complete seq... 72 2e-09
55ref|XM_473117.1| Oryza sativa (japonica cultivar-group), predic... 70 8e-09
56dbj|AK107325.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 8e-09
57dbj|AK070042.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 8e-09
58emb|AL163792.1|ATT15N1 Arabidopsis thaliana DNA chromosome 5, BA... 68 3e-08
59emb|Y16751.1|PSP16751 Piromyces sp. E2 mRNA for isocitrate dehyd... 64 5e-07
60gb|BT016882.1| Zea mays clone Contig715 mRNA sequence 62 2e-06
61ref|XM_504978.1| Yarrowia lipolytica CLIB122, YALI0F04095g predi... 62 2e-06
62gb|AF367449.1| Prunus persica clone Icdh2 NADP-dependent isocitr... 62 2e-06
63gb|AF457967.1| Zea mays clone bms1.pk0003.f5, mRNA sequence 62 2e-06
64gb|AY104847.1| Zea mays PCO066525 mRNA sequence 62 2e-06
65dbj|AK116068.1| Ciona intestinalis cDNA, clone:citb006p20, full ... 62 2e-06
66emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 62 2e-06
67gb|AY730588.2| Pisum sativum NADP-dependent isocitrate dehydroge... 60 8e-06
68ref|XM_655511.1| Aspergillus nidulans FGSC A4 isocitrate dehydro... 58 3e-05
69emb|Z68343.1|CEF59B8 Caenorhabditis elegans Cosmid F59B8, comple... 58 3e-05
70emb|AL662969.3|OSJN00169 Oryza sativa genomic DNA, chromosome 4,... 58 3e-05
71gb|CP000264.1| Jannaschia sp. CCS1, complete genome 58 3e-05
72ref|NM_069264.3| Caenorhabditis elegans F59B8.2 (F59B8.2) mRNA, ... 58 3e-05
73dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
74ref|XM_312860.2| Anopheles gambiae str. PEST ENSANGP00000016660 ... 58 3e-05
75dbj|AK107792.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
76gb|M86719.1|PIGMTNADP Pig mitochondrial NADP-isocitrate dehydrog... 56 1e-04
77dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 54 5e-04
78gb|AY617794.1| Sterkiella histriomuscorum clone UGC1O0005_K08_R ... 52 0.002
79gb|AY432993.1| Aedes aegypti ASAP ID: 36387 isocitrate dehydroge... 50 0.008
80gb|DQ465384.1| Oreochromis mossambicus clone SSH #509 mitochondr... 50 0.008
81ref|XM_390523.1| Gibberella zeae PH-1 chromosome 1 hypothetical ... 50 0.008
82emb|CR730912.2|CNS0GQX1 Tetraodon nigroviridis full-length cDNA 50 0.008
83emb|CR671470.1|CNS0FH2S Tetraodon nigroviridis full-length cDNA 50 0.008
84gb|AY551096.1| Crassostrea gigas isocitrate dehydrogenase mRNA, ... 48 0.031
85gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence 48 0.031
86gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 48 0.031
87gb|BC074545.1| Xenopus tropicalis MGC69505 protein, mRNA (cDNA c... 48 0.031
88emb|CT025337.2| Xenopus tropicalis finished cDNA, clone TNeu118i04 48 0.031
89ref|XM_536192.2| PREDICTED: Canis familiaris similar to isocitra... 48 0.031
90gb|AC126787.12| Medicago truncatula clone mth2-11c8, complete se... 48 0.031
91emb|X92486.1|STICDH2 S.tuberosum mRNA for NADP-isocitrate dehydr... 48 0.031
92gb|AE009520.1| Brucella melitensis 16M chromosome I, section 77 ... 48 0.031
93ref|NM_001004799.1| Xenopus tropicalis MGC69505 protein (MGC6950... 48 0.031
94dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 48 0.031
95gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I... 48 0.031
96emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,... 48 0.031
97emb|AL591788.1|SME591788 Sinorhizobium meliloti 1021 complete ch... 46 0.12
98gb|AY040207.1| Aspergillus nidulans C1 tetrahydrofolate synthase... 46 0.12
99dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.12
100dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 46 0.12
101dbj|AP003766.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.12
102dbj|AB000261.1| Aspergillus niger icdA mRNA for NADP-dependent i... 46 0.12
103gb|DQ443205.1| Bombyx mori NADPH-specific isocitrate dehydrogena... 44 0.48
104ref|XM_757165.1| Ustilago maydis 521 hypothetical protein (UM061... 44 0.48
105ref|XM_823090.1| Trypanosoma brucei TREU927 isocitrate dehydroge... 44 0.48
106gb|DQ311190.1| Bombyx mori isocitrate dehydrogenase precursor, m... 44 0.48
107dbj|AB109115.1| Lupinus albus LaICDH2;1 mRNA for NADP-specific i... 44 0.48
108ref|XM_510589.1| PREDICTED: Pan troglodytes isocitrate dehydroge... 42 1.9
109ref|XM_463748.1| Oryza sativa (japonica cultivar-group), predic... 42 1.9
110gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome 42 1.9
111ref|XM_950757.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.9
112ref|XM_323175.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.9
113ref|XM_708587.1| Candida albicans SC5314 putative nucleolar FKBP... 42 1.9
114ref|XM_708542.1| Candida albicans SC5314 putative nucleolar FKBP... 42 1.9
115emb|CR734506.2|CNS0GTIX Tetraodon nigroviridis full-length cDNA 42 1.9
116emb|CR732599.2|CNS0GS7W Tetraodon nigroviridis full-length cDNA 42 1.9
117emb|CR730591.2|CNS0GQO4 Tetraodon nigroviridis full-length cDNA 42 1.9
118emb|CR730276.2|CNS0GQFD Tetraodon nigroviridis full-length cDNA 42 1.9
119emb|CR729792.2|CNS0GQ1Y Tetraodon nigroviridis full-length cDNA 42 1.9
120emb|CR721079.2|CNS0GJBX Tetraodon nigroviridis full-length cDNA 42 1.9
121emb|CR704578.2|CNS0G6LQ Tetraodon nigroviridis full-length cDNA 42 1.9
122emb|CR703700.2|CNS0G5XC Tetraodon nigroviridis full-length cDNA 42 1.9
123emb|CR701753.2|CNS0G4F9 Tetraodon nigroviridis full-length cDNA 42 1.9
124emb|CR695643.2|CNS0FZPJ Tetraodon nigroviridis full-length cDNA 42 1.9
125emb|CR694676.2|CNS0FYYO Tetraodon nigroviridis full-length cDNA 42 1.9
126emb|CR694604.1|CNS0FYWO Tetraodon nigroviridis full-length cDNA 42 1.9
127emb|CR694034.2|CNS0FYGU Tetraodon nigroviridis full-length cDNA 42 1.9
128emb|CR692818.2|CNS0FXJ2 Tetraodon nigroviridis full-length cDNA 42 1.9
129emb|CR691587.2|CNS0FWKV Tetraodon nigroviridis full-length cDNA 42 1.9
130emb|CR686180.2|CNS0FSEO Tetraodon nigroviridis full-length cDNA 42 1.9
131emb|CR684377.2|CNS0FR0L Tetraodon nigroviridis full-length cDNA 42 1.9
132emb|CR683921.2|CNS0FQNX Tetraodon nigroviridis full-length cDNA 42 1.9
133ref|XM_729441.1| Plasmodium chabaudi chabaudi hypothetical prote... 42 1.9
134ref|XM_735713.1| Plasmodium chabaudi chabaudi hypothetical prote... 42 1.9
135emb|CR673730.2|CNS0FITK Tetraodon nigroviridis full-length cDNA 42 1.9
136emb|CR669331.2|CNS0FFFD Tetraodon nigroviridis full-length cDNA 42 1.9
137emb|CR668443.2|CNS0FEQP Tetraodon nigroviridis full-length cDNA 42 1.9
138ref|NM_002168.2| Homo sapiens isocitrate dehydrogenase 2 (NADP+)... 42 1.9
139emb|AL356059.27| Human DNA sequence from clone RP11-192G4 on chr... 42 1.9
140emb|X69433.1|HSIDNADP H.sapiens mRNA for mitochondrial isocitrat... 42 1.9
141emb|CR615856.1| full-length cDNA clone CS0DI077YD06 of Placenta ... 42 1.9
142emb|CR625817.1| full-length cDNA clone CS0DA002YE04 of Neuroblas... 42 1.9
143emb|CR625730.1| full-length cDNA clone CS0DF007YI03 of Fetal bra... 42 1.9
144emb|CR625291.1| full-length cDNA clone CS0DI018YK23 of Placenta ... 42 1.9
145emb|CR622745.1| full-length cDNA clone CS0DI029YO14 of Placenta ... 42 1.9
146emb|CR619410.1| full-length cDNA clone CS0DI042YG08 of Placenta ... 42 1.9
147emb|CR619261.1| full-length cDNA clone CS0DL009YE05 of B cells (... 42 1.9
148emb|CR617370.1| full-length cDNA clone CS0DI081YH08 of Placenta ... 42 1.9
149emb|CR617266.1| full-length cDNA clone CS0DI041YL18 of Placenta ... 42 1.9
150emb|CR617229.1| full-length cDNA clone CS0DF006YD12 of Fetal bra... 42 1.9
151emb|CR616318.1| full-length cDNA clone CS0DI008YC17 of Placenta ... 42 1.9
152emb|CR613707.1| full-length cDNA clone CS0DI044YJ06 of Placenta ... 42 1.9
153emb|CR610921.1| full-length cDNA clone CS0DF013YA17 of Fetal bra... 42 1.9
154emb|CR610749.1| full-length cDNA clone CS0DI056YE07 of Placenta ... 42 1.9
155emb|CR610676.1| full-length cDNA clone CS0DH005YD07 of T cells (... 42 1.9
156emb|CR607742.1| full-length cDNA clone CS0DK005YD09 of HeLa cell... 42 1.9
157emb|CR607159.1| full-length cDNA clone CS0CAP008YI14 of Thymus o... 42 1.9
158emb|CR607058.1| full-length cDNA clone CS0DI057YN22 of Placenta ... 42 1.9
159emb|CR606745.1| full-length cDNA clone CS0DH005YP17 of T cells (... 42 1.9
160emb|CR606440.1| full-length cDNA clone CS0DI066YD06 of Placenta ... 42 1.9
161emb|CR604829.1| full-length cDNA clone CS0DA005YA06 of Neuroblas... 42 1.9
162emb|CR602902.1| full-length cDNA clone CS0DF017YA02 of Fetal bra... 42 1.9
163emb|CR602079.1| full-length cDNA clone CS0DI039YF02 of Placenta ... 42 1.9
164emb|CR600938.1| full-length cDNA clone CS0DA007YE17 of Neuroblas... 42 1.9
165emb|CR600286.1| full-length cDNA clone CS0DI027YC02 of Placenta ... 42 1.9
166emb|CR599284.1| full-length cDNA clone CS0DL002YF02 of B cells (... 42 1.9
167emb|CR599159.1| full-length cDNA clone CS0DI013YL09 of Placenta ... 42 1.9
168emb|CR598530.1| full-length cDNA clone CS0DI043YC04 of Placenta ... 42 1.9
169emb|CR597829.1| full-length cDNA clone CS0DI018YK02 of Placenta ... 42 1.9
170emb|CR597564.1| full-length cDNA clone CS0DA008YM06 of Neuroblas... 42 1.9
171emb|CR595435.1| full-length cDNA clone CS0DI054YK01 of Placenta ... 42 1.9
172emb|CR594870.1| full-length cDNA clone CS0DI064YE13 of Placenta ... 42 1.9
173emb|CR593589.1| full-length cDNA clone CS0DM002YM16 of Fetal liv... 42 1.9
174emb|CR593087.1| full-length cDNA clone CS0DI023YP13 of Placenta ... 42 1.9
175emb|CR590507.1| full-length cDNA clone CS0DI040YO19 of Placenta ... 42 1.9
176gb|AY939844.1| Cyanophage P-SSM2, complete genome 42 1.9
177dbj|AK222916.1| Homo sapiens mRNA for isocitrate dehydrogenase 2... 42 1.9
178dbj|AP003735.4| Oryza sativa (japonica cultivar-group) genomic D... 42 1.9
179gb|AC092769.7| Homo sapiens chromosome 15, clone CTD-2315E11, co... 42 1.9
180gb|BC071828.1| Homo sapiens isocitrate dehydrogenase 2 (NADP+), ... 42 1.9
181gb|BC009244.2| Homo sapiens isocitrate dehydrogenase 2 (NADP+), ... 42 1.9
182gb|AC164075.4| Mus musculus chromosome 7, clone RP24-259P13, com... 40 7.5
183gb|AY663392.1| Triticum aestivum cultivar Renan clone BAC 930H14... 40 7.5
184gb|BC060030.1| Mus musculus isocitrate dehydrogenase 2 (NADP+), ... 40 7.5
185gb|AC109232.17| Mus musculus chromosome 7, clone RP23-423P21, co... 40 7.5
186ref|XM_569233.1| Cryptococcus neoformans var. neoformans JEC21 i... 40 7.5
187ref|XM_569234.1| Cryptococcus neoformans var. neoformans JEC21 i... 40 7.5
188gb|AC087893.15| Homo sapiens 12 BAC RP11-423G4 (Roswell Park Can... 40 7.5
189emb|BX530407.26| Zebrafish DNA sequence from clone DKEY-83M22 in... 40 7.5
190emb|BX936402.12| Zebrafish DNA sequence from clone CH211-128D20 ... 40 7.5
191gb|BC054241.1| Xenopus laevis hypothetical protein MGC64442, mRN... 40 7.5
192emb|CR729897.2|CNS0GQ4V Tetraodon nigroviridis full-length cDNA 40 7.5
193ref|XM_848139.1| PREDICTED: Canis familiaris similar to thyroid ... 40 7.5
194ref|XM_948169.1| Theileria annulata strain Ankara isocitrate deh... 40 7.5
195gb|AC137644.3| Artibeus jamaicensis clone 25B10, complete sequence 40 7.5
196emb|AL589842.5| Human DNA sequence from clone RP11-268A15 on chr... 40 7.5
197emb|X69432.1|BTIDNADP B.taurus mRNA for mitochondrial isocitrate... 40 7.5
198ref|NM_001014161.1| Rattus norvegicus similar to NADP+-specific ... 40 7.5
199gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 7.5
200gb|AF435451.2| Nicotiana tabacum calcium-dependent protein kinas... 40 7.5
201gb|DQ397556.1| Cenarchaeum symbiosum clone C13A10, complete sequ... 40 7.5
202gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 7.5
203gb|AC145027.17| Medicago truncatula clone mth2-15e6, complete se... 40 7.5
204gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 7.5
205dbj|AK146564.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 40 7.5
206dbj|AK145753.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 40 7.5
207dbj|AK161640.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 40 7.5
208dbj|AK169395.1| Mus musculus 16 days embryo heart cDNA, RIKEN fu... 40 7.5
209gb|DP000001.1| Artibeus jamaicensis target 1 genomic scaffold 40 7.5
210gb|AC102416.5| Mus musculus chromosome 18, clone RP24-492H24, co... 40 7.5
211dbj|AB169742.1| Macaca fascicularis brain cDNA, clone: QnpA-1356... 40 7.5
212gb|AE016814.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 7.5
213dbj|AK088110.1| Mus musculus 2 days neonate thymus thymic cells ... 40 7.5
214gb|BC102509.1| Bos taurus isocitrate dehydrogenase 2 (NADP+), mi... 40 7.5
215gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 40 7.5
216gb|AF212319.1|AF212319 Mus musculus NADP+-specific isocitrate de... 40 7.5
217ref|XM_623670.1| PREDICTED: Apis mellifera similar to CG7176-PB,... 40 7.5
218ref|XM_623631.1| PREDICTED: Apis mellifera similar to CG7176-PC,... 40 7.5
219ref|NM_175790.2| Bos taurus isocitrate dehydrogenase 2 (NADP+), ... 40 7.5
220gb|BC046379.1| Xenopus laevis, clone IMAGE:5542876, mRNA 40 7.5
221ref|NM_173011.1| Mus musculus isocitrate dehydrogenase 2 (NADP+)... 40 7.5
222gb|AF003529.2| Homo sapiens glypican 3 (GPC3) gene, partial cds ... 40 7.5
223gb|BC076398.1| Rattus norvegicus similar to NADP+-specific isoci... 40 7.5
224gb|AC002407.1|AC002407 Human Chromosome X, complete sequence 40 7.5
225ref|NM_207873.1| Eremothecium gossypii AAL022Wp (AAL022W), mRNA 40 7.5
226emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 40 7.5
227emb|BX571722.18| Zebrafish DNA sequence from clone DKEY-96O13 in... 40 7.5
228emb|AJ565856.1|SSP565856 Saccharum spontaneum mRNA for NADP-mala... 40 7.5
229emb|AJ512375.1|VZI512375 Vetiveria zizanioides partial mRNA for ... 40 7.5
230emb|AJ416567.1|SSP416567 Saccharum spontaneum mRNA for putative ... 40 7.5
231emb|AJ344433.1|VZI344433 Vetiveria zizanioides partial mRNA for ... 40 7.5
232emb|AJ344432.1|SOF344432 Saccharum officinarum mRNA for NADP-dep... 40 7.5
233emb|AJ320265.1|SSP320265 Saccharum spontaneum partial mRNA for m... 40 7.5
234gb|U51167.1|MMU51167 Mus musculus isocitrate dehydrogenase mRNA,... 40 7.5
235emb|AL672254.9| Mouse DNA sequence from clone RP23-409H23 on chr... 40 7.5
236dbj|AB007994.1| Candida tropicalis gene for NADP-linked isocitra... 40 7.5

>dbj|AK061752.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-H06, full
           insert sequence
          Length = 1686

 Score =  680 bits (343), Expect = 0.0
 Identities = 451/487 (92%)
 Strand = Plus / Plus

                                                                       
Query: 58  ccgccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatg 117
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 82  ccgccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatg 141

                                                                       
Query: 118 agatgaccagagtattctggcagtctatcaaggacaagcttatcttcccatttttggact 177
           ||||||||||  |||||||||||||||||||||||||||||||||| |||||||||||  
Sbjct: 142 agatgaccaggatattctggcagtctatcaaggacaagcttatctttccatttttggatc 201

                                                                       
Query: 178 tggacatcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggtta 237
           ||||||| || |||| ||||||||||||||| ||||| |||||||||||||||||||| |
Sbjct: 202 tggacattaagtactatgacttgggagttctccaccgtgatgcaactgatgacaaggtca 261

                                                                       
Query: 238 cagtggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactatta 297
           | |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||
Sbjct: 262 ccgtggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcgacgatta 321

                                                                       
Query: 298 ctccagatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatg 357
           |||||||||| | |||||||||||||||||||||||| |||||||||| |||||| ||||
Sbjct: 322 ctccagatgaggctcgggttaaggagttcaacctaaagcaaatgtggaagagccccaatg 381

                                                                       
Query: 358 gcacaattaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatg 417
           ||||||||||||| ||||| || ||||| || ||||||||||||||||||||||| ||||
Sbjct: 382 gcacaattaggaatattatcaatggcactgtattcagagagccaattatatgcaaaaatg 441

                                                                       
Query: 418 tcccaaagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtg 477
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||| ||||
Sbjct: 442 tcccaaggcttgttccaggatggactaagcccatttgcattggaaggcatgcttttggtg 501

                                                                       
Query: 478 atcagtacagagcaactgatgccgttctcaagggacctggcaaactcagactagtttttg 537
           |||||||| ||||||||||||| ||||| ||||| |||||||| ||||  || |||||||
Sbjct: 502 atcagtaccgagcaactgatgcagttctgaaggggcctggcaagctcaagctggtttttg 561

                  
Query: 538 agggaaa 544
           |||||||
Sbjct: 562 agggaaa 568



to top

>gb|AF155333.2|AF155333 Oryza sativa NADP-specific isocitrate dehydrogenase mRNA, complete
           cds
          Length = 1594

 Score =  680 bits (343), Expect = 0.0
 Identities = 451/487 (92%)
 Strand = Plus / Plus

                                                                       
Query: 58  ccgccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatg 117
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ccgccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatg 120

                                                                       
Query: 118 agatgaccagagtattctggcagtctatcaaggacaagcttatcttcccatttttggact 177
           ||||||||||  |||||||||||||||||||||||||||||||||| |||||||||||  
Sbjct: 121 agatgaccaggatattctggcagtctatcaaggacaagcttatctttccatttttggatc 180

                                                                       
Query: 178 tggacatcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggtta 237
           ||||||| || |||| ||||||||||||||| ||||| |||||||||||||||||||| |
Sbjct: 181 tggacattaagtactatgacttgggagttctccaccgtgatgcaactgatgacaaggtca 240

                                                                       
Query: 238 cagtggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactatta 297
           | |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||
Sbjct: 241 ccgtggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcgacgatta 300

                                                                       
Query: 298 ctccagatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatg 357
           |||||||||| | |||||||||||||||||||||||| |||||||||| |||||| ||||
Sbjct: 301 ctccagatgaggctcgggttaaggagttcaacctaaagcaaatgtggaagagccccaatg 360

                                                                       
Query: 358 gcacaattaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatg 417
           ||||||||||||| ||||| || ||||| || ||||||||||||||||||||||| ||||
Sbjct: 361 gcacaattaggaatattatcaatggcactgtattcagagagccaattatatgcaaaaatg 420

                                                                       
Query: 418 tcccaaagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtg 477
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||| ||||
Sbjct: 421 tcccaaggcttgttccaggatggactaagcccatttgcattggaaggcatgcttttggtg 480

                                                                       
Query: 478 atcagtacagagcaactgatgccgttctcaagggacctggcaaactcagactagtttttg 537
           |||||||| ||||||||||||| ||||| ||||| |||||||| ||||  || |||||||
Sbjct: 481 atcagtaccgagcaactgatgcagttctgaaggggcctggcaagctcaagctggtttttg 540

                  
Query: 538 agggaaa 544
           |||||||
Sbjct: 541 agggaaa 547



to top

>ref|NM_192424.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1239

 Score =  670 bits (338), Expect = 0.0
 Identities = 446/482 (92%)
 Strand = Plus / Plus

                                                                       
Query: 63  atggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatg 122
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   atggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatg 60

                                                                       
Query: 123 accagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttggac 182
           |||||  |||||||||||||||||||||||||||||||||| |||||||||||  |||||
Sbjct: 61  accaggatattctggcagtctatcaaggacaagcttatctttccatttttggatctggac 120

                                                                       
Query: 183 atcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacagtg 242
           || || |||| ||||||||||||||| ||||| |||||||||||||||||||| || |||
Sbjct: 121 attaagtactatgacttgggagttctccaccgtgatgcaactgatgacaaggtcaccgtg 180

                                                                       
Query: 243 gaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactcca 302
           ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||
Sbjct: 181 gaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcgacgattactcca 240

                                                                       
Query: 303 gatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggcaca 362
           ||||| | |||||||||||||||||||||||| |||||||||| |||||| |||||||||
Sbjct: 241 gatgaggctcgggttaaggagttcaacctaaagcaaatgtggaagagccccaatggcaca 300

                                                                       
Query: 363 attaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtccca 422
           |||||||| ||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 301 attaggaatattatcaatggcactgtattcagagagccaattatatgcaaaaatgtccca 360

                                                                       
Query: 423 aagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcag 482
           | ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||
Sbjct: 361 aggcttgttccaggatggactaagcccatttgcattggaaggcatgcttttggtgatcag 420

                                                                       
Query: 483 tacagagcaactgatgccgttctcaagggacctggcaaactcagactagtttttgaggga 542
           ||| ||||||||||||| ||||| ||||| |||||||| ||||  || ||||||||||||
Sbjct: 421 taccgagcaactgatgcagttctgaaggggcctggcaagctcaagctggtttttgaggga 480

             
Query: 543 aa 544
           ||
Sbjct: 481 aa 482



to top

>gb|AY105031.1| Zea mays PCO072845 mRNA sequence
          Length = 1614

 Score =  615 bits (310), Expect = e-173
 Identities = 445/490 (90%)
 Strand = Plus / Plus

                                                                       
Query: 58  ccgccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatg 117
           ||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||
Sbjct: 93  ccgccatggcgttcgagaagatcaaggtctccaacccaatcgtcgagatggacggtgatg 152

                                                                       
Query: 118 agatgaccagagtattctggcagtctatcaaggacaagcttatcttcccatttttggact 177
           |||||||||| ||||||||||||||||||||||||||||||||| |||||||| ||||| 
Sbjct: 153 agatgaccagggtattctggcagtctatcaaggacaagcttatcctcccatttctggacc 212

                                                                       
Query: 178 tggacatcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggtta 237
           |||||||||| |||| ||| |||||  | |||||||| || ||||||||||||||||| |
Sbjct: 213 tggacatcaagtactatgatttggggatactgcaccgtgaagcaactgatgacaaggtca 272

                                                                       
Query: 238 cagtggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactatta 297
           |||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||
Sbjct: 273 cagtggaggctgcagaggctactctcaagtacaacgtggctattaagtgtgcgaccatta 332

                                                                       
Query: 298 ctccagatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatg 357
           |||||||||||  |||||||||||||||||| || ||||| ||||||| |||||||||||
Sbjct: 333 ctccagatgaaactcgggttaaggagttcaatctgaaacacatgtggaagagcccaaatg 392

                                                                       
Query: 358 gcacaattaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatg 417
           |||||||||||||||||||||| ||||| |||||||||||||| ||||||||||| || |
Sbjct: 393 gcacaattaggaacattataaatggcactgtgttcagagagcctattatatgcaaaaacg 452

                                                                       
Query: 418 tcccaaagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtg 477
           | ||||  |||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 453 ttccaagacttgttccaggatggactaagcccatctgcattggaaggcatgccttcggtg 512

                                                                       
Query: 478 atcagtacagagcaactgatgccgttctcaagggacctggcaaactcagactagtttttg 537
           |||| ||| |||| || ||||| ||||| ||||| ||||| || || |  ||||||||||
Sbjct: 513 atcaataccgagctaccgatgcagttctgaaggggcctgggaagctgaagctagtttttg 572

                     
Query: 538 agggaaaaga 547
           ||||||||||
Sbjct: 573 agggaaaaga 582



to top

>gb|BT019016.1| Zea mays clone Contig512.F mRNA sequence
          Length = 1390

 Score =  438 bits (221), Expect = e-120
 Identities = 350/393 (89%)
 Strand = Plus / Plus

                                                                       
Query: 155 gcttatcttcccatttttggacttggacatcaaatactttgacttgggagttctgcaccg 214
           ||||||| |||||||| ||||| |||||||||| |||| ||| |||||  | ||||||||
Sbjct: 9   gcttatcctcccatttctggacctggacatcaagtactatgatttggggatactgcaccg 68

                                                                       
Query: 215 cgatgcaactgatgacaaggttacagtggaggctgcagaggctactctcaagtacaatgt 274
            || ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||
Sbjct: 69  tgaagcaactgatgacaaggtcacagtggaggctgcagaggctactctcaagtacaacgt 128

                                                                       
Query: 275 ggctattaagtgtgcaactattactccagatgaagatcgggttaaggagttcaacctaaa 334
           ||||||||||||||| || |||||||||||||||  |||||||||||||||||| || ||
Sbjct: 129 ggctattaagtgtgcgaccattactccagatgaaactcgggttaaggagttcaatctgaa 188

                                                                       
Query: 335 acaaatgtggaggagcccaaatggcacaattaggaacattataaacggcaccgtgttcag 394
           ||| ||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||
Sbjct: 189 acacatgtggaagagcccaaatggcacaattaggaacattataaatggcactgtgttcag 248

                                                                       
Query: 395 agagccaattatatgcaagaatgtcccaaagcttgttccaggatggactaagcccatctg 454
           |||||| ||||||||||| || || ||||  |||||||||||||||||||||||||||||
Sbjct: 249 agagcctattatatgcaaaaacgttccaagacttgttccaggatggactaagcccatctg 308

                                                                       
Query: 455 cattggaaggcatgctttcggtgatcagtacagagcaactgatgccgttctcaagggacc 514
           ||||||||||||||| ||||||||||| ||| |||| || ||||| ||||| ||||| ||
Sbjct: 309 cattggaaggcatgccttcggtgatcaataccgagctaccgatgcagttctgaaggggcc 368

                                            
Query: 515 tggcaaactcagactagtttttgagggaaaaga 547
           ||| || || |  ||||||||||| ||||||||
Sbjct: 369 tgggaagctgaagctagtttttgaaggaaaaga 401



to top

>gb|AF155334.1|AF155334 Oryza sativa NADP-specific isocitrate dehydrogenase mRNA, complete
           cds
          Length = 1503

 Score =  375 bits (189), Expect = e-100
 Identities = 402/473 (84%)
 Strand = Plus / Plus

                                                                       
Query: 75  aagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgaccagagtattc 134
           ||||||||||||||||||||||| ||||||||||||||||||||||||||  ||||||||
Sbjct: 96  aagatcaaggtcgccaaccccattgtcgagatggacggtgatgagatgactcgagtattc 155

                                                                       
Query: 135 tggcagtctatcaaggacaagcttatcttcccatttttggacttggacatcaaatacttt 194
           ||| | |||||||||||||||||||||||||| || ||||| |||||||| || ||||||
Sbjct: 156 tggaaatctatcaaggacaagcttatcttcccgttcttggagttggacattaagtacttt 215

                                                                       
Query: 195 gacttgggagttctgcaccgcgatgcaactgatgacaaggttacagtggaggctgcagag 254
           ||  | ||| |||   |||| |||  ||| || || || || ||||||||||| ||||||
Sbjct: 216 gatctcggacttccataccgtgatcaaaccgacgataaagtcacagtggaggcagcagag 275

                                                                       
Query: 255 gctactctcaagtacaatgtggctattaagtgtgcaactattactccagatgaagatcgg 314
           ||||| ||||||||||||||||| || ||||||||||| ||||| ||||||||||   ||
Sbjct: 276 gctaccctcaagtacaatgtggccatcaagtgtgcaaccattacaccagatgaagcaagg 335

                                                                       
Query: 315 gttaaggagttcaacctaaaacaaatgtggaggagcccaaatggcacaattaggaacatt 374
           ||||| ||||||| |||||||   ||||||| ||||||||| ||||||||||| || || 
Sbjct: 336 gttaaagagttcagcctaaaatccatgtggaagagcccaaacggcacaattagaaatatc 395

                                                                       
Query: 375 ataaacggcaccgtgttcagagagccaattatatgcaagaatgtcccaaagcttgttcca 434
            |||| ||||| ||||||||||| ||||| || ||||| ||  ||||   ||||||||||
Sbjct: 396 ctaaatggcactgtgttcagagaaccaataatctgcaaaaacatccctcggcttgttcca 455

                                                                       
Query: 435 ggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacagagcaact 494
           ||||||||||||||||| |||||||||||||| || || |||||||||||| | ||||| 
Sbjct: 456 ggatggactaagcccatttgcattggaaggcacgcatttggtgatcagtaccgtgcaacg 515

                                                                
Query: 495 gatgccgttctcaagggacctggcaaactcagactagtttttgagggaaaaga 547
           ||||| ||| |||||||||||||||| || | | | |||| ||||||||||||
Sbjct: 516 gatgcagttatcaagggacctggcaagcttaaattggtttatgagggaaaaga 568



to top

>gb|AF176669.1|AF176669 Citrus limon NADP-isocitrate dehydrogenase mRNA, complete cds
          Length = 1708

 Score =  252 bits (127), Expect = 1e-63
 Identities = 370/451 (82%)
 Strand = Plus / Plus

                                                                       
Query: 73  agaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgaccagagtat 132
           ||||||||||||||||||| |||||||| || |||||||| ||||| |||||  |||| |
Sbjct: 165 agaagatcaaggtcgccaatcccatcgttgaaatggacggagatgaaatgactcgagttt 224

                                                                       
Query: 133 tctggcagtctatcaaggacaagcttatcttcccatttttggacttggacatcaaatact 192
           ||||| | || || ||||| |||||||| ||||| ||| |||| |||||||| || ||||
Sbjct: 225 tctggaaatcgattaaggataagcttattttcccttttctggagttggacataaagtact 284

                                                                       
Query: 193 ttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacagtggaggctgcag 252
           | ||| | ||  ||| | | || ||||||||||||||||| ||||| || ||   |||||
Sbjct: 285 tcgaccttggccttccgaatcgtgatgcaactgatgacaaagttaccgttgaaagtgcag 344

                                                                       
Query: 253 aggctactctcaagtacaatgtggctattaagtgtgcaactattactccagatgaagatc 312
           | || ||||||||||||||||| || || |||||||| ||||||||||||||||||| ||
Sbjct: 345 aagccactctcaagtacaatgtagcgatcaagtgtgctactattactccagatgaagctc 404

                                                                       
Query: 313 gggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggcacaattaggaaca 372
           | |||||||| ||   | | ||||| ||||||| ||| |||||||| ||||| ||||| |
Sbjct: 405 gtgttaaggaatttgtcttgaaacagatgtggaagagtccaaatgggacaatcaggaata 464

                                                                       
Query: 373 ttataaacggcaccgtgttcagagagccaattatatgcaagaatgtcccaaagcttgttc 432
           || | || ||||| || |||||||| ||||| || ||||| ||||||||   |||| |||
Sbjct: 465 ttttgaatggcactgttttcagagaaccaatcatttgcaaaaatgtccctcggcttattc 524

                                                                       
Query: 433 caggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacagagcaa 492
           |||| ||||| |||||||| |||||||| ||||||||||| |||||||| ||  ||||||
Sbjct: 525 caggctggacaaagcccatatgcattggcaggcatgcttttggtgatcaatatcgagcaa 584

                                          
Query: 493 ctgatgccgttctcaagggacctggcaaact 523
           ||||| | ||| |  | ||||||||||||||
Sbjct: 585 ctgatacagttattcaaggacctggcaaact 615



to top

>gb|AF367443.1| Prunus persica clone Icdh1 NADP-dependent isocitrate dehydrogenase
           (icdh1) mRNA, complete cds
          Length = 1561

 Score =  240 bits (121), Expect = 4e-60
 Identities = 358/437 (81%)
 Strand = Plus / Plus

                                                                       
Query: 63  atggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatg 122
           ||||| ||| ||||||||||||| |||||||||||||| ||||||||||| ||||| |||
Sbjct: 1   atggctttccagaagatcaaggtggccaaccccatcgtggagatggacggagatgaaatg 60

                                                                       
Query: 123 accagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttggac 182
           ||  |||| |||||| | || || ||||| |||||||| || || |||||||| ||||||
Sbjct: 61  acgcgagttttctggaaatccataaaggataagcttattttaccctttttggaattggac 120

                                                                       
Query: 183 atcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacagtg 242
           ||||| ||||||||| | ||  |||  || || ||||| |||||||| || ||||| || 
Sbjct: 121 atcaagtactttgaccttggtcttcctcatcgtgatgccactgatgataaagttactgtt 180

                                                                       
Query: 243 gaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactcca 302
           ||   ||||||||||||||| ||||||||||| || || || ||||||||||| ||||||
Sbjct: 181 gaaagtgcagaggctactcttaagtacaatgtagcaatcaaatgtgcaactatcactcca 240

                                                                       
Query: 303 gatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggcaca 362
           ||||||| ||| ||||||||||| ||| | ||    ||||||||||| || |||||||| 
Sbjct: 241 gatgaaggtcgtgttaaggagtttaacttgaagagtatgtggaggagtcccaatggcact 300

                                                                       
Query: 363 attaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtccca 422
           |||||||| ||| | || || || || |||||||| |||||| | ||||| ||  |||| 
Sbjct: 301 attaggaatattttgaatggtactgttttcagagaaccaattctttgcaaaaacatccct 360

                                                                       
Query: 423 aagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcag 482
              ||| | ||||| ||||| ||||| || ||||||||||| ||||||||||||||||||
Sbjct: 361 cgccttatcccaggctggacaaagccaatatgcattggaagacatgctttcggtgatcag 420

                            
Query: 483 tacagagcaactgatgc 499
           ||  |||||||||||||
Sbjct: 421 tatcgagcaactgatgc 437



to top

>dbj|AB019327.1| Daucus carota mRNA for NADP specific isocitrate dehydrogenase,
           complete cds
          Length = 1512

 Score =  240 bits (121), Expect = 4e-60
 Identities = 358/437 (81%)
 Strand = Plus / Plus

                                                                       
Query: 63  atggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatg 122
           ||||||||  |||||||||||||||| || ||||||||||| |||||||| ||||| |||
Sbjct: 93  atggcgtttcagaagatcaaggtcgcgaatcccatcgtcgaaatggacggagatgaaatg 152

                                                                       
Query: 123 accagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttggac 182
           ||  | ||||||||| | |||||||||||||||||||| || || ||  | ||  |||| 
Sbjct: 153 actcgtgtattctggaaatctatcaaggacaagcttatatttcccttcgttgagctggat 212

                                                                       
Query: 183 atcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacagtg 242
           || |||||||||||| | ||  |||  ||||| |||||||||||||| || ||||| || 
Sbjct: 213 ataaaatactttgaccttggccttcctcaccgtgatgcaactgatgataaagttactgtt 272

                                                                       
Query: 243 gaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactcca 302
           ||   |||||||||||| |||||||| ||||| ||||| || |||||||| ||||| |||
Sbjct: 273 gaaagtgcagaggctaccctcaagtataatgtagctatcaaatgtgcaacaattacccca 332

                                                                       
Query: 303 gatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggcaca 362
           ||||||| ||| || ||||||||   | | ||||| ||||||| ||| |||||||| |||
Sbjct: 333 gatgaagctcgtgtgaaggagtttggcttgaaacagatgtggaagagtccaaatgggaca 392

                                                                       
Query: 363 attaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtccca 422
           ||||| || ||| |||||||||| || || || || |||||||||||||| ||| |||||
Sbjct: 393 attagaaatattttaaacggcacggtatttagggaaccaattatatgcaaaaatatccca 452

                                                                       
Query: 423 aagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcag 482
           |||||  | || || ||||| ||||| || ||||||||||| |||||||| || ||||||
Sbjct: 453 aagctcatccctgggtggacaaagccaatatgcattggaagacatgcttttggcgatcag 512

                            
Query: 483 tacagagcaactgatgc 499
           ||| | ||||| |||||
Sbjct: 513 taccgcgcaacagatgc 529



to top

>gb|BT017177.1| Zea mays clone EL01N0369B08.c mRNA sequence
          Length = 1434

 Score =  222 bits (112), Expect = 9e-55
 Identities = 304/368 (82%)
 Strand = Plus / Plus

                                                                       
Query: 180 gacatcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttaca 239
           ||||||||||| |||||| | ||  |||  ||||| ||||| || || ||||| || |||
Sbjct: 23  gacatcaaatattttgacctcgggcttccacaccgtgatgctaccgacgacaaagtcaca 82

                                                                       
Query: 240 gtggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattact 299
           ||||||||||| ||||| || |||||||||||||||||||| |||||||| || ||||| 
Sbjct: 83  gtggaggctgcggaggccacactcaagtacaatgtggctatcaagtgtgccaccattaca 142

                                                                       
Query: 300 ccagatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggc 359
           ||||||||||   |||| ||||||||   | | ||    ||||||| |||||||||||||
Sbjct: 143 ccagatgaagcaagggtaaaggagtttggcttgaaggctatgtggaagagcccaaatggc 202

                                                                       
Query: 360 acaattaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtc 419
           ||||||||||| ||| | || ||||| ||||||||||| ||||| || ||||| ||  ||
Sbjct: 203 acaattaggaatattctgaatggcactgtgttcagagaaccaatcatctgcaaaaacatc 262

                                                                       
Query: 420 ccaaagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgat 479
           |||  |||||||||||| ||||| |||||||| |||||||| |||||||| ||||| |||
Sbjct: 263 ccacggcttgttccagggtggacaaagcccatttgcattgggaggcatgcattcggcgat 322

                                                                       
Query: 480 cagtacagagcaactgatgccgttctcaagggacctggcaaactcagactagtttttgag 539
           |||||| | ||||||||||| ||| ||||||| || || || || | | |||||||||||
Sbjct: 323 cagtaccgggcaactgatgcagttatcaaggggccggggaagcttaaattagtttttgag 382

                   
Query: 540 ggaaaaga 547
           ||||||||
Sbjct: 383 ggaaaaga 390



to top

>gb|U80912.1|EGU80912 Eucalyptus globulus NADP-isocitrate dehydrogenase (EgICDH) mRNA,
           complete cds
          Length = 1645

 Score =  208 bits (105), Expect = 1e-50
 Identities = 348/429 (81%)
 Strand = Plus / Plus

                                                                       
Query: 69  ttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgaccaga 128
           |||||||||||||||||||  ||||||||||||||||||||||| ||||| |||||| ||
Sbjct: 167 ttcgagaagatcaaggtcgagaaccccatcgtcgagatggacggggatgaaatgacccga 226

                                                                       
Query: 129 gtattctggcagtctatcaaggacaagcttatcttcccatttttggacttggacatcaaa 188
           || |||||| | || |||||||| |||||||| || || || ||||| ||||| ||||| 
Sbjct: 227 gtgttctggaaatcaatcaaggataagcttatttttcccttcttggagttggatatcaag 286

                                                                       
Query: 189 tactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacagtggaggct 248
           ||||| ||| | ||  |||  || || ||||| |||||||||||||||||| | ||    
Sbjct: 287 tacttcgaccttggtcttcctcatcgtgatgccactgatgacaaggttacaattgaaagc 346

                                                                       
Query: 249 gcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactccagatgaa 308
           ||||| || ||||| || ||||||||||| || || |||||||||||||| |||||||||
Sbjct: 347 gcagaagcaactcttaaatacaatgtggccatcaaatgtgcaactattacaccagatgaa 406

                                                                       
Query: 309 gatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggcacaattagg 368
           | |||| | |||||||| |   | || ||||||||||  || || ||||| || ||||||
Sbjct: 407 gctcggatgaaggagtttactttgaagcaaatgtggaaaagtcccaatgggacgattagg 466

                                                                       
Query: 369 aacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtcccaaagctt 428
           |||||  | || ||||| || |||||||||||||| || ||||| ||| | ||   ||||
Sbjct: 467 aacatcttgaatggcactgtcttcagagagccaataatgtgcaaaaatattccccggctt 526

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           || ||||| ||| | ||||| || ||||||||||| |||||||| |||||||| |||| |
Sbjct: 527 gtcccagggtggtccaagccaatatgcattggaagacatgcttttggtgatcaatacaaa 586

                    
Query: 489 gcaactgat 497
           || ||||||
Sbjct: 587 gctactgat 595



to top

>gb|AY107138.1| Zea mays PCO115488 mRNA sequence
          Length = 1634

 Score =  198 bits (100), Expect = 1e-47
 Identities = 211/248 (85%)
 Strand = Plus / Plus

                                                                       
Query: 62  catggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagat 121
           |||||| ||| | |||||||||||| |||||||| |||||||||||||||| ||||||||
Sbjct: 128 catggccttcaacaagatcaaggtctccaaccccgtcgtcgagatggacggcgatgagat 187

                                                                       
Query: 122 gaccagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttgga 181
           |||||| || |||||| | |||||||||||||||||||| ||||| ||  | ||| | ||
Sbjct: 188 gaccagggtgttctggaaatctatcaaggacaagcttatattccctttcgtagacctcga 247

                                                                       
Query: 182 catcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacagt 241
           ||||||||| |||||| | ||  |||  ||||| ||||| || || ||||| || |||||
Sbjct: 248 catcaaatattttgacctcgggcttccacaccgtgatgctaccgacgacaaagtcacagt 307

                                                                       
Query: 242 ggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactcc 301
           ||||||||| ||||| || |||||||||||||||||||| |||||||| || ||||| ||
Sbjct: 308 ggaggctgcggaggccacactcaagtacaatgtggctatcaagtgtgccaccattacacc 367

                   
Query: 302 agatgaag 309
           ||||||||
Sbjct: 368 agatgaag 375



 Score =  161 bits (81), Expect = 3e-36
 Identities = 177/209 (84%)
 Strand = Plus / Plus

                                                                       
Query: 339 atgtggaggagcccaaatggcacaattaggaacattataaacggcaccgtgttcagagag 398
           ||||||| |||||||||||||||||||||||| ||| | || ||||| ||||||||||| 
Sbjct: 405 atgtggaagagcccaaatggcacaattaggaatattctgaatggcactgtgttcagagaa 464

                                                                       
Query: 399 ccaattatatgcaagaatgtcccaaagcttgttccaggatggactaagcccatctgcatt 458
           ||||| || ||||| ||  |||||  |||||||||||| ||||| || ||||| ||||| 
Sbjct: 465 ccaatcatctgcaaaaacatcccacggcttgttccagggtggacaaaacccatttgcatc 524

                                                                       
Query: 459 ggaaggcatgctttcggtgatcagtacagagcaactgatgccgttctcaagggacctggc 518
           || |||||||| ||||||||||||||| | ||||||||||| ||| ||||||| || || 
Sbjct: 525 gggaggcatgcattcggtgatcagtaccgggcaactgatgcagttatcaaggggccaggg 584

                                        
Query: 519 aaactcagactagtttttgagggaaaaga 547
           || || | | |||||||||||||||||||
Sbjct: 585 aagcttaaattagtttttgagggaaaaga 613



to top

>ref|NM_105265.2| Arabidopsis thaliana isocitrate dehydrogenase (NADP+)/
           oxidoreductase AT1G65930 mRNA, complete cds
          Length = 1663

 Score =  196 bits (99), Expect = 5e-47
 Identities = 372/463 (80%)
 Strand = Plus / Plus

                                                                       
Query: 61  ccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgaga 120
           |||||||||| |||||||||||||| || || ||||||||||||||||| |||||||| |
Sbjct: 163 ccatggcgtttgagaagatcaaggtggcaaatcccatcgtcgagatggatggtgatgaaa 222

                                                                       
Query: 121 tgaccagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttgg 180
           ||||||| ||  | ||| ||||||||||||| ||||||||    || ||| |||| ||||
Sbjct: 223 tgaccagggttatttggaagtctatcaaggataagcttattactccttttgtggagttgg 282

                                                                       
Query: 181 acatcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacag 240
           | ||||| ||||| ||| | ||  |||  ||||| ||||| || |||||||| |||||  
Sbjct: 283 atatcaagtacttcgaccttggtcttcctcaccgtgatgctacggatgacaaagttacta 342

                                                                       
Query: 241 tggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactc 300
           | ||   ||| || ||||||   |||||||||||||| || |||||||| || || ||||
Sbjct: 343 ttgaaagtgctgaagctactaagaagtacaatgtggcgatcaagtgtgccaccatcactc 402

                                                                       
Query: 301 cagatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggca 360
           |||||||||  || || | ||| ||   | | || || |||||||| || |||||||| |
Sbjct: 403 cagatgaaggccgtgtcacggaatttggcttgaagcagatgtggagaagtccaaatggga 462

                                                                       
Query: 361 caattaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtcc 420
           | || ||||| ||  | || || || || || |||||||||||||| ||||| ||||| |
Sbjct: 463 ccatcaggaatatcctgaatggaactgtatttagagagccaattatctgcaaaaatgttc 522

                                                                       
Query: 421 caaagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatc 480
           | |||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 523 ccaagcttgtcccaggctggacaaagcccatctgcattggaaggcatgcttttggtgatc 582

                                                      
Query: 481 agtacagagcaactgatgccgttctcaagggacctggcaaact 523
           ||||| | || |||||||| ||  |||||||||| || |||||
Sbjct: 583 agtaccgtgccactgatgctgtaatcaagggaccaggaaaact 625



to top

>emb|AJ437268.1|ATH437268 Arabidopsis thaliana mRNA for isocitrate dehydrogenase
          Length = 1610

 Score =  196 bits (99), Expect = 5e-47
 Identities = 372/463 (80%)
 Strand = Plus / Plus

                                                                       
Query: 61  ccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgaga 120
           |||||||||| |||||||||||||| || || ||||||||||||||||| |||||||| |
Sbjct: 163 ccatggcgtttgagaagatcaaggtggcaaatcccatcgtcgagatggatggtgatgaaa 222

                                                                       
Query: 121 tgaccagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttgg 180
           ||||||| ||  | ||| ||||||||||||| ||||||||    || ||| |||| ||||
Sbjct: 223 tgaccagggttatttggaagtctatcaaggataagcttattactccttttgtggagttgg 282

                                                                       
Query: 181 acatcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacag 240
           | ||||| ||||| ||| | ||  |||  ||||| ||||| || |||||||| |||||  
Sbjct: 283 atatcaagtacttcgaccttggtcttcctcaccgtgatgctacggatgacaaagttacta 342

                                                                       
Query: 241 tggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactc 300
           | ||   ||| || ||||||   |||||||||||||| || |||||||| || || ||||
Sbjct: 343 ttgaaagtgctgaagctactaagaagtacaatgtggcgatcaagtgtgccaccatcactc 402

                                                                       
Query: 301 cagatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggca 360
           |||||||||  || || | ||| ||   | | || || |||||||| || |||||||| |
Sbjct: 403 cagatgaaggccgtgtcacggaatttggcttgaagcagatgtggagaagtccaaatggga 462

                                                                       
Query: 361 caattaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtcc 420
           | || ||||| ||  | || || || || || |||||||||||||| ||||| ||||| |
Sbjct: 463 ccatcaggaatatcctgaatggaactgtatttagagagccaattatctgcaaaaatgttc 522

                                                                       
Query: 421 caaagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatc 480
           | |||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 523 ccaagcttgtcccaggctggacaaagcccatctgcattggaaggcatgcttttggtgatc 582

                                                      
Query: 481 agtacagagcaactgatgccgttctcaagggacctggcaaact 523
           ||||| | || |||||||| ||  |||||||||| || |||||
Sbjct: 583 agtaccgtgccactgatgctgtaatcaagggaccaggaaaact 625



to top

>gb|AY093091.1| Arabidopsis thaliana similar to NADP-specific isocitrate
           dehydrogenase (At1g65930) mRNA, complete cds
          Length = 1551

 Score =  196 bits (99), Expect = 5e-47
 Identities = 372/463 (80%)
 Strand = Plus / Plus

                                                                       
Query: 61  ccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgaga 120
           |||||||||| |||||||||||||| || || ||||||||||||||||| |||||||| |
Sbjct: 153 ccatggcgtttgagaagatcaaggtggcaaatcccatcgtcgagatggatggtgatgaaa 212

                                                                       
Query: 121 tgaccagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttgg 180
           ||||||| ||  | ||| ||||||||||||| ||||||||    || ||| |||| ||||
Sbjct: 213 tgaccagggttatttggaagtctatcaaggataagcttattactccttttgtggagttgg 272

                                                                       
Query: 181 acatcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacag 240
           | ||||| ||||| ||| | ||  |||  ||||| ||||| || |||||||| |||||  
Sbjct: 273 atatcaagtacttcgaccttggtcttcctcaccgtgatgctacggatgacaaagttacta 332

                                                                       
Query: 241 tggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactc 300
           | ||   ||| || ||||||   |||||||||||||| || |||||||| || || ||||
Sbjct: 333 ttgaaagtgctgaagctactaagaagtacaatgtggcgatcaagtgtgccaccatcactc 392

                                                                       
Query: 301 cagatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggca 360
           |||||||||  || || | ||| ||   | | || || |||||||| || |||||||| |
Sbjct: 393 cagatgaaggccgtgtcacggaatttggcttgaagcagatgtggagaagtccaaatggga 452

                                                                       
Query: 361 caattaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtcc 420
           | || ||||| ||  | || || || || || |||||||||||||| ||||| ||||| |
Sbjct: 453 ccatcaggaatatcctgaatggaactgtatttagagagccaattatctgcaaaaatgttc 512

                                                                       
Query: 421 caaagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatc 480
           | |||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 513 ccaagcttgtcccaggctggacaaagcccatctgcattggaaggcatgcttttggtgatc 572

                                                      
Query: 481 agtacagagcaactgatgccgttctcaagggacctggcaaact 523
           ||||| | || |||||||| ||  |||||||||| || |||||
Sbjct: 573 agtaccgtgccactgatgctgtaatcaagggaccaggaaaact 615



to top

>gb|AF419575.1|AF419575 Arabidopsis thaliana At1g65930/F12P19_10 mRNA, complete cds
          Length = 1636

 Score =  196 bits (99), Expect = 5e-47
 Identities = 372/463 (80%)
 Strand = Plus / Plus

                                                                       
Query: 61  ccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgaga 120
           |||||||||| |||||||||||||| || || ||||||||||||||||| |||||||| |
Sbjct: 152 ccatggcgtttgagaagatcaaggtggcaaatcccatcgtcgagatggatggtgatgaaa 211

                                                                       
Query: 121 tgaccagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttgg 180
           ||||||| ||  | ||| ||||||||||||| ||||||||    || ||| |||| ||||
Sbjct: 212 tgaccagggttatttggaagtctatcaaggataagcttattactccttttgtggagttgg 271

                                                                       
Query: 181 acatcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacag 240
           | ||||| ||||| ||| | ||  |||  ||||| ||||| || |||||||| |||||  
Sbjct: 272 atatcaagtacttcgaccttggtcttcctcaccgtgatgctacggatgacaaagttacta 331

                                                                       
Query: 241 tggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactc 300
           | ||   ||| || ||||||   |||||||||||||| || |||||||| || || ||||
Sbjct: 332 ttgaaagtgctgaagctactaagaagtacaatgtggcgatcaagtgtgccaccatcactc 391

                                                                       
Query: 301 cagatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggca 360
           |||||||||  || || | ||| ||   | | || || |||||||| || |||||||| |
Sbjct: 392 cagatgaaggccgtgtcacggaatttggcttgaagcagatgtggagaagtccaaatggga 451

                                                                       
Query: 361 caattaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtcc 420
           | || ||||| ||  | || || || || || |||||||||||||| ||||| ||||| |
Sbjct: 452 ccatcaggaatatcctgaatggaactgtatttagagagccaattatctgcaaaaatgttc 511

                                                                       
Query: 421 caaagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatc 480
           | |||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 512 ccaagcttgtcccaggctggacaaagcccatctgcattggaaggcatgcttttggtgatc 571

                                                      
Query: 481 agtacagagcaactgatgccgttctcaagggacctggcaaact 523
           ||||| | || |||||||| ||  |||||||||| || |||||
Sbjct: 572 agtaccgtgccactgatgctgtaatcaagggaccaggaaaact 614



to top

>gb|AY045631.1| Arabidopsis thaliana At1g65930/F12P19_10 mRNA, complete cds
          Length = 1653

 Score =  196 bits (99), Expect = 5e-47
 Identities = 372/463 (80%)
 Strand = Plus / Plus

                                                                       
Query: 61  ccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgaga 120
           |||||||||| |||||||||||||| || || ||||||||||||||||| |||||||| |
Sbjct: 152 ccatggcgtttgagaagatcaaggtggcaaatcccatcgtcgagatggatggtgatgaaa 211

                                                                       
Query: 121 tgaccagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttgg 180
           ||||||| ||  | ||| ||||||||||||| ||||||||    || ||| |||| ||||
Sbjct: 212 tgaccagggttatttggaagtctatcaaggataagcttattactccttttgtggagttgg 271

                                                                       
Query: 181 acatcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacag 240
           | ||||| ||||| ||| | ||  |||  ||||| ||||| || |||||||| |||||  
Sbjct: 272 atatcaagtacttcgaccttggtcttcctcaccgtgatgctacggatgacaaagttacta 331

                                                                       
Query: 241 tggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactc 300
           | ||   ||| || ||||||   |||||||||||||| || |||||||| || || ||||
Sbjct: 332 ttgaaagtgctgaagctactaagaagtacaatgtggcgatcaagtgtgccaccatcactc 391

                                                                       
Query: 301 cagatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggca 360
           |||||||||  || || | ||| ||   | | || || |||||||| || |||||||| |
Sbjct: 392 cagatgaaggccgtgtcacggaatttggcttgaagcagatgtggagaagtccaaatggga 451

                                                                       
Query: 361 caattaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtcc 420
           | || ||||| ||  | || || || || || |||||||||||||| ||||| ||||| |
Sbjct: 452 ccatcaggaatatcctgaatggaactgtatttagagagccaattatctgcaaaaatgttc 511

                                                                       
Query: 421 caaagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatc 480
           | |||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 512 ccaagcttgtcccaggctggacaaagcccatctgcattggaaggcatgcttttggtgatc 571

                                                      
Query: 481 agtacagagcaactgatgccgttctcaagggacctggcaaact 523
           ||||| | || |||||||| ||  |||||||||| || |||||
Sbjct: 572 agtaccgtgccactgatgctgtaatcaagggaccaggaaaact 614



to top

>gb|BT002400.1| Arabidopsis thaliana isocitrate dehydrogenase, putative (At1g65930)
           mRNA, complete cds
          Length = 1581

 Score =  196 bits (99), Expect = 5e-47
 Identities = 372/463 (80%)
 Strand = Plus / Plus

                                                                       
Query: 61  ccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgaga 120
           |||||||||| |||||||||||||| || || ||||||||||||||||| |||||||| |
Sbjct: 152 ccatggcgtttgagaagatcaaggtggcaaatcccatcgtcgagatggatggtgatgaaa 211

                                                                       
Query: 121 tgaccagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttgg 180
           ||||||| ||  | ||| ||||||||||||| ||||||||    || ||| |||| ||||
Sbjct: 212 tgaccagggttatttggaagtctatcaaggataagcttattactccttttgtggagttgg 271

                                                                       
Query: 181 acatcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacag 240
           | ||||| ||||| ||| | ||  |||  ||||| ||||| || |||||||| |||||  
Sbjct: 272 atatcaagtacttcgaccttggtcttcctcaccgtgatgctacggatgacaaagttacta 331

                                                                       
Query: 241 tggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactc 300
           | ||   ||| || ||||||   |||||||||||||| || |||||||| || || ||||
Sbjct: 332 ttgaaagtgctgaagctactaagaagtacaatgtggcgatcaagtgtgccaccatcactc 391

                                                                       
Query: 301 cagatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggca 360
           |||||||||  || || | ||| ||   | | || || |||||||| || |||||||| |
Sbjct: 392 cagatgaaggccgtgtcacggaatttggcttgaagcagatgtggagaagtccaaatggga 451

                                                                       
Query: 361 caattaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtcc 420
           | || ||||| ||  | || || || || || |||||||||||||| ||||| ||||| |
Sbjct: 452 ccatcaggaatatcctgaatggaactgtatttagagagccaattatctgcaaaaatgttc 511

                                                                       
Query: 421 caaagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatc 480
           | |||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 512 ccaagcttgtcccaggctggacaaagcccatctgcattggaaggcatgcttttggtgatc 571

                                                      
Query: 481 agtacagagcaactgatgccgttctcaagggacctggcaaact 523
           ||||| | || |||||||| ||  |||||||||| || |||||
Sbjct: 572 agtaccgtgccactgatgctgtaatcaagggaccaggaaaact 614



to top

>gb|AY088129.1| Arabidopsis thaliana clone 41544 mRNA, complete sequence
          Length = 1554

 Score =  194 bits (98), Expect = 2e-46
 Identities = 371/462 (80%)
 Strand = Plus / Plus

                                                                       
Query: 62  catggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagat 121
           ||||||||| |||||||||||||| || || ||||||||||||||||| |||||||| ||
Sbjct: 153 catggcgtttgagaagatcaaggtggcaaatcccatcgtcgagatggatggtgatgaaat 212

                                                                       
Query: 122 gaccagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttgga 181
           |||||| ||  | ||| ||||||||||||| ||||||||    || ||| |||| |||||
Sbjct: 213 gaccagggttatttggaagtctatcaaggataagcttattactccttttgtggagttgga 272

                                                                       
Query: 182 catcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacagt 241
            ||||| ||||| ||| | ||  |||  ||||| ||||| || |||||||| |||||  |
Sbjct: 273 tatcaagtacttcgaccttggtcttcctcaccgtgatgctacggatgacaaagttactat 332

                                                                       
Query: 242 ggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactcc 301
            ||   ||| || ||||||   |||||||||||||| || |||||||| || || |||||
Sbjct: 333 tgaaagtgctgaagctactaagaagtacaatgtggcgatcaagtgtgccaccatcactcc 392

                                                                       
Query: 302 agatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggcac 361
           ||||||||  || || | ||| ||   | | || || |||||||| || |||||||| ||
Sbjct: 393 agatgaaggccgtgtcacggaatttggcttgaagcagatgtggagaagtccaaatgggac 452

                                                                       
Query: 362 aattaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtccc 421
            || ||||| ||  | || || || || || |||||||||||||| ||||| ||||| ||
Sbjct: 453 catcaggaatatcctgaatggaactgtatttagagagccaattatctgcaaaaatgttcc 512

                                                                       
Query: 422 aaagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatca 481
            |||||||| ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 513 caagcttgtcccaggctggacaaagcccatctgcattggaaggcatgcttttggtgatca 572

                                                     
Query: 482 gtacagagcaactgatgccgttctcaagggacctggcaaact 523
           |||| | || |||||||| ||  |||||||||| || |||||
Sbjct: 573 gtaccgtgccactgatgctgtaatcaagggaccaggaaaact 614



to top

>gb|AY112639.1| Zea mays CL62576_1 mRNA sequence
          Length = 435

 Score =  194 bits (98), Expect = 2e-46
 Identities = 162/185 (87%)
 Strand = Plus / Plus

                                                                       
Query: 333 aaacaaatgtggaggagcccaaatggcacaattaggaacattataaacggcaccgtgttc 392
           ||||| ||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||
Sbjct: 23  aaacacatgtggaagagcccaaatggcacaattaggaacattataaatggcactgtgttc 82

                                                                       
Query: 393 agagagccaattatatgcaagaatgtcccaaagcttgttccaggatggactaagcccatc 452
           |||||||| |||||||||      || ||||  |||| ||||||||||||||||||||||
Sbjct: 83  agagagcctattatatgcnnnnncgttccaagacttggtccaggatggactaagcccatc 142

                                                                       
Query: 453 tgcattggaaggcatgctttcggtgatcagtacagagcaactgatgccgttctcaaggga 512
           ||||||||||||||||| ||||||||||| ||| |||| || ||||| ||||| ||||| 
Sbjct: 143 tgcattggaaggcatgccttcggtgatcaataccgagctaccgatgcagttctgaagggg 202

                
Query: 513 cctgg 517
           |||||
Sbjct: 203 cctgg 207



to top

>gb|AY509880.1| Pisum sativum NADP-dependent isocitrate dehydrogenase mRNA,
           complete cds
          Length = 1564

 Score =  192 bits (97), Expect = 8e-46
 Identities = 367/457 (80%)
 Strand = Plus / Plus

                                                                       
Query: 61  ccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgaga 120
           ||||||| ||| |||| ||||| |||||||  |||||||| ||||||||||| ||||| |
Sbjct: 77  ccatggcattccagaaaatcaaagtcgccagtcccatcgttgagatggacggagatgaaa 136

                                                                       
Query: 121 tgaccagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttgg 180
           ||||| ||||  ||||| |||| |||||||| ||||| || || || || ||||| ||||
Sbjct: 137 tgacccgagttatctggaagtcaatcaaggataagctcatttttcctttcttggagttgg 196

                                                                       
Query: 181 acatcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacag 240
           ||||||| ||||||||| | ||  |||  || || |||   |||||||| || |||||||
Sbjct: 197 acatcaagtactttgacctaggccttcctcatcgtgatcagactgatgataaagttacag 256

                                                                       
Query: 241 tggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactc 300
           | ||   ||| || || ||||||||||| ||||| || || |||||||||||||| ||||
Sbjct: 257 ttgaaagtgccgaagcaactctcaagtataatgttgcaatcaagtgtgcaactatcactc 316

                                                                       
Query: 301 cagatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggca 360
           ||||||||| ||| ||  ||||||||  ||| ||    ||||||||||| |||||||| |
Sbjct: 317 cagatgaagctcgtgtcgaggagttcggcctgaagagcatgtggaggagtccaaatggga 376

                                                                       
Query: 361 caattaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtcc 420
           ||||||| |||||| | || || || || |||||||| |||||||| ||||| |||||||
Sbjct: 377 caattagaaacattttgaatggaactgtcttcagagaaccaattatttgcaaaaatgtcc 436

                                                                       
Query: 421 caaagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatc 480
           |    ||| |||| || ||||| ||||| || || ||||||||||||||||| |||||||
Sbjct: 437 ctcgccttattcctggttggacaaagccaatatgtattggaaggcatgcttttggtgatc 496

                                                
Query: 481 agtacagagcaactgatgccgttctcaagggacctgg 517
           | || || || |||||||| ||| | || ||||||||
Sbjct: 497 aatatagggccactgatgcagttattaaaggacctgg 533



to top

>emb|AJ437269.1|CSA437269 Cucumis sativus mRNA for isocitrate dehydrogenase
          Length = 1551

 Score =  192 bits (97), Expect = 8e-46
 Identities = 352/437 (80%)
 Strand = Plus / Plus

                                                                       
Query: 61  ccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgaga 120
           ||||||| ||| ||||||||||||||||||| |||||||| ||||||||||| ||||| |
Sbjct: 60  ccatggctttccagaagatcaaggtcgccaatcccatcgttgagatggacggagatgaaa 119

                                                                       
Query: 121 tgaccagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttgg 180
           ||||  ||||  ||||| |||| || ||| | |||||||| |||||||||||||| ||||
Sbjct: 120 tgactcgagttatctgggagtcaattaagaataagcttattttcccatttttggaattgg 179

                                                                       
Query: 181 acatcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacag 240
           ||||||| || |||||| | ||  |||  ||||| ||||| || ||||| || |||||| 
Sbjct: 180 acatcaagtattttgaccttggccttccacaccgtgatgccacagatgataaagttacaa 239

                                                                       
Query: 241 tggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactc 300
           | ||   |||||| |||||| | ||||||||||| || || || |||||||| |||||||
Sbjct: 240 ttgaaagtgcagaagctactttaaagtacaatgtagcaatcaaatgtgcaacaattactc 299

                                                                       
Query: 301 cagatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggca 360
           ||||||| |  || |||||||| ||   | | || || |||||||| || |||||||| |
Sbjct: 300 cagatgaggcacgtgttaaggaatttggcttgaagcagatgtggagaagtccaaatggaa 359

                                                                       
Query: 361 caattaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtcc 420
           |||| ||||| ||| | || || || || |||||||| || ||| | ||||| ||||| |
Sbjct: 360 caatcaggaatattctgaatggaactgtcttcagagaaccgattctttgcaaaaatgttc 419

                                                                       
Query: 421 caaagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatc 480
           |    ||||| ||||| ||||| ||||| ||||| |||||||| |||||||| |||||||
Sbjct: 420 ctcgccttgtaccaggttggacgaagcctatctgtattggaagacatgcttttggtgatc 479

                            
Query: 481 agtacagagcaactgat 497
           | |||||||| ||||||
Sbjct: 480 aatacagagctactgat 496



to top

>gb|AY097340.1| Arabidopsis thaliana At1g65930/F12P19_10 mRNA, complete cds
          Length = 1233

 Score =  192 bits (97), Expect = 8e-46
 Identities = 370/461 (80%)
 Strand = Plus / Plus

                                                                       
Query: 63  atggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatg 122
           |||||||| |||||||||||||| || || ||||||||||||||||| |||||||| |||
Sbjct: 1   atggcgtttgagaagatcaaggtggcaaatcccatcgtcgagatggatggtgatgaaatg 60

                                                                       
Query: 123 accagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttggac 182
           ||||| ||  | ||| ||||||||||||| ||||||||    || ||| |||| ||||| 
Sbjct: 61  accagggttatttggaagtctatcaaggataagcttattactccttttgtggagttggat 120

                                                                       
Query: 183 atcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacagtg 242
           ||||| ||||| ||| | ||  |||  ||||| ||||| || |||||||| |||||  | 
Sbjct: 121 atcaagtacttcgaccttggtcttcctcaccgtgatgctacggatgacaaagttactatt 180

                                                                       
Query: 243 gaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactcca 302
           ||   ||| || ||||||   |||||||||||||| || |||||||| || || ||||||
Sbjct: 181 gaaagtgctgaagctactaagaagtacaatgtggcgatcaagtgtgccaccatcactcca 240

                                                                       
Query: 303 gatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggcaca 362
           |||||||  || || | ||| ||   | | || || |||||||| || |||||||| || 
Sbjct: 241 gatgaaggccgtgtcacggaatttggcttgaagcagatgtggagaagtccaaatgggacc 300

                                                                       
Query: 363 attaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtccca 422
           || ||||| ||  | || || || || || |||||||||||||| ||||| ||||| || 
Sbjct: 301 atcaggaatatcctgaatggaactgtatttagagagccaattatctgcaaaaatgttccc 360

                                                                       
Query: 423 aagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcag 482
           |||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||||||||
Sbjct: 361 aagcttgtcccaggctggacaaagcccatctgcattggaaggcatgcttttggtgatcag 420

                                                    
Query: 483 tacagagcaactgatgccgttctcaagggacctggcaaact 523
           ||| | || |||||||| ||  |||||||||| || |||||
Sbjct: 421 taccgtgccactgatgctgtaatcaagggaccaggaaaact 461



to top

>dbj|AB243085.1| Codonopsis lanceolata mRNA for NADP-isocitrate dehydrogenase,
           complete cds
          Length = 1500

 Score =  182 bits (92), Expect = 8e-43
 Identities = 362/452 (80%)
 Strand = Plus / Plus

                                                                       
Query: 63  atggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatg 122
           |||||||| |||||||||||||| || ||||||||||| |||||||| || ||||| |||
Sbjct: 92  atggcgtttgagaagatcaaggttgcaaaccccatcgttgagatggatggagatgaaatg 151

                                                                       
Query: 123 accagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttggac 182
           ||  |  | |||||||| || || ||||| |||||||| || || ||||||||  | || 
Sbjct: 152 actcgtatcttctggcaatcgataaaggataagcttatttttccctttttggagcttgat 211

                                                                       
Query: 183 atcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacagtg 242
           || || ||||||||| | ||  |||  ||||| ||||| || |||||||| || || || 
Sbjct: 212 ataaagtactttgaccttggccttcctcaccgtgatgccaccgatgacaaagtcacggta 271

                                                                       
Query: 243 gaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactcca 302
           |||  ||| || |||||||| ||||||||||| || || ||||| ||||| |||||||||
Sbjct: 272 gagagtgctgaagctactcttaagtacaatgttgcaatcaagtgcgcaaccattactcca 331

                                                                       
Query: 303 gatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggcaca 362
           ||||| | |||  | |||||||| | ||| |||   |||||||  || |||||||| |||
Sbjct: 332 gatgaggctcgtatgaaggagtttaccctgaaaagtatgtggaaaagtccaaatggaaca 391

                                                                       
Query: 363 attaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtccca 422
           |||||||| ||| | || || || ||||||||||| || ||||| ||||||||  | || 
Sbjct: 392 attaggaatattttgaatggtacggtgttcagagaaccgattatttgcaagaacattccc 451

                                                                       
Query: 423 aagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcag 482
           | |||| | ||||||||||| ||||| || || ||||||||||||||||| |||||||||
Sbjct: 452 aggcttatcccaggatggacaaagccaatatgtattggaaggcatgcttttggtgatcag 511

                                           
Query: 483 tacagagcaactgatgccgttctcaagggacc 514
           ||  |||| |||||||| ||  ||||||||||
Sbjct: 512 tatcgagctactgatgcagtcatcaagggacc 543



to top

>gb|L12157.1|SOYIDH Glycine max NADP-specific isocitrate dehydrogenase (idh1) mRNA, 3'
           end
          Length = 1560

 Score =  182 bits (92), Expect = 8e-43
 Identities = 335/416 (80%)
 Strand = Plus / Plus

                                                                       
Query: 66  gcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           |||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||| 
Sbjct: 93  gcgttccagaagatcaaggtcgccaaccccatcgtcgagatggacggagatgaaatgact 152

                                                                       
Query: 126 agagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttggacatc 185
           || ||  ||||| |||| |||||||||||||| || || || || ||||| |||||||||
Sbjct: 153 agggttatctggaagtcaatcaaggacaagctcattttgcccttcttggagttggacatc 212

                                                                       
Query: 186 aaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacagtggag 245
           || || | |||||| ||  |||   |||| ||||  || ||||| || |||||| | || 
Sbjct: 213 aagtattatgacttaggccttccttaccgtgatgagaccgatgataaagttacaattgaa 272

                                                                       
Query: 246 gctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactccagat 305
             ||| || || ||||||||||| |||||||| |||||||| ||||||||||||||||||
Sbjct: 273 agtgcggaagcaactctcaagtataatgtggcaattaagtgcgcaactattactccagat 332

                                                                       
Query: 306 gaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggcacaatt 365
           |||| ||| || ||||||||    || ||   |||||||| ||| |||||||| ||||||
Sbjct: 333 gaagctcgtgtgaaggagtttggtctgaagtcaatgtggaagagtccaaatgggacaatt 392

                                                                       
Query: 366 aggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtcccaaag 425
           ||||||||| | || || || || |||||||| |||||| | ||||| ||  | ||    
Sbjct: 393 aggaacattttgaatggaactgtcttcagagaaccaattctttgcaaaaacattccccgc 452

                                                                   
Query: 426 cttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatca 481
           |||||||| || ||||| ||| | || ||||||||||| ||||| || ||||||||
Sbjct: 453 cttgttcctggttggacaaaggcaatatgcattggaagacatgcgtttggtgatca 508



to top

>dbj|D21069.1|RICAK88B Oryza sativa mRNA for isocitrate dehydrogenase, partial cds
          Length = 187

 Score =  180 bits (91), Expect = 3e-42
 Identities = 120/127 (94%), Gaps = 2/127 (1%)
 Strand = Plus / Plus

                                                                       
Query: 58  ccgccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatg 117
           |||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 57  ccgccatggc-ttcgagaagatcaaggtcgccaaccccatcgtcgagatg-acggtgatg 114

                                                                       
Query: 118 agatgaccagagtattctggcagtctatcaaggacaagcttatcttcccatttttggact 177
           ||||||||||  |||||||||||||||||||||||||||||||||| |||||||||||  
Sbjct: 115 agatgaccaggatattctggcagtctatcaaggacaagcttatctttccatttttggatc 174

                  
Query: 178 tggacat 184
           |||||||
Sbjct: 175 tggacat 181



to top

>emb|Y12540.1|AGIDHC A.graveolens mRNA for isocitrate dehydrogenase (NADP+)
          Length = 1535

 Score =  178 bits (90), Expect = 1e-41
 Identities = 369/462 (79%)
 Strand = Plus / Plus

                                                                       
Query: 62  catggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagat 121
           |||||||||  ||||||| |||||||| |||||||||||||| |||||||| ||||| ||
Sbjct: 60  catggcgtttcagaagattaaggtcgctaaccccatcgtcgaaatggacggagatgaaat 119

                                                                       
Query: 122 gaccagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttgga 181
           |||| | ||||| ||| | ||||| |||||||||||||| || || ||| | ||  | ||
Sbjct: 120 gacccgtgtattttggaaatctattaaggacaagcttatatttccctttgttgagcttga 179

                                                                       
Query: 182 catcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacagt 241
            || |||||||||||| | ||  |||  ||||| |||||||| ||||| || ||||| ||
Sbjct: 180 tataaaatactttgaccttggccttcctcaccgtgatgcaaccgatgataaagttactgt 239

                                                                       
Query: 242 ggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactcc 301
            ||   |||||||||||| |||||||| ||||| || || || |||||||| ||||||||
Sbjct: 240 tgaaagtgcagaggctaccctcaagtataatgtagcaatcaaatgtgcaacaattactcc 299

                                                                       
Query: 302 agatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggcac 361
           |||||||| ||||||| |||| ||     | || || ||||||| ||| |||||||| ||
Sbjct: 300 agatgaagctcgggttgaggaatttggtttgaagcagatgtggaagagtccaaatgggac 359

                                                                       
Query: 362 aattaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtccc 421
            ||||| || ||| |||| ||||| || || || || |||||||| ||||| ||  ||||
Sbjct: 360 tattagaaatattttaaatggcacggtatttagggaaccaattatctgcaaaaacatccc 419

                                                                       
Query: 422 aaagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatca 481
            |||||  | ||||| ||||| ||||| || ||||| ||||| |||||||| ||||||||
Sbjct: 420 gaagctcatcccagggtggacgaagccaatatgcatcggaagacatgcttttggtgatca 479

                                                     
Query: 482 gtacagagcaactgatgccgttctcaagggacctggcaaact 523
            ||| | ||||| ||||| ||| |||| ||||| || |||||
Sbjct: 480 ataccgcgcaacagatgcagttatcaaaggaccaggaaaact 521



to top

>ref|NM_104312.2| Arabidopsis thaliana ICDH (isocitrate dehydrogenase); isocitrate
           dehydrogenase (NADP+)/ oxidoreductase AT1G54340 (ICDH)
           mRNA, complete cds
          Length = 1571

 Score =  174 bits (88), Expect = 2e-40
 Identities = 319/396 (80%)
 Strand = Plus / Plus

                                                                       
Query: 144 atcaaggacaagcttatcttcccatttttggacttggacatcaaatactttgacttggga 203
           ||||| ||||||||||| ||||| ||  ||||  |||| ||||||||||||||  | |||
Sbjct: 122 atcaaagacaagcttattttccctttcctggagctggatatcaaatactttgatcttgga 181

                                                                       
Query: 204 gttctgcaccgcgatgcaactgatgacaaggttacagtggaggctgcagaggctactctc 263
            | |   ||||||||   |||||||| ||||||||  | ||| |||| || |||||| | 
Sbjct: 182 ctgcctaaccgcgatttcactgatgataaggttactatagagactgctgaagctacttta 241

                                                                       
Query: 264 aagtacaatgtggctattaagtgtgcaactattactccagatgaagatcgggttaaggag 323
           ||||| |||||||||||||||||||| || |||||||| ||||||| ||| |||| ||||
Sbjct: 242 aagtataatgtggctattaagtgtgcgacgattactccggatgaagctcgtgttagggag 301

                                                                       
Query: 324 ttcaacctaaaacaaatgtggaggagcccaaatggcacaattaggaacattataaacggc 383
           |||  | ||||  ||||||||||||| || ||||| || || ||||||||| ||||||||
Sbjct: 302 ttcggcttaaagaaaatgtggaggagtcctaatggaactataaggaacattttaaacggc 361

                                                                       
Query: 384 accgtgttcagagagccaattatatgcaagaatgtcccaaagcttgttccaggatggact 443
           || || ||||| || || || || ||||  ||  ||||    ||||||||||||||||| 
Sbjct: 362 acagttttcagggaacctatcatttgcagaaacatccctcgtcttgttccaggatggacg 421

                                                                       
Query: 444 aagcccatctgcattggaaggcatgctttcggtgatcagtacagagcaactgatgccgtt 503
           ||||| ||||| ||||||||||||||||| ||||||||||| ||||| ||||||  | ||
Sbjct: 422 aagccaatctgtattggaaggcatgcttttggtgatcagtatagagccactgatctcatt 481

                                               
Query: 504 ctcaagggacctggcaaactcagactagtttttgag 539
            |||| | ||| || ||||| | |||||||||||||
Sbjct: 482 gtcaatgaaccaggaaaactgaaactagtttttgag 517



to top

>gb|AF316501.1|AF316501 Arabidopsis thaliana NADP-specific isocitrate dehydrogenase (ICDH)
           mRNA, complete cds
          Length = 1551

 Score =  174 bits (88), Expect = 2e-40
 Identities = 319/396 (80%)
 Strand = Plus / Plus

                                                                       
Query: 144 atcaaggacaagcttatcttcccatttttggacttggacatcaaatactttgacttggga 203
           ||||| ||||||||||| ||||| ||  ||||  |||| ||||||||||||||  | |||
Sbjct: 102 atcaaagacaagcttattttccctttcctggagctggatatcaaatactttgatcttgga 161

                                                                       
Query: 204 gttctgcaccgcgatgcaactgatgacaaggttacagtggaggctgcagaggctactctc 263
            | |   ||||||||   |||||||| ||||||||  | ||| |||| || |||||| | 
Sbjct: 162 ctgcctaaccgcgatttcactgatgataaggttactatagagactgctgaagctacttta 221

                                                                       
Query: 264 aagtacaatgtggctattaagtgtgcaactattactccagatgaagatcgggttaaggag 323
           ||||| |||||||||||||||||||| || |||||||| ||||||| ||| |||| ||||
Sbjct: 222 aagtataatgtggctattaagtgtgcgacgattactccggatgaagctcgtgttagggag 281

                                                                       
Query: 324 ttcaacctaaaacaaatgtggaggagcccaaatggcacaattaggaacattataaacggc 383
           |||  | ||||  ||||||||||||| || ||||| || || ||||||||| ||||||||
Sbjct: 282 ttcggcttaaagaaaatgtggaggagtcctaatggaactataaggaacattttaaacggc 341

                                                                       
Query: 384 accgtgttcagagagccaattatatgcaagaatgtcccaaagcttgttccaggatggact 443
           || || ||||| || || || || ||||  ||  ||||    ||||||||||||||||| 
Sbjct: 342 acagttttcagggaacctatcatttgcagaaacatccctcgtcttgttccaggatggacg 401

                                                                       
Query: 444 aagcccatctgcattggaaggcatgctttcggtgatcagtacagagcaactgatgccgtt 503
           ||||| ||||| ||||||||||||||||| ||||||||||| ||||| ||||||  | ||
Sbjct: 402 aagccaatctgtattggaaggcatgcttttggtgatcagtatagagccactgatctcatt 461

                                               
Query: 504 ctcaagggacctggcaaactcagactagtttttgag 539
            |||| | ||| || ||||| | |||||||||||||
Sbjct: 462 gtcaatgaaccaggaaaactgaaactagtttttgag 497



to top

>dbj|AB109114.1| Lupinus albus LaICDH1;2 mRNA for NADP-specific isocitrate
           dehydrogenase, complete cds
          Length = 1583

 Score =  168 bits (85), Expect = 1e-38
 Identities = 337/421 (80%)
 Strand = Plus / Plus

                                                                       
Query: 61  ccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgaga 120
           ||||||| ||| |||||||||| |||||||||||||||||||| |||||||| ||||| |
Sbjct: 41  ccatggcattccagaagatcaacgtcgccaaccccatcgtcgaaatggacggagatgaaa 100

                                                                       
Query: 121 tgaccagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttgg 180
           ||||  ||||  ||||| | || |||||||||||||| || || || || ||||| ||||
Sbjct: 101 tgactcgagttatctggaaatcaatcaaggacaagctcattttgcccttcttggagttgg 160

                                                                       
Query: 181 acatcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacag 240
           ||||||| || | |||| | ||  |||   |||| ||||  || |||||||| || ||||
Sbjct: 161 acatcaagtattatgaccttggccttccttaccgtgatgagacagatgacaaagtcacag 220

                                                                       
Query: 241 tggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactc 300
           | ||   ||| || || ||||| ||||||||||| || || |||||||||||||||||||
Sbjct: 221 ttgaaagtgctgaagcaactctgaagtacaatgtagcaatcaagtgtgcaactattactc 280

                                                                       
Query: 301 cagatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggca 360
           |||||||||  || || ||||||||   ||| || |||||||||| ||| |||||||| |
Sbjct: 281 cagatgaagcccgtgtgaaggagtttggcctgaagcaaatgtggaagagtccaaatggga 340

                                                                       
Query: 361 caattaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtcc 420
           |||| ||||| ||| | ||||| || || |||||||| |||||| | ||||| ||  |||
Sbjct: 341 caatcaggaatattttgaacggaactgttttcagagaaccaattctttgcaaaaacatcc 400

                                                                       
Query: 421 caaagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatc 480
           |    |||||||| || ||||  ||||| || || |||||||| |||||||| |||||||
Sbjct: 401 cccgccttgttcctggttggaacaagccaatatgtattggaagacatgcttttggtgatc 460

            
Query: 481 a 481
           |
Sbjct: 461 a 461



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  149 bits (75), Expect = 1e-32
 Identities = 105/115 (91%)
 Strand = Plus / Minus

                                                                            
Query: 154      agcttatcttcccatttttggacttggacatcaaatactttgacttgggagttctgcacc 213
                |||||||||| |||||||||||  ||||||| || |||| ||||||||||||||| ||||
Sbjct: 26529346 agcttatctttccatttttggatctggacattaagtactatgacttgggagttctccacc 26529287

                                                                       
Query: 214      gcgatgcaactgatgacaaggttacagtggaggctgcagaggctactctcaagta 268
                | |||||||||||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 26529286 gtgatgcaactgatgacaaggtcaccgtggaggctgcagaggctactctcaagta 26529232



 Score =  131 bits (66), Expect = 3e-27
 Identities = 87/94 (92%)
 Strand = Plus / Minus

                                                                            
Query: 432      ccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacagagca 491
                |||||||||||||||||||| |||||||||||||||||||| |||||||||||| |||||
Sbjct: 26528534 ccaggatggactaagcccatttgcattggaaggcatgcttttggtgatcagtaccgagca 26528475

                                                  
Query: 492      actgatgccgttctcaagggacctggcaaactca 525
                |||||||| ||||| ||||| |||||||| ||||
Sbjct: 26528474 actgatgcagttctgaaggggcctggcaagctca 26528441



 Score =  111 bits (56), Expect = 2e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                        
Query: 58       ccgccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggt 113
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 26530285 ccgccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggt 26530230



 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                            
Query: 299      tccagatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatgg 358
                ||||||||| | |||||||||||||||||||||||| |||||||||| |||||| |||||
Sbjct: 26528845 tccagatgaggctcgggttaaggagttcaacctaaagcaaatgtggaagagccccaatgg 26528786

                                  
Query: 359      cacaattaggaacattat 376
                |||||||||||| |||||
Sbjct: 26528785 cacaattaggaatattat 26528768



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                        
Query: 381      ggcaccgtgttcagagagccaattatatgcaagaatgtcccaaagcttgttccagg 436
                ||||| || ||||||||||||||||||||||| |||||||||| ||||||||||||
Sbjct: 26528663 ggcactgtattcagagagccaattatatgcaaaaatgtcccaaggcttgttccagg 26528608



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                         
Query: 58      ccgccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtga 115
               |||||||||||||||||||||||   || ||||||||| |||||||||||||||||||
Sbjct: 8169500 ccgccatggcgttcgagaagatcgtcgtggccaaccccgtcgtcgagatggacggtga 8169557



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                             
Query: 111      ggtgatgagatgaccagagtattctggcagtctatcaaggacaag 155
                |||||||||||||||||  ||||||||||||||||||||||||||
Sbjct: 26529507 ggtgatgagatgaccaggatattctggcagtctatcaaggacaag 26529463



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                      
Query: 266      gtacaatgtggctattaagtgtgcaactattactccag 303
                |||||||||||||||||||||||| || ||||||||||
Sbjct: 26528973 gtacaatgtggctattaagtgtgcgacgattactccag 26528936



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                             
Query: 154     agcttatcttcccatttttggacttggacatcaaatactttgactt 199
               ||||||| ||||| || |||||||||||||| ||||||| ||||||
Sbjct: 8170631 agcttatattccctttcttggacttggacataaaatactatgactt 8170676



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 39       ggcagcgcctccgccgcgaccgcca 63
                |||||||| ||||||||||||||||
Sbjct: 41889389 ggcagcgcgtccgccgcgaccgcca 41889413



to top

>dbj|AP003212.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
            clone:OSJNBa0049H05
          Length = 161934

 Score =  149 bits (75), Expect = 1e-32
 Identities = 105/115 (91%)
 Strand = Plus / Minus

                                                                        
Query: 154  agcttatcttcccatttttggacttggacatcaaatactttgacttgggagttctgcacc 213
            |||||||||| |||||||||||  ||||||| || |||| ||||||||||||||| ||||
Sbjct: 3060 agcttatctttccatttttggatctggacattaagtactatgacttgggagttctccacc 3001

                                                                   
Query: 214  gcgatgcaactgatgacaaggttacagtggaggctgcagaggctactctcaagta 268
            | |||||||||||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 3000 gtgatgcaactgatgacaaggtcaccgtggaggctgcagaggctactctcaagta 2946



 Score =  131 bits (66), Expect = 3e-27
 Identities = 87/94 (92%)
 Strand = Plus / Minus

                                                                        
Query: 432  ccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacagagca 491
            |||||||||||||||||||| |||||||||||||||||||| |||||||||||| |||||
Sbjct: 2248 ccaggatggactaagcccatttgcattggaaggcatgcttttggtgatcagtaccgagca 2189

                                              
Query: 492  actgatgccgttctcaagggacctggcaaactca 525
            |||||||| ||||| ||||| |||||||| ||||
Sbjct: 2188 actgatgcagttctgaaggggcctggcaagctca 2155



 Score =  111 bits (56), Expect = 2e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                    
Query: 58   ccgccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggt 113
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3999 ccgccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggt 3944



 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                        
Query: 299  tccagatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatgg 358
            ||||||||| | |||||||||||||||||||||||| |||||||||| |||||| |||||
Sbjct: 2559 tccagatgaggctcgggttaaggagttcaacctaaagcaaatgtggaagagccccaatgg 2500

                              
Query: 359  cacaattaggaacattat 376
            |||||||||||| |||||
Sbjct: 2499 cacaattaggaatattat 2482



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                    
Query: 381  ggcaccgtgttcagagagccaattatatgcaagaatgtcccaaagcttgttccagg 436
            ||||| || ||||||||||||||||||||||| |||||||||| ||||||||||||
Sbjct: 2377 ggcactgtattcagagagccaattatatgcaaaaatgtcccaaggcttgttccagg 2322



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                         
Query: 111  ggtgatgagatgaccagagtattctggcagtctatcaaggacaag 155
            |||||||||||||||||  ||||||||||||||||||||||||||
Sbjct: 3221 ggtgatgagatgaccaggatattctggcagtctatcaaggacaag 3177



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                  
Query: 266  gtacaatgtggctattaagtgtgcaactattactccag 303
            |||||||||||||||||||||||| || ||||||||||
Sbjct: 2687 gtacaatgtggctattaagtgtgcgacgattactccag 2650



to top

>dbj|AP003709.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:OSJNBb0006H05
          Length = 154821

 Score =  149 bits (75), Expect = 1e-32
 Identities = 105/115 (91%)
 Strand = Plus / Minus

                                                                          
Query: 154    agcttatcttcccatttttggacttggacatcaaatactttgacttgggagttctgcacc 213
              |||||||||| |||||||||||  ||||||| || |||| ||||||||||||||| ||||
Sbjct: 137965 agcttatctttccatttttggatctggacattaagtactatgacttgggagttctccacc 137906

                                                                     
Query: 214    gcgatgcaactgatgacaaggttacagtggaggctgcagaggctactctcaagta 268
              | |||||||||||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 137905 gtgatgcaactgatgacaaggtcaccgtggaggctgcagaggctactctcaagta 137851



 Score =  131 bits (66), Expect = 3e-27
 Identities = 87/94 (92%)
 Strand = Plus / Minus

                                                                          
Query: 432    ccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacagagca 491
              |||||||||||||||||||| |||||||||||||||||||| |||||||||||| |||||
Sbjct: 137153 ccaggatggactaagcccatttgcattggaaggcatgcttttggtgatcagtaccgagca 137094

                                                
Query: 492    actgatgccgttctcaagggacctggcaaactca 525
              |||||||| ||||| ||||| |||||||| ||||
Sbjct: 137093 actgatgcagttctgaaggggcctggcaagctca 137060



 Score =  111 bits (56), Expect = 2e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                      
Query: 58     ccgccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggt 113
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 138904 ccgccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggt 138849



 Score =  107 bits (54), Expect = 4e-20
 Identities = 72/78 (92%)
 Strand = Plus / Minus

                                                                          
Query: 299    tccagatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatgg 358
              ||||||||| | |||||||||||||||||||||||| |||||||||| |||||| |||||
Sbjct: 137464 tccagatgaggctcgggttaaggagttcaacctaaagcaaatgtggaagagccccaatgg 137405

                                
Query: 359    cacaattaggaacattat 376
              |||||||||||| |||||
Sbjct: 137404 cacaattaggaatattat 137387



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                      
Query: 381    ggcaccgtgttcagagagccaattatatgcaagaatgtcccaaagcttgttccagg 436
              ||||| || ||||||||||||||||||||||| |||||||||| ||||||||||||
Sbjct: 137282 ggcactgtattcagagagccaattatatgcaaaaatgtcccaaggcttgttccagg 137227



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                           
Query: 111    ggtgatgagatgaccagagtattctggcagtctatcaaggacaag 155
              |||||||||||||||||  ||||||||||||||||||||||||||
Sbjct: 138126 ggtgatgagatgaccaggatattctggcagtctatcaaggacaag 138082



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                    
Query: 266    gtacaatgtggctattaagtgtgcaactattactccag 303
              |||||||||||||||||||||||| || ||||||||||
Sbjct: 137592 gtacaatgtggctattaagtgtgcgacgattactccag 137555



to top

>emb|X75638.1|STNICD S.tuberosum  mRNA for NADP-dependent isocitrate dehydrogenase
          Length = 1569

 Score =  135 bits (68), Expect = 2e-28
 Identities = 323/408 (79%)
 Strand = Plus / Plus

                                                                       
Query: 90  aaccccatcgtcgagatggacggtgatgagatgaccagagtattctggcagtctatcaag 149
           ||||||||||| ||||||||||| ||||| |||||  ||||  | ||| | |||||||||
Sbjct: 96  aaccccatcgttgagatggacggagatgaaatgacacgagttatttggaaatctatcaag 155

                                                                       
Query: 150 gacaagcttatcttcccatttttggacttggacatcaaatactttgacttgggagttctg 209
           || ||||| ||| | || ||| |||| |||||||| |||||||||  | | ||  |||  
Sbjct: 156 gataagctcatccttccctttctggaattggacataaaatactttagccttggccttccc 215

                                                                       
Query: 210 caccgcgatgcaactgatgacaaggttacagtggaggctgcagaggctactctcaagtac 269
           ||||| ||||| || ||||| ||||||||||| ||   ||| || || ||||  ||||||
Sbjct: 216 caccgtgatgccacagatgataaggttacagttgaaagtgcggaagccactcagaagtac 275

                                                                       
Query: 270 aatgtggctattaagtgtgcaactattactccagatgaagatcgggttaaggagttcaac 329
           || || ||||| ||||||||||| || || |||||||| |  || || |||||||| |||
Sbjct: 276 aacgtagctatcaagtgtgcaaccatcaccccagatgaggcccgtgtaaaggagtttaac 335

                                                                       
Query: 330 ctaaaacaaatgtggaggagcccaaatggcacaattaggaacattataaacggcaccgtg 389
            | |||   |||||||||||||||||||| ||||| || |||||  |||| || || || 
Sbjct: 336 ttgaaatccatgtggaggagcccaaatgggacaatcagaaacatcttaaatggaactgtc 395

                                                                       
Query: 390 ttcagagagccaattatatgcaagaatgtcccaaagcttgttccaggatggactaagccc 449
           || ||||| |||||||| ||||| ||| |||| |  ||||| ||||| |||||||| || 
Sbjct: 396 tttagagaaccaattatgtgcaaaaatatccccagacttgtcccaggttggactaaacca 455

                                                           
Query: 450 atctgcattggaaggcatgctttcggtgatcagtacagagcaactgat 497
           || |||||||| || |||||||| || ||||| ||| |||| ||||||
Sbjct: 456 atttgcattggtagacatgcttttggagatcaataccgagctactgat 503



to top

>dbj|AK072762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023139I05, full
           insert sequence
          Length = 1859

 Score =  135 bits (68), Expect = 2e-28
 Identities = 344/436 (78%)
 Strand = Plus / Plus

                                                                       
Query: 58  ccgccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatg 117
           |||||||||||||||||||||||   || ||||||||| |||||||||||||||||||||
Sbjct: 196 ccgccatggcgttcgagaagatcgtcgtggccaaccccgtcgtcgagatggacggtgatg 255

                                                                       
Query: 118 agatgaccagagtattctggcagtctatcaaggacaagcttatcttcccatttttggact 177
           |||||||  ||||  | ||| | |  ||||| || |||||||| ||||| || |||||||
Sbjct: 256 agatgactcgagttatttggaaatggatcaaagataagcttatattccctttcttggact 315

                                                                       
Query: 178 tggacatcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggtta 237
           ||||||| ||||||| |||||| ||  | |   | || || || ||||  ||||| ||||
Sbjct: 316 tggacataaaatactatgacttaggtctacctaatcgtgacgctactggggacaaagtta 375

                                                                       
Query: 238 cagtggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactatta 297
           || | |||  |||||| || || || ||||| ||||| || || || ||||||||||| |
Sbjct: 376 caatagagagtgcagaagcgaccctaaagtataatgtagccatcaaatgtgcaactataa 435

                                                                       
Query: 298 ctccagatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatg 357
           ||||||||||||  || || || ||||| ||  |||    |||||||| ||| |||||||
Sbjct: 436 ctccagatgaaggacgcgtgaaagagtttaatttaagtgcaatgtggaagagtccaaatg 495

                                                                       
Query: 358 gcacaattaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatg 417
           | ||||| ||||||||| | || || || || ||| |||| ||||| || ||||||||| 
Sbjct: 496 ggacaataaggaacattttgaatggaactgttttccgagaaccaatcatctgcaagaata 555

                                                                       
Query: 418 tcccaaagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtg 477
           | ||   |||||| || || ||||  |||||||| ||||||||| | ||||| || ||||
Sbjct: 556 ttcctcggcttgtacctgggtggataaagcccatatgcattggacgacatgcatttggtg 615

                           
Query: 478 atcagtacagagcaac 493
           |||| ||| |||||||
Sbjct: 616 atcaataccgagcaac 631



to top

>emb|X77944.1|NTNIDH N.tabacum (Xanthi) NADP-dependent Isocitrate dehydrogenase mRNA
          Length = 1584

 Score =  129 bits (65), Expect = 1e-26
 Identities = 326/413 (78%)
 Strand = Plus / Plus

                                                                       
Query: 69  ttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgaccaga 128
           ||||| || |||||||| |  ||||| ||||| ||||||||||| ||||| |||||  | 
Sbjct: 91  ttcgacaaaatcaaggttgaaaaccctatcgttgagatggacggagatgaaatgactcgt 150

                                                                       
Query: 129 gtattctggcagtctatcaaggacaagcttatcttcccatttttggacttggacatcaaa 188
           ||  | ||| | || |||||||| ||||| ||||  || ||| |||| ||||| || |||
Sbjct: 151 gttatttggaaatcgatcaaggataagctcatctgtccttttctggagttggatataaaa 210

                                                                       
Query: 189 tactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacagtggaggct 248
           ||||||||| | ||  ||| |||||| ||||| || || || ||||||||||| ||   |
Sbjct: 211 tactttgaccttggccttccgcaccgtgatgccacagacgataaggttacagttgaaagt 270

                                                                       
Query: 249 gcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactccagatgaa 308
           || || || ||||  || |||||||| ||||||||||||||||| |||||||||||||| 
Sbjct: 271 gcggaagccactcagaaatacaatgtagctattaagtgtgcaaccattactccagatgag 330

                                                                       
Query: 309 gatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggcacaattagg 368
           |  || || || ||||| ||| | |||   |||||||||||||||||||| |||||||| 
Sbjct: 331 gcccgtgtaaaagagtttaacttgaaatccatgtggaggagcccaaatgggacaattaga 390

                                                                       
Query: 369 aacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtcccaaagctt 428
           |||||  |||| || || || |||||||| |||||||| ||||| ||| | ||    |||
Sbjct: 391 aacatcctaaatggaacggtcttcagagaaccaattatgtgcaaaaatattccccgactt 450

                                                                
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatca 481
           || ||||| |||||||| || || |||||||| || |||||||| || |||||
Sbjct: 451 gtcccaggttggactaaaccaatatgcattggtagacatgcttttggagatca 503



to top

>gb|M93672.1|ALFISDHYA Medicago sativa isocitrate dehydrogenase mRNA, 3' end cds
          Length = 1577

 Score =  129 bits (65), Expect = 1e-26
 Identities = 323/409 (78%)
 Strand = Plus / Plus

                                                                       
Query: 73  agaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgaccagagtat 132
           |||| ||||| |||||||| |||||||| ||||||||||| ||||| |||||| |  |  
Sbjct: 76  agaaaatcaaagtcgccaatcccatcgttgagatggacggagatgaaatgacccgtatta 135

                                                                       
Query: 133 tctggcagtctatcaaggacaagcttatcttcccatttttggacttggacatcaaatact 192
           ||||| ||| ||||||||| ||||| || || || ||  |||| ||||||||||| ||||
Sbjct: 136 tctggaagtatatcaaggataagctcatttttcccttcgtggagttggacatcaagtact 195

                                                                       
Query: 193 ttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacagtggaggctgcag 252
           ||||| | ||  |||   | || ||||  ||  |||| || |||||||| |||  |||||
Sbjct: 196 ttgacctaggccttccttatcgtgatgagaccaatgataaagttacagttgagagtgcag 255

                                                                       
Query: 253 aggctactctcaagtacaatgtggctattaagtgtgcaactattactccagatgaagatc 312
           | || || |||||||| ||||| || || |||||||||||||| ||||||||||||| ||
Sbjct: 256 aagcaaccctcaagtataatgtagcaatcaagtgtgcaactatcactccagatgaagctc 315

                                                                       
Query: 313 gggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggcacaattaggaaca 372
           | || ||||||||   ||| ||    ||||||||||| |||||||| ||||| || ||||
Sbjct: 316 gtgtcaaggagtttggcctgaagagtatgtggaggagtccaaatggaacaatcagaaaca 375

                                                                       
Query: 373 ttataaacggcaccgtgttcagagagccaattatatgcaagaatgtcccaaagcttgttc 432
           || | || || || || |||||||| |||||||| ||||| ||  ||||    ||| |||
Sbjct: 376 ttttgaatggaactgtcttcagagaaccaattatttgcaaaaacatccctcgccttattc 435

                                                            
Query: 433 caggatggactaagcccatctgcattggaaggcatgctttcggtgatca 481
           | || ||||| ||||| || || ||||||||||||||||| ||||||||
Sbjct: 436 ctggttggacaaagccaatatgtattggaaggcatgcttttggtgatca 484



to top

>ref|NM_188785.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1227

 Score =  125 bits (63), Expect = 2e-25
 Identities = 339/431 (78%)
 Strand = Plus / Plus

                                                                       
Query: 63  atggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatg 122
           ||||||||||||||||||   || ||||||||| ||||||||||||||||||||||||||
Sbjct: 1   atggcgttcgagaagatcgtcgtggccaaccccgtcgtcgagatggacggtgatgagatg 60

                                                                       
Query: 123 accagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttggac 182
           ||  ||||  | ||| | |  ||||| || |||||||| ||||| || ||||||||||||
Sbjct: 61  actcgagttatttggaaatggatcaaagataagcttatattccctttcttggacttggac 120

                                                                       
Query: 183 atcaaatactttgacttgggagttctgcaccgcgatgcaactgatgacaaggttacagtg 242
           || ||||||| |||||| ||  | |   | || || || ||||  ||||| |||||| | 
Sbjct: 121 ataaaatactatgacttaggtctacctaatcgtgacgctactggggacaaagttacaata 180

                                                                       
Query: 243 gaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactcca 302
           |||  |||||| || || || ||||| ||||| || || || ||||||||||| ||||||
Sbjct: 181 gagagtgcagaagcgaccctaaagtataatgtagccatcaaatgtgcaactataactcca 240

                                                                       
Query: 303 gatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggcaca 362
           |||||||  || || || ||||| ||  |||    |||||||| ||| |||||||| |||
Sbjct: 241 gatgaaggacgcgtgaaagagtttaatttaagtgcaatgtggaagagtccaaatgggaca 300

                                                                       
Query: 363 attaggaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtccca 422
           || ||||||||| | || || || || ||| |||| ||||| || ||||||||| | || 
Sbjct: 301 ataaggaacattttgaatggaactgttttccgagaaccaatcatctgcaagaatattcct 360

                                                                       
Query: 423 aagcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcag 482
             |||||| || || ||||  |||||||| ||||||||| | ||||| || |||||||| 
Sbjct: 361 cggcttgtacctgggtggataaagcccatatgcattggacgacatgcatttggtgatcaa 420

                      
Query: 483 tacagagcaac 493
           ||| |||||||
Sbjct: 421 taccgagcaac 431



to top

>gb|AF095445.1|AF095445 Glycine max NADP-dependent isocitrate dehydrogenase (IDH1) mRNA,
           complete cds
          Length = 1827

 Score =  123 bits (62), Expect = 6e-25
 Identities = 179/218 (82%)
 Strand = Plus / Plus

                                                                       
Query: 255 gctactctcaagtacaatgtggctattaagtgtgcaactattactccagatgaagatcgg 314
           ||||| |||||||| ||||| ||||| || ||||| ||||| ||||||||||||| ||| 
Sbjct: 481 gctacactcaagtataatgtagctatcaaatgtgctactataactccagatgaagctcgt 540

                                                                       
Query: 315 gttaaggagttcaacctaaaacaaatgtggaggagcccaaatggcacaattaggaacatt 374
           || |||||||| ||| |||||||||||||||| || |||||||| || ||  | ||||||
Sbjct: 541 gtcaaggagtttaacttaaaacaaatgtggagaagtccaaatgggacgatccgaaacatt 600

                                                                       
Query: 375 ataaacggcaccgtgttcagagagccaattatatgcaagaatgtcccaaagcttgttcca 434
            |||| || || || || |||||||||||||| || |||||  | ||    |||||| ||
Sbjct: 601 ttaaatggtacagtttttagagagccaattatctgtaagaacattcctcgtcttgtttca 660

                                                 
Query: 435 ggatggactaagcccatctgcattggaaggcatgcttt 472
           |||||||| ||||| || ||||||||||| ||||||||
Sbjct: 661 ggatggacaaagccaatatgcattggaagacatgcttt 698



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 89  caaccccatcgtcgagatggacggtgatgagatgaccagagt 130
           ||||||||||||||| ||||| || ||||| |||||| ||||
Sbjct: 315 caaccccatcgtcgaaatggatggggatgaaatgacccgagt 356



to top

>gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1735_C10,
              complete sequence
          Length = 187034

 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Plus

                                                                          
Query: 433    caggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacagagcaa 492
              ||||||||||||||||||| |||||||||||||| || || |||||||||||| | ||||
Sbjct: 112902 caggatggactaagcccatttgcattggaaggcacgcatttggtgatcagtaccgtgcaa 112961

                                          
Query: 493    ctgatgccgttctcaagggacctggcaa 520
              | ||||| ||| ||||||||||||||||
Sbjct: 112962 cggatgcagttatcaagggacctggcaa 112989



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 38/39 (97%)
 Strand = Plus / Plus

                                                     
Query: 75     aagatcaaggtcgccaaccccatcgtcgagatggacggt 113
              ||||||||||||||||||||||| |||||||||||||||
Sbjct: 111582 aagatcaaggtcgccaaccccattgtcgagatggacggt 111620



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                           
Query: 111    ggtgatgagatgaccagagtattctggcagtctatcaaggacaag 155
              ||||||||||||||  ||||||||||| | |||||||||||||||
Sbjct: 111940 ggtgatgagatgactcgagtattctggaaatctatcaaggacaag 111984



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                     
Query: 313    gggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggcacaattag 367
              ||||||| ||||||| |||||||   ||||||| ||||||||| |||||||||||
Sbjct: 112622 gggttaaagagttcagcctaaaatccatgtggaagagcccaaacggcacaattag 112676



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 93/115 (80%)
 Strand = Plus / Plus

                                                                          
Query: 154    agcttatcttcccatttttggacttggacatcaaatactttgacttgggagttctgcacc 213
              ||||||||||||| || ||||| |||||||| || ||||||||  | ||| |||   |||
Sbjct: 112092 agcttatcttcccgttcttggagttggacattaagtactttgatctcggacttccatacc 112151

                                                                     
Query: 214    gcgatgcaactgatgacaaggttacagtggaggctgcagaggctactctcaagta 268
              | |||  ||| || || || || ||||||||||| ||||||||||| ||||||||
Sbjct: 112152 gtgatcaaaccgacgataaagtcacagtggaggcagcagaggctaccctcaagta 112206



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 266    gtacaatgtggctattaagtgtgcaactattactccag 303
              |||||||||||| || ||||||||||| ||||| ||||
Sbjct: 112492 gtacaatgtggccatcaagtgtgcaaccattacaccag 112529



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  103 bits (52), Expect = 6e-19
 Identities = 79/88 (89%)
 Strand = Plus / Plus

                                                                            
Query: 433      caggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacagagcaa 492
                ||||||||||||||||||| |||||||||||||| || || |||||||||||| | ||||
Sbjct: 28328660 caggatggactaagcccatttgcattggaaggcacgcatttggtgatcagtaccgtgcaa 28328719

                                            
Query: 493      ctgatgccgttctcaagggacctggcaa 520
                | ||||| ||| ||||||||||||||||
Sbjct: 28328720 cggatgcagttatcaagggacctggcaa 28328747



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 38/39 (97%)
 Strand = Plus / Plus

                                                       
Query: 75       aagatcaaggtcgccaaccccatcgtcgagatggacggt 113
                ||||||||||||||||||||||| |||||||||||||||
Sbjct: 28327340 aagatcaaggtcgccaaccccattgtcgagatggacggt 28327378



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                             
Query: 111      ggtgatgagatgaccagagtattctggcagtctatcaaggacaag 155
                ||||||||||||||  ||||||||||| | |||||||||||||||
Sbjct: 28327698 ggtgatgagatgactcgagtattctggaaatctatcaaggacaag 28327742



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                       
Query: 313      gggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggcacaattag 367
                ||||||| ||||||| |||||||   ||||||| ||||||||| |||||||||||
Sbjct: 28328380 gggttaaagagttcagcctaaaatccatgtggaagagcccaaacggcacaattag 28328434



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 93/115 (80%)
 Strand = Plus / Plus

                                                                            
Query: 154      agcttatcttcccatttttggacttggacatcaaatactttgacttgggagttctgcacc 213
                ||||||||||||| || ||||| |||||||| || ||||||||  | ||| |||   |||
Sbjct: 28327850 agcttatcttcccgttcttggagttggacattaagtactttgatctcggacttccatacc 28327909

                                                                       
Query: 214      gcgatgcaactgatgacaaggttacagtggaggctgcagaggctactctcaagta 268
                | |||  ||| || || || || ||||||||||| ||||||||||| ||||||||
Sbjct: 28327910 gtgatcaaaccgacgataaagtcacagtggaggcagcagaggctaccctcaagta 28327964



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                      
Query: 266      gtacaatgtggctattaagtgtgcaactattactccag 303
                |||||||||||| || ||||||||||| ||||| ||||
Sbjct: 28328250 gtacaatgtggccatcaagtgtgcaaccattacaccag 28328287



to top

>dbj|AB109113.1| Lupinus albus LaICDH1;1 mRNA for NADP-specific isocitrate
           dehydrogenase, complete cds
          Length = 1627

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 180/224 (80%)
 Strand = Plus / Plus

                                                                       
Query: 258 actctcaagtacaatgtggctattaagtgtgcaactattactccagatgaagatcgggtt 317
           ||||| ||||| ||||| || || |||||||||||||||||||||||||| |  || || 
Sbjct: 274 actctgaagtataatgtagcaatcaagtgtgcaactattactccagatgagggccgtgtg 333

                                                                       
Query: 318 aaggagttcaacctaaaacaaatgtggaggagcccaaatggcacaattaggaacattata 377
           ||||| ||   ||| || |||||||||||||| |||||||| ||||||||||||||| | 
Sbjct: 334 aaggaatttggcctgaagcaaatgtggaggagtccaaatgggacaattaggaacattttg 393

                                                                       
Query: 378 aacggcaccgtgttcagagagccaattatatgcaagaatgtcccaaagcttgttccagga 437
           || || || || |||||||| |||||| | ||||| ||  ||||    ||| |||| || 
Sbjct: 394 aatggaactgttttcagagaaccaattctttgcaaaaacatcccccgccttcttcctggc 453

                                                       
Query: 438 tggactaagcccatctgcattggaaggcatgctttcggtgatca 481
           ||||  ||||| || || |||||||| |||||||| ||||||||
Sbjct: 454 tggaacaagccaatatgtattggaagacatgcttttggtgatca 497



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                       
Query: 60  gccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgag 119
           |||||||| ||| |||||||||| |||||||| |||||||| ||||||||||| ||||| 
Sbjct: 76  gccatggcattccagaagatcaacgtcgccaatcccatcgttgagatggacggagatgaa 135

                                                                       
Query: 120 atgaccagagtattctggcagtctatcaaggacaagcttatcttcccatttttggacttg 179
           |||||  ||||  ||||| | || |||||||| ||||| || || || || ||||| |||
Sbjct: 136 atgactcgagttatctggaaatcaatcaaggataagctcatttttcccttcttggagttg 195

                   
Query: 180 gacatcaa 187
           ||||||||
Sbjct: 196 gacatcaa 203



to top

>gb|AC009513.2|F12P19 Sequence of BAC F12P19 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 81490

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                         
Query: 438   tggactaagcccatctgcattggaaggcatgctttcggtgatcagtacagagcaactgat 497
             ||||| ||||||||||||||||||||||||||||| |||||||||||| | || ||||||
Sbjct: 45602 tggacaaagcccatctgcattggaaggcatgcttttggtgatcagtaccgtgccactgat 45661

                                       
Query: 498   gccgttctcaagggacctggcaaact 523
             || ||  |||||||||| || |||||
Sbjct: 45662 gctgtaatcaagggaccaggaaaact 45687



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                    
Query: 61    ccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtga 115
             |||||||||| |||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 44447 ccatggcgtttgagaagatcaaggtggcaaatcccatcgtcgagatggatggtga 44501



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 393   agagagccaattatatgcaagaatgtcccaaagcttgttccagg 436
             |||||||||||||| ||||| ||||| || |||||||| |||||
Sbjct: 45479 agagagccaattatctgcaaaaatgttcccaagcttgtcccagg 45522



to top

>ref|NM_121463.3| Arabidopsis thaliana isocitrate dehydrogenase (NADP+)/
           oxidoreductase AT5G14590 mRNA, complete cds
          Length = 1801

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 113/136 (83%)
 Strand = Plus / Plus

                                                                       
Query: 172 tggacttggacatcaaatactttgacttgggagttctgcaccgcgatgcaactgatgaca 231
           |||| |||||||| || ||||| ||||||||  ||||| | |||||||| ||||||||||
Sbjct: 428 tggatttggacattaagtacttcgacttggggattctgaatcgcgatgctactgatgaca 487

                                                                       
Query: 232 aggttacagtggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaa 291
           |||||||||| ||   |||||| ||  |||| ||||||||||| ||||| || ||||| |
Sbjct: 488 aggttacagttgaaagtgcagaagcagctcttaagtacaatgttgctatcaaatgtgcca 547

                           
Query: 292 ctattactccagatga 307
           |||| ||||| |||||
Sbjct: 548 ctataactcctgatga 563



to top

>gb|BT000276.1| Arabidopsis thaliana isocitrate dehydrogenase-like protein
           (At5g14590) mRNA, complete cds
          Length = 1514

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 113/136 (83%)
 Strand = Plus / Plus

                                                                       
Query: 172 tggacttggacatcaaatactttgacttgggagttctgcaccgcgatgcaactgatgaca 231
           |||| |||||||| || ||||| ||||||||  ||||| | |||||||| ||||||||||
Sbjct: 320 tggatttggacattaagtacttcgacttggggattctgaatcgcgatgctactgatgaca 379

                                                                       
Query: 232 aggttacagtggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaa 291
           |||||||||| ||   |||||| ||  |||| ||||||||||| ||||| || ||||| |
Sbjct: 380 aggttacagttgaaagtgcagaagcagctcttaagtacaatgttgctatcaaatgtgcca 439

                           
Query: 292 ctattactccagatga 307
           |||| ||||| |||||
Sbjct: 440 ctataactcctgatga 455



to top

>gb|AY099683.1| Arabidopsis thaliana isocitrate dehydrogenase-like protein
           (At5g14590) mRNA, complete cds
          Length = 1722

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 113/136 (83%)
 Strand = Plus / Plus

                                                                       
Query: 172 tggacttggacatcaaatactttgacttgggagttctgcaccgcgatgcaactgatgaca 231
           |||| |||||||| || ||||| ||||||||  ||||| | |||||||| ||||||||||
Sbjct: 425 tggatttggacattaagtacttcgacttggggattctgaatcgcgatgctactgatgaca 484

                                                                       
Query: 232 aggttacagtggaggctgcagaggctactctcaagtacaatgtggctattaagtgtgcaa 291
           |||||||||| ||   |||||| ||  |||| ||||||||||| ||||| || ||||| |
Sbjct: 485 aggttacagttgaaagtgcagaagcagctcttaagtacaatgttgctatcaaatgtgcca 544

                           
Query: 292 ctattactccagatga 307
           |||| ||||| |||||
Sbjct: 545 ctataactcctgatga 560



to top

>gb|AF173666.1|AF173666 Beta vulgaris clone ISORT isocitrate dehydrogenase (Icdh) mRNA,
           partial cds
          Length = 720

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 189/238 (79%)
 Strand = Plus / Plus

                                                                       
Query: 248 tgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactccagatga 307
           |||||| ||||| |||||||| || || || ||||| |||||||| || || ||||||||
Sbjct: 152 tgcagaagctacactcaagtataacgttgcaattaaatgtgcaaccatcacaccagatga 211

                                                                       
Query: 308 agatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggcacaattag 367
           ||  || |||||||| |||||| | || || ||||||||||| |||||||| || ||  |
Sbjct: 212 aggccgtgttaaggaattcaacttgaagcagatgtggaggagtccaaatggaactatccg 271

                                                                       
Query: 368 gaacattataaacggcaccgtgttcagagagccaattatatgcaagaatgtcccaaagct 427
            |||||  | || ||||| || ||||| || || || || |||   || || || |||||
Sbjct: 272 aaacatccttaatggcacggtcttcagggaaccgataatctgccgaaacgttcccaagct 331

                                                                     
Query: 428 tgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtac 485
           ||||||||| ||||| || || |||||||| || || |||||||| ||||||||||||
Sbjct: 332 tgttccaggttggacaaaaccaatctgcatagggagacatgcttttggtgatcagtac 389



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 97  tcgtcgagatggacggtgatgagatgaccagagt 130
           |||||||||||||||| ||||| ||||| |||||
Sbjct: 1   tcgtcgagatggacggagatgaaatgactagagt 34



to top

>gb|AC005287.4| Arabidopsis thaliana chromosome I BAC F20D21 genomic sequence, complete
             sequence
          Length = 143186

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                         
Query: 433   caggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacagagcaa 492
             |||||||||| ||||| ||||| ||||||||||||||||| ||||||||||| ||||| |
Sbjct: 56079 caggatggacgaagccaatctgtattggaaggcatgcttttggtgatcagtatagagcca 56138

                  
Query: 493   ctgat 497
             |||||
Sbjct: 56139 ctgat 56143



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Plus

                                                                         
Query: 301   cagatgaagatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatggca 360
             ||||||||| ||| |||| |||||||  | ||||  ||||||||||||| || ||||| |
Sbjct: 55774 cagatgaagctcgtgttagggagttcggcttaaagaaaatgtggaggagtcctaatggaa 55833

                                   
Query: 361   caattaggaacattataaacgg 382
             | || ||||||||| |||||||
Sbjct: 55834 ctataaggaacattttaaacgg 55855



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 270   aatgtggctattaagtgtgcaactattactcc 301
             |||||||||||||||||||| || ||||||||
Sbjct: 55658 aatgtggctattaagtgtgcgacgattactcc 55689



to top

>dbj|AP004491.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT17G08, TM0023,
             complete sequence
          Length = 91039

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                  
Query: 61    ccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggt 113
             ||||||| ||||| |||||||||||||||||||||||||| ||||||||||||
Sbjct: 18166 ccatggctttcgacaagatcaaggtcgccaaccccatcgttgagatggacggt 18114



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                
Query: 336   caaatgtggaggagcccaaatggcacaattaggaa 370
             |||||||||||||| |||||||| |||||||||||
Sbjct: 16750 caaatgtggaggagtccaaatgggacaattaggaa 16716



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 178   tggacatcaaatactttgacttggg 202
             |||||||||| ||||||||||||||
Sbjct: 17203 tggacatcaagtactttgacttggg 17179



to top

>ref|XM_963757.1| PREDICTED: Tribolium castaneum similar to CG7176-PC, isoform C
           (LOC657289), mRNA
          Length = 1589

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 93/111 (83%)
 Strand = Plus / Plus

                                                                       
Query: 264 aagtacaatgtggctattaagtgtgcaactattactccagatgaagatcgggttaaggag 323
           ||||||||||| |  ||||| ||||| |||||||| || |||||  |  ||||| |||||
Sbjct: 437 aagtacaatgttggaattaaatgtgccactattacgcccgatgagaagagggttgaggag 496

                                                              
Query: 324 ttcaacctaaaacaaatgtggaggagcccaaatggcacaattaggaacatt 374
           |||||| | ||||||||||||| ||||||||| ||||| ||||| ||||||
Sbjct: 497 ttcaacttgaaacaaatgtggaagagcccaaacggcaccattagaaacatt 547



to top

>gb|AC007789.1| Oryza sativa BAC OSJNBa0049B20 genomic sequence, complete sequence
          Length = 182756

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                        
Query: 58     ccgccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtga 115
              |||||||||||||||||||||||   || ||||||||| |||||||||||||||||||
Sbjct: 133621 ccgccatggcgttcgagaagatcgtcgtggccaaccccgtcgtcgagatggacggtga 133678



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                            
Query: 154    agcttatcttcccatttttggacttggacatcaaatactttgactt 199
              ||||||| ||||| || |||||||||||||| ||||||| ||||||
Sbjct: 134752 agcttatattccctttcttggacttggacataaaatactatgactt 134797



to top

>dbj|AP002865.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0034C11
          Length = 139399

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                       
Query: 58    ccgccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtga 115
             |||||||||||||||||||||||   || ||||||||| |||||||||||||||||||
Sbjct: 87218 ccgccatggcgttcgagaagatcgtcgtggccaaccccgtcgtcgagatggacggtga 87275



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                           
Query: 154   agcttatcttcccatttttggacttggacatcaaatactttgactt 199
             ||||||| ||||| || |||||||||||||| ||||||| ||||||
Sbjct: 88349 agcttatattccctttcttggacttggacataaaatactatgactt 88394



to top

>dbj|AB019328.1| Daucus carota mRNA for NADP specific isocitrate dehydrogenase,
           complete cds
          Length = 1488

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 248 tgcagaggctactctcaagtacaatgtggctattaagtgtgcaactattactccagatga 307
           |||||| || ||||| ||||||||||| || ||||||||||||||||| || ||||||||
Sbjct: 276 tgcagaagccactcttaagtacaatgtagcaattaagtgtgcaactatcacaccagatga 335

                                                 
Query: 308 agatcgggttaaggagttcaacctaaaacaaatgtgga 345
           |  |||  | |||||||||||| |||| || |||||||
Sbjct: 336 aactcgtctcaaggagttcaacttaaagcagatgtgga 373



to top

>gb|AC132565.28| Medicago truncatula clone mth2-4a8, complete sequence
          Length = 134155

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                     
Query: 318   aaggagttcaacctaaaacaaatgtggaggagcccaaatggcacaattaggaacat 373
             |||||||| ||||||||||||||||||| |||||||||||| |||||  |||||||
Sbjct: 28722 aaggagtttaacctaaaacaaatgtggaagagcccaaatgggacaatccggaacat 28777



to top

>ref|XM_473117.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1407

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                          
Query: 78  atcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgac 124
           |||||||||  ||||||||||||||||||||||||||| ||||||||
Sbjct: 178 atcaaggtccacaaccccatcgtcgagatggacggtgacgagatgac 224



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 93/115 (80%)
 Strand = Plus / Plus

                                                                       
Query: 265 agtacaatgtggctattaagtgtgcaactattactccagatgaagatcgggttaaggagt 324
           |||| ||||| ||| |||||||||| || ||||| || ||||||    | ||||| ||||
Sbjct: 365 agtataatgttgctgttaagtgtgctaccattacacctgatgaaacaagagttaaagagt 424

                                                                  
Query: 325 tcaacctaaaacaaatgtggaggagcccaaatggcacaattaggaacattataaa 379
           |||| || ||   |||||||||||||||||||||||| || ||||| ||| ||||
Sbjct: 425 tcaaactcaagtcaatgtggaggagcccaaatggcaccatcaggaatattctaaa 479



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 444 aagcccatctgcattggaaggcatgc 469
           |||||||| |||||||||||||||||
Sbjct: 544 aagcccatttgcattggaaggcatgc 569



to top

>dbj|AK107325.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-126-E10, full
           insert sequence
          Length = 1434

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 75  aagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||||||||||||||| |||||||| | ||||| ||||||||||||
Sbjct: 110 aagatcaaggtcgccaaccccgtcgtcgagctcgacggcgatgagatgacc 160



to top

>dbj|AK070042.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023038I06, full
           insert sequence
          Length = 1765

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                          
Query: 78  atcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgac 124
           |||||||||  ||||||||||||||||||||||||||| ||||||||
Sbjct: 260 atcaaggtccacaaccccatcgtcgagatggacggtgacgagatgac 306



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 93/115 (80%)
 Strand = Plus / Plus

                                                                       
Query: 265 agtacaatgtggctattaagtgtgcaactattactccagatgaagatcgggttaaggagt 324
           |||| ||||| ||| |||||||||| || ||||| || ||||||    | ||||| ||||
Sbjct: 447 agtataatgttgctgttaagtgtgctaccattacacctgatgaaacaagagttaaagagt 506

                                                                  
Query: 325 tcaacctaaaacaaatgtggaggagcccaaatggcacaattaggaacattataaa 379
           |||| || ||   |||||||||||||||||||||||| || ||||| ||| ||||
Sbjct: 507 tcaaactcaagtcaatgtggaggagcccaaatggcaccatcaggaatattctaaa 561



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 444 aagcccatctgcattggaaggcatgc 469
           |||||||| |||||||||||||||||
Sbjct: 626 aagcccatttgcattggaaggcatgc 651



to top

>emb|AL163792.1|ATT15N1 Arabidopsis thaliana DNA chromosome 5, BAC clone T15N1 (ESSA project)
          Length = 86574

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 61/70 (87%)
 Strand = Plus / Minus

                                                                         
Query: 172   tggacttggacatcaaatactttgacttgggagttctgcaccgcgatgcaactgatgaca 231
             |||| |||||||| || ||||| ||||||||  ||||| | |||||||| ||||||||||
Sbjct: 42987 tggatttggacattaagtacttcgacttggggattctgaatcgcgatgctactgatgaca 42928

                       
Query: 232   aggttacagt 241
             ||||||||||
Sbjct: 42927 aggttacagt 42918



to top

>emb|Y16751.1|PSP16751 Piromyces sp. E2 mRNA for isocitrate dehydrogenase (NADP+)
          Length = 862

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 276 gctattaagtgtgcaactattactccagatgaagatcgggttaaggagttcaacct 331
           |||||||||||||| |||||||| ||||||||||  || |||||||| ||||||||
Sbjct: 158 gctattaagtgtgccactattaccccagatgaagcccgtgttaaggaattcaacct 213



to top

>gb|BT016882.1| Zea mays clone Contig715 mRNA sequence
          Length = 1851

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 90   aaccccatcgtcgagatggacggtgatgagatgac 124
            ||||||||||||||||||||||| |||||||||||
Sbjct: 1477 aaccccatcgtcgagatggacggggatgagatgac 1443



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 339  atgtggaggagcccaaatggcacaattaggaacattataaa 379
            |||||| |||| |||||||||||||| ||||| ||| ||||
Sbjct: 1228 atgtggcggagtccaaatggcacaataaggaatattctaaa 1188



to top

>ref|XM_504978.1| Yarrowia lipolytica CLIB122, YALI0F04095g predicted mRNA
          Length = 1323

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 75  aagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgaccagagtattc 134
           ||||||||||||   |||||||| |||||| | || ||||||||||||||| || |  ||
Sbjct: 106 aagatcaaggtcaagaaccccattgtcgagctcgatggtgatgagatgacccgaatcatc 165

                                  
Query: 135 tggcagtctatcaaggacaagct 157
           ||| |||| ||||||||||||||
Sbjct: 166 tggaagtccatcaaggacaagct 188



to top

>gb|AF367449.1| Prunus persica clone Icdh2 NADP-dependent isocitrate dehydrogenase
           (icdh2) mRNA, partial cds
          Length = 396

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 453 tgcattggaaggcatgctttcggtgatcagtacagagcaactgatgc 499
           |||||||| ||||||||||| ||||| |||||| |||||||||||||
Sbjct: 25  tgcattgggaggcatgcttttggtgaccagtaccgagcaactgatgc 71



to top

>gb|AF457967.1| Zea mays clone bms1.pk0003.f5, mRNA sequence
          Length = 482

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                              
Query: 90  aaccccatcgtcgagatggacggtgatgagatgac 124
           ||||||||||||||||||||||| |||||||||||
Sbjct: 4   aaccccatcgtcgagatggacggggatgagatgac 38



to top

>gb|AY104847.1| Zea mays PCO066525 mRNA sequence
          Length = 1776

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                              
Query: 90  aaccccatcgtcgagatggacggtgatgagatgac 124
           ||||||||||||||||||||||| |||||||||||
Sbjct: 313 aaccccatcgtcgagatggacggggatgagatgac 347



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 339 atgtggaggagcccaaatggcacaattaggaacattataaa 379
           |||||| |||| |||||||||||||| ||||| ||| ||||
Sbjct: 562 atgtggcggagtccaaatggcacaataaggaatattctaaa 602



to top

>dbj|AK116068.1| Ciona intestinalis cDNA, clone:citb006p20, full insert sequence
          Length = 1825

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 267 tacaatgtggctattaagtgtgcaactattactccagatgaagatcgggttaaggagttc 326
           |||||||| ||| | || ||||||||||||||||| ||||||||  | |||  |||||||
Sbjct: 449 tacaatgttgctgtaaaatgtgcaactattactcctgatgaagacagagttgtggagttc 508

                              
Query: 327 aacctaaaacaaatgtgga 345
           ||| | |||||||||||||
Sbjct: 509 aacttgaaacaaatgtgga 527



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                          
Query: 75     aagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgaccagagtattc 134
              ||||||||||||   |||||||| |||||| | || ||||||||||||||| || |  ||
Sbjct: 619630 aagatcaaggtcaagaaccccattgtcgagctcgatggtgatgagatgacccgaatcatc 619571

                                     
Query: 135    tggcagtctatcaaggacaagct 157
              ||| |||| ||||||||||||||
Sbjct: 619570 tggaagtccatcaaggacaagct 619548



to top

>gb|AY730588.2| Pisum sativum NADP-dependent isocitrate dehydrogenase I gene,
            complete cds
          Length = 4004

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 72/86 (83%)
 Strand = Plus / Plus

                                                                        
Query: 432  ccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacagagca 491
            ||||| ||||| ||||| || || ||||||||||||||||| |||||||| || || || 
Sbjct: 1797 ccaggttggacaaagccaatatgtattggaaggcatgcttttggtgatcaatatagggcc 1856

                                      
Query: 492  actgatgccgttctcaagggacctgg 517
            |||||||| ||| | || ||||||||
Sbjct: 1857 actgatgcagttattaaaggacctgg 1882



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 61  ccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggt 113
           ||||||| ||| |||| ||||| |||||||  |||||||| ||||||||||||
Sbjct: 77  ccatggcattccagaaaatcaaagtcgccagtcccatcgttgagatggacggt 129



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                
Query: 339  atgtggaggagcccaaatggcacaattaggaacatt 374
            ||||||||||| |||||||| |||||||| ||||||
Sbjct: 1475 atgtggaggagtccaaatgggacaattagaaacatt 1510



to top

>ref|XM_655511.1| Aspergillus nidulans FGSC A4 isocitrate dehydrogenase (AN2999.2),
           mRNA
          Length = 1476

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 73  agaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||||||||   |||||| |||| ||| ||||||||||||||||||||
Sbjct: 257 agaagatcaaggtcaagaaccccgtcgtggagttggacggtgatgagatgacc 309



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 435 ggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtac 485
           ||||||||||||||||||  ||| ||  | |||||||||||||| ||||||
Sbjct: 613 ggatggactaagcccatcatcatcggtcgtcatgctttcggtgaccagtac 663



to top

>emb|Z68343.1|CEF59B8 Caenorhabditis elegans Cosmid F59B8, complete sequence
          Length = 11827

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 71/85 (83%)
 Strand = Plus / Minus

                                                                        
Query: 261  ctcaagtacaatgtggctattaagtgtgcaactattactccagatgaagatcgggttaag 320
            |||||||||||||| ||| |||||||||| || || ||||||||||| | ||| ||  ||
Sbjct: 8868 ctcaagtacaatgttgctgttaagtgtgccaccatcactccagatgaggctcgtgtcgag 8809

                                     
Query: 321  gagttcaacctaaaacaaatgtgga 345
            |||||||| || ||  |||||||||
Sbjct: 8808 gagttcaagctcaagaaaatgtgga 8784



to top

>emb|AL662969.3|OSJN00169 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0043L24,
             complete sequence
          Length = 164577

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                  
Query: 78    atcaaggtcgccaaccccatcgtcgagatggacggtg 114
             |||||||||  ||||||||||||||||||||||||||
Sbjct: 89895 atcaaggtccacaaccccatcgtcgagatggacggtg 89931



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                       
Query: 338   aatgtggaggagcccaaatggcacaattaggaacattataaa 379
             |||||||||||||||||||||||| || ||||| ||| ||||
Sbjct: 92062 aatgtggaggagcccaaatggcaccatcaggaatattctaaa 92103



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 444   aagcccatctgcattggaaggcatgc 469
             |||||||| |||||||||||||||||
Sbjct: 92654 aagcccatttgcattggaaggcatgc 92679



to top

>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Plus

                                                                           
Query: 89      caaccccatcgtcgagatggacggtgatgagatgaccagagtattctggcagtctatcaa 148
               ||||||||| |||||||||||||| || ||||||||| |  |  |||||||||  |||||
Sbjct: 2377764 caaccccattgtcgagatggacggcgacgagatgacccgcatcatctggcagttcatcaa 2377823

                        
Query: 149     ggacaagct 157
               |||||||||
Sbjct: 2377824 ggacaagct 2377832



to top

>ref|NM_069264.3| Caenorhabditis elegans F59B8.2 (F59B8.2) mRNA, complete cds
          Length = 1438

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 71/85 (83%)
 Strand = Plus / Plus

                                                                       
Query: 261 ctcaagtacaatgtggctattaagtgtgcaactattactccagatgaagatcgggttaag 320
           |||||||||||||| ||| |||||||||| || || ||||||||||| | ||| ||  ||
Sbjct: 219 ctcaagtacaatgttgctgttaagtgtgccaccatcactccagatgaggctcgtgtcgag 278

                                    
Query: 321 gagttcaacctaaaacaaatgtgga 345
           |||||||| || ||  |||||||||
Sbjct: 279 gagttcaagctcaagaaaatgtgga 303



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                     
Query: 78       atcaaggtcgccaaccccatcgtcgagatggacggtg 114
                |||||||||  ||||||||||||||||||||||||||
Sbjct: 25363336 atcaaggtccacaaccccatcgtcgagatggacggtg 25363372



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                          
Query: 338      aatgtggaggagcccaaatggcacaattaggaacattataaa 379
                |||||||||||||||||||||||| || ||||| ||| ||||
Sbjct: 25365503 aatgtggaggagcccaaatggcaccatcaggaatattctaaa 25365544



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 444      aagcccatctgcattggaaggcatgc 469
                |||||||| |||||||||||||||||
Sbjct: 25366095 aagcccatttgcattggaaggcatgc 25366120



to top

>ref|XM_312860.2| Anopheles gambiae str. PEST ENSANGP00000016660
           (ENSANGG00000014171), partial mRNA
          Length = 1221

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 102 gagatggacggtgatgagatgaccagagtattctggcagtctatcaaggacaagcttatc 161
           |||||||||||||||||||||||| |  |  |||||||||  |||||||| ||||| |||
Sbjct: 31  gagatggacggtgatgagatgacccgcatcatctggcagttcatcaaggataagctgatc 90

                
Query: 162 ttccc 166
           |||||
Sbjct: 91  ttccc 95



to top

>dbj|AK107792.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-133-D06, full
           insert sequence
          Length = 703

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 78  atcaaggtcgccaaccccatcgtcgagatggacggtg 114
           |||||||||  ||||||||||||||||||||||||||
Sbjct: 120 atcaaggtccacaaccccatcgtcgagatggacggtg 84



to top

>gb|M86719.1|PIGMTNADP Pig mitochondrial NADP-isocitrate dehydrogenase mRNA, 3' end
          Length = 1585

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 102 gagatggacggtgatgagatgaccagagtattctggcagtctatcaaggacaagct 157
           |||||||||||||||||||||||| || |  |||||||||  |||||||| |||||
Sbjct: 63  gagatggacggtgatgagatgacccgaatcatctggcagttcatcaaggagaagct 118



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                          
Query: 75     aagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgaccagagtattc 134
              |||||||| ||||| ||||| ||||||||| ||||||| || ||||||||| |  |  ||
Sbjct: 656086 aagatcaaagtcgcaaacccgatcgtcgagctggacggcgacgagatgacccggatcatc 656145

                                     
Query: 135    tggcagtctatcaaggacaagct 157
              ||| |||  ||||||||||||||
Sbjct: 656146 tggaagttcatcaaggacaagct 656168



to top

>gb|AY617794.1| Sterkiella histriomuscorum clone UGC1O0005_K08_R genomic sequence
          Length = 643

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 75  aagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgaccaga 128
           ||||||||||||| ||||||  | || || |||||||||||||| |||||||||
Sbjct: 235 aagatcaaggtcgacaacccagttgtagacatggacggtgatgaaatgaccaga 288



to top

>gb|AY432993.1| Aedes aegypti ASAP ID: 36387 isocitrate dehydrogenase mRNA sequence
          Length = 763

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 97  tcgtcgagatggacggtgatgagatgacc 125
           |||| ||||||||||||||||||||||||
Sbjct: 373 tcgtggagatggacggtgatgagatgacc 401



to top

>gb|DQ465384.1| Oreochromis mossambicus clone SSH #509 mitochondrial isocitrate
           dehydrogenase 2-like mRNA, complete cds; nuclear gene
           for mitochondrial product
          Length = 1674

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 58/69 (84%)
 Strand = Plus / Plus

                                                                       
Query: 425 gcttgttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagta 484
           ||||||||| || |||||  ||||||||  |||||| || || || || |||||||||||
Sbjct: 544 gcttgttcctggctggacacagcccatcaccattggcagacacgcctttggtgatcagta 603

                    
Query: 485 cagagcaac 493
           |||||||||
Sbjct: 604 cagagcaac 612



to top

>ref|XM_390523.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG10347.1)
           partial mRNA
          Length = 1338

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 73  agaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||||||||   |||||| |||||||  | ||||||||||||||||||
Sbjct: 110 agaagatcaaggtcaagaaccccgtcgtcgaactcgacggtgatgagatgacc 162



to top

>emb|CR730912.2|CNS0GQX1 Tetraodon nigroviridis full-length cDNA
          Length = 1615

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || |||||||| ||||| || |||||||||
Sbjct: 567 gttccaggctggacgcagcccatcaccatcggcaggcatgcgttcggcgaccagtacaga 626

                
Query: 489 gcaac 493
           |||||
Sbjct: 627 gcaac 631



to top

>emb|CR671470.1|CNS0FH2S Tetraodon nigroviridis full-length cDNA
          Length = 1605

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  |||||| ||||| || ||||| || |||||||||
Sbjct: 567 gttccaggctggacgcagcccatcaccattggcaggcacgcgttcggcgaccagtacaga 626

                
Query: 489 gcaac 493
           |||||
Sbjct: 627 gcaac 631



to top

>gb|AY551096.1| Crassostrea gigas isocitrate dehydrogenase mRNA, complete cds;
           nuclear gene for mitochondrial product
          Length = 1914

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 267 tacaatgtggctattaagtgtgcaactattactccagatgaaga 310
           |||||||||||| | ||||||||||| || |||||||| |||||
Sbjct: 325 tacaatgtggctgtcaagtgtgcaacaatcactccagacgaaga 368



to top

>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence
          Length = 2107794

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                           
Query: 78      atcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgaccagagtattctgg 137
               |||||||| || |||||  |||||||| | ||||| || ||||||||| |  |  |||||
Sbjct: 1174090 atcaaggttgcaaacccggtcgtcgagctcgacggcgacgagatgacccgcattatctgg 1174149

                                       
Query: 138     cagtctatcaaggacaagcttatc 161
               ||||  ||||||||||||||||||
Sbjct: 1174150 cagttcatcaaggacaagcttatc 1174173



to top

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                   
Query: 74      gaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
               |||||||||||| || |||||| |||||||| | ||||| || |||||||||
Sbjct: 2176393 gaagatcaaggtagcgaaccccgtcgtcgagctcgacggcgacgagatgacc 2176444



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                  
Query: 74     gaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
              |||||||||||| || |||||| |||||||| | ||||| || |||||||||
Sbjct: 147836 gaagatcaaggtagcgaaccccgtcgtcgagctcgacggcgacgagatgacc 147887



to top

>gb|BC074545.1| Xenopus tropicalis MGC69505 protein, mRNA (cDNA clone MGC:69505
           IMAGE:5336402), complete cds
          Length = 1801

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 102 gagatggacggtgatgagatgacc 125
           ||||||||||||||||||||||||
Sbjct: 298 gagatggacggtgatgagatgacc 321



to top

>emb|CT025337.2| Xenopus tropicalis finished cDNA, clone TNeu118i04
          Length = 1685

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 102 gagatggacggtgatgagatgacc 125
           ||||||||||||||||||||||||
Sbjct: 188 gagatggacggtgatgagatgacc 211



to top

>ref|XM_536192.2| PREDICTED: Canis familiaris similar to isocitrate dehydrogenase 2
           (NADP+), mitochondrial (LOC479043), mRNA
          Length = 1804

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 102 gagatggacggtgatgagatgaccagagtattctggcagtctatcaaggacaagct 157
           ||||||||||| ||||||||||||||  |  |||||||||  |||||||| |||||
Sbjct: 352 gagatggacggcgatgagatgaccaggatcatctggcagttcatcaaggagaagct 407



to top

>gb|AC126787.12| Medicago truncatula clone mth2-11c8, complete sequence
          Length = 124211

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 438   tggactaagcccatctgcattggaaggcatgctttcggtgatca 481
             ||||| ||||| || || ||||||||||||||||| ||||||||
Sbjct: 45633 tggacaaagccaatatgtattggaaggcatgcttttggtgatca 45590



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                      
Query: 73    agaagatcaaggtcgccaaccccatcgtcgagatggacggt 113
             |||| ||||| || ||||| |||||||| ||||||||||||
Sbjct: 47826 agaaaatcaaagttgccaatcccatcgttgagatggacggt 47786



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 339   atgtggaggagcccaaatggcacaattaggaacatt 374
             ||||||||||| |||||||| ||||| || ||||||
Sbjct: 45961 atgtggaggagtccaaatggaacaatcagaaacatt 45926



to top

>emb|X92486.1|STICDH2 S.tuberosum mRNA for NADP-isocitrate dehydrogenase
          Length = 1554

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 93  cccatcgtcgagatggacggtgatgagatgac 124
           ||||||||||| |||||||||||||| |||||
Sbjct: 259 cccatcgtcgaaatggacggtgatgaaatgac 290



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 104/131 (79%)
 Strand = Plus / Plus

                                                                       
Query: 354 aatggcacaattaggaacattataaacggcaccgtgttcagagagccaattatatgcaag 413
           ||||||||||| || |||||| ||||||| || || ||| | ||||| ||  |||||| |
Sbjct: 520 aatggcacaatcagaaacattttaaacggtactgttttccgggagcctatactatgcacg 579

                                                                       
Query: 414 aatgtcccaaagcttgttccaggatggactaagcccatctgcattggaaggcatgctttc 473
           ||  | || | | ||||||| || ||||  || ||||| || ||||| ||||||||||| 
Sbjct: 580 aacattcccaggattgttcctggttggaagaaacccatttgtattggtaggcatgctttt 639

                      
Query: 474 ggtgatcagta 484
           |||||||||||
Sbjct: 640 ggtgatcagta 650



to top

>gb|AE009520.1| Brucella melitensis 16M chromosome I, section 77 of 195 of the
            complete sequence
          Length = 10543

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                        
Query: 78   atcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgaccagagtattctgg 137
            |||||||| || |||||  |||||||| | ||||| || ||||||||| |  |  |||||
Sbjct: 7381 atcaaggttgcaaacccggtcgtcgagctcgacggcgacgagatgacccgcattatctgg 7322

                                    
Query: 138  cagtctatcaaggacaagcttatc 161
            ||||  ||||||||||||||||||
Sbjct: 7321 cagttcatcaaggacaagcttatc 7298



to top

>ref|NM_001004799.1| Xenopus tropicalis MGC69505 protein (MGC69505), mRNA
          Length = 1801

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 102 gagatggacggtgatgagatgacc 125
           ||||||||||||||||||||||||
Sbjct: 298 gagatggacggtgatgagatgacc 321



to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                         
Query: 74    gaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgaccagagtatt 133
             |||||||||||| || |||||  |||||||| | ||||| || ||||||||| |  |  |
Sbjct: 30339 gaagatcaaggtggcgaacccggtcgtcgagctcgacggcgacgagatgacccgcatcat 30280

                                     
Query: 134   ctggcagtctatcaaggacaagct 157
             ||||||||  ||||||||||||||
Sbjct: 30279 ctggcagttcatcaaggacaagct 30256



to top

>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence
          Length = 2124241

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                           
Query: 78      atcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgaccagagtattctgg 137
               |||||||| || |||||  |||||||| | ||||| || ||||||||| |  |  |||||
Sbjct: 1192198 atcaaggttgcaaacccggtcgtcgagctcgacggcgacgagatgacccgcattatctgg 1192257

                                       
Query: 138     cagtctatcaaggacaagcttatc 161
               ||||  ||||||||||||||||||
Sbjct: 1192258 cagttcatcaaggacaagcttatc 1192281



to top

>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence, strain
               2308
          Length = 2121359

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                           
Query: 78      atcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgaccagagtattctgg 137
               |||||||| || |||||  |||||||| | ||||| || ||||||||| |  |  |||||
Sbjct: 1189349 atcaaggttgcaaacccggtcgtcgagctcgacggcgacgagatgacccgcattatctgg 1189408

                                       
Query: 138     cagtctatcaaggacaagcttatc 161
               ||||  ||||||||||||||||||
Sbjct: 1189409 cagttcatcaaggacaagcttatc 1189432



to top

>emb|AL591788.1|SME591788 Sinorhizobium meliloti 1021 complete chromosome; segment 7/12
          Length = 306250

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 68/83 (81%)
 Strand = Plus / Plus

                                                                          
Query: 75     aagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgaccagagtattc 134
              ||||||||||||||||| ||  |||||||  | ||||| || ||||||||| |  |  ||
Sbjct: 155695 aagatcaaggtcgccaatccggtcgtcgaactcgacggcgacgagatgacccgcatcatc 155754

                                     
Query: 135    tggcagtctatcaaggacaagct 157
              |||||||  ||||||||||||||
Sbjct: 155755 tggcagttcatcaaggacaagct 155777



to top

>gb|AY040207.1| Aspergillus nidulans C1 tetrahydrofolate synthase C1-THFS gene,
            partial cds; mitochondrial and peroxisomal NADP-dependent
            isocitrate dehydrogenase (idpA) gene, complete cds
          Length = 5749

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                               
Query: 435  ggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtac 485
            ||||||||||||||||||  ||| ||  | |||||||||||||| ||||||
Sbjct: 4441 ggatggactaagcccatcatcatcggtcgtcatgctttcggtgaccagtac 4491



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 73   agaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgag 119
            ||||||||||||||   |||||| |||| ||| ||||||||||||||
Sbjct: 3486 agaagatcaaggtcaagaaccccgtcgtggagttggacggtgatgag 3532



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 135      tggcagtctatcaaggacaagct 157
                |||||||||||||||||||||||
Sbjct: 28116737 tggcagtctatcaaggacaagct 28116715



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                              
Query: 111     ggtgatgagatgaccagagtattctggcagtctatcaaggacaagct 157
               |||||||||||||||||  |  |||||||||  ||||||||||||||
Sbjct: 1024889 ggtgatgagatgaccaggatcatctggcagttcatcaaggacaagct 1024935



to top

>dbj|AP003766.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0009H10
          Length = 175754

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 135   tggcagtctatcaaggacaagct 157
             |||||||||||||||||||||||
Sbjct: 47643 tggcagtctatcaaggacaagct 47621



to top

>dbj|AB000261.1| Aspergillus niger icdA mRNA for NADP-dependent isocitrate
           dehydrogenase precursor, complete cds
          Length = 1985

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 75  aagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||||||   |||||| |||| ||| | ||||||||||||||||||
Sbjct: 561 aagatcaaggtcaagaaccccgtcgttgagctcgacggtgatgagatgacc 611



to top

>gb|DQ443205.1| Bombyx mori NADPH-specific isocitrate dehydrogenase mRNA, complete
           cds
          Length = 2085

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 99  gtcgagatggacggtgatgagatgac 124
           ||||||||||| ||||||||||||||
Sbjct: 265 gtcgagatggatggtgatgagatgac 290



to top

>ref|XM_757165.1| Ustilago maydis 521 hypothetical protein (UM06111.1) partial mRNA
          Length = 1290

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 75  aagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgac 124
           |||||||||||| |||||||  |||| ||| | |||||||| ||||||||
Sbjct: 40  aagatcaaggtctccaaccctgtcgttgagctcgacggtgacgagatgac 89



to top

>ref|XM_823090.1| Trypanosoma brucei TREU927 isocitrate dehydrogenase (Tb11.03.0230)
           partial mRNA
          Length = 1242

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 288 gcaactattactccagatgaagatcgggttaaggagttcaacctaaaacaaatgtggagg 347
           ||||| ||||| || |||||||  || || |||||||||||||| ||  |||||||||||
Sbjct: 220 gcaaccattacacccgatgaagcgcgagtaaaggagttcaacctcaagaaaatgtggagg 279

             
Query: 348 ag 349
           ||
Sbjct: 280 ag 281



to top

>gb|DQ311190.1| Bombyx mori isocitrate dehydrogenase precursor, mRNA, complete cds;
           mitochondrial
          Length = 2073

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 99  gtcgagatggacggtgatgagatgac 124
           ||||||||||| ||||||||||||||
Sbjct: 265 gtcgagatggatggtgatgagatgac 290



to top

>dbj|AB109115.1| Lupinus albus LaICDH2;1 mRNA for NADP-specific isocitrate
           dehydrogenase, complete cds
          Length = 1794

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 258 actctcaagtacaatgtggctattaagtgtgcaactattactccagatga 307
           ||||||||||||||||| ||| | || |||||||| || ||||| |||||
Sbjct: 460 actctcaagtacaatgttgctgtgaaatgtgcaacaataactcctgatga 509



to top

>ref|XM_510589.1| PREDICTED: Pan troglodytes isocitrate dehydrogenase 2 (NADP+),
           mitochondrial (LOC453645), mRNA
          Length = 1686

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 39  gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 87



to top

>ref|XM_463748.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1635

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 39   ggcagcgcctccgccgcgaccgcca 63
            |||||||| ||||||||||||||||
Sbjct: 1244 ggcagcgcgtccgccgcgaccgcca 1220



to top

>gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome
          Length = 2560265

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 72     gagaagatcaaggtcgccaac 92
              |||||||||||||||||||||
Sbjct: 625068 gagaagatcaaggtcgccaac 625088



to top

>ref|XM_950757.1| Neurospora crassa OR74A hypothetical protein (NCU03857.1) partial
           mRNA
          Length = 1389

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 73  agaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||||||||   |||||| |||||||| | || || ||||||||||||
Sbjct: 161 agaagatcaaggtcaagaaccccgtcgtcgagctcgatggcgatgagatgacc 213



to top

>ref|XM_323175.1| Neurospora crassa OR74A hypothetical protein (NCU03857.1) partial
           mRNA
          Length = 1389

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 73  agaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||||||||   |||||| |||||||| | || || ||||||||||||
Sbjct: 161 agaagatcaaggtcaagaaccccgtcgtcgagctcgatggcgatgagatgacc 213



to top

>ref|XM_708587.1| Candida albicans SC5314 putative nucleolar FKBP-type peptidylprolyl
           cis/trans isomerase (CaO19.8632), mRNA
          Length = 1287

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 290 aactattactccagatgaaga 310
           |||||||||||||||||||||
Sbjct: 456 aactattactccagatgaaga 476



to top

>ref|XM_708542.1| Candida albicans SC5314 putative nucleolar FKBP-type peptidylprolyl
           cis/trans isomerase (CaO19.1030), mRNA
          Length = 1281

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 290 aactattactccagatgaaga 310
           |||||||||||||||||||||
Sbjct: 450 aactattactccagatgaaga 470



to top

>emb|CR734506.2|CNS0GTIX Tetraodon nigroviridis full-length cDNA
          Length = 1608

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 569 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 628

                
Query: 489 gcaac 493
           |||||
Sbjct: 629 gcaac 633



to top

>emb|CR732599.2|CNS0GS7W Tetraodon nigroviridis full-length cDNA
          Length = 1605

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 564 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 623

                
Query: 489 gcaac 493
           |||||
Sbjct: 624 gcaac 628



to top

>emb|CR730591.2|CNS0GQO4 Tetraodon nigroviridis full-length cDNA
          Length = 1577

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 553 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 612

                
Query: 489 gcaac 493
           |||||
Sbjct: 613 gcaac 617



to top

>emb|CR730276.2|CNS0GQFD Tetraodon nigroviridis full-length cDNA
          Length = 1728

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 564 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 623

                
Query: 489 gcaac 493
           |||||
Sbjct: 624 gcaac 628



to top

>emb|CR729792.2|CNS0GQ1Y Tetraodon nigroviridis full-length cDNA
          Length = 1687

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 114 gatgagatgaccagagtattctggcagtctatcaaggacaagcttatcttccc 166
           |||||||||||||| ||  ||||| ||   |||||||||||||| ||||||||
Sbjct: 135 gatgagatgaccagggtcatctgggagctgatcaaggacaagctcatcttccc 187



to top

>emb|CR721079.2|CNS0GJBX Tetraodon nigroviridis full-length cDNA
          Length = 1740

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 571 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 630

                
Query: 489 gcaac 493
           |||||
Sbjct: 631 gcaac 635



to top

>emb|CR704578.2|CNS0G6LQ Tetraodon nigroviridis full-length cDNA
          Length = 1604

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 571 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 630

                
Query: 489 gcaac 493
           |||||
Sbjct: 631 gcaac 635



to top

>emb|CR703700.2|CNS0G5XC Tetraodon nigroviridis full-length cDNA
          Length = 1575

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 553 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 612

                
Query: 489 gcaac 493
           |||||
Sbjct: 613 gcaac 617



to top

>emb|CR701753.2|CNS0G4F9 Tetraodon nigroviridis full-length cDNA
          Length = 1544

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 569 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 628

                
Query: 489 gcaac 493
           |||||
Sbjct: 629 gcaac 633



to top

>emb|CR695643.2|CNS0FZPJ Tetraodon nigroviridis full-length cDNA
          Length = 1745

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 564 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 623

                
Query: 489 gcaac 493
           |||||
Sbjct: 624 gcaac 628



to top

>emb|CR694676.2|CNS0FYYO Tetraodon nigroviridis full-length cDNA
          Length = 1446

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 258 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 317

                
Query: 489 gcaac 493
           |||||
Sbjct: 318 gcaac 322



to top

>emb|CR694604.1|CNS0FYWO Tetraodon nigroviridis full-length cDNA
          Length = 1581

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 554 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 613

                
Query: 489 gcaac 493
           |||||
Sbjct: 614 gcaac 618



to top

>emb|CR694034.2|CNS0FYGU Tetraodon nigroviridis full-length cDNA
          Length = 1576

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 553 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 612

                
Query: 489 gcaac 493
           |||||
Sbjct: 613 gcaac 617



to top

>emb|CR692818.2|CNS0FXJ2 Tetraodon nigroviridis full-length cDNA
          Length = 1617

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 571 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 630

                
Query: 489 gcaac 493
           |||||
Sbjct: 631 gcaac 635



to top

>emb|CR691587.2|CNS0FWKV Tetraodon nigroviridis full-length cDNA
          Length = 1734

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 558 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 617

                
Query: 489 gcaac 493
           |||||
Sbjct: 618 gcaac 622



to top

>emb|CR686180.2|CNS0FSEO Tetraodon nigroviridis full-length cDNA
          Length = 1612

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 566 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 625

                
Query: 489 gcaac 493
           |||||
Sbjct: 626 gcaac 630



to top

>emb|CR684377.2|CNS0FR0L Tetraodon nigroviridis full-length cDNA
          Length = 1737

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||| | ||| || ||||| || ||||| || |||||||||
Sbjct: 564 gttccaggctggacgcagcccatttccatcggcaggcacgcgttcggcgaccagtacaga 623

                
Query: 489 gcaac 493
           |||||
Sbjct: 624 gcaac 628



to top

>emb|CR683921.2|CNS0FQNX Tetraodon nigroviridis full-length cDNA
          Length = 1763

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 565 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 624

                
Query: 489 gcaac 493
           |||||
Sbjct: 625 gcaac 629



to top

>ref|XM_729441.1| Plasmodium chabaudi chabaudi hypothetical protein (PC302184.00.0)
           partial mRNA
          Length = 654

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 331 taaaacaaatgtggaggagcccaaatggcacaattag 367
           ||||| |||||||||  ||||||||||| ||||||||
Sbjct: 239 taaaagaaatgtggaaaagcccaaatggtacaattag 275



to top

>ref|XM_735713.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000375.04.0)
           partial mRNA
          Length = 444

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 331 taaaacaaatgtggaggagcccaaatggcacaattag 367
           ||||| |||||||||  ||||||||||| ||||||||
Sbjct: 353 taaaagaaatgtggaaaagcccaaatggtacaattag 389



to top

>emb|CR673730.2|CNS0FITK Tetraodon nigroviridis full-length cDNA
          Length = 1612

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 571 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 630

                
Query: 489 gcaac 493
           |||||
Sbjct: 631 gcaac 635



to top

>emb|CR669331.2|CNS0FFFD Tetraodon nigroviridis full-length cDNA
          Length = 1705

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 551 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 610

                
Query: 489 gcaac 493
           |||||
Sbjct: 611 gcaac 615



to top

>emb|CR668443.2|CNS0FEQP Tetraodon nigroviridis full-length cDNA
          Length = 1603

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 gttccaggatggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga 488
           |||||||| |||||  ||||||||  ||| || ||||| || ||||| || |||||||||
Sbjct: 572 gttccaggctggacgcagcccatcaccatcggcaggcacgcgttcggcgaccagtacaga 631

                
Query: 489 gcaac 493
           |||||
Sbjct: 632 gcaac 636



to top

>ref|NM_002168.2| Homo sapiens isocitrate dehydrogenase 2 (NADP+), mitochondrial
           (IDH2), mRNA
          Length = 1740

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 215 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 263



to top

>emb|AL356059.27| Human DNA sequence from clone RP11-192G4 on chromosome 1 Contains part
             of the COL24A1 gene for collagen type XXIV alpha 1,
             complete sequence
          Length = 76418

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 158   tatcttcccatttttggacttggacatca 186
             ||||||||||||||||| |||||| ||||
Sbjct: 63480 tatcttcccatttttggccttggatatca 63452



to top

>emb|X69433.1|HSIDNADP H.sapiens mRNA for mitochondrial isocitrate dehydrogenase (NADP+)
          Length = 1751

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 215 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 263



to top

>emb|CR615856.1| full-length cDNA clone CS0DI077YD06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1688

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 205 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 253



to top

>emb|CR625817.1| full-length cDNA clone CS0DA002YE04 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1667

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 184 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 232



to top

>emb|CR625730.1| full-length cDNA clone CS0DF007YI03 of Fetal brain of Homo sapiens
           (human)
          Length = 1707

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 205 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 253



to top

>emb|CR625291.1| full-length cDNA clone CS0DI018YK23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1701

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 220 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 268



to top

>emb|CR622745.1| full-length cDNA clone CS0DI029YO14 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1692

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 198 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 246



to top

>emb|CR619410.1| full-length cDNA clone CS0DI042YG08 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1671

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 193 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 241



to top

>emb|CR619261.1| full-length cDNA clone CS0DL009YE05 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 1723

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 238 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 286



to top

>emb|CR617370.1| full-length cDNA clone CS0DI081YH08 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1669

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 205 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 253



to top

>emb|CR617266.1| full-length cDNA clone CS0DI041YL18 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1625

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 140 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 188



to top

>emb|CR617229.1| full-length cDNA clone CS0DF006YD12 of Fetal brain of Homo sapiens
           (human)
          Length = 1698

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 195 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 243



to top

>emb|CR616318.1| full-length cDNA clone CS0DI008YC17 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1664

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 184 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 232



to top

>emb|CR613707.1| full-length cDNA clone CS0DI044YJ06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1528

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 47  gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 95



to top

>emb|CR610921.1| full-length cDNA clone CS0DF013YA17 of Fetal brain of Homo sapiens
           (human)
          Length = 1724

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 205 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 253



to top

>emb|CR610749.1| full-length cDNA clone CS0DI056YE07 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1278

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 216 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 264



to top

>emb|CR610676.1| full-length cDNA clone CS0DH005YD07 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 1704

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 205 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 253



to top

>emb|CR607742.1| full-length cDNA clone CS0DK005YD09 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1667

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 193 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 241



to top

>emb|CR607159.1| full-length cDNA clone CS0CAP008YI14 of Thymus of Homo sapiens
           (human)
          Length = 1695

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 208 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 256



to top

>emb|CR607058.1| full-length cDNA clone CS0DI057YN22 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1724

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 238 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 286



to top

>emb|CR606745.1| full-length cDNA clone CS0DH005YP17 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 1695

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 198 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 246



to top

>emb|CR606440.1| full-length cDNA clone CS0DI066YD06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1640

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 193 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 241



to top

>emb|CR604829.1| full-length cDNA clone CS0DA005YA06 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1700

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 203 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 251



to top

>emb|CR602902.1| full-length cDNA clone CS0DF017YA02 of Fetal brain of Homo sapiens
           (human)
          Length = 1669

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 187 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 235



to top

>emb|CR602079.1| full-length cDNA clone CS0DI039YF02 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1678

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 199 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 247



to top

>emb|CR600938.1| full-length cDNA clone CS0DA007YE17 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1699

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 205 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 253



to top

>emb|CR600286.1| full-length cDNA clone CS0DI027YC02 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1661

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 179 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 227



to top

>emb|CR599284.1| full-length cDNA clone CS0DL002YF02 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 1668

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 205 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 253



to top

>emb|CR599159.1| full-length cDNA clone CS0DI013YL09 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1648

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 194 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 242



to top

>emb|CR598530.1| full-length cDNA clone CS0DI043YC04 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1686

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 199 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 247



to top

>emb|CR597829.1| full-length cDNA clone CS0DI018YK02 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1671

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 184 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 232



to top

>emb|CR597564.1| full-length cDNA clone CS0DA008YM06 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1682

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 199 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 247



to top

>emb|CR595435.1| full-length cDNA clone CS0DI054YK01 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1704

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 201 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 249



to top

>emb|CR594870.1| full-length cDNA clone CS0DI064YE13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1672

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 194 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 242



to top

>emb|CR593589.1| full-length cDNA clone CS0DM002YM16 of Fetal liver of Homo sapiens
           (human)
          Length = 1645

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 163 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 211



to top

>emb|CR593087.1| full-length cDNA clone CS0DI023YP13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1681

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 199 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 247



to top

>emb|CR590507.1| full-length cDNA clone CS0DI040YO19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1674

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 192 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 240



to top

>gb|AY939844.1| Cyanophage P-SSM2, complete genome
          Length = 252401

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 144    atcaaggacaagcttatcttc 164
              |||||||||||||||||||||
Sbjct: 219173 atcaaggacaagcttatcttc 219153



to top

>dbj|AK222916.1| Homo sapiens mRNA for isocitrate dehydrogenase 2 (NADP+),
           mitochondrial precursor variant, clone: HRC04508
          Length = 1738

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 207 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 255



to top

>dbj|AP003735.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1147A04
          Length = 150053

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 39     ggcagcgcctccgccgcgaccgcca 63
              |||||||| ||||||||||||||||
Sbjct: 132765 ggcagcgcgtccgccgcgaccgcca 132789



to top

>gb|AC092769.7| Homo sapiens chromosome 15, clone CTD-2315E11, complete sequence
          Length = 82168

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                              
Query: 77    gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
             ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 27249 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 27201



to top

>gb|BC071828.1| Homo sapiens isocitrate dehydrogenase 2 (NADP+), mitochondrial,
           mRNA (cDNA clone MGC:88486 IMAGE:6090792), complete cds
          Length = 1726

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 194 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 242



to top

>gb|BC009244.2| Homo sapiens isocitrate dehydrogenase 2 (NADP+), mitochondrial,
           mRNA (cDNA clone MGC:3700 IMAGE:2959540), complete cds
          Length = 1727

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||||||| || || ||| | || |||||||| |||||||||||||||
Sbjct: 195 gatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacc 243



to top

>gb|AC164075.4| Mus musculus chromosome 7, clone RP24-259P13, complete sequence
          Length = 159578

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 102   gagatggacggtgatgagatgacc 125
             |||||||||||||| |||||||||
Sbjct: 98021 gagatggacggtgacgagatgacc 97998



to top

>gb|AY663392.1| Triticum aestivum cultivar Renan clone BAC 930H14, complete sequence
          Length = 153766

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 528   ctagtttttgagggaaaaga 547
             ||||||||||||||||||||
Sbjct: 38791 ctagtttttgagggaaaaga 38810



to top

>gb|BC060030.1| Mus musculus isocitrate dehydrogenase 2 (NADP+), mitochondrial,
           mRNA (cDNA clone MGC:68036 IMAGE:6515657), complete cds
          Length = 1708

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 102 gagatggacggtgatgagatgacc 125
           |||||||||||||| |||||||||
Sbjct: 216 gagatggacggtgacgagatgacc 239



to top

>gb|AC109232.17| Mus musculus chromosome 7, clone RP23-423P21, complete sequence
          Length = 201262

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 102  gagatggacggtgatgagatgacc 125
            |||||||||||||| |||||||||
Sbjct: 5401 gagatggacggtgacgagatgacc 5378



to top

>ref|XM_569233.1| Cryptococcus neoformans var. neoformans JEC21 isocitrate
           dehydrogenase (NADP+) (CNB04090) partial mRNA
          Length = 1535

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 435 ggatggactaagcccatctgcattggaaggcatgctttcggtga 478
           |||||||| ||||||||||| || ||  | ||||||||||||||
Sbjct: 540 ggatggaccaagcccatctgtatcggtcgacatgctttcggtga 583



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgac 124
           ||||||||||   |||||| | || ||||| |||||||||||||||||
Sbjct: 182 gatcaaggtcaagaaccccgtggttgagattgacggtgatgagatgac 229



to top

>ref|XM_569234.1| Cryptococcus neoformans var. neoformans JEC21 isocitrate
           dehydrogenase (NADP+) (CNB04090) partial mRNA
          Length = 1501

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 435 ggatggactaagcccatctgcattggaaggcatgctttcggtga 478
           |||||||| ||||||||||| || ||  | ||||||||||||||
Sbjct: 506 ggatggaccaagcccatctgtatcggtcgacatgctttcggtga 549



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 77  gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgac 124
           ||||||||||   |||||| | || ||||| |||||||||||||||||
Sbjct: 148 gatcaaggtcaagaaccccgtggttgagattgacggtgatgagatgac 195



to top

>gb|AC087893.15| Homo sapiens 12 BAC RP11-423G4 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 207829

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 144    atcaaggacaagcttatcttccca 167
              ||||| ||||||||||||||||||
Sbjct: 164368 atcaatgacaagcttatcttccca 164345



to top

>emb|BX530407.26| Zebrafish DNA sequence from clone DKEY-83M22 in linkage group 9, complete
              sequence
          Length = 292409

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 350    cccaaatggcacaattagga 369
              ||||||||||||||||||||
Sbjct: 146538 cccaaatggcacaattagga 146519



to top

>emb|BX936402.12| Zebrafish DNA sequence from clone CH211-128D20 in linkage group 9,
              complete sequence
          Length = 156082

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 350    cccaaatggcacaattagga 369
              ||||||||||||||||||||
Sbjct: 141797 cccaaatggcacaattagga 141816



to top

>gb|BC054241.1| Xenopus laevis hypothetical protein MGC64442, mRNA (cDNA clone
           MGC:64442 IMAGE:6880463), complete cds
          Length = 1808

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 102 gagatggacggtgatgagatgacc 125
           |||||||| |||||||||||||||
Sbjct: 304 gagatggatggtgatgagatgacc 327



to top

>emb|CR729897.2|CNS0GQ4V Tetraodon nigroviridis full-length cDNA
          Length = 1673

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 115 atgagatgaccagagtattctggcagtctatcaaggacaagcttatcttccc 166
           ||||||||||||| ||  ||||| ||   |||||||||||||| ||||||||
Sbjct: 122 atgagatgaccagggtcatctgggagctgatcaaggacaagctcatcttccc 173



to top

>ref|XM_848139.1| PREDICTED: Canis familiaris similar to thyroid hormone receptor
            interactor 11 (LOC490039), mRNA
          Length = 5691

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 268  acaatgtggctattaagtgt 287
            ||||||||||||||||||||
Sbjct: 2224 acaatgtggctattaagtgt 2205



to top

>ref|XM_948169.1| Theileria annulata strain Ankara isocitrate dehydrogenase (TA10850)
           partial mRNA
          Length = 1380

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 459 ggaaggcatgctttcggtgatcagtaca 486
           |||||||||||||| || ||||||||||
Sbjct: 559 ggaaggcatgcttttggagatcagtaca 586



to top

>gb|AC137644.3| Artibeus jamaicensis clone 25B10, complete sequence
          Length = 120831

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   gcaagaatgtcccaaagctt 428
             ||||||||||||||||||||
Sbjct: 36595 gcaagaatgtcccaaagctt 36614



to top

>emb|AL589842.5| Human DNA sequence from clone RP11-268A15 on chromosome X Contains
            part of the PLS3 gene for the T isoform of plastin 3,
            complete sequence
          Length = 34744

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 3    ccaacctgcccctccccgct 22
            ||||||||||||||||||||
Sbjct: 9027 ccaacctgcccctccccgct 9008



to top

>emb|X69432.1|BTIDNADP B.taurus mRNA for mitochondrial isocitrate dehydrogenase (NADP+)
          Length = 1740

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 102 gagatggacggtgatgagatgacc 125
           ||||||||||| ||||||||||||
Sbjct: 220 gagatggacggcgatgagatgacc 243



to top

>ref|NM_001014161.1| Rattus norvegicus similar to NADP+-specific isocitrate
           dehydrogenase (LOC361596), mRNA
          Length = 1695

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 390 ttcagagagccaattatatgcaagaatgtccc 421
           ||||||||||||||||| ||||| ||| ||||
Sbjct: 471 ttcagagagccaattatctgcaaaaatatccc 502



to top

>gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 2, complete
               sequence
          Length = 1632307

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                           
Query: 435     ggatggactaagcccatctgcattggaaggcatgctttcggtga 478
               |||||||| ||||||||||| || ||  | ||||||||||||||
Sbjct: 1203426 ggatggaccaagcccatctgtatcggtcgacatgctttcggtga 1203469



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                               
Query: 77      gatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgac 124
               ||||||||||   |||||| | || ||||| |||||||||||||||||
Sbjct: 1202880 gatcaaggtcaagaaccccgtggttgagattgacggtgatgagatgac 1202927



to top

>gb|AF435451.2| Nicotiana tabacum calcium-dependent protein kinase CPK4 mRNA,
            complete cds
          Length = 2360

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 150  gacaagcttatcttcccatttttg 173
            ||||||||||||||||||| ||||
Sbjct: 1832 gacaagcttatcttcccatctttg 1809



to top

>gb|DQ397556.1| Cenarchaeum symbiosum clone C13A10, complete sequence
          Length = 40870

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   gatggacggtgatgagatga 123
             ||||||||||||||||||||
Sbjct: 27022 gatggacggtgatgagatga 27041



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   gatggacggtgatgagatga 123
             ||||||||||||||||||||
Sbjct: 26989 gatggacggtgatgagatga 27008



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   gatggacggtgatgagatga 123
             ||||||||||||||||||||
Sbjct: 26956 gatggacggtgatgagatga 26975



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   gatggacggtgatgagatga 123
             ||||||||||||||||||||
Sbjct: 26923 gatggacggtgatgagatga 26942



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   gatggacggtgatgagatga 123
             ||||||||||||||||||||
Sbjct: 26890 gatggacggtgatgagatga 26909



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                           
Query: 78      atcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgaccagagtattctgg 137
               ||||||||  |||||||| |||||||  | ||||| || |||||||||||  |  |||||
Sbjct: 1716113 atcaaggtgaccaaccccgtcgtcgaactcgacggcgacgagatgaccaggatcatctgg 1716054

                                   
Query: 138     cagtctatcaaggacaagct 157
               || |  ||||||||||||||
Sbjct: 1716053 caatacatcaaggacaagct 1716034



to top

>gb|AC145027.17| Medicago truncatula clone mth2-15e6, complete sequence
          Length = 122014

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 280   ttaagtgtgcaactattact 299
             ||||||||||||||||||||
Sbjct: 39908 ttaagtgtgcaactattact 39927



to top

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                                   
Query: 73      agaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgac 124
               ||||||||||||||||||| ||| ||| |||  | ||||| ||||| |||||
Sbjct: 2416142 agaagatcaaggtcgccaatcccgtcgccgatctcgacggcgatgaaatgac 2416193



to top

>dbj|AK146564.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920026L21 product:isocitrate
           dehydrogenase 2 (NADP+), mitochondrial, full insert
           sequence
          Length = 1786

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 102 gagatggacggtgatgagatgacc 125
           |||||||||||||| |||||||||
Sbjct: 211 gagatggacggtgacgagatgacc 234



to top

>dbj|AK145753.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0037L06 product:isocitrate
           dehydrogenase 2 (NADP+), mitochondrial, full insert
           sequence
          Length = 1642

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 102 gagatggacggtgatgagatgacc 125
           |||||||||||||| |||||||||
Sbjct: 173 gagatggacggtgacgagatgacc 196



to top

>dbj|AK161640.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:5730427P19 product:isocitrate
           dehydrogenase 2 (NADP+), mitochondrial, full insert
           sequence
          Length = 1683

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 102 gagatggacggtgatgagatgacc 125
           |||||||||||||| |||||||||
Sbjct: 212 gagatggacggtgacgagatgacc 235



to top

>dbj|AK169395.1| Mus musculus 16 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920194K10 product:isocitrate
           dehydrogenase 2 (NADP+), mitochondrial, full insert
           sequence
          Length = 1697

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 102 gagatggacggtgatgagatgacc 125
           |||||||||||||| |||||||||
Sbjct: 225 gagatggacggtgacgagatgacc 248



to top

>gb|DP000001.1| Artibeus jamaicensis target 1 genomic scaffold
          Length = 584809

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   gcaagaatgtcccaaagctt 428
             ||||||||||||||||||||
Sbjct: 36595 gcaagaatgtcccaaagctt 36614



to top

>gb|AC102416.5| Mus musculus chromosome 18, clone RP24-492H24, complete sequence
          Length = 190211

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 447    cccatctgcattggaaggca 466
              ||||||||||||||||||||
Sbjct: 140368 cccatctgcattggaaggca 140387



to top

>dbj|AB169742.1| Macaca fascicularis brain cDNA, clone: QnpA-13564, similar to human
           isocitrate dehydrogenase 2 (NADP+), mitochondrial(IDH2),
           mRNA, RefSeq: NM_002168.2
          Length = 1745

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 102 gagatggacggtgatgagatgacc 125
           |||||||| |||||||||||||||
Sbjct: 238 gagatggatggtgatgagatgacc 261



to top

>gb|AE016814.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome I,
              complete sequence
          Length = 691920

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 93     cccatcgtcgagatggacgg 112
              ||||||||||||||||||||
Sbjct: 302970 cccatcgtcgagatggacgg 302989



to top

>dbj|AK088110.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430004F23
           product:isocitrate dehydrogenase 2 (NADP+),
           mitochondrial, full insert sequence
          Length = 1670

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 102 gagatggacggtgatgagatgacc 125
           |||||||||||||| |||||||||
Sbjct: 200 gagatggacggtgacgagatgacc 223



to top

>gb|BC102509.1| Bos taurus isocitrate dehydrogenase 2 (NADP+), mitochondrial, mRNA
           (cDNA clone MGC:127877 IMAGE:7954808), complete cds
          Length = 1818

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 102 gagatggacggtgatgagatgacc 125
           ||||||||||| ||||||||||||
Sbjct: 236 gagatggacggcgatgagatgacc 259



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 65/80 (81%)
 Strand = Plus / Plus

                                                                           
Query: 78      atcaaggtcgccaaccccatcgtcgagatggacggtgatgagatgaccagagtattctgg 137
               ||||||||  |||||||| |||||||  | |||||||| ||||||||| |  |  |||||
Sbjct: 4267153 atcaaggtgaccaaccccgtcgtcgaactcgacggtgacgagatgacccgcatcatctgg 4267212

                                   
Query: 138     cagtctatcaaggacaagct 157
               |||   ||||||||||||||
Sbjct: 4267213 cagatgatcaaggacaagct 4267232



to top

>gb|AF212319.1|AF212319 Mus musculus NADP+-specific isocitrate dehydrogenase mRNA, complete
           cds; nuclear gene for mitochondrial product
          Length = 1679

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 102 gagatggacggtgatgagatgacc 125
           |||||||||||||| |||||||||
Sbjct: 199 gagatggacggtgacgagatgacc 222



to top

>ref|XM_623670.1| PREDICTED: Apis mellifera similar to CG7176-PB, isoform B
           (LOC551276), mRNA
          Length = 1838

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 285 tgtgcaactattactccagatgaa 308
           ||||| ||||||||||||||||||
Sbjct: 590 tgtgctactattactccagatgaa 613



to top

>ref|XM_623631.1| PREDICTED: Apis mellifera similar to CG7176-PC, isoform C
           (LOC551276), mRNA
          Length = 1646

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 285 tgtgcaactattactccagatgaa 308
           ||||| ||||||||||||||||||
Sbjct: 398 tgtgctactattactccagatgaa 421



to top

>ref|NM_175790.2| Bos taurus isocitrate dehydrogenase 2 (NADP+), mitochondrial
           (IDH2), mRNA
          Length = 1740

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 102 gagatggacggtgatgagatgacc 125
           ||||||||||| ||||||||||||
Sbjct: 220 gagatggacggcgatgagatgacc 243



to top

>gb|BC046379.1| Xenopus laevis, clone IMAGE:5542876, mRNA
          Length = 1808

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 102 gagatggacggtgatgagatgacc 125
           |||||||| |||||||||||||||
Sbjct: 324 gagatggatggtgatgagatgacc 347



to top

>ref|NM_173011.1| Mus musculus isocitrate dehydrogenase 2 (NADP+), mitochondrial
           (Idh2), mRNA
          Length = 1679

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 102 gagatggacggtgatgagatgacc 125
           |||||||||||||| |||||||||
Sbjct: 199 gagatggacggtgacgagatgacc 222



to top

>gb|AF003529.2| Homo sapiens glypican 3 (GPC3) gene, partial cds and flanking repeat
              regions
          Length = 165658

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 121    tgaccagagtattctggcagtcta 144
              |||||| |||||||||||||||||
Sbjct: 154874 tgaccatagtattctggcagtcta 154851



to top

>gb|BC076398.1| Rattus norvegicus similar to NADP+-specific isocitrate
           dehydrogenase, mRNA (cDNA clone MGC:94864
           IMAGE:7110062), complete cds
          Length = 1695

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 390 ttcagagagccaattatatgcaagaatgtccc 421
           ||||||||||||||||| ||||| ||| ||||
Sbjct: 471 ttcagagagccaattatctgcaaaaatatccc 502



to top

>gb|AC002407.1|AC002407 Human Chromosome X, complete sequence
          Length = 95506

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 121   tgaccagagtattctggcagtcta 144
             |||||| |||||||||||||||||
Sbjct: 14997 tgaccatagtattctggcagtcta 14974



to top

>ref|NM_207873.1| Eremothecium gossypii AAL022Wp (AAL022W), mRNA
          Length = 1248

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cccatcgtcgagatggacgg 112
           ||||||||||||||||||||
Sbjct: 25  cccatcgtcgagatggacgg 44



to top

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 64     tggcgttcgagaagatcaaggtcg 87
              ||||||||||| ||||||||||||
Sbjct: 405185 tggcgttcgaggagatcaaggtcg 405208



to top

>emb|BX571722.18| Zebrafish DNA sequence from clone DKEY-96O13 in linkage group 9, complete
              sequence
          Length = 228214

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 350    cccaaatggcacaattagga 369
              ||||||||||||||||||||
Sbjct: 179392 cccaaatggcacaattagga 179411



to top

>emb|AJ565856.1|SSP565856 Saccharum spontaneum mRNA for NADP-malate dehydrogenase,
           unproductive transcript (nadp-MDH pseudogene)
          Length = 1385

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 43  gcgcctccgccgcgaccgcc 62
           ||||||||||||||||||||
Sbjct: 217 gcgcctccgccgcgaccgcc 198



to top

>emb|AJ512375.1|VZI512375 Vetiveria zizanioides partial mRNA for NADP-dependant malate
           dehydrogenase (nadp-mdh gene)
          Length = 1248

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 43  gcgcctccgccgcgaccgcc 62
           ||||||||||||||||||||
Sbjct: 154 gcgcctccgccgcgaccgcc 135



to top

>emb|AJ416567.1|SSP416567 Saccharum spontaneum mRNA for putative malate deshydrogenase (mdh
           gene)
          Length = 1385

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 43  gcgcctccgccgcgaccgcc 62
           ||||||||||||||||||||
Sbjct: 217 gcgcctccgccgcgaccgcc 198



to top

>emb|AJ344433.1|VZI344433 Vetiveria zizanioides partial mRNA for NADP-dependent malate
           dehydrogenase (nadp-MDH gene)
          Length = 1281

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 43  gcgcctccgccgcgaccgcc 62
           ||||||||||||||||||||
Sbjct: 112 gcgcctccgccgcgaccgcc 93



to top

>emb|AJ344432.1|SOF344432 Saccharum officinarum mRNA for NADP-dependent malate dehydrogenase
           (nadp-MDH gene)
          Length = 1388

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 43  gcgcctccgccgcgaccgcc 62
           ||||||||||||||||||||
Sbjct: 217 gcgcctccgccgcgaccgcc 198



to top

>emb|AJ320265.1|SSP320265 Saccharum spontaneum partial mRNA for malate deshydrogenase (mdh
           gene)
          Length = 1007

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 43  gcgcctccgccgcgaccgcc 62
           ||||||||||||||||||||
Sbjct: 217 gcgcctccgccgcgaccgcc 198



to top

>gb|U51167.1|MMU51167 Mus musculus isocitrate dehydrogenase mRNA, complete cds
          Length = 1863

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 102 gagatggacggtgatgagatgacc 125
           |||||||||||||| |||||||||
Sbjct: 393 gagatggacggtgacgagatgacc 416



to top

>emb|AL672254.9| Mouse DNA sequence from clone RP23-409H23 on chromosome X, complete
              sequence
          Length = 173251

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 238    cagtggaggctgcagaggctactc 261
              |||||||||| |||||||||||||
Sbjct: 129501 cagtggaggcagcagaggctactc 129524



to top

>dbj|AB007994.1| Candida tropicalis gene for NADP-linked isocitrate dehydrogenase,
           complete cds
          Length = 1817

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 90  aaccccatcgtcgagatggacggtgatgagatgacc 125
           ||||| |||||||| ||||||||||| || ||||||
Sbjct: 271 aacccaatcgtcgaaatggacggtgacgaaatgacc 306


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,709,755
Number of Sequences: 3902068
Number of extensions: 4709755
Number of successful extensions: 93732
Number of sequences better than 10.0: 236
Number of HSP's better than 10.0 without gapping: 232
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 92529
Number of HSP's gapped (non-prelim): 1238
length of query: 554
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 531
effective length of database: 17,143,297,704
effective search space: 9103091080824
effective search space used: 9103091080824
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top