ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags9m22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC104850.2| Homo sapiens chromosome 3 clone RP11-241K18, comp... 40 0.34
2gb|AC099332.2| Homo sapiens chromosome 3 clone RP11-256B12, comp... 40 0.34
3gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold 38 1.3
4gb|AC153100.3| Oryctolagus cuniculus clone LB1-192J7, complete s... 38 1.3
5gb|AC139099.2| Homo sapiens chromosome 17, clone G549, complete ... 38 1.3
6gb|AC163344.2| Mus musculus BAC clone RP24-66I20 from chromosome... 36 5.3
7gb|AC161419.2| Mus musculus BAC clone RP23-405I13 from chromosom... 36 5.3
8gb|DQ334671.1| Hippophae goniocarpa tRNA-Leu (trnL) gene and trn... 36 5.3
9gb|AY913821.1| Hippophae thibetana voucher J.Q.Liu 1800-3 tRNA-L... 36 5.3
10gb|AY913820.1| Hippophae neurocarpa subsp. neurocarpa voucher J.... 36 5.3
11gb|AY913819.1| Hippophae neurocarpa subsp. neurocarpa voucher J.... 36 5.3
12gb|AY913818.1| Hippophae goniocarpa voucher J.Q.Liu 1524-5 tRNA-... 36 5.3
13gb|AY913817.1| Hippophae neurocarpa subsp. neurocarpa voucher J.... 36 5.3
14gb|AY913816.1| Hippophae goniocarpa voucher J.Q.Liu H18 tRNA-Leu... 36 5.3
15gb|AY913815.1| Hippophae neurocarpa subsp. neurocarpa voucher J.... 36 5.3
16gb|AY913814.1| Hippophae rhamnoides subsp. sinensis voucher J.Q.... 36 5.3
17gb|AY913813.1| Hippophae neurocarpa subsp. neurocarpa voucher J.... 36 5.3
18gb|AY913812.1| Hippophae rhamnoides subsp. sinensis voucher J.Q.... 36 5.3
19gb|AY913811.1| Hippophae goniocarpa voucher J.Q.Liu 1524-f tRNA-... 36 5.3
20emb|AJ225801.1|HSJ225801 Hippophae salicifolia chloroplast DNA f... 36 5.3

>gb|AC104850.2| Homo sapiens chromosome 3 clone RP11-241K18, complete sequence
          Length = 173580

 Score = 40.1 bits (20), Expect = 0.34
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 6      agccctgtgatacatgaaag 25
              ||||||||||||||||||||
Sbjct: 171187 agccctgtgatacatgaaag 171206



to top

>gb|AC099332.2| Homo sapiens chromosome 3 clone RP11-256B12, complete sequence
          Length = 164268

 Score = 40.1 bits (20), Expect = 0.34
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     agccctgtgatacatgaaag 25
             ||||||||||||||||||||
Sbjct: 77699 agccctgtgatacatgaaag 77680



to top

>gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold
          Length = 1889755

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 5      aagccctgtgatacatgaa 23
              |||||||||||||||||||
Sbjct: 908224 aagccctgtgatacatgaa 908206



to top

>gb|AC153100.3| Oryctolagus cuniculus clone LB1-192J7, complete sequence
          Length = 132131

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 5     aagccctgtgatacatgaa 23
             |||||||||||||||||||
Sbjct: 74444 aagccctgtgatacatgaa 74426



to top

>gb|AC139099.2| Homo sapiens chromosome 17, clone G549, complete sequence
          Length = 125104

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 9      cctgtgatacatgaaagtgcaat 31
              ||||||||| |||||||||||||
Sbjct: 111271 cctgtgatagatgaaagtgcaat 111249



to top

>gb|AC163344.2| Mus musculus BAC clone RP24-66I20 from chromosome 9, complete sequence
          Length = 221000

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 5      aagccctgtgatacatga 22
              ||||||||||||||||||
Sbjct: 207329 aagccctgtgatacatga 207346



to top

>gb|AC161419.2| Mus musculus BAC clone RP23-405I13 from chromosome 9, complete sequence
          Length = 213468

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 5     aagccctgtgatacatga 22
             ||||||||||||||||||
Sbjct: 99271 aagccctgtgatacatga 99254



to top

>gb|DQ334671.1| Hippophae goniocarpa tRNA-Leu (trnL) gene and trnL-trnF intergenic
           spacer, partial sequence; chloroplast
          Length = 830

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 3   acaagccctgtgatacat 20
           ||||||||||||||||||
Sbjct: 619 acaagccctgtgatacat 636



to top

>gb|AY913821.1| Hippophae thibetana voucher J.Q.Liu 1800-3 tRNA-Leu (trnL) gene and
           trnL-trnF intergenic spacer, partial sequence;
           chloroplast
          Length = 796

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 3   acaagccctgtgatacat 20
           ||||||||||||||||||
Sbjct: 595 acaagccctgtgatacat 578



to top

>gb|AY913820.1| Hippophae neurocarpa subsp. neurocarpa voucher J.Q.Liu 1522A-d
           tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer,
           partial sequence; chloroplast
          Length = 835

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 3   acaagccctgtgatacat 20
           ||||||||||||||||||
Sbjct: 621 acaagccctgtgatacat 638



to top

>gb|AY913819.1| Hippophae neurocarpa subsp. neurocarpa voucher J.Q.Liu 1520B-h
           tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer,
           partial sequence; chloroplast
          Length = 733

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 3   acaagccctgtgatacat 20
           ||||||||||||||||||
Sbjct: 523 acaagccctgtgatacat 540



to top

>gb|AY913818.1| Hippophae goniocarpa voucher J.Q.Liu 1524-5 tRNA-Leu (trnL) gene
           and trnL-trnF intergenic spacer, partial sequence;
           chloroplast
          Length = 832

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 3   acaagccctgtgatacat 20
           ||||||||||||||||||
Sbjct: 621 acaagccctgtgatacat 638



to top

>gb|AY913817.1| Hippophae neurocarpa subsp. neurocarpa voucher J.Q.Liu 1520B-e
           tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer,
           partial sequence; chloroplast
          Length = 830

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 3   acaagccctgtgatacat 20
           ||||||||||||||||||
Sbjct: 619 acaagccctgtgatacat 636



to top

>gb|AY913816.1| Hippophae goniocarpa voucher J.Q.Liu H18 tRNA-Leu (trnL) gene and
           trnL-trnF intergenic spacer, partial sequence;
           chloroplast
          Length = 830

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 3   acaagccctgtgatacat 20
           ||||||||||||||||||
Sbjct: 619 acaagccctgtgatacat 636



to top

>gb|AY913815.1| Hippophae neurocarpa subsp. neurocarpa voucher J.Q.Liu 1522B-1
           tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer,
           partial sequence; chloroplast
          Length = 832

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 3   acaagccctgtgatacat 20
           ||||||||||||||||||
Sbjct: 621 acaagccctgtgatacat 638



to top

>gb|AY913814.1| Hippophae rhamnoides subsp. sinensis voucher J.Q.Liu H11 tRNA-Leu
           (trnL) gene and trnL-trnF intergenic spacer, partial
           sequence; chloroplast
          Length = 831

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 3   acaagccctgtgatacat 20
           ||||||||||||||||||
Sbjct: 620 acaagccctgtgatacat 637



to top

>gb|AY913813.1| Hippophae neurocarpa subsp. neurocarpa voucher J.Q.Liu H8 tRNA-Leu
           (trnL) gene and trnL-trnF intergenic spacer, partial
           sequence; chloroplast
          Length = 831

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 3   acaagccctgtgatacat 20
           ||||||||||||||||||
Sbjct: 621 acaagccctgtgatacat 638



to top

>gb|AY913812.1| Hippophae rhamnoides subsp. sinensis voucher J.Q.Liu 1523B-a
           tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer,
           partial sequence; chloroplast
          Length = 830

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 3   acaagccctgtgatacat 20
           ||||||||||||||||||
Sbjct: 619 acaagccctgtgatacat 636



to top

>gb|AY913811.1| Hippophae goniocarpa voucher J.Q.Liu 1524-f tRNA-Leu (trnL) gene
           and trnL-trnF intergenic spacer, partial sequence;
           chloroplast
          Length = 830

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 3   acaagccctgtgatacat 20
           ||||||||||||||||||
Sbjct: 619 acaagccctgtgatacat 636



to top

>emb|AJ225801.1|HSJ225801 Hippophae salicifolia chloroplast DNA for trnL-F
          Length = 916

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 3   acaagccctgtgatacat 20
           ||||||||||||||||||
Sbjct: 661 acaagccctgtgatacat 644


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 219,313
Number of Sequences: 3902068
Number of extensions: 219313
Number of successful extensions: 48402
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48370
Number of HSP's gapped (non-prelim): 32
length of query: 44
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 24
effective length of database: 17,155,003,908
effective search space: 411720093792
effective search space used: 411720093792
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top