ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags9i05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AJ440011.1|HVU440011 Hordeum vulgare bnuc2 gene, promoter re... 129 1e-26
2gb|AC016827.7|ATAC016827 Arabidopsis thaliana chromosome III BAC... 44 0.56
3gb|DQ267106.1| Triticum urartu clone BAC 210J24 chromosome 4A, c... 44 0.56
4gb|AC104516.2| Drosophila melanogaster clone BACR20O17, complete... 42 2.2
5tpg|BK003203.1| TPA: TPA_inf: Drosophila melanogaster HDC19641 (... 42 2.2
6gb|AE003510.5| Drosophila melanogaster chromosome X, section 62 ... 42 2.2
7gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete... 40 8.8
8gb|DQ205341.1| Lycopersicon esculentum ethylene-responsive nucle... 40 8.8
9gb|CP000057.1| Haemophilus influenzae strain 86-028NP, complete ... 40 8.8
10gb|AY587989.1| Norovirus Hu/NLV/Oxford/B2S16/2002/UK, complete g... 40 8.8
11gb|AY588030.1| Norovirus Hu/NLV/Witney/B7S2/2003/UK non-structur... 40 8.8
12gb|AY588029.1| Norovirus Hu/NLV/Banbury/B9S23/2003/UK non-struct... 40 8.8
13gb|AY588028.1| Norovirus Hu/NLV/ChippingNorton/2003/UK non-struc... 40 8.8
14gb|AY588027.1| Norovirus Hu/NLV/Didcot/B9S2/2003/UK non-structur... 40 8.8
15gb|AY588025.1| Norovirus Hu/NLV/Oxford/B6S4/2003/UK non-structur... 40 8.8
16gb|AY588024.1| Norovirus Hu/NLV/Oxford/B6S5/2003/UK non-structur... 40 8.8
17gb|AY588023.1| Norovirus Hu/NLV/Oxford/B5S23/2003/UK non-structu... 40 8.8
18gb|AY588022.1| Norovirus Hu/NLV/Oxford/B6S2/2003/UK non-structur... 40 8.8
19gb|AY588021.1| Norovirus Hu/NLV/Oxford/B6S6/2003/UK non-structur... 40 8.8
20gb|AY588020.1| Norovirus Hu/NLV/Oxford/B6S3/2003/UK non-structur... 40 8.8
21gb|AY588012.1| Norovirus Hu/NLV/Oxford/B3S20/2003/UK non-structu... 40 8.8
22gb|AY588011.1| Norovirus Hu/NLV/Oxford/B3S19/2003/UK non-structu... 40 8.8
23gb|AY588010.1| Norovirus Hu/NLV/Oxford/B3S18/2003/UK non-structu... 40 8.8
24gb|AY588009.1| Norovirus Hu/NLV/Oxford/B3S16/2003/UK non-structu... 40 8.8
25gb|AY588008.1| Norovirus Hu/NLV/Oxford/B3S4/2003/UK non-structur... 40 8.8
26gb|AY588007.1| Norovirus Hu/NLV/Oxford/B2S26/2002/UK non-structu... 40 8.8
27gb|AY588006.1| Norovirus Hu/NLV/Oxford/B2S25/2002/UK non-structu... 40 8.8
28gb|AY588005.1| Norovirus Hu/NLV/Oxford/B2S24/2002/UK non-structu... 40 8.8
29gb|AY588004.1| Norovirus Hu/NLV/Oxford/B2S23/2002/UK non-structu... 40 8.8
30gb|AY588003.1| Norovirus Hu/NLV/Oxford/B2S20/2002/UK non-structu... 40 8.8
31gb|AY588002.1| Norovirus Hu/NLV/Oxford/B2S18/2002/UK non-structu... 40 8.8
32gb|AY588001.1| Norovirus Hu/NLV/Oxford/B2S17/2002/UK non-structu... 40 8.8
33gb|AY588000.1| Norovirus Hu/NLV/Oxford/B2S15/2002/UK non-structu... 40 8.8
34gb|AY587999.1| Norovirus Hu/NLV/Oxford/B2S14/2002/UK non-structu... 40 8.8
35gb|AY587998.1| Norovirus Hu/NLV/Oxford/B2S11/2002/UK non-structu... 40 8.8
36gb|AY587997.1| Norovirus Hu/NLV/Oxford/B2S10/2002/UK non-structu... 40 8.8
37gb|AY587996.1| Norovirus Hu/NLV/Oxford/B1S21/2002/UK non-structu... 40 8.8
38gb|AY587995.1| Norovirus Hu/NLV/Oxford/B1S16/2002/UK non-structu... 40 8.8
39gb|AY587994.1| Norovirus Hu/NLV/Oxford/B1S12/2002/UK non-structu... 40 8.8
40gb|AY587993.1| Norovirus Hu/NLV/Oxford/B1S11/2002/UK non-structu... 40 8.8
41gb|AY587992.1| Norovirus Hu/NLV/Oxford/B1S4/2002/UK non-structur... 40 8.8
42gb|AY587991.1| Norovirus Hu/NLV/Oxford/B1S2/2002/UK non-structur... 40 8.8
43gb|AY587990.1| Norovirus Hu/NLV/Oxford/B1S1/2002/UK non-structur... 40 8.8
44gb|AY581254.1| Human calicivirus Hu/NLV/Oxford/B5S22/2003/UK, co... 40 8.8
45gb|AC137529.3| Carollia perspicillata clone 6M17, complete sequence 40 8.8
46emb|CR352327.13| Zebrafish DNA sequence from clone CH211-194C22 ... 40 8.8
47emb|CR932271.1|CNS0KYK1 Dicer-like ribonuclease with mutated hel... 40 8.8
48emb|CR394556.10| Zebrafish DNA sequence from clone DKEY-79P17 in... 40 8.8
49gb|AC122298.3| Mus musculus BAC clone RP23-269A11 from 12, compl... 40 8.8
50gb|AC117210.3| Mus musculus BAC clone RP23-286E20 from 10, compl... 40 8.8
51gb|AC106845.8| Homo sapiens chromosome 8, clone RP11-183J19, com... 40 8.8
52gb|AY038600.2| Human calicivirus NLV/VA98387/1998 RNA polymerase... 40 8.8
53emb|BX005332.20| Zebrafish DNA sequence from clone CH211-103F14 ... 40 8.8
54gb|AC105630.4| Rattus norvegicus X BAC CH230-131N20 (Children's ... 40 8.8
55gb|AC113761.6| Rattus norvegicus X BAC CH230-91H16 (Children's H... 40 8.8
56gb|AC134333.3| Mus musculus BAC clone RP24-140M19 from chromosom... 40 8.8
57ref|NM_001025987.1| Caenorhabditis elegans C07A9.6 (UDP-glucuron... 40 8.8
58emb|AL935153.19| Zebrafish DNA sequence from clone CH211-226F24 ... 40 8.8
59emb|BX649390.12| Zebrafish DNA sequence from clone DKEY-261L2 in... 40 8.8
60gb|AC020611.15| Homo sapiens 12 BAC RP11-1029F8 (Roswell Park Ca... 40 8.8
61gb|AC005993.2|AC005993 Homo sapiens PAC clone RP6-114E22 from 14... 40 8.8
62emb|BX936328.7| Zebrafish DNA sequence from clone CH211-11F20 in... 40 8.8
63emb|AL929171.9| Zebrafish DNA sequence from clone CH211-132P20 i... 40 8.8
64emb|Z29094.1|CEC07A9 Caenorhabditis elegans Cosmid C07A9, comple... 40 8.8
65gb|DP000018.1| Carollia perspicillata target 1 genomic scaffold 40 8.8
66emb|AL663073.9| Mouse DNA sequence from clone RP23-197O6 on chro... 40 8.8 
>emb|AJ440011.1|HVU440011 Hordeum vulgare bnuc2 gene, promoter region
          Length = 1100

 Score =  129 bits (65), Expect = 1e-26
 Identities = 149/173 (86%), Gaps = 3/173 (1%)
 Strand = Plus / Plus

                                                                       
Query: 32  catagtacatacccctggnatcatacatacatagcatatttgggattgaagacgacacgt 91
           |||||||||||| | ||| |||||||||||||| |||| |||| ||||||||||||||||
Sbjct: 136 catagtacatacacttgg-atcatacatacatatcatacttgg-attgaagacgacacgt 193

                                                                       
Query: 92  ttactctt-taggttggtgcacaagcgagtatataatccatttgagtaatcgatctactg 150
           |||||||| ||||||||||||| ||||  ||| ||  ||||||||| |||||| ||| ||
Sbjct: 194 ttactcttataggttggtgcacgagcgcatatctagcccatttgagcaatcgagctattg 253

                                                                
Query: 151 tctcactaaaatccatgcaacacgagcttttcctgggtctcatattttgtgct 203
           |||| ||| | |||||||||||| ||||||||  |||||| | ||||||||||
Sbjct: 254 tctctctagagtccatgcaacaccagcttttctcgggtcttacattttgtgct 306
to top
>gb|AC016827.7|ATAC016827 Arabidopsis thaliana chromosome III BAC F17A9 genomic sequence,
             complete sequence
          Length = 90142

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 316   tttaatatcttgattaacaatt 337
             ||||||||||||||||||||||
Sbjct: 48003 tttaatatcttgattaacaatt 48024
to top
>gb|DQ267106.1| Triticum urartu clone BAC 210J24 chromosome 4A, complete sequence
          Length = 111912

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                           
Query: 552   tcatctccgttcttcaatgacaatgacgacgcaaacaactacatca 597
             ||||||||| ||||| |  || |||||| |||||||||||||||||
Sbjct: 94655 tcatctccggtcttcgacaacgatgacggcgcaaacaactacatca 94610



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 53    catacatacatagcatatttgggat 77
             ||||||||||||||||| |||||||
Sbjct: 98514 catacatacatagcatacttgggat 98538
to top
>gb|AC104516.2| Drosophila melanogaster clone BACR20O17, complete sequence
          Length = 174404

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 583   caaacaactacatcaaccaaa 603
             |||||||||||||||||||||
Sbjct: 71054 caaacaactacatcaaccaaa 71034
to top
>tpg|BK003203.1| TPA: TPA_inf: Drosophila melanogaster HDC19641 (HDC19641) gene,
           complete cds
          Length = 4447

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 583 caaacaactacatcaaccaaa 603
           |||||||||||||||||||||
Sbjct: 874 caaacaactacatcaaccaaa 854
to top
>gb|AE003510.5| Drosophila melanogaster chromosome X, section 62 of 74 of the complete
              sequence
          Length = 297236

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 583    caaacaactacatcaaccaaa 603
              |||||||||||||||||||||
Sbjct: 245729 caaacaactacatcaaccaaa 245709
to top
>gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete genome
          Length = 2201561

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 325     ttgattaacaattgcttgaatttt 348
               ||||| ||||||||||||||||||
Sbjct: 1467652 ttgataaacaattgcttgaatttt 1467675
to top
>gb|DQ205341.1| Lycopersicon esculentum ethylene-responsive nuclear protein (ERN1)
            mRNA, complete cds
          Length = 1584

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 290  gcaattttgtgaatcttcct 309
            ||||||||||||||||||||
Sbjct: 1340 gcaattttgtgaatcttcct 1321
to top
>gb|CP000057.1| Haemophilus influenzae strain 86-028NP, complete genome
          Length = 1913428

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 315     ttttaatatcttgattaacaattgcttgaatt 346
               |||||||||| | ||||| |||||||||||||
Sbjct: 1503637 ttttaatatcgttattaataattgcttgaatt 1503668
to top
>gb|AY587989.1| Norovirus Hu/NLV/Oxford/B2S16/2002/UK, complete genome
          Length = 7558

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 6790 catcaaccaaaaagttgagt 6809
to top
>gb|AY588030.1| Norovirus Hu/NLV/Witney/B7S2/2003/UK non-structural polyprotein gene,
            partial cds; and capsid protein and ORF3 genes, complete
            cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588029.1| Norovirus Hu/NLV/Banbury/B9S23/2003/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588028.1| Norovirus Hu/NLV/ChippingNorton/2003/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588027.1| Norovirus Hu/NLV/Didcot/B9S2/2003/UK non-structural polyprotein gene,
            partial cds; and capsid protein and ORF3 genes, complete
            cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588025.1| Norovirus Hu/NLV/Oxford/B6S4/2003/UK non-structural polyprotein gene,
            partial cds; and capsid protein and ORF3 genes, complete
            cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588024.1| Norovirus Hu/NLV/Oxford/B6S5/2003/UK non-structural polyprotein gene,
            partial cds; and capsid protein and ORF3 genes, complete
            cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588023.1| Norovirus Hu/NLV/Oxford/B5S23/2003/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588022.1| Norovirus Hu/NLV/Oxford/B6S2/2003/UK non-structural polyprotein gene,
            partial cds; and capsid protein and ORF3 genes, complete
            cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588021.1| Norovirus Hu/NLV/Oxford/B6S6/2003/UK non-structural polyprotein gene,
            partial cds; and capsid protein and ORF3 genes, complete
            cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588020.1| Norovirus Hu/NLV/Oxford/B6S3/2003/UK non-structural polyprotein gene,
            partial cds; and capsid protein and ORF3 genes, complete
            cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588012.1| Norovirus Hu/NLV/Oxford/B3S20/2003/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588011.1| Norovirus Hu/NLV/Oxford/B3S19/2003/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588010.1| Norovirus Hu/NLV/Oxford/B3S18/2003/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588009.1| Norovirus Hu/NLV/Oxford/B3S16/2003/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588008.1| Norovirus Hu/NLV/Oxford/B3S4/2003/UK non-structural polyprotein gene,
            partial cds; and capsid protein and ORF3 genes, complete
            cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588007.1| Norovirus Hu/NLV/Oxford/B2S26/2002/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588006.1| Norovirus Hu/NLV/Oxford/B2S25/2002/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588005.1| Norovirus Hu/NLV/Oxford/B2S24/2002/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588004.1| Norovirus Hu/NLV/Oxford/B2S23/2002/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588003.1| Norovirus Hu/NLV/Oxford/B2S20/2002/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588002.1| Norovirus Hu/NLV/Oxford/B2S18/2002/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588001.1| Norovirus Hu/NLV/Oxford/B2S17/2002/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY588000.1| Norovirus Hu/NLV/Oxford/B2S15/2002/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY587999.1| Norovirus Hu/NLV/Oxford/B2S14/2002/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY587998.1| Norovirus Hu/NLV/Oxford/B2S11/2002/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY587997.1| Norovirus Hu/NLV/Oxford/B2S10/2002/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY587996.1| Norovirus Hu/NLV/Oxford/B1S21/2002/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY587995.1| Norovirus Hu/NLV/Oxford/B1S16/2002/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY587994.1| Norovirus Hu/NLV/Oxford/B1S12/2002/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY587993.1| Norovirus Hu/NLV/Oxford/B1S11/2002/UK non-structural polyprotein
            gene, partial cds; and capsid protein and ORF3 genes,
            complete cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY587992.1| Norovirus Hu/NLV/Oxford/B1S4/2002/UK non-structural polyprotein gene,
            partial cds; and capsid protein and ORF3 genes, complete
            cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY587991.1| Norovirus Hu/NLV/Oxford/B1S2/2002/UK non-structural polyprotein gene,
            partial cds; and capsid protein and ORF3 genes, complete
            cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY587990.1| Norovirus Hu/NLV/Oxford/B1S1/2002/UK non-structural polyprotein gene,
            partial cds; and capsid protein and ORF3 genes, complete
            cds
          Length = 3255

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2487 catcaaccaaaaagttgagt 2506
to top
>gb|AY581254.1| Human calicivirus Hu/NLV/Oxford/B5S22/2003/UK, complete genome
          Length = 7558

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 6790 catcaaccaaaaagttgagt 6809
to top
>gb|AC137529.3| Carollia perspicillata clone 6M17, complete sequence
          Length = 118381

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 53    catacatacatagcatattt 72
             ||||||||||||||||||||
Sbjct: 88866 catacatacatagcatattt 88847
to top
>emb|CR352327.13| Zebrafish DNA sequence from clone CH211-194C22 in linkage group 8,
             complete sequence
          Length = 203325

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 190   tcatattttgtgctcattccttgg 213
             |||||||||||||||||| |||||
Sbjct: 94461 tcatattttgtgctcattacttgg 94438
to top
>emb|CR932271.1|CNS0KYK1 Dicer-like ribonuclease with mutated helicase and Rnase III
           domains, Paramecium tetraurelia macronuclear gene
          Length = 5172

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 aatcttcctcaacattttaa 320
           ||||||||||||||||||||
Sbjct: 802 aatcttcctcaacattttaa 821
to top
>emb|CR394556.10| Zebrafish DNA sequence from clone DKEY-79P17 in linkage group 9,
             complete sequence
          Length = 136863

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 124   taatccatttgagtaatcga 143
             ||||||||||||||||||||
Sbjct: 66418 taatccatttgagtaatcga 66437
to top
>gb|AC122298.3| Mus musculus BAC clone RP23-269A11 from 12, complete sequence
          Length = 151332

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 273   tatatttgctttgcattgca 292
             ||||||||||||||||||||
Sbjct: 17241 tatatttgctttgcattgca 17260
to top
>gb|AC117210.3| Mus musculus BAC clone RP23-286E20 from 10, complete sequence
          Length = 178173

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 313    cattttaatatcttgattaa 332
              ||||||||||||||||||||
Sbjct: 155802 cattttaatatcttgattaa 155821



 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 313    cattttaatatcttgattaa 332
              ||||||||||||||||||||
Sbjct: 127792 cattttaatatcttgattaa 127811
to top
>gb|AC106845.8| Homo sapiens chromosome 8, clone RP11-183J19, complete sequence
          Length = 166676

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 60     acatagcatatttgggattgaaga 83
              |||||||||||||||| |||||||
Sbjct: 100771 acatagcatatttgggtttgaaga 100794
to top
>gb|AY038600.2| Human calicivirus NLV/VA98387/1998 RNA polymerase mRNA, partial cds;
            and capsid and minor structural protein mRNAs, complete
            cds
          Length = 3241

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 593  catcaaccaaaaagttgagt 612
            ||||||||||||||||||||
Sbjct: 2470 catcaaccaaaaagttgagt 2489
to top
>emb|BX005332.20| Zebrafish DNA sequence from clone CH211-103F14 in linkage group 10,
             complete sequence
          Length = 189101

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 329   ttaacaattgcttgaatttt 348
             ||||||||||||||||||||
Sbjct: 62031 ttaacaattgcttgaatttt 62050
to top
>gb|AC105630.4| Rattus norvegicus X BAC CH230-131N20 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 86901

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 303   tcttcctcaacattttaata 322
             ||||||||||||||||||||
Sbjct: 57643 tcttcctcaacattttaata 57624
to top
>gb|AC113761.6| Rattus norvegicus X BAC CH230-91H16 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 232930

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 303   tcttcctcaacattttaata 322
             ||||||||||||||||||||
Sbjct: 66436 tcttcctcaacattttaata 66455
to top
>gb|AC134333.3| Mus musculus BAC clone RP24-140M19 from chromosome 10, complete
             sequence
          Length = 137079

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 313   cattttaatatcttgattaa 332
             ||||||||||||||||||||
Sbjct: 23427 cattttaatatcttgattaa 23446
to top
>ref|NM_001025987.1| Caenorhabditis elegans C07A9.6 (UDP-glucuronosyltransferase) mRNA,
           complete cds
          Length = 1602

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 293 attttgtgaatcttcctcaa 312
           ||||||||||||||||||||
Sbjct: 681 attttgtgaatcttcctcaa 700
to top
>emb|AL935153.19| Zebrafish DNA sequence from clone CH211-226F24 in linkage group 8,
             complete sequence
          Length = 173789

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 190   tcatattttgtgctcattccttgg 213
             |||||||||||||||||| |||||
Sbjct: 90101 tcatattttgtgctcattacttgg 90078
to top
>emb|BX649390.12| Zebrafish DNA sequence from clone DKEY-261L2 in linkage group 2,
             complete sequence
          Length = 184594

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 21    gatccattttgcatagtaca 40
             ||||||||||||||||||||
Sbjct: 45401 gatccattttgcatagtaca 45420
to top
>gb|AC020611.15| Homo sapiens 12 BAC RP11-1029F8 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 188972

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 334   aattgcttgaattttgtgcc 353
             ||||||||||||||||||||
Sbjct: 88695 aattgcttgaattttgtgcc 88714
to top
>gb|AC005993.2|AC005993 Homo sapiens PAC clone RP6-114E22 from 14, complete sequence
          Length = 143943

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    aaataacaatgatccatttt 30
             ||||||||||||||||||||
Sbjct: 17279 aaataacaatgatccatttt 17260
to top
>emb|BX936328.7| Zebrafish DNA sequence from clone CH211-11F20 in linkage group 18,
             complete sequence
          Length = 113038

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 53    catacatacatagcatattt 72
             ||||||||||||||||||||
Sbjct: 98245 catacatacatagcatattt 98264
to top
>emb|AL929171.9| Zebrafish DNA sequence from clone CH211-132P20 in linkage group 4,
              complete sequence
          Length = 176577

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 124    taatccatttgagtaatcga 143
              ||||||||||||||||||||
Sbjct: 116366 taatccatttgagtaatcga 116385
to top
>emb|Z29094.1|CEC07A9 Caenorhabditis elegans Cosmid C07A9, complete sequence
          Length = 66004

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 293   attttgtgaatcttcctcaa 312
             ||||||||||||||||||||
Sbjct: 15136 attttgtgaatcttcctcaa 15117
to top
>gb|DP000018.1| Carollia perspicillata target 1 genomic scaffold
          Length = 1501503

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 53     catacatacatagcatattt 72
              ||||||||||||||||||||
Sbjct: 536518 catacatacatagcatattt 536499
to top
>emb|AL663073.9| Mouse DNA sequence from clone RP23-197O6 on chromosome X, complete
              sequence
          Length = 192304

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 491    attgtttatctcatttccta 510
              ||||||||||||||||||||
Sbjct: 120518 attgtttatctcatttccta 120537


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,151,688
Number of Sequences: 3902068
Number of extensions: 6151688
Number of successful extensions: 108238
Number of sequences better than 10.0: 66
Number of HSP's better than 10.0 without gapping: 66
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 108083
Number of HSP's gapped (non-prelim): 153
length of query: 646
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 623
effective length of database: 17,143,297,704
effective search space: 10680274469592
effective search space used: 10680274469592
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top