ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags9g06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|D01000.1|RICSODB Oryza sativa mRNA for copper/zinc-superoxid... 422 e-115
2gb|AY109448.1| Zea mays CL1415_1 mRNA sequence 359 6e-96
3gb|BT017337.1| Zea mays clone EL01N0321D04.c mRNA sequence 351 2e-93
4emb|X17564.1|ZMSOD4A Zea mays mRNA for superoxide dismutase-4A (... 335 9e-89
5emb|X17565.1|ZMSOD4 Zea mays mRNA for superoxide dismutase-4AP (... 333 4e-88
6gb|AY103754.1| Zea mays PCO107770 mRNA sequence 315 8e-83
7gb|M15175.1|MZESOD2A Maize superoxide dismutase 2 (SOD2) mRNA, c... 299 5e-78
8gb|M54936.1|MZESOD2 Maize superoxide dismutase-2 (Sod-2) mRNA, c... 299 5e-78
9ref|NM_186073.1| Oryza sativa (japonica cultivar-group), mRNA 291 1e-75
10gb|L32834.1|ASNCZSD Aspergillus japonicus (clone Assod4-g) coppe... 264 3e-67
11dbj|AK120692.1| Oryza sativa (japonica cultivar-group) cDNA clon... 246 6e-62
12dbj|AK061662.1| Oryza sativa (japonica cultivar-group) cDNA clon... 246 6e-62
13dbj|D00999.1|RICSODA Oryza sativa mRNA for copper/zinc-superoxid... 246 6e-62
14gb|DQ058108.1| Oryza sativa (indica cultivar-group) cytoplasmic ... 238 2e-59
15gb|L36320.1|RICSOXDM Oryza sativa (clone cu101) superoxide dismu... 238 2e-59
16gb|AY823553.1| Pennisetum glaucum superoxide dismutase mRNA, par... 157 5e-35
17emb|AJ250667.1|ACO250667 Ananas comosus mRNA for copper/zinc-sup... 149 1e-32
18gb|AF479059.1| Sandersonia aurantiaca copper/zinc superoxide dis... 105 2e-19
19dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 105 2e-19
20dbj|AP003825.3| Oryza sativa (japonica cultivar-group) genomic D... 105 2e-19
21dbj|AP004274.5| Oryza sativa (japonica cultivar-group) genomic D... 105 2e-19
22gb|L19434.1|RICSODCC2A Oryza sativa cytosolic copper/zinc-supero... 105 2e-19
23emb|AJ586519.1| Fagus sylvatica partial sod1 mRNA for superoxide... 98 4e-17
24gb|AY646367.1| Malus xiaojinensis superoxide dismutase (Sod1) mR... 96 1e-16
25gb|AF037359.1|AF037359 Paulownia kawakamii superoxide dismutase ... 96 1e-16
26gb|AF009735.1| Raphanus sativus Cu/Zn superoxide dismutase (SOD)... 92 2e-15
27gb|AF328859.1| Avicennia marina Cu-Zn superoxide dismutase mRNA,... 90 9e-15
28gb|U34726.1|ZMU34726 Zea mays superoxide dismutase 4 (sod4) gene... 88 4e-14
29gb|AY833718.1| Codonopsis lanceolata CuZn superoxide dismutase (... 86 1e-13
30emb|AJ844003.1| Plantago major mRNA for copper-zinc superoxide d... 86 1e-13
31gb|U34727.1|ZMU34727 Zea mays superoxide dismutase 4A (sod4A) ge... 86 1e-13
32dbj|AB062752.1| Bruguiera gymnorhiza SodC mRNA for copper/zinc s... 86 1e-13
33gb|DQ078121.2| Rheum australe copper/zinc superoxide dismutase m... 84 6e-13
34gb|AF426829.1|AF426829 Olea europaea Cu/Zn-superoxide dismutase ... 82 2e-12
35gb|AF054150.1|AF054150 Zantedeschia aethiopica cytosolic Cu/Zn-s... 82 2e-12
36emb|Y13610.1|CPCZSD Carica papaya mRNA for copper/zinc-superoxid... 80 9e-12
37gb|DQ088818.1| Gossypium hirsutum cytoplasmic Cu/ZnSOD mRNA, com... 78 3e-11
38emb|AJ428575.2|OEU428575 Olea europaea Cu/Zn super-oxide dismuta... 78 3e-11
39emb|AJ278669.1|PTR278669 Populus tremula x Populus tremuloides m... 78 3e-11
40dbj|AB190501.1| Populus alba x Populus tremula var. glandulosa C... 78 3e-11
41dbj|AB190500.1| Populus alba x Populus tremula var. glandulosa C... 78 3e-11
42dbj|AB091055.1| Barbula unguiculata mRNA for cytosolic copper/zi... 78 3e-11
43gb|AF016892.1|AF016892 Populus tremuloides cytoplasmic superoxid... 78 3e-11
44gb|U80069.1|MCU80069 Mesembryanthemum crystallinum cytosolic cop... 78 3e-11
45emb|X95728.1|BJMSOD1GE B.juncea mRNA for Cu/Zn-superoxide dismutase 76 1e-10
46gb|AF071112.1|AF071112 Brassica rapa ssp. pekinensis cytosolic C... 76 1e-10
47gb|AY694187.1| Camellia sinensis Cu/Zn superoxide dismutase mRNA... 74 5e-10
48gb|DQ481231.1| Populus suaveolens cytoplasmic Cu/Zn-superoxide d... 74 5e-10
49gb|DQ499511.1| Arachis hypogaea cultivar JL-24 Cu-Zn superoxide ... 74 5e-10
50emb|X73139.1|IBSOD I.batatas mRNA for superoxide dismutase 74 5e-10
51gb|DQ097721.1| Arachis hypogaea Cu-Zn superoxide dismutase mRNA,... 74 5e-10
52emb|AJ786258.1| Helianthus annuus mRNA for Cu/Zn superoxide dism... 74 5e-10
53gb|AF355460.1|AF355460 Solanum tuberosum Cu/Zn-superoxide dismut... 74 5e-10
54gb|AF354748.1|AF354748 Solanum tuberosum copper-zinc superoxide ... 74 5e-10
55ref|NM_100757.2| Arabidopsis thaliana CSD1; copper, zinc superox... 72 2e-09
56gb|DQ227345.1| Nelumbo nucifera isolate 0 copper-zinc superoxide... 72 2e-09
57gb|AY091168.1| Arabidopsis thaliana putative superoxide dismutas... 72 2e-09
58gb|AY050932.1| Arabidopsis thaliana putative superoxidase dismut... 72 2e-09
59emb|X60935.1|ATCZSUDI A.thaliana mRNA for Cu,Zn superoxide dismu... 72 2e-09
60emb|X55974.1|NPSODM N.plumbaginifolia mRNA for superoxide dismutase 72 2e-09
61emb|BX818158.1|CNS0AE2K Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
62gb|AY087273.1| Arabidopsis thaliana clone 33493 mRNA, complete s... 72 2e-09
63gb|AY881163.1| Nelumbo nucifera isolate 13 copper-zinc superoxid... 72 2e-09
64gb|AY881162.1| Nelumbo nucifera isolate 11 copper-zinc superoxid... 72 2e-09
65gb|AY881155.1| Nelumbo nucifera isolate 4 copper-zinc superoxide... 72 2e-09
66emb|X14040.1|LECYTSOD Tomato mRNA for cytoplasmic Cu-Zn superoxi... 70 8e-09
67emb|AJ844861.1| Drosophila bipectinata partial Sod gene, exons 1... 70 8e-09
68emb|AJ844854.1| Drosophila malerkotliana pallens partial Sod gen... 70 8e-09
69emb|AJ844850.1| Drosophila bipectinata partial Sod gene, exons 1... 70 8e-09
70emb|AJ844844.1| Drosophila malerkotliana malerkotliana partial S... 70 8e-09
71gb|M37150.1|TOMSODA Tomato superoxide dismutase (SOD) mRNA, comp... 70 8e-09
72gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 68 3e-08
73gb|AC135257.1| Genomic sequence for Oryza sativa, Nipponbare str... 68 3e-08
74emb|X53872.1|SOSODCY Spinacia oleracea mRNA for cytosolic copper... 68 3e-08
75emb|AJ844862.1| Drosophila bipectinata partial Sod gene, exons 1... 68 3e-08
76dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 68 3e-08
77gb|L19435.1|RICSODCC Oryza sativa cytosolic copper/zinc-superoxi... 68 3e-08
78emb|X58578.1|PSCUZNPS3 P.sylvestris mRNA for CuZn superoxide dis... 66 1e-07
79emb|AJ844839.1| Drosophila malerkotliana malerkotliana partial S... 66 1e-07
80emb|AJ278671.1|PTR278671 Populus tremula x Populus tremuloides m... 66 1e-07
81emb|AJ278670.1|PTR278670 Populus tremula x Populus tremuloides p... 66 1e-07
82dbj|D49485.1| Solidago canadensis var. scabra mRNA for copper/zi... 66 1e-07
83gb|AY642137.1| Manihot esculenta copper/zinc superoxide dismutas... 66 1e-07
84gb|DQ124227.1| Fagus sylvatica putative copper/zinc-superoxide d... 64 5e-07
85emb|BX816203.1|CNS0AE91 Arabidopsis thaliana Full-length cDNA Co... 64 5e-07
86gb|AF016893.1|AF016893 Populus tremuloides copper/zinc-superoxid... 64 5e-07
87gb|AF318938.1| Citrus limon copper/zinc superoxide dismutase mRN... 62 2e-06
88emb|AJ844865.1| Drosophila parabipectinata partial Sod gene, exo... 62 2e-06
89emb|AJ844860.1| Drosophila bipectinata partial Sod gene, exons 1... 62 2e-06
90emb|AJ844859.1| Drosophila bipectinata partial Sod gene, exons 1... 62 2e-06
91emb|AJ844855.1| Drosophila malerkotliana pallens partial Sod gen... 62 2e-06
92gb|AF191342.1| Olea europaea copper/zinc superoxide dismutase (S... 62 2e-06
93gb|AY881165.1| Nelumbo nucifera isolate 16 copper-zinc superoxid... 62 2e-06
94gb|AY881164.1| Nelumbo nucifera isolate 14 copper-zinc superoxid... 62 2e-06
95gb|AF009734.1|AF009734 Capsicum annuum Cu/Zn superoxide dismutas... 62 2e-06
96gb|DQ431473.1| Malus xiaojinensis Sod2 (Sod2) mRNA, complete cds 60 8e-06
97gb|S72444.1| Drosophila subobscura Sod gene, partial cds 60 8e-06
98gb|AC003981.2|AC003981 Genomic sequence for Arabidopsis thaliana... 60 8e-06
99gb|AF457209.1| Hevea brasiliensis Cu/Zn superoxide dismutase (Cu... 60 8e-06
100gb|L13281.1|DROCUZNSOD Drosophila willistoni Cu/Zn-superoxide di... 60 8e-06
101gb|AF034630.1|AF034630 Panax ginseng Cu/Zn superoxide dismutase ... 60 8e-06
102gb|AF540558.1| Brassica juncea clone SOD 8A superoxide dismutase... 58 3e-05
103emb|AJ012739.1|CAR012739 Cicer arietinum mRNA for superoxide dis... 58 3e-05
104emb|AJ012691.1|CAR012691 Cicer arietinum mRNA for superoxide dis... 58 3e-05
105dbj|AB189165.1| Pisum sativum mRNA for copper zinc superoxide di... 58 3e-05
106dbj|AB087845.1| Pisum sativum SOD mRNA for superoxide dismutase,... 58 3e-05
107gb|AF170297.1|AF170297 Manihot esculenta copper/zinc-superoxide ... 58 3e-05
108gb|U37714.1|DHU37714 Drosophila hydei Cu,Zn superoxide dismutase... 58 3e-05
109gb|M63003.1|PEACUZNSD Pea Cu-Zn superoxide dismutase mRNA, compl... 58 3e-05
110gb|DQ178940.1| Cucumis sativus Cu/Zn superoxide dismutase 1 mRNA... 56 1e-04
111emb|X95726.1|BJMSOD2GE B.juncea mRNA for Cu/Zn-superoxide dismutase 56 1e-04
112gb|DQ445093.1| Gossypium hirsutum putative cytosolic copper/zinc... 56 1e-04
113gb|AF127156.1| Drosophila erecta Cu-Zn superoxide dismutase (Sod... 56 1e-04
114gb|AY335229.1| Drosophila sucinea clone D.suc23 superoxide dismu... 56 1e-04
115gb|AY335228.1| Drosophila capricorni clone D.cap3 superoxide dis... 56 1e-04
116gb|AY335226.1| Drosophila capricorni clone D.cap1 superoxide dis... 56 1e-04
117gb|AF021825.1|AF021825 Drosophila immigrans superoxide dismutase... 56 1e-04
118gb|U47868.1|DAU47868 Drosophila ambigua NDSSC 14011-0091.1 Cu,Zn... 56 1e-04
119gb|AY257198.1| Lotus corniculatus var. japonicus cytosolic CuZn-... 54 5e-04
120emb|Z19591.1|DMCZSUDMA D.melanogaster Cu-Zn superoxide dismutase... 52 0.002
121emb|Y00367.1|DMSOD Drosophila mRNA for Cu-Zn superoxide dismutase 52 0.002
122emb|X17332.1|DMSODG2 Drosophila Cu-Zn superoxide dismutase gene ... 52 0.002
123emb|X13780.1|DMSODG Drosophila melanogaster sod gene for Cu-Zn s... 52 0.002
124gb|AC010023.6| Drosophila melanogaster 3L BAC RP98-19G23 (Roswel... 52 0.002
125gb|AC096692.5| Drosophila melanogaster 3L BAC RP98-48O3 (Roswell... 52 0.002
126ref|NM_057387.3| Drosophila melanogaster Superoxide dismutase CG... 52 0.002
127gb|AY071435.1| Drosophila melanogaster RE52090 full length cDNA 52 0.002
128gb|AF127158.1| Drosophila mauritiana Cu-Zn superoxide dismutase ... 52 0.002
129gb|AF127157.1| Drosophila sechellia Cu-Zn superoxide dismutase (... 52 0.002
130gb|AY335227.1| Drosophila capricorni clone D.cap2 superoxide dis... 52 0.002
131gb|AC006562.8|AC006562 Drosophila melanogaster, chromosome 3L, r... 52 0.002
132gb|S72589.1|S72589 Drosophila melanogaster slow superoxide dismu... 52 0.002
133gb|AE003546.4| Drosophila melanogaster chromosome 3L, section 39... 52 0.002
134gb|U47892.1|DOU47892 Drosophila obscura Cu,Zn superoxide dismuta... 52 0.002
135gb|M24421.1|DROSODCUZN Drosophila melanogaster Cu-Zn superoxide ... 52 0.002
136gb|AY804513.1| Drosophila yakuba strain Tai18 sod (sod) gene, pa... 50 0.008
137gb|AY804512.1| Drosophila santomea strain STO.4 sod (sod) gene, ... 50 0.008
138emb|X56435.1|PSSODII Pea mRNA for Cu/Zn superoxide dismutase II ... 50 0.008
139gb|DQ286712.1| Eisenia fetida superoxide dismutase mRNA, partial... 50 0.008
140gb|AF127160.1| Drosophila teissieri Cu-Zn superoxide dismutase (... 50 0.008
141gb|AF127159.1| Drosophila yakuba Cu-Zn superoxide dismutase (Sod... 50 0.008
142gb|AF021830.1|AF021830 Drosophila nebulosa superoxide dismutase ... 50 0.008
143gb|AF021829.1|AF021829 Drosophila paulistorum superoxide dismuta... 50 0.008
144gb|AF021828.1|AF021828 Drosophila teissieri superoxide dismutase... 50 0.008
145gb|AF021824.1|AF021824 Hirtodrosophila pictiventris superoxide d... 50 0.008
146gb|AF021823.1|AF021823 Zaprionus tuberculatus superoxide dismuta... 50 0.008
147emb|AL670114.17| Mouse DNA sequence from clone RP23-7C19 on chro... 50 0.008
148gb|U08097.1|PTU08097 Populus tremuloides Cu/Zn-superoxide dismut... 50 0.008
149gb|J04087.1|PEASOD Pea chloroplastic copper/zinc-superoxide dism... 50 0.008
150gb|DQ088819.1| Gossypium hirsutum chloroplast Cu/ZnSOD mRNA, com... 48 0.031
151gb|AC156827.4| Medicago truncatula clone mth2-15c17, complete se... 48 0.031
152gb|DQ120514.1| Gossypium hirsutum chloroplast Cu/Zn superoxide d... 48 0.031
153emb|X87372.1|LESODCC L.esculentum SodCc;Le;2 gene 48 0.031
154gb|AY898945.1| Lilium hybrid cultivar superoxide dismutase (SOD)... 48 0.031
155dbj|AB066500.1| Barbula unguiculata mRNA for chloroplastic coppe... 48 0.031
156gb|AF059879.1|AF059879 Drosophila immigrans Cu-Zn superoxide dis... 48 0.031
157gb|AF021822.1|AF021822 Scaptodrosophila lebanonensis superoxide ... 48 0.031
158gb|L08253.1|TOBCCZSODM Nicotiana plumbaginifolia Cu/Zn-superoxid... 48 0.031
159gb|DQ440061.1| Aedes aegypti clone AE-321 Cu2+/Zn2+ superoxide d... 46 0.12
160emb|AJ971950.1| Pinus pinea partial mRNA for chloroplast CuZn su... 46 0.12
161gb|AY434497.1| Trifolium pratense superoxide dismutase mRNA, com... 46 0.12
162gb|AC126007.16| Medicago truncatula clone mth2-11o4, complete se... 46 0.12
163emb|X58579.1|PSCUZNPST P.sylvestris mRNA for CuZn superoxide dis... 46 0.12
164emb|X15685.1|DSSOD Drosophila simulans DNA for Cu-Zn superoxide ... 46 0.12
165emb|AJ279694.1|BPE279694 Betula pendula partial mRNA for copper/... 46 0.12
166gb|AY867724.1| Pinus taeda isolate FBRC30 chloroplast Cu/Zn supe... 46 0.12
167gb|AY867723.1| Pinus taeda isolate FBRC29 chloroplast Cu/Zn supe... 46 0.12
168gb|AY867722.1| Pinus taeda isolate FBRC28 chloroplast Cu/Zn supe... 46 0.12
169gb|AY867719.1| Pinus taeda isolate FBRC25 chloroplast Cu/Zn supe... 46 0.12
170gb|AY867717.1| Pinus taeda isolate FBRC23 chloroplast Cu/Zn supe... 46 0.12
171gb|AY867714.1| Pinus taeda isolate FBRC20 chloroplast Cu/Zn supe... 46 0.12
172gb|AY867713.1| Pinus taeda isolate FBRC19 chloroplast Cu/Zn supe... 46 0.12
173gb|AY867712.1| Pinus taeda isolate FBRC18 chloroplast Cu/Zn supe... 46 0.12
174gb|AY867710.1| Pinus taeda isolate FBRC16 chloroplast Cu/Zn supe... 46 0.12
175gb|AY867708.1| Pinus taeda isolate FBRC14 chloroplast Cu/Zn supe... 46 0.12
176gb|AY867707.1| Pinus taeda isolate FBRC13 chloroplast Cu/Zn supe... 46 0.12
177gb|AY867706.1| Pinus taeda isolate FBRC12 chloroplast Cu/Zn supe... 46 0.12
178gb|AY867703.1| Pinus taeda isolate FBRC9 chloroplast Cu/Zn super... 46 0.12
179gb|AY867702.1| Pinus taeda isolate FBRC8 chloroplast Cu/Zn super... 46 0.12
180gb|AY867700.1| Pinus taeda isolate FBRC6 chloroplast Cu/Zn super... 46 0.12
181gb|AY867697.1| Pinus taeda isolate FBRC3 chloroplast Cu/Zn super... 46 0.12
182gb|AF434186.1|AF434186 Pinus pinaster Cu-Zn-superoxide dismutase... 46 0.12
183gb|AF056621.1|AF056621 Medicago sativa putative Cu/Zn superoxide... 46 0.12
184gb|AY172569.1| Helianthus annuus cultivar EL64 cytosolic Cu/Zn-s... 44 0.48
185emb|AJ971949.1| Pinus pinea partial mRNA for cytosolic CuZn supe... 44 0.48
186gb|AC130711.3| Mus musculus BAC clone RP23-22M24 from chromosome... 44 0.48
187gb|AC130801.16| Medicago truncatula clone mth2-12p19, complete s... 44 0.48
188emb|X61687.1|CASOD C.amoena sod gene for Cu,Zn superoxidase dism... 44 0.48
189gb|AC158975.9| Mus musculus chromosome 18, clone RP24-192J22, co... 44 0.48
190dbj|AK144519.1| Mus musculus 13 days embryo brain cDNA, RIKEN fu... 44 0.48
191gb|AF127155.1| Drosophila orena Cu-Zn superoxide dismutase (Sod)... 44 0.48
192gb|AF220294.1|AF220294 Mus musculus clone BAC126c8 Rsp29-like pr... 44 0.48
193gb|AY754566.1| Drosophila miranda strain MSH22 superoxide dismut... 44 0.48
194gb|AF021826.1|AF021826 Drosophila guttifera superoxide dismutase... 44 0.48
195gb|AC119259.15| Mus musculus chromosome 18, clone RP24-285N19, c... 44 0.48
196gb|AC154229.1| Mus musculus BAC clone RP24-155I8 from 17, comple... 44 0.48
197gb|U47873.1|DPU47873 Drosophila persimilis NDSSC 14011-0111.2 Cu... 44 0.48
198gb|U47872.1|DPU47872 Drosophila pseudoobscura bogotana NDSSC 140... 44 0.48
199gb|U47871.1|DPU47871 Drosophila pseudoobscura pseudoobscura NDSS... 44 0.48
200gb|U47870.1|DMU47870 Drosophila miranda NDSSC 14011-0101.1 Cu,Zn... 44 0.48
201gb|U47869.1|DBU47869 Drosophila bifasciata NDSSC 14012-0181.0 Cu... 44 0.48
202gb|L36229.1|IPBCCZS Ipomoea batatas cytosolic Cu/Zn-superoxide d... 44 0.48
203gb|M61170.2|HUMPEM Human polymorphic epithelial mucin (PEM) gene... 42 1.9
204gb|L41624.1|GIBMUC1A01 Hylobates lar mucin (MUC1) gene, exons 1 ... 42 1.9
205gb|BT012694.1| Lycopersicon esculentum clone 113564F, mRNA sequence 42 1.9
206gb|AF385581.2| Dichanthelium lanuginosum copper/zinc superoxide ... 42 1.9
207gb|AY463543.1| Homo sapiens mucin 1, transmembrane (MUC1) gene, ... 42 1.9
208gb|AC146631.27| Medicago truncatula clone mth2-7g1, complete seq... 42 1.9
209emb|AL713999.28| Human DNA sequence from clone RP11-263K19 on ch... 42 1.9
210emb|AL359390.14| Human DNA sequence from clone RP11-139E24 on ch... 42 1.9
211emb|X14041.1|LECHSOD Tomato mRNA for chloroplast Cu-Zn superoxid... 42 1.9
212emb|X13831.1|DVSOD Drosophila sod gene for Cu-Zn superoxide dism... 42 1.9
213gb|AY081436.1| Drosophila guttifera superoxide dismutase (Sod) g... 42 1.9
214gb|AY081435.1| Drosophila flexa superoxide dismutase (Sod) gene,... 42 1.9
215gb|AY081434.1| Drosophila ornatipennis superoxide dismutase (Sod... 42 1.9
216gb|AY081433.1| Drosophila nannoptera superoxide dismutase (Sod) ... 42 1.9
217dbj|D49486.1| Solidago canadensis var. scabra mRNA for copper/zi... 42 1.9
218ref|NM_143372.1| Drosophila melanogaster huntingtin CG9995-RA (h... 42 1.9
219gb|AC007827.5|AC007827 Drosophila melanogaster, chromosome 3R, r... 42 1.9
220gb|L06162.1|HUMDF3Z Homo sapiens breast carcinoma-associated ant... 42 1.9
221gb|AY754565.1| Drosophila affinis superoxide dismutase (Sod) gen... 42 1.9
222gb|AF147779.1|AF147779 Drosophila melanogaster Huntington diseas... 42 1.9
223gb|AF146362.1|AF146362 Drosophila melanogaster Huntington diseas... 42 1.9
224gb|AF177386.1|AF177386 Drosophila melanogaster huntingtin homolo... 42 1.9
225gb|AE003766.2| Drosophila melanogaster chromosome 3R, section 10... 42 1.9
226emb|X77175.1|LESOD1 L.esculentum (cherry tomato) SOD Cp;Le:1 gen... 42 1.9
227dbj|AP002832.3| Homo sapiens genomic DNA, chromosome 11q, clone:... 42 1.9
228gb|U39445.1|DBU39445 Drosophila busckii Cu,Zn superoxide dismuta... 42 1.9
229emb|X69118.1|HSMUC1PS H.sapiens promoter sequence of MUC1 gene 42 1.9
230gb|M37151.1|TOMSODB Tomato superoxide dismutase (SOD) mRNA, comp... 42 1.9
231ref|NM_000730.2| Homo sapiens cholecystokinin A receptor (CCKAR)... 40 7.5
232gb|AC145322.2| Oryza sativa (japonica cultivar-group) chromosome... 40 7.5
233gb|BC074987.2| Homo sapiens cholecystokinin A receptor, mRNA (cD... 40 7.5
234gb|DQ497636.1| Thermoascus aurantiacus var. levisporus Cu,Zn-sup... 40 7.5
235gb|DQ226932.1| Boechera divaricarpa isolate SLW-E-A10 mRNA sequence 40 7.5
236gb|AY566699.1| Citrullus lanatus copper-zinc superoxide dismutas... 40 7.5
237ref|XM_748622.1| Aspergillus fumigatus Af293 Cu,Zn superoxide di... 40 7.5
238ref|XM_385171.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 40 7.5
239gb|AF264031.1| Callinectes sapidus extracellular Cu, Zn-superoxi... 40 7.5
240ref|XM_503850.1| Yarrowia lipolytica CLIB122, YALI0E12133g predi... 40 7.5
241gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete ... 40 7.5
242gb|AY322549.1| Homo sapiens cholecystokinin A receptor mRNA, com... 40 7.5
243emb|BX842646.1| Bdellovibrio bacteriovorus complete genome, stra... 40 7.5
244emb|AJ002604.1|PSAJ2604 Pinus sylvestris mRNA for novel high pI ... 40 7.5
245emb|AJ307586.1|PSY307586 Pinus sylvestris mRNA for superoxide di... 40 7.5
246emb|AJ305146.1|PAN305146 Podospora anserina sod1 gene for copper... 40 7.5
247emb|AJ278668.1|PTR278668 Populus tremula x Populus tremuloides c... 40 7.5
248gb|AF401280.1| Aspergillus flavus Cu,Zn-superoxide dismutase mRN... 40 7.5
249dbj|AB226266.1| Aspergillus oryzae cDNA, contig sequence: AoEST3125 40 7.5
250dbj|AB223448.1| Aspergillus oryzae cDNA, contig sequence: AoEST0280 40 7.5
251gb|AC093637.5| Homo sapiens BAC clone RP11-239C17 from 4, comple... 40 7.5
252dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.5
253dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.5
254gb|AC140006.1| Oryza sativa (japonica cultivar-group) chromosome... 40 7.5
255gb|AC104474.2| Oryza sativa (japonica cultivar-group) chromosome... 40 7.5
256dbj|AP005457.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.5
257gb|AF128886.1|AF128886 Aspergillus fumigatus Cu,Zn superoxide di... 40 7.5
258dbj|AK107208.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.5
259dbj|AK073785.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.5
260gb|AF021827.1|AF021827 Scaptomyza adusta superoxide dismutase (S... 40 7.5
261dbj|AK061281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.5
262dbj|D85606.1| Homo sapiens gene for cholecystokinin type-A recep... 40 7.5
263gb|AF059886.1|AF059886 Drosophila tanythrix Cu-Zn superoxide dis... 40 7.5
264gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 7.5
265gb|AF021821.1|AF021821 Chymomyza procnemis superoxide dismutase ... 40 7.5
266emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 40 7.5
267gb|U23430.1|HSCCKA4 Human cholecystokinin type A receptor (CCK-A... 40 7.5
268gb|L13605.1|HUMCCKAR Human cholecystokinin A receptor mRNA, comp... 40 7.5
269gb|L19315.1|HUMCHOLREC Human cholecystokinin A receptor mRNA, co... 40 7.5

>dbj|D01000.1|RICSODB Oryza sativa mRNA for copper/zinc-superoxide dismutase, complete
           cds, clone:RSODB
          Length = 667

 Score =  422 bits (213), Expect = e-115
 Identities = 399/461 (86%)
 Strand = Plus / Plus

                                                                       
Query: 87  gagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaag 146
           |||| |||||| ||||||||||||||||| ||||||||| |  |||| ||||||||||||
Sbjct: 1   gagaacacatagacaatggtgaaggctgttgctgtgcttgctagcagtgagggtgtcaag 60

                                                                       
Query: 147 ggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgggaagtgtcacg 206
           ||||||||||| ||| |||| ||||||||||| |||||| ||||||||||||||||| | 
Sbjct: 61  ggcaccatctttttctcccaagagggagatggtccgacctctgtgacgggaagtgtctct 120

                                                                       
Query: 207 ggactcaaggaagggctccacggcttccatgtgcacgctcttggtgacaccaccaacggc 266
           || ||||||  ||||||||| || |||||||||||||| || ||||||||||| || |||
Sbjct: 121 gggctcaagccagggctccatggattccatgtgcacgcgctcggtgacaccactaatggc 180

                                                                       
Query: 267 tgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatggggcacccgaagat 326
           ||||||||||||||||| |||||||| ||  ||||  | |  |||||||||||  |||||
Sbjct: 181 tgcatgtcaactggaccacacttcaatcctactgggaaggaacatggggcaccacaagat 240

                                                                       
Query: 327 gaaatccgccatgctggtgacctcggaaatgtgacagctggagcggatggtgttgctaac 386
           || | ||||||||| ||||| || |||||| | ||||||||||| |||||||||||||| 
Sbjct: 241 gagaaccgccatgccggtgatcttggaaatataacagctggagcagatggtgttgctaat 300

                                                                       
Query: 387 atcaatgttactgacggccatatcccccttgctggaccacattcaatcattggccgtgct 446
            |||||||  ||||| |||| ||||||||| ||||| |||| || ||||||||||| |||
Sbjct: 301 gtcaatgtctctgacagccagatcccccttactggagcacactccatcattggccgagct 360

                                                                       
Query: 447 gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaagagc 506
           ||||| ||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
Sbjct: 361 gttgttgtccatgctgatcctgatgatcttggcaagggtggacatgagcttagcaagacc 420

                                                    
Query: 507 actggaaacgctggggcgcgtgttgcttgcgggatcatcgg 547
           |||||||| |||||||  || ||||||||||| ||||||||
Sbjct: 421 actggaaatgctgggggccgagttgcttgcggaatcatcgg 461



to top

>gb|AY109448.1| Zea mays CL1415_1 mRNA sequence
          Length = 1046

 Score =  359 bits (181), Expect = 6e-96
 Identities = 391/461 (84%)
 Strand = Plus / Plus

                                                                       
Query: 84  cctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtc 143
           |||||||||||||| ||||||||||||||||| |||||||||    ||||||| ||||||
Sbjct: 202 cctgagatcacataaacaatggtgaaggctgttgctgtgcttggtagcagcgatggtgtc 261

                                                                       
Query: 144 aagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgggaagtgtc 203
           ||||||||||||||||||||||| |||||||||||||| ||| |||| || |||||||||
Sbjct: 262 aagggcaccatcttcttcacccaagagggagatggccctaccgctgtcaccggaagtgtc 321

                                                                       
Query: 204 acgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgacaccaccaac 263
            | || ||||||   || ||||| || |||||||| || || ||||||||||||||||| 
Sbjct: 322 tctggcctcaagcctggcctccatgggttccatgtacatgcacttggtgacaccaccaat 381

                                                                       
Query: 264 ggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatggggcacccgaa 323
           || ||||||||||||||||| |||| ||| || ||  |  | | |||||||||||| |||
Sbjct: 382 ggatgcatgtcaactggaccacactacaatcctgcgagcaaggagcatggggcaccagaa 441

                                                                       
Query: 324 gatgaaatccgccatgctggtgacctcggaaatgtgacagctggagcggatggtgttgct 383
           ||||| | ||||||||||||||| || ||||| |||||||||||||| ||||||||||||
Sbjct: 442 gatgagaaccgccatgctggtgatcttggaaacgtgacagctggagcagatggtgttgct 501

                                                                       
Query: 384 aacatcaatgttactgacggccatatcccccttgctggaccacattcaatcattggccgt 443
           || |||||||| || ||| |||| ||||| ||  |||| ||| | |||||||||||| | 
Sbjct: 502 aatatcaatgtcaccgacagccagatcccactgactgggccaaactcaatcattggcaga 561

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| || || | |||| ||||||||||||| |||||||| || ||||| ||||||
Sbjct: 562 gctgttgttgttcacgctgatcctgatgatcttggaaagggtgggcacgagctcagcaag 621

                                                    
Query: 504 agcactggaaacgctggggcgcgtgttgcttgcgggatcat 544
           |||||||||||||| || |  ||||||||||| ||||||||
Sbjct: 622 agcactggaaacgccggtggccgtgttgcttgtgggatcat 662



to top

>gb|BT017337.1| Zea mays clone EL01N0321D04.c mRNA sequence
          Length = 756

 Score =  351 bits (177), Expect = 2e-93
 Identities = 396/469 (84%)
 Strand = Plus / Plus

                                                                       
Query: 76  gggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcg 135
           ||||||| | |||||||||||| ||||||||||||||||| |||||||||    |||| |
Sbjct: 37  gggggtcccttgagatcacataaacaatggtgaaggctgttgctgtgcttggtagcagtg 96

                                                                       
Query: 136 agggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgg 195
           | |||||||||||||||||||| |||||||| |||||||||||||| ||| |||| || |
Sbjct: 97  atggtgtcaagggcaccatctttttcacccaagagggagatggccctaccgctgtcaccg 156

                                                                       
Query: 196 gaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgaca 255
           |||||||| | || ||||||   || ||||| || |||||||| || || ||||||||||
Sbjct: 157 gaagtgtctctggcctcaagcctggcctccatgggttccatgtacatgcacttggtgaca 216

                                                                       
Query: 256 ccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatgggg 315
           ||||||| || ||||||||||||||||| |||| ||| || ||  |  | | ||||||||
Sbjct: 217 ccaccaatggatgcatgtcaactggaccacactacaatcctgcgagcaaggagcatgggg 276

                                                                       
Query: 316 cacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggagcggatg 375
           |||| |||||||| | ||||||||| ||||| || |||||||||||||||||||| ||||
Sbjct: 277 caccagaagatgagaaccgccatgccggtgatcttggaaatgtgacagctggagcagatg 336

                                                                       
Query: 376 gtgttgctaacatcaatgttactgacggccatatcccccttgctggaccacattcaatca 435
           |||||||||| |||||||| |||||| |||| ||||| ||  |||| ||| | |||||||
Sbjct: 337 gtgttgctaatatcaatgtcactgacagccagatcccactgactgggccaaactcaatca 396

                                                                       
Query: 436 ttggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagc 495
           ||||| | |||||||| || || | |||| ||||||||||||| |||||||| || ||||
Sbjct: 397 ttggcagagctgttgttgttcacgctgatcctgatgatcttggaaagggtgggcacgagc 456

                                                            
Query: 496 ttagcaagagcactggaaacgctggggcgcgtgttgcttgcgggatcat 544
           | |||||||||||||||||||| || |  ||||||||||| ||||||||
Sbjct: 457 tgagcaagagcactggaaacgccggtggccgtgttgcttgtgggatcat 505



to top

>emb|X17564.1|ZMSOD4A Zea mays mRNA for superoxide dismutase-4A (Sod4A gene)
          Length = 691

 Score =  335 bits (169), Expect = 9e-89
 Identities = 395/469 (84%), Gaps = 1/469 (0%)
 Strand = Plus / Plus

                                                                       
Query: 76  gggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcg 135
           ||||||| |||||||||||||| ||| ||||||||||||| ||||||||     ||||||
Sbjct: 24  gggggtcgcctgagatcacataaaca-tggtgaaggctgttgctgtgctgggtagcagcg 82

                                                                       
Query: 136 agggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgg 195
           | |||||||||||||||||||| |||||||| |||||||||||||| ||| |||| || |
Sbjct: 83  atggtgtcaagggcaccatctttttcacccaagagggagatggccctaccgctgtcactg 142

                                                                       
Query: 196 gaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgaca 255
           |||||||| | || ||||||   || ||||| || |||||||| || || ||||||||||
Sbjct: 143 gaagtgtctctggcctcaagcctggcctccatgggttccatgtacatgcacttggtgaca 202

                                                                       
Query: 256 ccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatgggg 315
           ||||||| || ||||||||||||||||   ||| ||| || ||  |  | | ||||||||
Sbjct: 203 ccaccaatggatgcatgtcaactggacacgactacaatcctgcgagcaaggagcatgggg 262

                                                                       
Query: 316 cacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggagcggatg 375
           |||| |||||||| | ||||||||| ||||| || |||||||||||||||||||| ||||
Sbjct: 263 caccagaagatgagaaccgccatgccggtgatcttggaaatgtgacagctggagcagatg 322

                                                                       
Query: 376 gtgttgctaacatcaatgttactgacggccatatcccccttgctggaccacattcaatca 435
           |||||||||| |||||||| |||||| |||| ||||| ||  |||| ||| | |||||||
Sbjct: 323 gtgttgctaatatcaatgtcactgacagccagatcccactgactgggccaaactcaatca 382

                                                                       
Query: 436 ttggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagc 495
           ||||| | |||||||| || || | |||| ||||||||||||| |||||||| || ||||
Sbjct: 383 ttggcagagctgttgttgttcacgctgatcctgatgatcttggaaagggtgggcacgagc 442

                                                            
Query: 496 ttagcaagagcactggaaacgctggggcgcgtgttgcttgcgggatcat 544
           |||||||||||||||||||||| || |  ||||||||||| ||||||||
Sbjct: 443 ttagcaagagcactggaaacgcgggtggccgtgttgcttgtgggatcat 491



to top

>emb|X17565.1|ZMSOD4 Zea mays mRNA for superoxide dismutase-4AP (Sod4AP gene)
          Length = 722

 Score =  333 bits (168), Expect = 4e-88
 Identities = 397/472 (84%), Gaps = 1/472 (0%)
 Strand = Plus / Plus

                                                                       
Query: 76  gggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcg 135
           ||||||| |||||||||||||| ||| ||||||||||||| ||||||||     ||||||
Sbjct: 67  gggggtcgcctgagatcacataaaca-tggtgaaggctgttgctgtgctgggtagcagcg 125

                                                                       
Query: 136 agggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgg 195
           |||||||||||||||| |||||||||||||| || || |||||||| |||||||| || |
Sbjct: 126 agggtgtcaagggcacaatcttcttcacccaagaaggggatggccctaccactgtcactg 185

                                                                       
Query: 196 gaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgaca 255
           |||||||| | || ||||||   || ||||| || ||||||||||| || ||||||||||
Sbjct: 186 gaagtgtctctggcctcaagcctggcctccatgggttccatgtgcatgcacttggtgaca 245

                                                                       
Query: 256 ccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatgggg 315
           ||||||| |||||||||||||||||||| |||| ||| || ||  |  | |  ||||| |
Sbjct: 246 ccaccaatggctgcatgtcaactggaccacactacaatcctgcgagcaaggaacatggag 305

                                                                       
Query: 316 cacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggagcggatg 375
           |||| |||||||| | ||||||||| ||||| || |||||||||||||||||||| || |
Sbjct: 306 caccagaagatgagaaccgccatgccggtgatcttggaaatgtgacagctggagcagacg 365

                                                                       
Query: 376 gtgttgctaacatcaatgttactgacggccatatcccccttgctggaccacattcaatca 435
           ||||||| ||||| |||||||| ||| |||| ||||| ||  |||| ||| | |||||||
Sbjct: 366 gtgttgcaaacattaatgttaccgacagccagatcccactgactgggccaaactcaatca 425

                                                                       
Query: 436 ttggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagc 495
           ||||| | |||||||| || || | |||| | ||||||||||| ||||||||||| ||||
Sbjct: 426 ttggcagagctgttgttgttcacgctgatcccgatgatcttggaaagggtggacacgagc 485

                                                               
Query: 496 ttagcaagagcactggaaacgctggggcgcgtgttgcttgcgggatcatcgg 547
           | ||||||||||| ||||||||||| |  ||||||||||| |||||||||||
Sbjct: 486 tcagcaagagcaccggaaacgctggcggccgtgttgcttgtgggatcatcgg 537



to top

>gb|AY103754.1| Zea mays PCO107770 mRNA sequence
          Length = 910

 Score =  315 bits (159), Expect = 8e-83
 Identities = 398/477 (83%), Gaps = 3/477 (0%)
 Strand = Plus / Plus

                                                                       
Query: 75  ggggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagc 134
           |||||||| ||||||||||||   |||||||||||||| || ||||| ||  ||||||  
Sbjct: 172 ggggggtcgcctgagatcacagcgacaatggtgaaggcagttgctgtcctcgccggcact 231

                                                                       
Query: 135 gagggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacg 194
           ||   |||||||||||||||||||||  | |||||||| ||||| |||||||| ||||| 
Sbjct: 232 ga---tgtcaagggcaccatcttcttttcacaggagggggatggtccgaccaccgtgact 288

                                                                       
Query: 195 ggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgac 254
           |||||| || | || ||||||  ||||||||| || |||||||||||||| ||||| |||
Sbjct: 289 ggaagtatctctggcctcaagccagggctccatgggttccatgtgcacgcgcttggcgac 348

                                                                       
Query: 255 accaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatggg 314
           |||||||||||||||||||| ||||| || |||||||| || | |||  | | |||||| 
Sbjct: 349 accaccaacggctgcatgtcgactgggccacacttcaatcctgttggcaaggagcatggc 408

                                                                       
Query: 315 gcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggagcggat 374
           ||||| ||||||||   ||||||||| ||||| || || ||||||||||| ||||  |||
Sbjct: 409 gcaccggaagatgaggaccgccatgccggtgatcttgggaatgtgacagcgggagaagat 468

                                                                       
Query: 375 ggtgttgctaacatcaatgttactgacggccatatcccccttgctggaccacattcaatc 434
           ||||||| |||  ||||| |||||||| |||| || || ||||||||||| || || |||
Sbjct: 469 ggtgttgttaatgtcaatattactgacagccagatacctcttgctggaccccactcgatc 528

                                                                       
Query: 435 attggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgag 494
           |||||||| |||||||| ||||||| |||| | |||||||||||||| ||||||||||||
Sbjct: 529 attggccgagctgttgttgtccatgctgatccggatgatcttggcaaaggtggacatgag 588

                                                                    
Query: 495 cttagcaagagcactggaaacgctggggcgcgtgttgcttgcgggatcatcgggctc 551
           |||||||||||||| ||||| ||||| |  |||||||| || || ||||| ||||||
Sbjct: 589 cttagcaagagcacgggaaatgctggcggacgtgttgcctgtggtatcattgggctc 645



to top

>gb|M15175.1|MZESOD2A Maize superoxide dismutase 2 (SOD2) mRNA, complete cds
          Length = 694

 Score =  299 bits (151), Expect = 5e-78
 Identities = 396/477 (83%), Gaps = 3/477 (0%)
 Strand = Plus / Plus

                                                                       
Query: 75  ggggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagc 134
           |||||||| |||||||||||| | |||||||||||||| || ||||| ||  ||||||  
Sbjct: 10  ggggggtcgcctgagatcacagagacaatggtgaaggcagttgctgtcctcgccggcact 69

                                                                       
Query: 135 gagggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacg 194
           ||   |||||||||||||||||||||  | ||||| || ||||| |||||||| ||||| 
Sbjct: 70  ga---tgtcaagggcaccatcttcttttcacaggaaggggatggtccgaccaccgtgact 126

                                                                       
Query: 195 ggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgac 254
           |||||| || | || ||||||  ||| ||||| || |||||||||||||| ||||| |||
Sbjct: 127 ggaagtatctctggcctcaagccaggcctccatgggttccatgtgcacgcgcttggcgac 186

                                                                       
Query: 255 accaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatggg 314
           |||||||||||||||||||| ||||| || |||||||| || | |||  | | |||||| 
Sbjct: 187 accaccaacggctgcatgtcgactgggccacacttcaatcctgttggcaaggagcatggt 246

                                                                       
Query: 315 gcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggagcggat 374
           ||||| ||||||||   ||||||||| ||||| || || ||||||||||| ||||  |||
Sbjct: 247 gcaccggaagatgaggaccgccatgccggtgatcttgggaatgtgacagcgggagaagat 306

                                                                       
Query: 375 ggtgttgctaacatcaatgttactgacggccatatcccccttgctggaccacattcaatc 434
           ||||||| |||  ||||| |||||||| |||| || || ||||||||||| || || |||
Sbjct: 307 ggtgttgttaatgtcaatattactgacagccagatacctcttgctggaccccactcgatc 366

                                                                       
Query: 435 attggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgag 494
           |||||||| |||||||| ||||||| |||| | ||||| |||||||| ||||||||||||
Sbjct: 367 attggccgagctgttgttgtccatgctgatccggatgaccttggcaaaggtggacatgag 426

                                                                    
Query: 495 cttagcaagagcactggaaacgctggggcgcgtgttgcttgcgggatcatcgggctc 551
           |||||||||||||| ||||| ||||| |  |||||||| || || ||||| ||||||
Sbjct: 427 cttagcaagagcaccggaaatgctggcggacgtgttgcctgtggtatcattgggctc 483



to top

>gb|M54936.1|MZESOD2 Maize superoxide dismutase-2 (Sod-2) mRNA, complete cds
          Length = 694

 Score =  299 bits (151), Expect = 5e-78
 Identities = 396/477 (83%), Gaps = 3/477 (0%)
 Strand = Plus / Plus

                                                                       
Query: 75  ggggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagc 134
           |||||||| |||||||||||| | |||||||||||||| || ||||| ||  ||||||  
Sbjct: 10  ggggggtcgcctgagatcacagagacaatggtgaaggcagttgctgtcctcgccggcact 69

                                                                       
Query: 135 gagggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacg 194
           ||   |||||||||||||||||||||  | ||||| || ||||| |||||||| ||||| 
Sbjct: 70  ga---tgtcaagggcaccatcttcttttcacaggaaggggatggtccgaccaccgtgact 126

                                                                       
Query: 195 ggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgac 254
           |||||| || | || ||||||  ||| ||||| || |||||||||||||| ||||| |||
Sbjct: 127 ggaagtatctctggcctcaagccaggcctccatgggttccatgtgcacgcgcttggcgac 186

                                                                       
Query: 255 accaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatggg 314
           |||||||||||||||||||| ||||| || |||||||| || | |||  | | |||||| 
Sbjct: 187 accaccaacggctgcatgtcgactgggccacacttcaatcctgttggcaaggagcatggt 246

                                                                       
Query: 315 gcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggagcggat 374
           ||||| ||||||||   ||||||||| ||||| || || ||||||||||| ||||  |||
Sbjct: 247 gcaccggaagatgaggaccgccatgccggtgatcttgggaatgtgacagcgggagaagat 306

                                                                       
Query: 375 ggtgttgctaacatcaatgttactgacggccatatcccccttgctggaccacattcaatc 434
           ||||||| |||  ||||| |||||||| |||| || || ||||||||||| || || |||
Sbjct: 307 ggtgttgttaatgtcaatattactgacagccagatacctcttgctggaccccactcgatc 366

                                                                       
Query: 435 attggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgag 494
           |||||||| |||||||| ||||||| |||| | ||||| |||||||| ||||||||||||
Sbjct: 367 attggccgagctgttgttgtccatgctgatccggatgaccttggcaaaggtggacatgag 426

                                                                    
Query: 495 cttagcaagagcactggaaacgctggggcgcgtgttgcttgcgggatcatcgggctc 551
           |||||||||||||| ||||| ||||| |  |||||||| || || ||||| ||||||
Sbjct: 427 cttagcaagagcaccggaaatgctggcggacgtgttgcctgtggtatcattgggctc 483



to top

>ref|NM_186073.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 444

 Score =  291 bits (147), Expect = 1e-75
 Identities = 365/435 (83%), Gaps = 12/435 (2%)
 Strand = Plus / Plus

                                                                       
Query: 102 atggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttcttc 161
           |||||||||||||| ||||||||| |  |||| ||||||||||||||||||||||| |||
Sbjct: 1   atggtgaaggctgttgctgtgcttgctagcagtgagggtgtcaagggcaccatctttttc 60

                                                                       
Query: 162 acccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactcaaggaaggg 221
            |||| |||||||||   |||||| ||||||||||||||||| | || ||||||  ||||
Sbjct: 61  tcccaagagggagat---ccgacctctgtgacgggaagtgtctctgggctcaagccaggg 117

                                                                       
Query: 222 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 281
           ||||| || |||||||||||||| || ||||||||||| || |||||||||||||||   
Sbjct: 118 ctccatggattccatgtgcacgcgctcggtgacaccactaatggctgcatgtcaact--- 174

                                                                       
Query: 282 ccgcacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgct 341
           || |||||||| ||  ||||  | |  |||||||||||  ||||||| | ||||||||| 
Sbjct: 175 ccacacttcaatcctactgggaaggaacatggggcaccacaagatgagaaccgccatgcc 234

                                                                       
Query: 342 ggtgacctcggaaatgtgacagctggagcggatggtgttgctaacatcaatgttactgac 401
           ||||| || |||||| | ||||||||||| ||||   |||||||  |||||||  |||||
Sbjct: 235 ggtgatcttggaaatataacagctggagcagatg---ttgctaatgtcaatgtctctgac 291

                                                                       
Query: 402 ggccatatcccccttgctggaccacattcaatcattggccgtgctgttgtcgtccatggt 461
            |||| ||||||||| ||||| |||| || ||||||||||| |||||||| ||||||| |
Sbjct: 292 agccagatcccccttactggagcacactccatcattggccgagctgttgttgtccatgct 351

                                                                       
Query: 462 gatgctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctggg 521
           ||| |||||||||||||||||   ||||||||||||||||||| ||||||||| ||||||
Sbjct: 352 gatcctgatgatcttggcaag---ggacatgagcttagcaagaccactggaaatgctggg 408

                          
Query: 522 gcgcgtgttgcttgc 536
           |  || |||||||||
Sbjct: 409 ggccgagttgcttgc 423



to top

>gb|L32834.1|ASNCZSD Aspergillus japonicus (clone Assod4-g) copper/zinc-superoxide
           dismutase gene, 3' end
          Length = 393

 Score =  264 bits (133), Expect = 3e-67
 Identities = 253/293 (86%)
 Strand = Plus / Plus

                                                                       
Query: 222 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 281
           ||||| || |||||||||||||| || ||||||||||| || ||||||||||||||||||
Sbjct: 20  ctccatggattccatgtgcacgcgctcggtgacaccactaatggctgcatgtcaactgga 79

                                                                       
Query: 282 ccgcacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgct 341
           || |||||||| ||  ||||  | |  |||||||||||  ||||||| | ||||||||| 
Sbjct: 80  ccacacttcaatcctactgggaaggaacatggggcaccacaagatgagaaccgccatgcc 139

                                                                       
Query: 342 ggtgacctcggaaatgtgacagctggagcggatggtgttgctaacatcaatgttactgac 401
           ||||| || |||||| | ||||||||||| ||||||||||||||  |||||||  |||||
Sbjct: 140 ggtgatcttggaaatataacagctggagcagatggtgttgctaatgtcaatgtctctgac 199

                                                                       
Query: 402 ggccatatcccccttgctggaccacattcaatcattggccgtgctgttgtcgtccatggt 461
            |||| ||||||||| ||||| |||| || ||||||||||| |||||||| ||||||| |
Sbjct: 200 agccagatcccccttactggagcacactccatcattggccgagctgttgttgtccatgct 259

                                                                
Query: 462 gatgctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaa 514
           ||| ||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 260 gatcctgatgatcttggcaagggtggacatgagcttagcaagaccactggaaa 312



to top

>dbj|AK120692.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013169L20, full
           insert sequence
          Length = 829

 Score =  246 bits (124), Expect = 6e-62
 Identities = 385/472 (81%)
 Strand = Plus / Plus

                                                                       
Query: 76  gggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcg 135
           ||||||| |||||||||||||  ||||||||||||||||| | |||||||    |||| |
Sbjct: 70  gggggtcgcctgagatcacattaacaatggtgaaggctgttgttgtgcttggtagcagtg 129

                                                                       
Query: 136 agggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgg 195
           ||  ||| |||||||| |||  |||   ||| ||||||||||| || ||||||||||| |
Sbjct: 130 agattgttaagggcactatccactttgtccaagagggagatggtcccaccactgtgactg 189

                                                                       
Query: 196 gaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgaca 255
           |||||||| | || ||||||   || ||||| || |||||| | || || ||||||||||
Sbjct: 190 gaagtgtctctggcctcaagcctggtctccatgggttccatattcatgcacttggtgaca 249

                                                                       
Query: 256 ccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatgggg 315
           ||||||| || |||||||||||||| || |||| ||| || || ||  | | |||||| |
Sbjct: 250 ccaccaatggttgcatgtcaactgggccacactacaatcctgccggaaaggagcatggag 309

                                                                       
Query: 316 cacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggagcggatg 375
           |||| |||||||| | ||||||||||||||| || |||||||| || |||||||  ||||
Sbjct: 310 caccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctggagaagatg 369

                                                                       
Query: 376 gtgttgctaacatcaatgttactgacggccatatcccccttgctggaccacattcaatca 435
           |||||||||| ||| |||||  |||| | || || || ||| |||||||| |||||||||
Sbjct: 370 gtgttgctaatatccatgttgttgacagtcagattccacttactggaccaaattcaatca 429

                                                                       
Query: 436 ttggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagc 495
           ||||| | || || || || ||||  ||| ||||||||||||| |||||||| || ||||
Sbjct: 430 ttggcagagccgtcgttgtgcatgccgatcctgatgatcttggaaagggtgggcacgagc 489

                                                               
Query: 496 ttagcaagagcactggaaacgctggggcgcgtgttgcttgcgggatcatcgg 547
           | ||||||| ||| ||||||||||| |  |||||||||||||||||||||||
Sbjct: 490 tgagcaagaccaccggaaacgctggtggccgtgttgcttgcgggatcatcgg 541



to top

>dbj|AK061662.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-036-E04, full
           insert sequence
          Length = 786

 Score =  246 bits (124), Expect = 6e-62
 Identities = 385/472 (81%)
 Strand = Plus / Plus

                                                                       
Query: 76  gggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcg 135
           ||||||| |||||||||||||  ||||||||||||||||| | |||||||    |||| |
Sbjct: 78  gggggtcgcctgagatcacattaacaatggtgaaggctgttgttgtgcttggtagcagtg 137

                                                                       
Query: 136 agggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgg 195
           ||  ||| |||||||| |||  |||   ||| ||||||||||| || ||||||||||| |
Sbjct: 138 agattgttaagggcactatccactttgtccaagagggagatggtcccaccactgtgactg 197

                                                                       
Query: 196 gaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgaca 255
           |||||||| | || ||||||   || ||||| || |||||| | || || ||||||||||
Sbjct: 198 gaagtgtctctggcctcaagcctggtctccatgggttccatattcatgcacttggtgaca 257

                                                                       
Query: 256 ccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatgggg 315
           ||||||| || |||||||||||||| || |||| ||| || || ||  | | |||||| |
Sbjct: 258 ccaccaatggttgcatgtcaactgggccacactacaatcctgccggaaaggagcatggag 317

                                                                       
Query: 316 cacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggagcggatg 375
           |||| |||||||| | ||||||||||||||| || |||||||| || |||||||  ||||
Sbjct: 318 caccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctggagaagatg 377

                                                                       
Query: 376 gtgttgctaacatcaatgttactgacggccatatcccccttgctggaccacattcaatca 435
           |||||||||| ||| |||||  |||| | || || || ||| |||||||| |||||||||
Sbjct: 378 gtgttgctaatatccatgttgttgacagtcagattccacttactggaccaaattcaatca 437

                                                                       
Query: 436 ttggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagc 495
           ||||| | || || || || ||||  ||| ||||||||||||| |||||||| || ||||
Sbjct: 438 ttggcagagccgtcgttgtgcatgccgatcctgatgatcttggaaagggtgggcacgagc 497

                                                               
Query: 496 ttagcaagagcactggaaacgctggggcgcgtgttgcttgcgggatcatcgg 547
           | ||||||| ||| ||||||||||| |  |||||||||||||||||||||||
Sbjct: 498 tgagcaagaccaccggaaacgctggtggccgtgttgcttgcgggatcatcgg 549



to top

>dbj|D00999.1|RICSODA Oryza sativa mRNA for copper/zinc-superoxide dismutase, complete
           cds, clone:RSODA
          Length = 760

 Score =  246 bits (124), Expect = 6e-62
 Identities = 385/472 (81%)
 Strand = Plus / Plus

                                                                       
Query: 76  gggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcg 135
           ||||||| |||||||||||||  ||||||||||||||||| | |||||||    |||| |
Sbjct: 48  gggggtcgcctgagatcacattaacaatggtgaaggctgttgttgtgcttggtagcagtg 107

                                                                       
Query: 136 agggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgg 195
           ||  ||| |||||||| |||  |||   ||| ||||||||||| || ||||||||||| |
Sbjct: 108 agattgttaagggcactatccactttgtccaagagggagatggtcccaccactgtgactg 167

                                                                       
Query: 196 gaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgaca 255
           |||||||| | || ||||||   || ||||| || |||||| | || || ||||||||||
Sbjct: 168 gaagtgtctctggcctcaagcctggtctccatgggttccatattcatgcacttggtgaca 227

                                                                       
Query: 256 ccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatgggg 315
           ||||||| || |||||||||||||| || |||| ||| || || ||  | | |||||| |
Sbjct: 228 ccaccaatggttgcatgtcaactgggccacactacaatcctgccggaaaggagcatggag 287

                                                                       
Query: 316 cacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggagcggatg 375
           |||| |||||||| | ||||||||||||||| || |||||||| || |||||||  ||||
Sbjct: 288 caccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctggagaagatg 347

                                                                       
Query: 376 gtgttgctaacatcaatgttactgacggccatatcccccttgctggaccacattcaatca 435
           |||||||||| ||| |||||  |||| | || || || ||| |||||||| |||||||||
Sbjct: 348 gtgttgctaatatccatgttgttgacagtcagattccacttactggaccaaattcaatca 407

                                                                       
Query: 436 ttggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagc 495
           ||||| | || || || || ||||  ||| ||||||||||||| |||||||| || ||||
Sbjct: 408 ttggcagagccgtcgttgtgcatgccgatcctgatgatcttggaaagggtgggcacgagc 467

                                                               
Query: 496 ttagcaagagcactggaaacgctggggcgcgtgttgcttgcgggatcatcgg 547
           | ||||||| ||| ||||||||||| |  |||||||||||||||||||||||
Sbjct: 468 tgagcaagaccaccggaaacgctggtggccgtgttgcttgcgggatcatcgg 519



to top

>gb|DQ058108.1| Oryza sativa (indica cultivar-group) cytoplasmic
           copper/zinc-superoxide dismutase mRNA, complete cds
          Length = 698

 Score =  238 bits (120), Expect = 2e-59
 Identities = 384/472 (81%)
 Strand = Plus / Plus

                                                                       
Query: 76  gggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcg 135
           ||||||| |||||||||||||  ||||||||||||||||| | |||||||    |||| |
Sbjct: 31  gggggtcgcctgagatcacattaacaatggtgaaggctgttgttgtgcttggtagcagtg 90

                                                                       
Query: 136 agggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgg 195
           ||  ||| |||||||| |||  |||   ||| ||||||||||| || ||||||||||| |
Sbjct: 91  agattgttaagggcactatccactttgtccaagagggagatggtcccaccactgtgactg 150

                                                                       
Query: 196 gaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgaca 255
           |||||||| | || || |||   || ||||| || |||||| | || || ||||||||||
Sbjct: 151 gaagtgtctctggccttaagcctggtctccatgggttccatattcatgcacttggtgaca 210

                                                                       
Query: 256 ccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatgggg 315
           ||||||| || |||||||||||||| || |||| ||| || || ||  | | |||||| |
Sbjct: 211 ccaccaatggttgcatgtcaactgggccacactacaatcctgccggaaaggagcatggag 270

                                                                       
Query: 316 cacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggagcggatg 375
           |||| |||||||| | ||||||||||||||| || |||||||| || |||||||  ||||
Sbjct: 271 caccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctggagaagatg 330

                                                                       
Query: 376 gtgttgctaacatcaatgttactgacggccatatcccccttgctggaccacattcaatca 435
           |||||||||| ||| |||||  |||| | || || || ||| |||||||| |||||||||
Sbjct: 331 gtgttgctaatatccatgttgttgacagtcagattccacttactggaccaaattcaatca 390

                                                                       
Query: 436 ttggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagc 495
           ||||| | || || || || ||||  ||| ||||||||||||| |||||||| || ||||
Sbjct: 391 ttggcagagccgtcgttgtgcatgccgatcctgatgatcttggaaagggtgggcacgagc 450

                                                               
Query: 496 ttagcaagagcactggaaacgctggggcgcgtgttgcttgcgggatcatcgg 547
           | ||||||| ||| ||||||||||| |  |||||||||||||||||||||||
Sbjct: 451 tgagcaagaccaccggaaacgctggtggccgtgttgcttgcgggatcatcgg 502



to top

>gb|L36320.1|RICSOXDM Oryza sativa (clone cu101) superoxide dismutase (cuznsod1) mRNA,
           complete cds
          Length = 768

 Score =  238 bits (120), Expect = 2e-59
 Identities = 384/472 (81%)
 Strand = Plus / Plus

                                                                       
Query: 76  gggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcg 135
           ||||||| |||||||||||||  ||||||||||||||||| | |||||||    |||| |
Sbjct: 62  gggggtcgcctgagatcacattaacaatggtgaaggctgttgttgtgcttggtagcagtg 121

                                                                       
Query: 136 agggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgg 195
           ||  ||| |||||||| |||  |||   ||| ||||||||||| || ||||||||||| |
Sbjct: 122 agattgttaagggcactatccactttgtccaagagggagatggtcccaccactgtgactg 181

                                                                       
Query: 196 gaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgaca 255
           |||||||| | || ||||||   || ||||| || |||||| | || || ||||||||||
Sbjct: 182 gaagtgtctctggcctcaagcctggtctccatgggttccatattcatgcacttggtgaca 241

                                                                       
Query: 256 ccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatgggg 315
           ||||||| || ||||| |||||||| || |||| ||| || || ||  | | |||||| |
Sbjct: 242 ccaccaatggttgcatctcaactgggccacactacaatcctgccggaaaggagcatggag 301

                                                                       
Query: 316 cacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggagcggatg 375
           |||| |||||||| | ||||||||||||||| || |||||||| || |||||||  ||||
Sbjct: 302 caccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctggagaagatg 361

                                                                       
Query: 376 gtgttgctaacatcaatgttactgacggccatatcccccttgctggaccacattcaatca 435
           |||||||||| ||| |||||  |||| | || || || ||| |||||||| |||||||||
Sbjct: 362 gtgttgctaatatccatgttgttgacagtcagattccacttactggaccaaattcaatca 421

                                                                       
Query: 436 ttggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagc 495
           ||||| | || || || || ||||  ||| ||||||||||||| |||||||| || ||||
Sbjct: 422 ttggcagagccgtcgttgtgcatgccgatcctgatgatcttggaaagggtgggcacgagc 481

                                                               
Query: 496 ttagcaagagcactggaaacgctggggcgcgtgttgcttgcgggatcatcgg 547
           | ||||||| ||| ||||||||||| |  |||||||||||||||||||||||
Sbjct: 482 tgagcaagaccaccggaaacgctggtggccgtgttgcttgcgggatcatcgg 533



to top

>gb|AY823553.1| Pennisetum glaucum superoxide dismutase mRNA, partial cds
          Length = 439

 Score =  157 bits (79), Expect = 5e-35
 Identities = 145/167 (86%)
 Strand = Plus / Plus

                                                                       
Query: 354 aatgtgacagctggagcggatggtgttgctaacatcaatgttactgacggccatatcccc 413
           ||||||||||| ||||| |||||||||||||||||||||||||| ||| |||| ||||| 
Sbjct: 7   aatgtgacagcaggagcagatggtgttgctaacatcaatgttaccgacagccagatccca 66

                                                                       
Query: 414 cttgctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgat 473
           ||  |||| ||| | |||||||||||||| |||||||| || || | |||| ||||||||
Sbjct: 67  ctgactgggccaaactcaatcattggccgagctgttgttgttcacgctgatcctgatgat 126

                                                          
Query: 474 cttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           ||||| | |||||| || ||||| |||||||||||||||||||||||
Sbjct: 127 cttggaaggggtgggcacgagctgagcaagagcactggaaacgctgg 173



to top

>emb|AJ250667.1|ACO250667 Ananas comosus mRNA for copper/zinc-superoxide dismutase (sod1
           gene)
          Length = 820

 Score =  149 bits (75), Expect = 1e-32
 Identities = 333/419 (79%)
 Strand = Plus / Plus

                                                                       
Query: 102 atggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttcttc 161
           |||||||||||||| ||||||||     |||| |||||||| || ||||| |||| ||||
Sbjct: 42  atggtgaaggctgttgctgtgctgggtagcagtgagggtgttaaaggcacaatctacttc 101

                                                                       
Query: 162 acccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactcaaggaaggg 221
           ||||| || || ||||| ||||| |||||||| |||||| || |||| ||||||   || 
Sbjct: 102 acccaagaaggggatggtccgacaactgtgactggaagtatctcgggcctcaagcccgga 161

                                                                       
Query: 222 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 281
           || || || || ||||| || || ||||| |||||||| || || |||||||||||||| 
Sbjct: 162 cttcatggatttcatgttcatgcacttggcgacaccacaaatggttgcatgtcaactggg 221

                                                                       
Query: 282 ccgcacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgct 341
           || || ||||| || || ||  |||  ||||| ||||| |||||||| | ||||||||||
Sbjct: 222 ccacatttcaatcctgccgggaatgaacatggcgcacctgaagatgagacccgccatgct 281

                                                                       
Query: 342 ggtgacctcggaaatgtgacagctggagcggatggtgttgctaacatcaatgttactgac 401
           ||||| || ||||||||||| | ||| | ||||||   || |||| | ||| ||  ||||
Sbjct: 282 ggtgatcttggaaatgtgactgttggcgaggatggcactgttaacgtaaatattgttgac 341

                                                                       
Query: 402 ggccatatcccccttgctggaccacattcaatcattggccgtgctgttgtcgtccatggt 461
            |||| || || ||| ||||| |  | || || |||||||| || ||||| ||||||| |
Sbjct: 342 agccagattccgctttctggatcgaactccattattggccgagcagttgttgtccatgct 401

                                                                      
Query: 462 gatgctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           ||  |||||||||| || ||||||||||||||||||||||||| ||| ||||| |||||
Sbjct: 402 gaccctgatgatctcggaaagggtggacatgagcttagcaagaccacgggaaatgctgg 460



to top

>gb|AF479059.1| Sandersonia aurantiaca copper/zinc superoxide dismutase mRNA,
           complete cds
          Length = 799

 Score =  105 bits (53), Expect = 2e-19
 Identities = 80/89 (89%)
 Strand = Plus / Plus

                                                                       
Query: 102 atggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttcttc 161
           |||||||||||||| ||||| || | ||| || |||||||||||||||||| | ||||||
Sbjct: 20  atggtgaaggctgttgctgttctgaacgggagtgagggtgtcaagggcaccgtgttcttc 79

                                        
Query: 162 acccaggagggagatggcccgaccactgt 190
           || ||||||||||||||||||||||||||
Sbjct: 80  acacaggagggagatggcccgaccactgt 108



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                       
Query: 418 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
           |||| |||||||| || |||||  | |||||||| ||||||| |||| ||||||| ||||
Sbjct: 336 ctgggccacattccattattggaagggctgttgttgtccatgctgatcctgatgaccttg 395

                                                      
Query: 478 gcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           | |||||||| ||||| |||||||||||||||||||| |||||
Sbjct: 396 gaaagggtgggcatgaacttagcaagagcactggaaatgctgg 438



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 125/153 (81%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           ||||| |||||||| || || || |||||||| || || ||||||||||| ||||| |||
Sbjct: 143 cacggattccatgttcatgcgctcggtgacactacaaatggctgcatgtctactgggccg 202

                                                                       
Query: 285 cacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggt 344
           || || || || |||||  | | |||||| ||||| ||||| |||| ||||||||| |||
Sbjct: 203 cattttaatcctgctgggaaggagcatggagcaccggaagacgaaaaccgccatgccggt 262

                                            
Query: 345 gacctcggaaatgtgacagctggagcggatggt 377
           || || || |||||||||||||| | |||||||
Sbjct: 263 gatcttgggaatgtgacagctggggaggatggt 295



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  105 bits (53), Expect = 2e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                            
Query: 180      ccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtg 239
                |||||| ||||||||||||||||| | || ||||||  ||||||||| || |||||||||
Sbjct: 28023204 ccgacctctgtgacgggaagtgtctctgggctcaagccagggctccatggattccatgtg 28023145

                                                         
Query: 240      cacgctcttggtgacaccaccaacggctgcatgtcaactgg 280
                ||||| || ||||||||||| || |||||||||||||||||
Sbjct: 28023144 cacgcgctcggtgacaccactaatggctgcatgtcaactgg 28023104



 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                            
Query: 92       cacatacacaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcac 151
                |||||| ||||||||||||||||| ||||||||| |  |||| |||||||||||||||||
Sbjct: 28023376 cacatagacaatggtgaaggctgttgctgtgcttgctagcagtgagggtgtcaagggcac 28023317

                                           
Query: 152      catcttcttcacccaggagggagatgg 178
                |||||| ||| |||| |||||||||||
Sbjct: 28023316 catctttttctcccaagagggagatgg 28023290



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 70/78 (89%)
 Strand = Plus / Minus

                                                                            
Query: 408      atcccccttgctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgct 467
                ||||||||| ||||| |||| || ||||||||||| |||||||| ||||||| |||| ||
Sbjct: 28022620 atcccccttactggagcacactccatcattggccgagctgttgttgtccatgctgatcct 28022561

                                  
Query: 468      gatgatcttggcaagggt 485
                ||||||||||||||||||
Sbjct: 28022560 gatgatcttggcaagggt 28022543



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                        
Query: 483      ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgg 538
                |||||||||||||||||||||| ||||||||| |||||||  || |||||||||||
Sbjct: 28022409 ggtggacatgagcttagcaagaccactggaaatgctgggggccgagttgcttgcgg 28022354



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                            
Query: 309      catggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgga 368
                |||||||||||  ||||||| | ||||||||| ||||| || |||||| | |||||||||
Sbjct: 28022987 catggggcaccacaagatgagaaccgccatgccggtgatcttggaaatataacagctgga 28022928

                         
Query: 369      gcggatggt 377
                || ||||||
Sbjct: 28022927 gcagatggt 28022919



to top

>dbj|AP003825.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1343_D04
          Length = 143407

 Score =  105 bits (53), Expect = 2e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                          
Query: 180    ccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtg 239
              |||||| ||||||||||||||||| | || ||||||  ||||||||| || |||||||||
Sbjct: 112538 ccgacctctgtgacgggaagtgtctctgggctcaagccagggctccatggattccatgtg 112479

                                                       
Query: 240    cacgctcttggtgacaccaccaacggctgcatgtcaactgg 280
              ||||| || ||||||||||| || |||||||||||||||||
Sbjct: 112478 cacgcgctcggtgacaccactaatggctgcatgtcaactgg 112438



 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                          
Query: 92     cacatacacaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcac 151
              |||||| ||||||||||||||||| ||||||||| |  |||| |||||||||||||||||
Sbjct: 112710 cacatagacaatggtgaaggctgttgctgtgcttgctagcagtgagggtgtcaagggcac 112651

                                         
Query: 152    catcttcttcacccaggagggagatgg 178
              |||||| ||| |||| |||||||||||
Sbjct: 112650 catctttttctcccaagagggagatgg 112624



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 70/78 (89%)
 Strand = Plus / Minus

                                                                          
Query: 408    atcccccttgctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgct 467
              ||||||||| ||||| |||| || ||||||||||| |||||||| ||||||| |||| ||
Sbjct: 111954 atcccccttactggagcacactccatcattggccgagctgttgttgtccatgctgatcct 111895

                                
Query: 468    gatgatcttggcaagggt 485
              ||||||||||||||||||
Sbjct: 111894 gatgatcttggcaagggt 111877



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                      
Query: 483    ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgg 538
              |||||||||||||||||||||| ||||||||| |||||||  || |||||||||||
Sbjct: 111743 ggtggacatgagcttagcaagaccactggaaatgctgggggccgagttgcttgcgg 111688



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                          
Query: 309    catggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgga 368
              |||||||||||  ||||||| | ||||||||| ||||| || |||||| | |||||||||
Sbjct: 112321 catggggcaccacaagatgagaaccgccatgccggtgatcttggaaatataacagctgga 112262

                       
Query: 369    gcggatggt 377
              || ||||||
Sbjct: 112261 gcagatggt 112253



to top

>dbj|AP004274.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
            clone:P0450A04
          Length = 162545

 Score =  105 bits (53), Expect = 2e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                        
Query: 180  ccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtg 239
            |||||| ||||||||||||||||| | || ||||||  ||||||||| || |||||||||
Sbjct: 6500 ccgacctctgtgacgggaagtgtctctgggctcaagccagggctccatggattccatgtg 6441

                                                     
Query: 240  cacgctcttggtgacaccaccaacggctgcatgtcaactgg 280
            ||||| || ||||||||||| || |||||||||||||||||
Sbjct: 6440 cacgcgctcggtgacaccactaatggctgcatgtcaactgg 6400



 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                        
Query: 92   cacatacacaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcac 151
            |||||| ||||||||||||||||| ||||||||| |  |||| |||||||||||||||||
Sbjct: 6672 cacatagacaatggtgaaggctgttgctgtgcttgctagcagtgagggtgtcaagggcac 6613

                                       
Query: 152  catcttcttcacccaggagggagatgg 178
            |||||| ||| |||| |||||||||||
Sbjct: 6612 catctttttctcccaagagggagatgg 6586



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 70/78 (89%)
 Strand = Plus / Minus

                                                                        
Query: 408  atcccccttgctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgct 467
            ||||||||| ||||| |||| || ||||||||||| |||||||| ||||||| |||| ||
Sbjct: 5916 atcccccttactggagcacactccatcattggccgagctgttgttgtccatgctgatcct 5857

                              
Query: 468  gatgatcttggcaagggt 485
            ||||||||||||||||||
Sbjct: 5856 gatgatcttggcaagggt 5839



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                    
Query: 483  ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgg 538
            |||||||||||||||||||||| ||||||||| |||||||  || |||||||||||
Sbjct: 5705 ggtggacatgagcttagcaagaccactggaaatgctgggggccgagttgcttgcgg 5650



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                        
Query: 309  catggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgga 368
            |||||||||||  ||||||| | ||||||||| ||||| || |||||| | |||||||||
Sbjct: 6283 catggggcaccacaagatgagaaccgccatgccggtgatcttggaaatataacagctgga 6224

                     
Query: 369  gcggatggt 377
            || ||||||
Sbjct: 6223 gcagatggt 6215



to top

>gb|L19434.1|RICSODCC2A Oryza sativa cytosolic copper/zinc-superoxide dismutase (SodCc2)
            gene, complete cds
          Length = 3522

 Score =  105 bits (53), Expect = 2e-19
 Identities = 89/101 (88%)
 Strand = Plus / Plus

                                                                        
Query: 180  ccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtg 239
            |||||| ||||||||||||||||| | || ||||||  ||||||||| || |||||||||
Sbjct: 2291 ccgacctctgtgacgggaagtgtctctgggctcaagccagggctccatggattccatgtg 2350

                                                     
Query: 240  cacgctcttggtgacaccaccaacggctgcatgtcaactgg 280
            ||||| || ||||||||||| || |||||||||||||||||
Sbjct: 2351 cacgcgctcggtgacaccactaatggctgcatgtcaactgg 2391



 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Plus

                                                                        
Query: 92   cacatacacaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcac 151
            |||||| ||||||||||||||||| ||||||||| |  |||| |||||||||||||||||
Sbjct: 2119 cacatagacaatggtgaaggctgttgctgtgcttgctagcagtgagggtgtcaagggcac 2178

                                       
Query: 152  catcttcttcacccaggagggagatgg 178
            |||||| ||| |||| |||||||||||
Sbjct: 2179 catctttttctcccaagagggagatgg 2205



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 70/78 (89%)
 Strand = Plus / Plus

                                                                        
Query: 408  atcccccttgctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgct 467
            ||||||||| ||||| |||| || ||||||||||| |||||||| ||||||| |||| ||
Sbjct: 2875 atcccccttactggagcacactccatcattggccgagctgttgttgtccatgctgatcct 2934

                              
Query: 468  gatgatcttggcaagggt 485
            ||||||||||||||||||
Sbjct: 2935 gatgatcttggcaagggt 2952



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                    
Query: 483  ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgg 538
            |||||||||||||||||||||| ||||||||| |||||||  || |||||||||||
Sbjct: 3086 ggtggacatgagcttagcaagaccactggaaatgctgggggccgagttgcttgcgg 3141



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Plus

                                                                        
Query: 309  catggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgga 368
            |||||||||||  ||||||| | ||||||||| ||||| || |||||| | |||||||||
Sbjct: 2508 catggggcaccacaagatgagaaccgccatgccggtgatcttggaaatataacagctgga 2567

                     
Query: 369  gcggatggt 377
            || ||||||
Sbjct: 2568 gcagatggt 2576



to top

>emb|AJ586519.1| Fagus sylvatica partial sod1 mRNA for superoxide dismutase
          Length = 710

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 70/77 (90%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| |||||||| ||| | ||||||||||||||||| |||||||| |||||||||
Sbjct: 385 gctgttgttgtccatggagatccagatgatcttggcaaggggggacatgaacttagcaag 444

                            
Query: 504 agcactggaaacgctgg 520
           ||||||||||| |||||
Sbjct: 445 agcactggaaatgctgg 461



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                       
Query: 222 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 281
           ||||| |||||||| ||||| |||||||| ||||| || || || |||||||||||||||
Sbjct: 163 ctccatggcttccacgtgcatgctcttggggacacaacaaatggttgcatgtcaactgga 222

                               
Query: 282 ccgcacttcaaccccgctgg 301
           || || ||||| || |||||
Sbjct: 223 ccacatttcaatcctgctgg 242



to top

>gb|AY646367.1| Malus xiaojinensis superoxide dismutase (Sod1) mRNA, complete cds
          Length = 805

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 147/180 (81%)
 Strand = Plus / Plus

                                                                       
Query: 164 ccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactcaaggaagggct 223
           |||||||||||||||||| || |||||||| ||||||||| | || ||||||   || ||
Sbjct: 175 ccaggagggagatggcccaactactgtgactggaagtgtctctggcctcaagcctggact 234

                                                                       
Query: 224 ccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggacc 283
            || || |||||||| || |||||||| ||||| || ||||| |||||||||||||| ||
Sbjct: 235 tcatggtttccatgtccatgctcttggagacacaacaaacggttgcatgtcaactgggcc 294

                                                                       
Query: 284 gcacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctgg 343
            |||||||| || |||||  | | |||||| || || ||||||||  | |||||||||||
Sbjct: 295 acacttcaatcctgctggaaaagagcatggtgcccctgaagatgagcttcgccatgctgg 354



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 73/86 (84%)
 Strand = Plus / Plus

                                                                       
Query: 417 gctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatctt 476
           ||||||||||| || ||||||||  | || ||||| ||||| |  ||  ||||||| |||
Sbjct: 428 gctggaccacactctatcattggtagggcggttgttgtccacgcagaccctgatgacctt 487

                                     
Query: 477 ggcaagggtggacatgagcttagcaa 502
           ||||||||||||||||||||||||||
Sbjct: 488 ggcaagggtggacatgagcttagcaa 513



to top

>gb|AF037359.1|AF037359 Paulownia kawakamii superoxide dismutase (SOD5) mRNA, complete cds
          Length = 794

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 213/268 (79%)
 Strand = Plus / Plus

                                                                       
Query: 102 atggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttcttc 161
           |||||||||| ||| || ||||| | | |||| |||||||| |  |||||||||| ||||
Sbjct: 88  atggtgaagggtgtcgcagtgctcagcagcagtgagggtgttagtggcaccatctacttc 147

                                                                       
Query: 162 acccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactcaaggaaggg 221
           |||||||| |||||||| || || ||||| || ||||  ||  | || || |||   || 
Sbjct: 148 acccaggaaggagatggtccaacaactgttactggaaacgtttctggccttaagcctgga 207

                                                                       
Query: 222 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 281
           | ||| ||||| |||||||| || ||||||||||||||||| || ||  |||||||||||
Sbjct: 208 ccccatggctttcatgtgcatgcccttggtgacaccaccaatggttgtttgtcaactgga 267

                                                                       
Query: 282 ccgcacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgct 341
           || |||||||| || |||||  | | |||||| || || || |||||  | |||||||||
Sbjct: 268 cctcacttcaatcctgctggcaaagagcatggagctcctgatgatgaggttcgccatgct 327

                                       
Query: 342 ggtgacctcggaaatgtgacagctggag 369
           |||||||| || ||||| |||| |||||
Sbjct: 328 ggtgaccttgggaatgtcacagttggag 355



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 420 ggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggc 479
           ||||||||||| || |||||  | ||||| || || |||| |||| ||||||||||||| 
Sbjct: 406 ggaccacattccataattggaagagctgtagttgttcatgctgatcctgatgatcttgga 465

                                              
Query: 480 aagggtggacatgagcttagcaagagcactggaaa 514
           |||||||||||||| || ||||| | |||||||||
Sbjct: 466 aagggtggacatgaactgagcaaaaccactggaaa 500



to top

>gb|AF009735.1| Raphanus sativus Cu/Zn superoxide dismutase (SOD) mRNA, complete
           cds
          Length = 576

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 136/166 (81%)
 Strand = Plus / Plus

                                                                       
Query: 130 gcagcgagggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactg 189
           ||||||||||||| ||||| |||||||||||||||||||| ||| | ||  | |||||||
Sbjct: 106 gcagcgagggtgttaagggaaccatcttcttcacccaggaaggaaacggttccaccactg 165

                                                                       
Query: 190 tgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttg 249
           |||| |||| |||  | || || |||   || ||||| || |||||||| || |||||||
Sbjct: 166 tgactggaactgtttctggccttaagcctggtctccatggtttccatgtccatgctcttg 225

                                                         
Query: 250 gtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccc 295
           |||||||||| || || |||||||| || || ||||| ||||||||
Sbjct: 226 gtgacaccactaatggttgcatgtccaccggtccgcatttcaaccc 271



to top

>gb|AF328859.1| Avicennia marina Cu-Zn superoxide dismutase mRNA, complete cds
          Length = 768

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 105/125 (84%)
 Strand = Plus / Plus

                                                                       
Query: 228 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 287
           ||||| |||||||| || ||||||||||||||||| ||||| ||||||||||| || |||
Sbjct: 173 ggctttcatgtgcatgcccttggtgacaccaccaatggctgtatgtcaactggtcctcac 232

                                                                       
Query: 288 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgac 347
           ||||| || |||||  | |  ||||| || || ||||||||  | |||||||||||||||
Sbjct: 233 ttcaatccggctggcaaagaccatggtgctccagaagatgaggttcgccatgctggtgac 292

                
Query: 348 ctcgg 352
           |||||
Sbjct: 293 ctcgg 297



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 82/101 (81%)
 Strand = Plus / Plus

                                                                       
Query: 420 ggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggc 479
           ||||||||||| ||  ||||  | ||||| || |||||||  ||| ||||||||||||| 
Sbjct: 365 ggaccacattccatagttggaagagctgtagttgtccatgccgatcctgatgatcttgga 424

                                                    
Query: 480 aagggtggacatgagcttagcaagagcactggaaacgctgg 520
           ||||| |||||||| || ||||| |  |||||||| |||||
Sbjct: 425 aagggcggacatgaactaagcaaaactactggaaatgctgg 465



to top

>gb|U34726.1|ZMU34726 Zea mays superoxide dismutase 4 (sod4) gene, partial cds
          Length = 3039

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 89/104 (85%)
 Strand = Plus / Plus

                                                                        
Query: 177  ggcccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccat 236
            ||||| |||||||| || ||||||||| | || ||||||   || ||||| || ||||||
Sbjct: 2375 ggccctaccactgtcactggaagtgtctctggcctcaagcctggcctccatgggttccat 2434

                                                        
Query: 237  gtgcacgctcttggtgacaccaccaacggctgcatgtcaactgg 280
            ||||| || ||||||||||||||||| |||||||||||||||||
Sbjct: 2435 gtgcatgcacttggtgacaccaccaatggctgcatgtcaactgg 2478



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 70/79 (88%), Gaps = 1/79 (1%)
 Strand = Plus / Plus

                                                                        
Query: 88   agatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagg 147
            |||||||||| ||| ||||||||||||| ||||||||     ||||||||||||||||||
Sbjct: 2208 agatcacataaaca-tggtgaaggctgttgctgtgctgggtagcagcgagggtgtcaagg 2266

                               
Query: 148  gcaccatcttcttcaccca 166
            |||| ||||||||||||||
Sbjct: 2267 gcacaatcttcttcaccca 2285



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                        
Query: 309  catggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgga 368
            ||||| ||||| |||||||| | ||||||||| ||||| || ||||||||||||||||||
Sbjct: 2612 catggagcaccagaagatgagaaccgccatgccggtgatcttggaaatgtgacagctgga 2671

              
Query: 369  gc 370
            ||
Sbjct: 2672 gc 2673



to top

>gb|AY833718.1| Codonopsis lanceolata CuZn superoxide dismutase (SODCc) mRNA,
           complete cds
          Length = 799

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                       
Query: 418 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
           ||||||| ||||| ||||||||  | ||||| || ||||||| |||| ||||||||||||
Sbjct: 471 ctggacctcattctatcattggaagggctgtagttgtccatgctgatcctgatgatcttg 530

                                                      
Query: 478 gcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           | |||||||| ||||| || ||||| ||||||||||| |||||
Sbjct: 531 gaaagggtggccatgaactcagcaaaagcactggaaatgctgg 573



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgg 280
           ||||| |||||||| || || ||||||||||| ||||| || ||||||||||||||
Sbjct: 278 cacggtttccatgttcatgcccttggtgacacaaccaatggttgcatgtcaactgg 333



to top

>emb|AJ844003.1| Plantago major mRNA for copper-zinc superoxide dismutase (csd1
           gene)
          Length = 779

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 115/139 (82%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           |||||||||||||| || |||||||||||||| |||||||| ||||||||||| ||||| 
Sbjct: 187 cacggcttccatgttcatgctcttggtgacactaccaacggttgcatgtcaacaggacca 246

                                                                       
Query: 285 cacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggt 344
           || ||||| || ||||   | | |||||| || || || |||||  | ||||||||||||
Sbjct: 247 catttcaatccggctgcaaaagagcatggtgctcctgatgatgaggttcgccatgctggt 306

                              
Query: 345 gacctcggaaatgtgacag 363
           ||||| || ||||| ||||
Sbjct: 307 gaccttggtaatgtcacag 325



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 70/85 (82%)
 Strand = Plus / Plus

                                                                       
Query: 418 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
           ||||||||||||| ||||||||  | |||||||| ||||||| |||  | |||||| | |
Sbjct: 380 ctggaccacattccatcattggaagggctgttgttgtccatgctgaccccgatgatttgg 439

                                    
Query: 478 gcaagggtggacatgagcttagcaa 502
           | | |||||||||||| || |||||
Sbjct: 440 gaaggggtggacatgaactcagcaa 464



to top

>gb|U34727.1|ZMU34727 Zea mays superoxide dismutase 4A (sod4A) gene, complete cds
          Length = 4326

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 80/91 (87%), Gaps = 1/91 (1%)
 Strand = Plus / Plus

                                                                        
Query: 88   agatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagg 147
            |||||||||| ||| ||||||||||||| ||||||||     ||||||| ||||||||||
Sbjct: 2128 agatcacataaaca-tggtgaaggctgttgctgtgctgggtagcagcgatggtgtcaagg 2186

                                           
Query: 148  gcaccatcttcttcacccaggagggagatgg 178
            |||||||||| |||||||| |||||||||||
Sbjct: 2187 gcaccatctttttcacccaagagggagatgg 2217



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 63/70 (90%)
 Strand = Plus / Plus

                                                                        
Query: 308  gcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgg 367
            |||||||||||| |||||||| | ||||||||| ||||| || |||||||||||||||||
Sbjct: 2733 gcatggggcaccagaagatgagaaccgccatgccggtgatcttggaaatgtgacagctgg 2792

                      
Query: 368  agcggatggt 377
            ||| ||||||
Sbjct: 2793 agcagatggt 2802



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                        
Query: 177  ggcccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccat 236
            ||||| ||| |||| || ||||||||| | || ||||||   || ||||| || ||||||
Sbjct: 2505 ggccctaccgctgtcactggaagtgtctctggcctcaagcctggcctccatgggttccat 2564

                                                        
Query: 237  gtgcacgctcttggtgacaccaccaacggctgcatgtcaactgg 280
            || || || ||||||||||||||||| || ||||||||||||||
Sbjct: 2565 gtacatgcacttggtgacaccaccaatggatgcatgtcaactgg 2608



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                 
Query: 483  ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttg 535
            ||||| || |||||||||||||||||||||||||| || |  |||||||||||
Sbjct: 3776 ggtgggcacgagcttagcaagagcactggaaacgcgggtggccgtgttgcttg 3828



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                     
Query: 429  tcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggt 485
            |||||||||||| | |||||||| || || | |||| ||||||||||||| ||||||
Sbjct: 3116 tcaatcattggcagagctgttgttgttcacgctgatcctgatgatcttggaaagggt 3172



to top

>dbj|AB062752.1| Bruguiera gymnorhiza SodC mRNA for copper/zinc superoxide
           dismutase, complete cds
          Length = 874

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 115/139 (82%)
 Strand = Plus / Plus

                                                                       
Query: 154 tcttcttcacccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactca 213
           ||||||||| ||| |||||||||||||| || ||||| || |||| |||  | || || |
Sbjct: 192 tcttcttcaaccaagagggagatggcccaactactgtaactggaaatgtttctggcctta 251

                                                                       
Query: 214 aggaagggctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgt 273
           ||  |||||| || ||||||||||| || |||||||| ||||| || || || |||||||
Sbjct: 252 agtcagggcttcatggcttccatgttcatgctcttggggacactacaaatggttgcatgt 311

                              
Query: 274 caactggaccgcacttcaa 292
           ||||||| |||||||||||
Sbjct: 312 caactgggccgcacttcaa 330



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| || |||| |||| |||||||||| |||||||| || ||||| |||||||| 
Sbjct: 482 gctgttgttgttcatgctgatcctgatgatctgggcaagggagggcatgaacttagcaaa 541

                            
Query: 504 agcactggaaacgctgg 520
           ||||||||||| |||||
Sbjct: 542 agcactggaaatgctgg 558



to top

>gb|DQ078121.2| Rheum australe copper/zinc superoxide dismutase mRNA, complete cds
          Length = 586

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 290
           |||||||||||||||||||||||||| || || |||||||||||||||||||| || |||
Sbjct: 194 ttccatgtgcacgctcttggtgacacaacaaatggctgcatgtcaactggaccacatttc 253

             
Query: 291 aa 292
           ||
Sbjct: 254 aa 255



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 86/107 (80%)
 Strand = Plus / Plus

                                                                       
Query: 414 cttgctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgat 473
           |||| ||||||| | |||||||||||  | || || || || |||| |||| | ||||| 
Sbjct: 377 cttgttggaccaaactcaatcattggaagggcggtggttgttcatgctgatccggatgac 436

                                                          
Query: 474 cttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           |||||||||||||| ||||| || |||| || ||| ||||| |||||
Sbjct: 437 cttggcaagggtggtcatgaactgagcacgaccacaggaaatgctgg 483



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 85  ctgagatcacatacacaatggtgaaggctgt 115
           |||||||||||  ||||||||||||||||||
Sbjct: 48  ctgagatcacaatcacaatggtgaaggctgt 78



to top

>gb|AF426829.1|AF426829 Olea europaea Cu/Zn-superoxide dismutase mRNA, partial cds
          Length = 312

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 228 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 287
           ||||||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| || 
Sbjct: 13  ggcttccatgtccacgcccttggtgacaccaccaatggctgtatgtcaactggacctcat 72

                
Query: 288 ttcaa 292
           |||||
Sbjct: 73  ttcaa 77



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 466 ctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           ||||||||||||| | |||||| |||||||| |||||||| ||||||||||||||
Sbjct: 251 ctgatgatcttggaaggggtggtcatgagctgagcaagagaactggaaacgctgg 305



to top

>gb|AF054150.1|AF054150 Zantedeschia aethiopica cytosolic Cu/Zn-superoxide dismutase (sod3)
           mRNA, complete cds
          Length = 832

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| ||||||| |||  ||||||||||||| ||||| ||||||||||| ||||||
Sbjct: 487 gctgttgttgtccatgctgactctgatgatcttgggaaggggggacatgagctcagcaag 546

                            
Query: 504 agcactggaaacgctgg 520
           | ||||||||| |||||
Sbjct: 547 accactggaaatgctgg 563



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 139/173 (80%)
 Strand = Plus / Plus

                                                                       
Query: 102 atggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttcttc 161
           |||||||||||||| || || ||||| ||    ||||||||| |||||||| | ||||| 
Sbjct: 145 atggtgaaggctgttgccgttcttactggatcggagggtgtccagggcaccgtgttcttt 204

                                                                       
Query: 162 acccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactcaaggaaggg 221
            |||||||||| || |||||||| ||  | ||||| ||| |  |||| || |||   |||
Sbjct: 205 gcccaggagggggaaggcccgactaccattacggggagtttgtcgggcctaaagcctggg 264

                                                                
Query: 222 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 274
           || |||||||| ||||||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 265 cttcacggctttcatgtgcacgcgcttggtgacactaccaatggctgtatgtc 317



to top

>emb|Y13610.1|CPCZSD Carica papaya mRNA for copper/zinc-superoxide dismutase
          Length = 768

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 89/104 (85%), Gaps = 1/104 (0%)
 Strand = Plus / Plus

                                                                       
Query: 85  ctgagatcacatacacaa-tggtgaaggctgtagctgtgcttaccggcagcgagggtgtc 143
           ||||||||||||||| || ||||||||||||||||||| |||| | |||| |||||||||
Sbjct: 37  ctgagatcacatacaaaaatggtgaaggctgtagctgtccttagcagcagtgagggtgtc 96

                                                       
Query: 144 aagggcaccatcttcttcacccaggagggagatggcccgaccac 187
           |  || || |||||||||||||| |  | ||||||||| |||||
Sbjct: 97  agtggaactatcttcttcacccaagcagcagatggcccaaccac 140



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| ||||| | |||| |||||||||||||||| || || |||||||| || |||
Sbjct: 397 gctgttgttgtccacgctgatcctgatgatcttggcaaaggggggcatgagctcagtaag 456

                              
Query: 504 agcactggaaacgctgggg 522
           |  |||||||| |||||||
Sbjct: 457 actactggaaatgctgggg 475



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           |||||||||||||| || ||  | |||||||| || || ||||||||||| ||||| || 
Sbjct: 178 cacggcttccatgttcatgccttgggtgacacaacaaatggctgcatgtcgactggtcct 237

                                                                       
Query: 285 cacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggt 344
           || ||||| || |||||  | |  ||||| || || || ||||| ||||| |||||||||
Sbjct: 238 catttcaatcctgctggcaaagaacatggtgctccagaggatgacatccgtcatgctggt 297

                         
Query: 345 gacctcggaaatgt 358
           ||||| ||||||||
Sbjct: 298 gaccttggaaatgt 311



to top

>gb|DQ088818.1| Gossypium hirsutum cytoplasmic Cu/ZnSOD mRNA, complete cds
          Length = 459

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 112/137 (81%)
 Strand = Plus / Plus

                                                                       
Query: 222 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 281
           ||||| ||||||||||| || || ||||| ||||| || ||||| |||||||||||||||
Sbjct: 121 ctccatggcttccatgttcatgcccttggggacacaactaacgggtgcatgtcaactgga 180

                                                                       
Query: 282 ccgcacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgct 341
           || || || || || |||||  | | |||||| || || |||||||| | ||||||||||
Sbjct: 181 ccccattttaatcctgctggcaaagagcatggtgctccngaagatgagaaccgccatgct 240

                            
Query: 342 ggtgacctcggaaatgt 358
           ||||| || || |||||
Sbjct: 241 ggtgatctaggnaatgt 257



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 468 gatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           ||||| ||||||||||| || |||||||| ||||| ||||| ||||| |||||
Sbjct: 367 gatgaccttggcaagggcggccatgagctcagcaaaagcacaggaaatgctgg 419



to top

>emb|AJ428575.2|OEU428575 Olea europaea Cu/Zn super-oxide dismutase (ole e 5 allergen)
          Length = 714

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 99/119 (83%)
 Strand = Plus / Plus

                                                                       
Query: 228 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 287
           ||||| ||||| ||||| ||||||||||||||||| ||||| |||||||||||||| || 
Sbjct: 127 ggctttcatgtccacgcccttggtgacaccaccaatggctgtatgtcaactggacctcat 186

                                                                      
Query: 288 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 346
           ||||| || | |||  | | |||||| ||||| | |||||| | ||| |||||||||||
Sbjct: 187 ttcaatcctgttgggaaagagcatggtgcacctggagatgagaaccgtcatgctggtga 245



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 466 ctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           ||||||||||||| | |||||| ||||| || ||||||||||||||||| |||||
Sbjct: 365 ctgatgatcttggaaggggtggtcatgaactgagcaagagcactggaaatgctgg 419



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 102 atggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttcttc 161
           ||||||||||| ||| | || || | | |||||||||||||||  |||||| ||| ||||
Sbjct: 1   atggtgaaggccgtaacagtcctcaacagcagcgagggtgtcactggcaccgtctacttc 60

                            
Query: 162 acccaggagggagatgg 178
           ||||| || ||||||||
Sbjct: 61  acccaagaaggagatgg 77



to top

>emb|AJ278669.1|PTR278669 Populus tremula x Populus tremuloides mRNA for putative cytosolic
           CuZn-superoxide dismutase (cyt-SOD1 gene)
          Length = 851

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                       
Query: 418 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
           |||||||| |||| ||| ||||  | |||||||| || ||||  ||| ||||||||||||
Sbjct: 395 ctggaccaaattccatcgttggaagggctgttgttgttcatgcagatcctgatgatcttg 454

                                                      
Query: 478 gcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           ||||||| |||||||| |||||||| |||||||| || |||||
Sbjct: 455 gcaagggaggacatgaacttagcaaaagcactggtaatgctgg 497



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 163/203 (80%), Gaps = 1/203 (0%)
 Strand = Plus / Plus

                                                                       
Query: 85  ctgagatcacataca-caatggtgaaggctgtagctgtgcttaccggcagcgagggtgtc 143
           ||||||||||||| | |||||||||||||||| ||||| || |   |||| || ||||||
Sbjct: 61  ctgagatcacatagaacaatggtgaaggctgttgctgttctgaatagcagtgaaggtgtc 120

                                                                       
Query: 144 aagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgggaagtgtc 203
           || |||||||||  ||| ||||| || |||||||| || || ||||| || |||||  ||
Sbjct: 121 aaaggcaccatcaactttacccaagaaggagatggtccaactactgtaactggaagcctc 180

                                                                       
Query: 204 acgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgacaccaccaac 263
              || || |||  ||| || || ||||||||||| || || ||||| |||||||| || 
Sbjct: 181 tgtggtcttaagccaggccttcatggcttccatgttcatgcccttggagacaccacaaat 240

                                  
Query: 264 ggctgcatgtcaactggaccgca 286
           ||||||||||||||||| |||||
Sbjct: 241 ggctgcatgtcaactggcccgca 263



to top

>dbj|AB190501.1| Populus alba x Populus tremula var. glandulosa CuZn-SOD mRNA for
           CuZn-superoxide dismutase, complete cds, clone:
           PO3024C12
          Length = 730

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 163/203 (80%), Gaps = 1/203 (0%)
 Strand = Plus / Plus

                                                                       
Query: 85  ctgagatcacataca-caatggtgaaggctgtagctgtgcttaccggcagcgagggtgtc 143
           ||||||||||||| | |||||||||||||||| ||||| || |   |||| || ||||||
Sbjct: 60  ctgagatcacatagaacaatggtgaaggctgttgctgttctgaatagcagtgaaggtgtc 119

                                                                       
Query: 144 aagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgggaagtgtc 203
           || |||||||||  ||| ||||| || |||||||| || || ||||| || |||||  ||
Sbjct: 120 aaaggcaccatcaactttacccaagaaggagatggtccaactactgtaactggaagcctc 179

                                                                       
Query: 204 acgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgacaccaccaac 263
              || || |||  ||| || || ||||||||||| || || ||||| |||||||| || 
Sbjct: 180 tgtggtcttaagccaggccttcatggcttccatgttcatgcccttggagacaccacaaat 239

                                  
Query: 264 ggctgcatgtcaactggaccgca 286
           ||||||||||||||||| |||||
Sbjct: 240 ggctgcatgtcaactggcccgca 262



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 466 ctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           ||||||||||||||||||| |||||||| |||||||| |||||||| || |||||
Sbjct: 442 ctgatgatcttggcaagggaggacatgaacttagcaaaagcactggtaatgctgg 496



to top

>dbj|AB190500.1| Populus alba x Populus tremula var. glandulosa CuZn-SOD mRNA for
           CuZn-superoxide dismutase, complete cds, clone:
           PO3023E02
          Length = 725

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 163/203 (80%), Gaps = 1/203 (0%)
 Strand = Plus / Plus

                                                                       
Query: 85  ctgagatcacataca-caatggtgaaggctgtagctgtgcttaccggcagcgagggtgtc 143
           ||||||||||||| | |||||||||||||||| ||||| || |   |||| || ||||||
Sbjct: 80  ctgagatcacatagaacaatggtgaaggctgttgctgttctgaatagcagtgaaggtgtc 139

                                                                       
Query: 144 aagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgggaagtgtc 203
           || |||||||||  ||| ||||| || |||||||| || || ||||| || |||||  ||
Sbjct: 140 aaaggcaccatcaactttacccaagaaggagatggtccaactactgtaactggaagcctc 199

                                                                       
Query: 204 acgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgacaccaccaac 263
              || || |||  ||| || || ||||||||||| || || ||||| |||||||| || 
Sbjct: 200 tgtggtcttaagccaggccttcatggcttccatgttcatgcccttggagacaccacaaat 259

                                  
Query: 264 ggctgcatgtcaactggaccgca 286
           ||||||||||||||||| |||||
Sbjct: 260 ggctgcatgtcaactggcccgca 282



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 466 ctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           ||||||||||||||||||| |||||||| |||||||| |||||||| || |||||
Sbjct: 462 ctgatgatcttggcaagggaggacatgaacttagcaaaagcactggtaatgctgg 516



to top

>dbj|AB091055.1| Barbula unguiculata mRNA for cytosolic copper/zinc superoxide
           dismutase, partial cds
          Length = 276

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                       
Query: 222 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 281
           |||||||| ||||| || ||||| || |||||||| ||||| ||||||||||||||||| 
Sbjct: 4   ctccacggattccacgttcacgccctgggtgacacaaccaatggctgcatgtcaactggt 63

                          
Query: 282 ccgcacttcaacccc 296
           || ||||||||||||
Sbjct: 64  ccccacttcaacccc 78



to top

>gb|AF016892.1|AF016892 Populus tremuloides cytoplasmic superoxide dismutase 1 (SODcyt1)
           mRNA, complete cds
          Length = 787

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                       
Query: 418 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
           ||||||||||||| || |||||  | |||||||| || ||||| ||| ||||||||||||
Sbjct: 395 ctggaccacattccattattggttgggctgttgttgttcatggagatcctgatgatcttg 454

                                                      
Query: 478 gcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           ||||||| |||||||| || ||||| | |||||| || |||||
Sbjct: 455 gcaagggaggacatgaactcagcaaaaccactggtaatgctgg 497



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 91/107 (85%), Gaps = 1/107 (0%)
 Strand = Plus / Plus

                                                                       
Query: 85  ctgagatcacataca-caatggtgaaggctgtagctgtgcttaccggcagcgagggtgtc 143
           ||||||||||||| | |||||||||||||||||||||| ||||   |||| || ||||| 
Sbjct: 61  ctgagatcacatagaacaatggtgaaggctgtagctgttcttaatagcagtgaaggtgtg 120

                                                          
Query: 144 aagggcaccatcttcttcacccaggagggagatggcccgaccactgt 190
           |  |||||||||||||| ||||| || ||||||||||| || |||||
Sbjct: 121 agtggcaccatcttctttacccaagaaggagatggcccaactactgt 167



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 228 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgca 286
           |||||||| || || || ||||| |||||||| || ||||||||||||||||| |||||
Sbjct: 205 ggcttccacgtccatgcccttggagacaccacaaatggctgcatgtcaactgggccgca 263



to top

>gb|U80069.1|MCU80069 Mesembryanthemum crystallinum cytosolic copper/zinc superoxide
           dismutase (SOD) mRNA, complete cds
          Length = 816

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 219 gggctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaact 278
           |||||||| || || ||||| ||||| |||||||||||||| || ||||||||||| |||
Sbjct: 248 gggctccatggatttcatgttcacgcccttggtgacaccacaaatggctgcatgtccact 307

                                  
Query: 279 ggaccgcacttcaaccccgctgg 301
           ||||| |||||||| || |||||
Sbjct: 308 ggaccacacttcaatcctgctgg 330



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           ||||| || ||||||| |||| ||||||||||||| | ||| ||||||||||| ||||||
Sbjct: 473 gctgtcgttgtccatgctgatcctgatgatcttggaagggggggacatgagctcagcaag 532



to top

>emb|X95728.1|BJMSOD1GE B.juncea mRNA for Cu/Zn-superoxide dismutase
          Length = 766

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 134/166 (80%)
 Strand = Plus / Plus

                                                                       
Query: 130 gcagcgagggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactg 189
           ||||||||||||| ||||| |||||||||||||| ||||| ||| | ||  | |||||||
Sbjct: 107 gcagcgagggtgttaaggggaccatcttcttcactcaggaaggaaacggtaccaccactg 166

                                                                       
Query: 190 tgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttg 249
           |||| ||||  ||  | || || |||   || ||||| || |||||||| || |||||||
Sbjct: 167 tgacaggaaccgtttctggccttaagcctggtctccatggtttccatgtccatgctcttg 226

                                                         
Query: 250 gtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccc 295
           |||||||||| ||||| |||||||| || || || || ||||||||
Sbjct: 227 gtgacaccactaacggttgcatgtctaccggtccacatttcaaccc 272



to top

>gb|AF071112.1|AF071112 Brassica rapa ssp. pekinensis cytosolic Cu/Zn superoxide dismutase
           mRNA, complete cds
          Length = 757

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 134/166 (80%)
 Strand = Plus / Plus

                                                                       
Query: 130 gcagcgagggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactg 189
           |||| |||||||| ||||| || ||||||||||||||||| ||||||||  | || ||||
Sbjct: 123 gcagtgagggtgttaaggggactatcttcttcacccaggaaggagatggtgccacaactg 182

                                                                       
Query: 190 tgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttg 249
           |||| |||| |||  | || || ||    || | ||| || |||||||| || |||||||
Sbjct: 183 tgactggaactgtttctggtcttaaacctggtccccatggtttccatgtccatgctcttg 242

                                                         
Query: 250 gtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccc 295
           |||||||||||||||| |||||||| || || || || ||||||||
Sbjct: 243 gtgacaccaccaacggttgcatgtctaccggtccacatttcaaccc 288



to top

>gb|AY694187.1| Camellia sinensis Cu/Zn superoxide dismutase mRNA, partial cds
          Length = 403

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 73/85 (85%)
 Strand = Plus / Plus

                                                                       
Query: 418 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
           |||||||||| || ||||||||  | || ||||| |||||||  ||  ||||||| ||||
Sbjct: 260 ctggaccacactctatcattggtagggccgttgttgtccatgcagaccctgatgaccttg 319

                                    
Query: 478 gcaagggtggacatgagcttagcaa 502
           |||||||||||||||||||||||||
Sbjct: 320 gcaagggtggacatgagcttagcaa 344



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 103/126 (81%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 290
           |||||||| || |||||||| ||||| ||||| || ||||||||||||||||| || |||
Sbjct: 73  ttccatgttcatgctcttggggacacaaccaatggttgcatgtcaactggaccacatttc 132

                                                                       
Query: 291 aaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctc 350
           || || |||||  | | ||||||| | || |||||||| |  || ||||||||||| || 
Sbjct: 133 aatcctgctggcaaagagcatgggtctcctgaagatgagactcgtcatgctggtgatctt 192

                 
Query: 351 ggaaat 356
           ||||||
Sbjct: 193 ggaaat 198



to top

>gb|DQ481231.1| Populus suaveolens cytoplasmic Cu/Zn-superoxide dismutase (SODcyt1)
           mRNA, complete cds
          Length = 487

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 73/85 (85%)
 Strand = Plus / Plus

                                                                       
Query: 418 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
           ||||||||||||| || |||||  | |||||||| || ||||| ||| ||||||||||||
Sbjct: 336 ctggaccacattccattattggaagggctgttgttgttcatggagatcctgatgatcttg 395

                                    
Query: 478 gcaagggtggacatgagcttagcaa 502
           ||||||| |||||||| || |||||
Sbjct: 396 gcaagggaggacatgaactcagcaa 420



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 150/188 (79%)
 Strand = Plus / Plus

                                                                       
Query: 99  acaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttc 158
           ||||||||||||||||||||||| ||||   |||| || ||||| |  ||||||||||||
Sbjct: 17  acaatggtgaaggctgtagctgttcttaatagcagtgaaggtgtgagtggcaccatcttc 76

                                                                       
Query: 159 ttcacccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactcaaggaa 218
           || ||||| || ||||||||||| || ||||| || ||||   |  | || || |||  |
Sbjct: 77  tttacccaagaaggagatggcccaactactgtaactggaaacctttctggtcttaagcca 136

                                                                       
Query: 219 gggctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaact 278
           || || || |||||||| || || || ||| | |||||||| || |||||||||||||||
Sbjct: 137 ggccttcatggcttccacgtccatgcccttagagacaccacaaatggctgcatgtcaact 196

                   
Query: 279 ggaccgca 286
           || |||||
Sbjct: 197 gggccgca 204



to top

>gb|DQ499511.1| Arachis hypogaea cultivar JL-24 Cu-Zn superoxide dismutase mRNA,
           complete cds
          Length = 562

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| ||||||| |||| ||||||||||||| || ||||| |||||||||||||| 
Sbjct: 349 gctgttgttgtccatgctgatcctgatgatcttgggaaaggtgggcatgagcttagcaaa 408

                            
Query: 504 agcactggaaacgctgg 520
             ||||||||| |||||
Sbjct: 409 tccactggaaatgctgg 425



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 290
           |||||||| || || ||||| |||||||| || || ||| |||||||||||||||| |||
Sbjct: 136 ttccatgtccatgcccttggagacaccacaaatggttgcctgtcaactggaccgcatttc 195

             
Query: 291 aa 292
           ||
Sbjct: 196 aa 197



to top

>emb|X73139.1|IBSOD I.batatas mRNA for superoxide dismutase
          Length = 702

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| || ||||||||| | ||||||||||| || ||||| |||||||| ||||| 
Sbjct: 369 gctgttgttgttcatggtgatcccgatgatcttggtaaaggtggccatgagctcagcaaa 428

                            
Query: 504 agcactggaaacgctgg 520
           ||||||||||| |||||
Sbjct: 429 agcactggaaatgctgg 445



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 171/218 (78%), Gaps = 1/218 (0%)
 Strand = Plus / Plus

                                                                       
Query: 85  ctgagatcacatacacaa-tggtgaaggctgtagctgtgcttaccggcagcgagggtgtc 143
           ||||||||||| ||| || ||||||||||||| || || |||| | | || || ||||||
Sbjct: 9   ctgagatcacaaacaaaaatggtgaaggctgtcgcagttcttagcagtagtgaaggtgtc 68

                                                                       
Query: 144 aagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgggaagtgtc 203
           |  |||||||| ||||||| ||| || |||||||| || ||||| || || ||||  || 
Sbjct: 69  agcggcaccattttcttcagccaagaaggagatggtccaaccacagtcactggaaacgtt 128

                                                                       
Query: 204 acgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgacaccaccaac 263
            |||| |||||    || || || ||||||||||| || || || |||||||| || || 
Sbjct: 129 tcgggcctcaaacctggtcttcatggcttccatgtccatgccctaggtgacacaacaaat 188

                                                 
Query: 264 ggctgcatgtcaactggaccgcacttcaaccccgctgg 301
           || |||||||| |||||||| || ||||| || |||||
Sbjct: 189 ggatgcatgtctactggaccacatttcaatcctgctgg 226



to top

>gb|DQ097721.1| Arachis hypogaea Cu-Zn superoxide dismutase mRNA, complete cds
          Length = 617

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| ||||||| |||| ||||||||||||| || ||||| |||||||||||||| 
Sbjct: 393 gctgttgttgtccatgctgatcctgatgatcttgggaaaggtgggcatgagcttagcaaa 452

                            
Query: 504 agcactggaaacgctgg 520
             ||||||||| |||||
Sbjct: 453 tccactggaaatgctgg 469



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 290
           |||||||| || || ||||| |||||||| || || ||| |||||||||||||||| |||
Sbjct: 180 ttccatgtccatgcccttggagacaccacaaatggttgcctgtcaactggaccgcatttc 239

             
Query: 291 aa 292
           ||
Sbjct: 240 aa 241



to top

>emb|AJ786258.1| Helianthus annuus mRNA for Cu/Zn superoxide dismutase, (sod2 gene)
          Length = 729

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           ||||| || ||||||| |||| ||||||||||||| ||||| || |||||||| ||||| 
Sbjct: 432 gctgtggttgtccatgctgatcctgatgatcttggaaagggagggcatgagctaagcaaa 491

                            
Query: 504 agcactggaaacgctgg 520
           ||||||||||| |||||
Sbjct: 492 agcactggaaatgctgg 508



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 231 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaac 277
           |||||||| || || ||||||||||| ||||| || |||||||||||
Sbjct: 219 ttccatgttcatgcgcttggtgacacaaccaatggatgcatgtcaac 265



to top

>gb|AF355460.1|AF355460 Solanum tuberosum Cu/Zn-superoxide dismutase mRNA, partial cds
          Length = 617

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| || |||| |||| ||||||||||||| ||||| ||||||||||| || || 
Sbjct: 321 gctgttgttgttcatgctgatcctgatgatcttggaaagggaggacatgagctcagtaaa 380

                            
Query: 504 agcactggaaacgctgg 520
           ||||||||||| |||||
Sbjct: 381 agcactggaaatgctgg 397



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 228 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 287
           ||||||||||| || || |||||||| ||||| || |||||||||||||| ||||| || 
Sbjct: 105 ggcttccatgtccatgcccttggtgataccacaaatggctgcatgtcaacaggaccacat 164

                                                                      
Query: 288 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 346
           | ||| || |||||| | | |||||| || || ||||||||  | || |||||||||||
Sbjct: 165 tacaatcctgctggtaaggagcatggtgctcctgaagatgaggtgcgtcatgctggtga 223



to top

>gb|AF354748.1|AF354748 Solanum tuberosum copper-zinc superoxide dismutase mRNA, partial
           cds
          Length = 443

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| || |||| |||| ||||||||||||| ||||| ||||||||||| || || 
Sbjct: 331 gctgttgttgttcatgctgatcctgatgatcttggaaagggaggacatgagctcagtaaa 390

                            
Query: 504 agcactggaaacgctgg 520
           ||||||||||| |||||
Sbjct: 391 agcactggaaatgctgg 407



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 228 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 287
           ||||||||||| || || |||||||| ||||| || |||||||||||||| ||||| || 
Sbjct: 115 ggcttccatgtccatgcccttggtgataccacaaatggctgcatgtcaacaggaccacat 174

                                                                      
Query: 288 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 346
           | ||| || |||||| | | |||||| || || ||||||||  | || |||||||||||
Sbjct: 175 tacaatcctgctggtaaggagcatggtgctcctgaagatgaggtgcgtcatgctggtga 233



to top

>ref|NM_100757.2| Arabidopsis thaliana CSD1; copper, zinc superoxide dismutase
           AT1G08830 (CSD1) mRNA, complete cds
          Length = 789

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 290
           |||||||| || ||||||||||||||||| ||||| |||||||| ||||| || || |||
Sbjct: 256 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactggtccacatttc 315

                       
Query: 291 aaccccgctggt 302
           ||||||| ||||
Sbjct: 316 aaccccgatggt 327



to top

>gb|DQ227345.1| Nelumbo nucifera isolate 0 copper-zinc superoxide dismutase
           (CuZn-SOD) mRNA, complete cds
          Length = 461

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 290
           |||||||| || |||||||||||||| || || || ||||||||||| ||||| || || 
Sbjct: 131 ttccatgtccatgctcttggtgacacaacaaatggttgcatgtcaacaggaccacatttt 190

                                                                       
Query: 291 aaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctc 350
           |||||   |||| | | |||||| || ||||| ||||||| ||| |||||||||||||| 
Sbjct: 191 aaccctcatggtaaagagcatggtgctcccgaggatgaaaaccgtcatgctggtgacctt 250

                   
Query: 351 ggaaatgt 358
           || |||||
Sbjct: 251 gggaatgt 258



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| || |||| |||| ||||||||||||| || || |||||||| || ||||| 
Sbjct: 344 gctgttgttgtgcatgctgatcctgatgatcttggaaaaggaggacatgaactcagcaaa 403

                            
Query: 504 agcactggaaacgctgg 520
           |||||||| || |||||
Sbjct: 404 agcactgggaatgctgg 420



to top

>gb|AY091168.1| Arabidopsis thaliana putative superoxide dismutase (At1g08830)
           mRNA, complete cds
          Length = 490

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 290
           |||||||| || ||||||||||||||||| ||||| |||||||| ||||| || || |||
Sbjct: 130 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactggtccacatttc 189

                       
Query: 291 aaccccgctggt 302
           ||||||| ||||
Sbjct: 190 aaccccgatggt 201



to top

>gb|AY050932.1| Arabidopsis thaliana putative superoxidase dismutase (At1g08830)
           mRNA, complete cds
          Length = 769

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 290
           |||||||| || ||||||||||||||||| ||||| |||||||| ||||| || || |||
Sbjct: 225 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactggtccacatttc 284

                       
Query: 291 aaccccgctggt 302
           ||||||| ||||
Sbjct: 285 aaccccgatggt 296



to top

>emb|X60935.1|ATCZSUDI A.thaliana mRNA for Cu,Zn superoxide dismutase
          Length = 788

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 290
           |||||||| || ||||||||||||||||| ||||| |||||||| ||||| || || |||
Sbjct: 242 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactggtccacatttc 301

                       
Query: 291 aaccccgctggt 302
           ||||||| ||||
Sbjct: 302 aaccccgatggt 313



to top

>emb|X55974.1|NPSODM N.plumbaginifolia mRNA for superoxide dismutase
          Length = 837

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 208/264 (78%), Gaps = 1/264 (0%)
 Strand = Plus / Plus

                                                                       
Query: 84  cctgagatcacatac-acaatggtgaaggctgtagctgtgcttaccggcagcgagggtgt 142
           ||||||||||||||| | |||||||||||| || || || |||| | |||| || |||||
Sbjct: 70  cctgagatcacataccaaaatggtgaaggccgttgccgtccttagcagcagtgaaggtgt 129

                                                                       
Query: 143 caagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgggaagtgt 202
            |  ||||||||||||||||| || || |||||||  || ||||| || || |||| |||
Sbjct: 130 tagcggcaccatcttcttcactcaagatggagatgcaccaaccacagttactggaaatgt 189

                                                                       
Query: 203 cacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgacaccaccaa 262
           | | || || ||    || || || ||||||||||| || || |||||||| ||||| ||
Sbjct: 190 ctctggcctaaaacccggacttcatggcttccatgtccatgcccttggtgataccacaaa 249

                                                                       
Query: 263 cggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatggggcacccga 322
            |||||||||||||| ||||| || | ||| || |||||| | | |||||| || || ||
Sbjct: 250 tggctgcatgtcaacgggaccacattacaatcctgctggtaaggagcatggtgctcctga 309

                                   
Query: 323 agatgaaatccgccatgctggtga 346
           ||||||  | || |||||||||||
Sbjct: 310 agatgaggtgcgtcatgctggtga 333



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 85/104 (81%)
 Strand = Plus / Plus

                                                                       
Query: 417 gctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatctt 476
           ||||| ||||| || ||||||||  | ||||| || || |||| |||| |||||||||||
Sbjct: 404 gctggtccacaatccatcattggtagagctgtggttgttcatgctgatcctgatgatctt 463

                                                       
Query: 477 ggcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           || ||||| ||||| ||||| || || | ||||||||| |||||
Sbjct: 464 ggaaagggaggacacgagctcagtaaaaccactggaaatgctgg 507



to top

>emb|BX818158.1|CNS0AE2K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL64ZA05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 737

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 290
           |||||||| || ||||||||||||||||| ||||| |||||||| ||||| || || |||
Sbjct: 204 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactggtccacatttc 263

                       
Query: 291 aaccccgctggt 302
           ||||||| ||||
Sbjct: 264 aaccccgatggt 275



to top

>gb|AY087273.1| Arabidopsis thaliana clone 33493 mRNA, complete sequence
          Length = 788

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 290
           |||||||| || ||||||||||||||||| ||||| |||||||| ||||| || || |||
Sbjct: 256 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactggtccacatttc 315

                       
Query: 291 aaccccgctggt 302
           ||||||| ||||
Sbjct: 316 aaccccgatggt 327



to top

>gb|AY881163.1| Nelumbo nucifera isolate 13 copper-zinc superoxide dismutase mRNA,
           partial cds
          Length = 457

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 290
           |||||||| || |||||||||||||| || || || ||||||||||| ||||| || || 
Sbjct: 131 ttccatgtccatgctcttggtgacacaacaaatggttgcatgtcaacaggaccacatttt 190

                                                                       
Query: 291 aaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctc 350
           |||||   |||| | | |||||| || ||||| ||||||| ||| |||||||||||||| 
Sbjct: 191 aaccctcatggtaaagagcatggtgctcccgaggatgaaaaccgtcatgctggtgacctt 250

                   
Query: 351 ggaaatgt 358
           || |||||
Sbjct: 251 gggaatgt 258



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| || |||| |||| ||||||||||||| || || |||||||| || ||||| 
Sbjct: 344 gctgttgttgtgcatgctgatcctgatgatcttggaaaaggaggacatgaactcagcaaa 403

                            
Query: 504 agcactggaaacgctgg 520
           |||||||| || |||||
Sbjct: 404 agcactgggaatgctgg 420



to top

>gb|AY881162.1| Nelumbo nucifera isolate 11 copper-zinc superoxide dismutase mRNA,
           partial cds
          Length = 457

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 290
           |||||||| || |||||||||||||| || || || ||||||||||| ||||| || || 
Sbjct: 131 ttccatgtccatgctcttggtgacacaacaaatggttgcatgtcaacaggaccacatttt 190

                                                                       
Query: 291 aaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctc 350
           |||||   |||| | | |||||| || ||||| ||||||| ||| |||||||||||||| 
Sbjct: 191 aaccctcatggtaaagagcatggtgctcccgaggatgaaaaccgtcatgctggtgacctt 250

                   
Query: 351 ggaaatgt 358
           || |||||
Sbjct: 251 gggaatgt 258



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| || |||| |||| ||||||||||||| || || |||||||| || ||||| 
Sbjct: 344 gctgttgttgtgcatgctgatcctgatgatcttggaaaaggaggacatgaactcagcaaa 403

                            
Query: 504 agcactggaaacgctgg 520
           |||||||| || |||||
Sbjct: 404 agcactgggaatgctgg 420



to top

>gb|AY881155.1| Nelumbo nucifera isolate 4 copper-zinc superoxide dismutase mRNA,
           partial cds
          Length = 457

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 290
           |||||||| || |||||||||||||| || || || ||||||||||| ||||| || || 
Sbjct: 131 ttccatgtccatgctcttggtgacacaacaaatggttgcatgtcaacaggaccacatttt 190

                                                                       
Query: 291 aaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctc 350
           |||||   |||| | | |||||| || ||||| ||||||| ||| |||||||||||||| 
Sbjct: 191 aaccctcatggtaaagagcatggtgctcccgaggatgaaaaccgtcatgctggtgacctt 250

                   
Query: 351 ggaaatgt 358
           || |||||
Sbjct: 251 gggaatgt 258



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| || |||| |||| ||||||||||||| || || |||||||| || ||||| 
Sbjct: 344 gctgttgttgtgcatgctgatcctgatgatcttggaaaaggaggacatgaactcagcaaa 403

                            
Query: 504 agcactggaaacgctgg 520
           |||||||| || |||||
Sbjct: 404 agcactgggaatgctgg 420



to top

>emb|X14040.1|LECYTSOD Tomato mRNA for cytoplasmic Cu-Zn superoxide dismutase (EC
           1.15.1.1)
          Length = 777

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 86/103 (83%)
 Strand = Plus / Plus

                                                                       
Query: 418 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
           |||| ||||| || ||||||||  | |||||||| || |||| |||| ||||||||||||
Sbjct: 322 ctggtccacagtccatcattggaagagctgttgttgttcatgctgatcctgatgatcttg 381

                                                      
Query: 478 gcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           | ||||| ||||||||||| || || ||||| ||||| |||||
Sbjct: 382 gaaagggaggacatgagctcagtaaaagcaccggaaatgctgg 424



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 96/119 (80%)
 Strand = Plus / Plus

                                                                       
Query: 228 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 287
           ||||||||||| || || |||||||| ||||| || ||||| |||||||| ||||| || 
Sbjct: 132 ggcttccatgtccatgcccttggtgataccacaaatggctgtatgtcaacaggaccacat 191

                                                                      
Query: 288 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 346
           | ||| || |||||| | | |||||| || || ||||||||  | || |||||||||||
Sbjct: 192 tacaatcctgctggtaaggagcatggtgctcctgaagatgaggtgcgtcatgctggtga 250



to top

>emb|AJ844861.1| Drosophila bipectinata partial Sod gene, exons 1-2, strain Pune
          Length = 996

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           |||||||||||||||||||   ||||||||| ||||||||||||||||||  |||| || 
Sbjct: 714 cacggcttccatgtgcacgagtttggtgacaacaccaacggctgcatgtcctctggtcct 773

                      
Query: 285 cacttcaaccc 295
           || ||||||||
Sbjct: 774 catttcaaccc 784



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 462 gatgctgatgatcttggcaagggtggacatgagcttagcaaga 504
           ||||| |||||||| |||||||||||||| ||||| |||||||
Sbjct: 951 gatgccgatgatctgggcaagggtggacacgagctcagcaaga 993



to top

>emb|AJ844854.1| Drosophila malerkotliana pallens partial Sod gene, exons 1-2,
           strain KB270
          Length = 1000

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           |||||||||||||||||||   ||||||||| ||||||||||||||||||  |||| || 
Sbjct: 718 cacggcttccatgtgcacgagtttggtgacaacaccaacggctgcatgtcctctggtcct 777

                      
Query: 285 cacttcaaccc 295
           || ||||||||
Sbjct: 778 catttcaaccc 788



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 432 atcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacat 491
           |||||||| ||| |||| || ||||| |  ||||| |||||||| |||||||||||||| 
Sbjct: 925 atcattggacgtactgtagtggtccacgccgatgccgatgatctgggcaagggtggacac 984

                        
Query: 492 gagcttagcaaga 504
           ||||| |||||||
Sbjct: 985 gagctcagcaaga 997



to top

>emb|AJ844850.1| Drosophila bipectinata partial Sod gene, exons 1-2, strain 381.3
          Length = 994

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           |||||||||||||||||||   ||||||||| ||||||||||||||||||  |||| || 
Sbjct: 712 cacggcttccatgtgcacgagtttggtgacaacaccaacggctgcatgtcctctggtcct 771

                      
Query: 285 cacttcaaccc 295
           || ||||||||
Sbjct: 772 catttcaaccc 782



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                       
Query: 432 atcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacat 491
           |||||||| ||| |||| |||||||| |  ||||| |||||||| |||||||||||||| 
Sbjct: 919 atcattggacgtactgtggtcgtccacgccgatgccgatgatctgggcaagggtggacac 978

                        
Query: 492 gagcttagcaaga 504
           ||||| |||||||
Sbjct: 979 gagctcagcaaga 991



to top

>emb|AJ844844.1| Drosophila malerkotliana malerkotliana partial Sod gene, exons 1-2,
           strain 391.0
          Length = 994

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           |||||||||||||||||||   ||||||||| ||||||||||||||||||  |||| || 
Sbjct: 712 cacggcttccatgtgcacgagtttggtgacaacaccaacggctgcatgtcctctggtccc 771

                      
Query: 285 cacttcaaccc 295
           || ||||||||
Sbjct: 772 catttcaaccc 782



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 462 gatgctgatgatcttggcaagggtggacatgagcttagcaaga 504
           ||||| |||||||| |||||||||||||| ||||| |||||||
Sbjct: 949 gatgccgatgatctgggcaagggtggacacgagctcagcaaga 991



to top

>gb|M37150.1|TOMSODA Tomato superoxide dismutase (SOD) mRNA, complete cds
          Length = 776

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 86/103 (83%)
 Strand = Plus / Plus

                                                                       
Query: 418 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
           |||| ||||| || ||||||||  | |||||||| || |||| |||| ||||||||||||
Sbjct: 322 ctggtccacagtccatcattggaagagctgttgttgttcatgctgatcctgatgatcttg 381

                                                      
Query: 478 gcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           | ||||| ||||||||||| || || ||||| ||||| |||||
Sbjct: 382 gaaagggaggacatgagctcagtaaaagcaccggaaatgctgg 424



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 96/119 (80%)
 Strand = Plus / Plus

                                                                       
Query: 228 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 287
           ||||||||||| || || |||||||| ||||| || ||||| |||||||| ||||| || 
Sbjct: 132 ggcttccatgtccatgcccttggtgataccacaaatggctgtatgtcaacaggaccacat 191

                                                                      
Query: 288 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 346
           | ||| || |||||| | | |||||| || || ||||||||  | || |||||||||||
Sbjct: 192 tacaatcctgctggtaaggagcatggtgctcctgaagatgaggtgcgtcatgctggtga 250



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                            
Query: 183      accactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcac 242
                ||||||||||| ||||||||| | || ||||||   || ||||| || |||||| | || 
Sbjct: 13157201 accactgtgactggaagtgtctctggcctcaagcctggtctccatgggttccatattcat 13157260

                                                      
Query: 243      gctcttggtgacaccaccaacggctgcatgtcaactgg 280
                || ||||||||||||||||| || ||||||||||||||
Sbjct: 13157261 gcacttggtgacaccaccaatggttgcatgtcaactgg 13157298



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                            
Query: 308      gcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgg 367
                |||||| ||||| |||||||| | ||||||||||||||| || |||||||| || |||||
Sbjct: 13157450 gcatggagcaccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctgg 13157509

                  
Query: 368      ag 369
                ||
Sbjct: 13157510 ag 13157511



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                        
Query: 483      ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgg 538
                ||||| || ||||| ||||||| ||| ||||||||||| |  ||||||||||||||
Sbjct: 13158488 ggtgggcacgagctgagcaagaccaccggaaacgctggtggccgtgttgcttgcgg 13158543



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                            
Query: 418      ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
                |||||||| |||||||||||||| | || || || || ||||  ||| ||||||||||||
Sbjct: 13157962 ctggaccaaattcaatcattggcagagccgtcgttgtgcatgccgatcctgatgatcttg 13158021

                        
Query: 478      gcaagggt 485
                | ||||||
Sbjct: 13158022 gaaagggt 13158029



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                      
Query: 88       agatcacatacacaatggtgaaggctgtagctgtgctt 125
                |||||||||  ||||||||||||||||| | |||||||
Sbjct: 13157014 agatcacattaacaatggtgaaggctgttgttgtgctt 13157051



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 247     ttggtgacaccaccaacggctgca 270
               |||| |||||||||||||||||||
Sbjct: 6243317 ttggcgacaccaccaacggctgca 6243294



to top

>gb|AC135257.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1113A07,
             from chromosome 3, complete sequence
          Length = 151173

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                         
Query: 183   accactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcac 242
             ||||||||||| ||||||||| | || ||||||   || ||||| || |||||| | || 
Sbjct: 69437 accactgtgactggaagtgtctctggcctcaagcctggtctccatgggttccatattcat 69378

                                                   
Query: 243   gctcttggtgacaccaccaacggctgcatgtcaactgg 280
             || ||||||||||||||||| || ||||||||||||||
Sbjct: 69377 gcacttggtgacaccaccaatggttgcatgtcaactgg 69340



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                         
Query: 308   gcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgg 367
             |||||| ||||| |||||||| | ||||||||||||||| || |||||||| || |||||
Sbjct: 69188 gcatggagcaccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctgg 69129

               
Query: 368   ag 369
             ||
Sbjct: 69128 ag 69127



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                         
Query: 418   ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
             |||||||| |||||||||||||| | || || || || ||||  ||| ||||||||||||
Sbjct: 68676 ctggaccaaattcaatcattggcagagccgtcgttgtgcatgccgatcctgatgatcttg 68617

                     
Query: 478   gcaagggt 485
             | ||||||
Sbjct: 68616 gaaagggt 68609



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                     
Query: 483   ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgg 538
             ||||| || ||||| ||||||| ||| ||||||||||| |  ||||||||||||||
Sbjct: 68150 ggtgggcacgagctgagcaagaccaccggaaacgctggtggccgtgttgcttgcgg 68095



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 88    agatcacatacacaatggtgaaggctgtagctgtgctt 125
             |||||||||  ||||||||||||||||| | |||||||
Sbjct: 69624 agatcacattaacaatggtgaaggctgttgttgtgctt 69587



to top

>emb|X53872.1|SOSODCY Spinacia oleracea mRNA for cytosolic copper/zinc-superoxide
           dismutase (EC 1.15.1.1)
          Length = 795

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 103/126 (81%)
 Strand = Plus / Plus

                                                                       
Query: 163 cccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactcaaggaagggc 222
           ||||||| |||||||| || || ||||| || |||| |||| | || ||||||   ||||
Sbjct: 132 cccaggaaggagatggtccaacaactgttactggaaatgtctccggtctcaagcctgggc 191

                                                                       
Query: 223 tccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggac 282
           |||| || || ||||| || || ||||||||||| || || ||||||||||||||||| |
Sbjct: 192 tccatggatttcatgttcatgcccttggtgacacaacaaatggctgcatgtcaactgggc 251

                 
Query: 283 cgcact 288
           ||||||
Sbjct: 252 cgcact 257



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                     
Query: 447 gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaaga 504
           ||||| ||||||| |||  | ||||||||||| | |||||||||||| || |||||||
Sbjct: 416 gttgttgtccatgctgaacccgatgatcttggaaggggtggacatgaactcagcaaga 473



to top

>emb|AJ844862.1| Drosophila bipectinata partial Sod gene, exons 1-2, strain KB51
          Length = 1001

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 274
           |||||||||||||||||||   ||||||||| ||||||||||||||||||
Sbjct: 719 cacggcttccatgtgcacgagtttggtgacaacaccaacggctgcatgtc 768



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 462 gatgctgatgatcttggcaagggtggacatgagcttagcaaga 504
           ||||| |||||||| |||||||||||||| ||||| |||||||
Sbjct: 956 gatgccgatgatctgggcaagggtggacacgagctcagcaaga 998



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                            
Query: 183      accactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcac 242
                ||||||||||| ||||||||| | || ||||||   || ||||| || |||||| | || 
Sbjct: 13153976 accactgtgactggaagtgtctctggcctcaagcctggtctccatgggttccatattcat 13154035

                                                      
Query: 243      gctcttggtgacaccaccaacggctgcatgtcaactgg 280
                || ||||||||||||||||| || ||||||||||||||
Sbjct: 13154036 gcacttggtgacaccaccaatggttgcatgtcaactgg 13154073



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                            
Query: 308      gcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgg 367
                |||||| ||||| |||||||| | ||||||||||||||| || |||||||| || |||||
Sbjct: 13154225 gcatggagcaccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctgg 13154284

                  
Query: 368      ag 369
                ||
Sbjct: 13154285 ag 13154286



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                        
Query: 483      ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgg 538
                ||||| || ||||| ||||||| ||| ||||||||||| |  ||||||||||||||
Sbjct: 13155263 ggtgggcacgagctgagcaagaccaccggaaacgctggtggccgtgttgcttgcgg 13155318



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                            
Query: 418      ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
                |||||||| |||||||||||||| | || || || || ||||  ||| ||||||||||||
Sbjct: 13154737 ctggaccaaattcaatcattggcagagccgtcgttgtgcatgccgatcctgatgatcttg 13154796

                        
Query: 478      gcaagggt 485
                | ||||||
Sbjct: 13154797 gaaagggt 13154804



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                      
Query: 88       agatcacatacacaatggtgaaggctgtagctgtgctt 125
                |||||||||  ||||||||||||||||| | |||||||
Sbjct: 13153789 agatcacattaacaatggtgaaggctgttgttgtgctt 13153826



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 247     ttggtgacaccaccaacggctgca 270
               |||| |||||||||||||||||||
Sbjct: 6242530 ttggcgacaccaccaacggctgca 6242507



to top

>gb|L19435.1|RICSODCC Oryza sativa cytosolic copper/zinc-superoxide dismutase (SodCc1)
            gene, complete cds
          Length = 4253

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                        
Query: 183  accactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcac 242
            ||||||||||| ||||||||| | || ||||||   || ||||| || |||||| | || 
Sbjct: 2429 accactgtgactggaagtgtctctggcctcaagcctggtctccatgggttccatattcat 2488

                                                  
Query: 243  gctcttggtgacaccaccaacggctgcatgtcaactgg 280
            || ||||||||||||||||| || ||||||||||||||
Sbjct: 2489 gcacttggtgacaccaccaatggttgcatgtcaactgg 2526



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                        
Query: 308  gcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgg 367
            |||||| ||||| |||||||| | ||||||||||||||| || |||||||| || |||||
Sbjct: 2678 gcatggagcaccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctgg 2737

              
Query: 368  ag 369
            ||
Sbjct: 2738 ag 2739



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 483  ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgg 538
            ||||| || ||||| ||||||| ||| ||||||||||| |  ||||||||||||||
Sbjct: 3613 ggtgggcacgagctgagcaagaccaccggaaacgctggtggccgtgttgcttgcgg 3668



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 418  ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
            |||||||| |||||||||||||| | || || || || ||||  ||| ||||||||||||
Sbjct: 3087 ctggaccaaattcaatcattggcagagccgtcgttgtgcatgccgatcctgatgatcttg 3146

                    
Query: 478  gcaagggt 485
            | ||||||
Sbjct: 3147 gaaagggt 3154



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 88   agatcacatacacaatggtgaaggctgtagctgtgctt 125
            |||||||||  ||||||||||||||||| | |||||||
Sbjct: 2242 agatcacattaacaatggtgaaggctgttgttgtgctt 2279



to top

>emb|X58578.1|PSCUZNPS3 P.sylvestris mRNA for CuZn superoxide dismutase, clone PS3
          Length = 821

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           ||||| || ||||||| |||| |||||||||||||||| ||||| ||||| || || |||
Sbjct: 461 gctgtagttgtccatgctgatcctgatgatcttggcaaaggtggccatgaactgagtaag 520

                            
Query: 504 agcactggaaacgctgg 520
           ||||| ||||| |||||
Sbjct: 521 agcacaggaaatgctgg 537



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 222 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 281
           ||||| || |||||||| || || || |||||||| || || || |||||||||||||||
Sbjct: 239 ctccatggtttccatgttcatgcactaggtgacacaacaaatgggtgcatgtcaactgga 298

             
Query: 282 cc 283
           ||
Sbjct: 299 cc 300



to top

>emb|AJ844839.1| Drosophila malerkotliana malerkotliana partial Sod gene, exons 1-2,
           strain Raichuri
          Length = 1000

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                       
Query: 432 atcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacat 491
           |||||||| ||| |||| || ||||| |  |||||||||||||| |||||||||||||| 
Sbjct: 925 atcattggacgtactgtggttgtccacgccgatgctgatgatctgggcaagggtggacac 984

                        
Query: 492 gagcttagcaaga 504
           ||||| |||||||
Sbjct: 985 gagctcagcaaga 997



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           |||||||||||||||||||   |||| |||| ||||||||||||||||||  |||| || 
Sbjct: 718 cacggcttccatgtgcacgaatttggcgacaacaccaacggctgcatgtcctctggtcct 777

                      
Query: 285 cacttcaaccc 295
           || ||||||||
Sbjct: 778 catttcaaccc 788



to top

>emb|AJ278671.1|PTR278671 Populus tremula x Populus tremuloides mRNA for putative
           CuZn-superoxide dismutase (hipI-SOD1 gene)
          Length = 780

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| || |||| |||| ||||||||||||| || ||||||||||| |||||||||
Sbjct: 415 gctgttgttgtgcatgctgatcctgatgatcttggaaaaggtggacatgaacttagcaag 474

            
Query: 504 a 504
           |
Sbjct: 475 a 475



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 243 gctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
           |||||||||||||||||||| |||||||  || |||||||| || |||||
Sbjct: 214 gctcttggtgacaccaccaatggctgcaattccactggacctcatttcaa 263



to top

>emb|AJ278670.1|PTR278670 Populus tremula x Populus tremuloides partial mRNA for putative
           CuZn-superoxide dismutase (hipI-SOD 2 gene)
          Length = 691

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| || |||| |||| ||||||||||||| || ||||||||||| |||||||||
Sbjct: 359 gctgttgttgtgcatgctgatcctgatgatcttggaaaaggtggacatgaacttagcaag 418

            
Query: 504 a 504
           |
Sbjct: 419 a 419



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 243 gctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
           |||||||||||||||||||| |||||||  || |||||||| || |||||
Sbjct: 158 gctcttggtgacaccaccaatggctgcaattccactggacctcatttcaa 207



to top

>dbj|D49485.1| Solidago canadensis var. scabra mRNA for copper/zinc-superoxide
           dismutase, complete cds, clone: SAcSODcy
          Length = 700

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           ||||| || ||||||| |||| ||||||||||||| ||||| || |||||||| ||||| 
Sbjct: 367 gctgtagttgtccatgctgatcctgatgatcttggaaagggaggccatgagctcagcaaa 426

                            
Query: 504 agcactggaaacgctgg 520
           | ||||||||| |||||
Sbjct: 427 accactggaaatgctgg 443



to top

>gb|AY642137.1| Manihot esculenta copper/zinc superoxide dismutase mRNA, complete
           cds
          Length = 774

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 156/197 (79%)
 Strand = Plus / Plus

                                                                       
Query: 99  acaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttc 158
           |||||||||||||| || ||||| |||| | | || ||||||||    || || ||||||
Sbjct: 11  acaatggtgaaggccgttgctgttcttaacagtagtgagggtgttgctgggacaatcttc 70

                                                                       
Query: 159 ttcacccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactcaaggaa 218
           |||||||| || |||||||| || ||||| || || ||||||||  | || || |||  |
Sbjct: 71  ttcacccaagaaggagatggtccaaccaccgtcactggaagtgtttctggccttaagcca 130

                                                                       
Query: 219 gggctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaact 278
           ||||| || || |||||||| || || ||||| ||||| || || || ||||||||||||
Sbjct: 131 gggcttcatggattccatgttcatgcccttggagacacaacaaatggttgcatgtcaact 190

                            
Query: 279 ggaccgcacttcaaccc 295
           || || || ||||||||
Sbjct: 191 gggccacatttcaaccc 207



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 466 ctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           ||||||||||||| ||||| |||||||| |||||||| | ||||||||| |||||
Sbjct: 378 ctgatgatcttggaaaggggggacatgaacttagcaaaaccactggaaatgctgg 432



to top

>gb|DQ124227.1| Fagus sylvatica putative copper/zinc-superoxide dismutase mRNA,
           partial cds
          Length = 388

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                       
Query: 222 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 281
           ||||| |||||||| ||||| |||||||| ||||| || || || |||||||||||||||
Sbjct: 122 ctccatggcttccacgtgcatgctcttggggacacaacaaatggttgcatgtcaactgga 181

                               
Query: 282 ccgcacttcaaccccgctgg 301
           || || ||||| || |||||
Sbjct: 182 ccacatttcaatcctgctgg 201



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtgga 488
           |||||||| |||||||| ||| | |||||||||||||||||||||
Sbjct: 344 gctgttgttgtccatggagatccagatgatcttggcaagggtgga 388



to top

>emb|BX816203.1|CNS0AE91 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH34ZB02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 748

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 290
           ||||||||||| |||||||||||||||||  |||| ||||| || ||||| || || |||
Sbjct: 225 ttccatgtgcatgctcttggtgacaccactgacggttgcatctctactggtccacatttc 284

                       
Query: 291 aaccccgctggt 302
           ||||||| ||||
Sbjct: 285 aaccccgatggt 296



to top

>gb|AF016893.1|AF016893 Populus tremuloides copper/zinc-superoxide dismutase (SodCc1) gene,
            complete cds
          Length = 4390

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                        
Query: 418  ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
            ||||||||||||| || |||||  | |||||||| || ||||| ||| ||||||||||||
Sbjct: 3183 ctggaccacattccattattggaagggctgttgttgttcatggagatcctgatgatcttg 3242

                    
Query: 478  gcaagggt 485
            ||||||||
Sbjct: 3243 gcaagggt 3250



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                        
Query: 99   acaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttc 158
            ||||||||||||||||||||||| ||||   |||| || ||||| |  ||||||||||||
Sbjct: 2408 acaatggtgaaggctgtagctgttcttaatagcagtgaaggtgtgagtggcaccatcttc 2467

                                
Query: 159  ttcacccaggagggagatgg 178
            || ||||| || ||||||||
Sbjct: 2468 tttacccaagaaggagatgg 2487



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                 
Query: 228  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgg 280
            |||||||| || || || ||||| |||||||| || |||||||||||||||||
Sbjct: 2626 ggcttccacgtccatgcccttggagacaccacaaatggctgcatgtcaactgg 2678



to top

>gb|AF318938.1| Citrus limon copper/zinc superoxide dismutase mRNA, complete cds
          Length = 744

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Plus

                                                                       
Query: 418 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
           |||||||| |||| || |||||  | |||||||| ||||| |  ||| | ||||||||||
Sbjct: 444 ctggaccaaattccattattggaagggctgttgtagtccacgcagatcccgatgatcttg 503

                                                      
Query: 478 gcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           ||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 504 gcaagggcggtcatgagctgagcaaaaccactggaaatgctgg 546



to top

>emb|AJ844865.1| Drosophila parabipectinata partial Sod gene, exons 1-2, strain
           Yunnan 7
          Length = 977

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           |||||||||||||||||||   |||| |||| ||||||||||||||||||  |||| || 
Sbjct: 695 cacggcttccatgtgcacgagtttggcgacaacaccaacggctgcatgtcctctggtcct 754

                      
Query: 285 cacttcaaccc 295
           || ||||||||
Sbjct: 755 catttcaaccc 765



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 462 gatgctgatgatcttggcaagggtggacatgagcttagcaaga 504
           ||||| |||||||| |||||||||||||| ||||| |||||||
Sbjct: 932 gatgccgatgatctgggcaagggtggacacgagctcagcaaga 974



to top

>emb|AJ844860.1| Drosophila bipectinata partial Sod gene, exons 1-2, strain 211.5
          Length = 933

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           |||||||||||||||||||   |||| |||| ||||||||||||||||||  |||| || 
Sbjct: 651 cacggcttccatgtgcacgagtttggcgacaacaccaacggctgcatgtcctctggtcct 710

                      
Query: 285 cacttcaaccc 295
           || ||||||||
Sbjct: 711 catttcaaccc 721



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 432 atcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacat 491
           |||||||| ||| |||| || ||||| |  ||||| |||||||| |||||||||||||| 
Sbjct: 858 atcattggacgtactgtggttgtccacgccgatgccgatgatctgggcaagggtggacac 917

                        
Query: 492 gagcttagcaaga 504
           ||||| |||||||
Sbjct: 918 gagctcagcaaga 930



to top

>emb|AJ844859.1| Drosophila bipectinata partial Sod gene, exons 1-2, strain 381.4
          Length = 995

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           |||||||||||||||||||   |||| |||| ||||||||||||||||||  |||| || 
Sbjct: 713 cacggcttccatgtgcacgagtttggcgacaacaccaacggctgcatgtcctctggtcct 772

                      
Query: 285 cacttcaaccc 295
           || ||||||||
Sbjct: 773 catttcaaccc 783



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 462 gatgctgatgatcttggcaagggtggacatgagcttagcaaga 504
           ||||| |||||||| |||||||||||||| ||||| |||||||
Sbjct: 950 gatgccgatgatctgggcaagggtggacacgagctcagcaaga 992



to top

>emb|AJ844855.1| Drosophila malerkotliana pallens partial Sod gene, exons 1-2,
           strain KB447
          Length = 1025

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           |||||||| ||||||||||   ||||||||| ||||||||||||||||||  |||| || 
Sbjct: 743 cacggctttcatgtgcacgagtttggtgacaacaccaacggctgcatgtcctctggtcct 802

                      
Query: 285 cacttcaaccc 295
           || ||||||||
Sbjct: 803 catttcaaccc 813



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                        
Query: 432  atcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacat 491
            |||||||| ||| |||| || ||||| |  ||||| |||||||| |||||||||||||| 
Sbjct: 950  atcattggacgtactgtggttgtccacgccgatgccgatgatctgggcaagggtggacac 1009

                         
Query: 492  gagcttagcaaga 504
            ||||| |||||||
Sbjct: 1010 gagctcagcaaga 1022



to top

>gb|AF191342.1| Olea europaea copper/zinc superoxide dismutase (SOD1) mRNA, partial
           cds
          Length = 276

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 466 ctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           ||||||||||||| | |||||| ||||| || |||||||| ||||||||||||||
Sbjct: 209 ctgatgatcttggaaggggtggtcatgaactgagcaagagaactggaaacgctgg 263



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                       
Query: 264 ggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatggggcacccgaa 323
           |||||||||||||||||||| || ||||| || | |||  | | |||||| ||||| | |
Sbjct: 7   ggctgcatgtcaactggacctcatttcaatcctgttgggaaagagcatggtgcacctgga 66

                                  
Query: 324 gatgaaatccgccatgctggtga 346
           ||||| | |||||||||||||||
Sbjct: 67  gatgagaaccgccatgctggtga 89



to top

>gb|AY881165.1| Nelumbo nucifera isolate 16 copper-zinc superoxide dismutase mRNA,
           partial cds
          Length = 457

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 76/91 (83%)
 Strand = Plus / Plus

                                                                       
Query: 418 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
           |||||||  ||||||| |||||  | ||||| || || |||| |||| ||||||||||||
Sbjct: 318 ctggaccctattcaattattggaagggctgtcgtggtacatgctgatcctgatgatcttg 377

                                          
Query: 478 gcaagggtggacatgagcttagcaagagcac 508
           | ||||| |||||||| |||||||| |||||
Sbjct: 378 ggaagggaggacatgaacttagcaaaagcac 408



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 231 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggacc 283
           |||||||| || || |||||||||||||| || || || |||||||| |||||
Sbjct: 131 ttccatgtccatgcccttggtgacaccacaaatggttgtatgtcaacaggacc 183



to top

>gb|AY881164.1| Nelumbo nucifera isolate 14 copper-zinc superoxide dismutase mRNA,
           partial cds
          Length = 457

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 76/91 (83%)
 Strand = Plus / Plus

                                                                       
Query: 418 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
           |||||||  ||||||| |||||  | ||||| || || |||| |||| ||||||||||||
Sbjct: 318 ctggaccctattcaattattggaagggctgtcgtagtacatgctgatcctgatgatcttg 377

                                          
Query: 478 gcaagggtggacatgagcttagcaagagcac 508
           | ||||| |||||||| |||||||| |||||
Sbjct: 378 ggaagggaggacatgaacttagcaaaagcac 408



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 231 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggacc 283
           |||||||| || || |||||||||||||| || || || |||||||| |||||
Sbjct: 131 ttccatgtccatgcccttggtgacaccacaaatggttgtatgtcaacaggacc 183



to top

>gb|AF009734.1|AF009734 Capsicum annuum Cu/Zn superoxide dismutase (SOD) mRNA, complete cds
          Length = 730

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 228 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 287
           ||||||||||| || || |||||||| ||||| || |||||||||||||| ||||| || 
Sbjct: 173 ggcttccatgtacatgcccttggtgataccacaaatggctgcatgtcaacaggaccacat 232

                                                                      
Query: 288 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 346
           | ||| || |||||| | |  ||||| || || |||||||| | ||| |||||||||||
Sbjct: 233 tacaatcctgctggtaaggaacatggtgctcctgaagatgagaaccgtcatgctggtga 291



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 456 catggtgatgctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaac 515
           |||| |||| ||||||||||||| ||||| ||||||||||| |  || | ||||||||||
Sbjct: 401 catgctgatcctgatgatcttggaaagggaggacatgagctcactaaaaccactggaaac 460

                
Query: 516 gctgg 520
           |||||
Sbjct: 461 gctgg 465



to top

>gb|DQ431473.1| Malus xiaojinensis Sod2 (Sod2) mRNA, complete cds
          Length = 805

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 447 gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaagagc 506
           ||||| |||||||| ||  | ||||| || ||||||||||||||||||||||||||   |
Sbjct: 478 gttgttgtccatggcgacccagatgacctgggcaagggtggacatgagcttagcaaatcc 537

                         
Query: 507 actggaaacgctgg 520
           |||||||| |||||
Sbjct: 538 actggaaatgctgg 551



to top

>gb|S72444.1| Drosophila subobscura Sod gene, partial cds
          Length = 439

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 462 gatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||||||||||||| |||||||||| ||||| ||||||
Sbjct: 338 gatgctgatgatcttggccagggtggacacgagctgagcaag 379



to top

>gb|AC003981.2|AC003981 Genomic sequence for Arabidopsis thaliana BAC F22O13 from chromosome I,
              complete sequence
          Length = 133843

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 231    ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgg 280
              |||||||| || ||||||||||||||||| ||||| |||||||| |||||
Sbjct: 125851 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactgg 125900



to top

>gb|AF457209.1| Hevea brasiliensis Cu/Zn superoxide dismutase (Cu/Zn-SOD) mRNA,
           complete cds
          Length = 738

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 467 tgatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           |||||||||||||||||| |||||||| || ||||| | ||||||||| |||||
Sbjct: 417 tgatgatcttggcaaggggggacatgaactcagcaaaatcactggaaatgctgg 470



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 153 atcttcttcacccaggagggagatggcccgaccactgtgacgggaagtgt 202
           |||||||||||||| || |||||||| || ||||| || || ||||||||
Sbjct: 103 atcttcttcacccaagaaggagatggtccaaccaccgtaactggaagtgt 152



to top

>gb|L13281.1|DROCUZNSOD Drosophila willistoni Cu/Zn-superoxide dismutase (Sod) gene,
           partial cds; and unknown gene
          Length = 1472

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 447 gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaaga 504
           |||||||||||||  ||| | |||||||| |||||||||||||| ||||| |||||||
Sbjct: 773 gttgtcgtccatgccgatcccgatgatctgggcaagggtggacacgagctgagcaaga 830



to top

>gb|AF034630.1|AF034630 Panax ginseng Cu/Zn superoxide dismutase (SOD) mRNA, complete cds
          Length = 624

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 96/118 (81%)
 Strand = Plus / Plus

                                                                       
Query: 246 cttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcat 305
           |||||||| || || ||||| ||| ||||||||||||| || |  ||||| |||  | | 
Sbjct: 163 cttggtgatacaacaaacggttgcctgtcaactggaccccattataaccctgctaataaa 222

                                                                     
Query: 306 gtgcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacag 363
           | |||||| || || |||||||| | ||||||||||||||| ||||| ||||||||||
Sbjct: 223 gagcatggtgctccggaagatgagacccgccatgctggtgatctcgggaatgtgacag 280



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 480 aagggtggacatgagcttagcaagagcactggaaacgctgg 520
           |||||||| ||||| || ||||| ||||||||||| |||||
Sbjct: 397 aagggtggtcatgaactcagcaaaagcactggaaatgctgg 437



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Plus

                                           
Query: 85  ctgagatcacataca-caatggtgaaggctgt 115
           ||||||||||||| | ||||||||||||||||
Sbjct: 1   ctgagatcacatataacaatggtgaaggctgt 32



to top

>gb|AF540558.1| Brassica juncea clone SOD 8A superoxide dismutase mRNA, complete
           cds
          Length = 755

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 128/161 (79%)
 Strand = Plus / Plus

                                                                       
Query: 135 gagggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacg 194
           |||||||| ||||| || ||||| ||||||||||| ||||| ||   |||||||||||| 
Sbjct: 107 gagggtgttaaggggactatctttttcacccaggaaggagacggtgtgaccactgtgact 166

                                                                       
Query: 195 ggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgac 254
           ||||  ||  | ||||| ||    || || || || |||||||| || ||||||||||||
Sbjct: 167 ggaacagtttctggacttaaacctggtctacatggtttccatgtccatgctcttggtgac 226

                                                    
Query: 255 accaccaacggctgcatgtcaactggaccgcacttcaaccc 295
           ||||| ||||| |||||||| || || || || ||||||||
Sbjct: 227 accactaacggttgcatgtccaccggtccacatttcaaccc 267



to top

>emb|AJ012739.1|CAR012739 Cicer arietinum mRNA for superoxide dismutase
          Length = 702

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| || |||| |||| ||||||||||||| || ||||| || ||||||||||| 
Sbjct: 364 gctgttgttgttcatgctgatcctgatgatcttgggaaaggtggtcacgagcttagcaaa 423

                            
Query: 504 agcactggaaacgctgg 520
           |  |||||||| |||||
Sbjct: 424 actactggaaatgctgg 440



to top

>emb|AJ012691.1|CAR012691 Cicer arietinum mRNA for superoxide dismutase
          Length = 809

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| || |||| |||| ||||||||||||| || ||||| || ||||||||||| 
Sbjct: 387 gctgttgttgttcatgctgatcctgatgatcttgggaaaggtggtcacgagcttagcaaa 446

                            
Query: 504 agcactggaaacgctgg 520
           |  |||||||| |||||
Sbjct: 447 actactggaaatgctgg 463



to top

>dbj|AB189165.1| Pisum sativum mRNA for copper zinc superoxide dismutase, complete
           cds
          Length = 857

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| |||||||  ||| ||||||||||||| || ||||| || ||||||||||| 
Sbjct: 408 gctgttgttgtccatgccgatcctgatgatcttgggaaaggtggtcacgagcttagcaaa 467

                            
Query: 504 agcactggaaacgctgg 520
           |  |||||||| |||||
Sbjct: 468 actactggaaatgctgg 484



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 222 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 281
           ||||||||||||||| | || ||  | || |||||||| ||||| ||||| |||||||||
Sbjct: 186 ctccacggcttccatatccatgccttgggagacaccacaaacggttgcatttcaactgga 245

                      
Query: 282 ccgcacttcaa 292
           || || |||||
Sbjct: 246 ccacatttcaa 256



to top

>dbj|AB087845.1| Pisum sativum SOD mRNA for superoxide dismutase, complete cds
          Length = 850

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| |||||||  ||| ||||||||||||| || ||||| || ||||||||||| 
Sbjct: 404 gctgttgttgtccatgccgatcctgatgatcttgggaaaggtggtcacgagcttagcaaa 463

                            
Query: 504 agcactggaaacgctgg 520
           |  |||||||| |||||
Sbjct: 464 actactggaaatgctgg 480



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 222 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 281
           ||||||||||||||| | || ||  | || |||||||| ||||| ||||| |||||||||
Sbjct: 182 ctccacggcttccatatccatgccttgggagacaccacaaacggttgcatttcaactgga 241

                      
Query: 282 ccgcacttcaa 292
           || || |||||
Sbjct: 242 ccacatttcaa 252



to top

>gb|AF170297.1|AF170297 Manihot esculenta copper/zinc-superoxide dismutase mRNA, complete
           cds
          Length = 801

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 155/197 (78%)
 Strand = Plus / Plus

                                                                       
Query: 99  acaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttc 158
           |||||||||||||||| |||||| |||||| | || ||||| || |  || || ||||||
Sbjct: 52  acaatggtgaaggctgaagctgttcttaccagtagtgagggggttagcggaacaatcttc 111

                                                                       
Query: 159 ttcacccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactcaaggaa 218
           || ||||| || |||||||| || |||||||| || ||||   |  | || || |||  |
Sbjct: 112 tttacccaagaaggagatggtcctaccactgtaactggaaacatttccggccttaagcca 171

                                                                       
Query: 219 gggctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaact 278
           ||||| || || ||||| || || || ||||| ||||| || ||||| ||||||||||||
Sbjct: 172 gggcttcatgggttccacgtccatgcccttggagacacaacaaacggttgcatgtcaact 231

                            
Query: 279 ggaccgcacttcaaccc 295
           || || ||||| |||||
Sbjct: 232 gggccacactttaaccc 248



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 466 ctgatgatcttggcaagggtggacatga 493
           ||||||||||||||| ||| ||||||||
Sbjct: 419 ctgatgatcttggcaggggaggacatga 446



to top

>gb|U37714.1|DHU37714 Drosophila hydei Cu,Zn superoxide dismutase mRNA, partial cds
          Length = 439

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 468 gatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           ||||| || ||||| ||||| ||||||||||||||||  ||||||||||||||
Sbjct: 344 gatgacctcggcaaaggtggccatgagcttagcaagacaactggaaacgctgg 396



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 228 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgca 286
           |||||||||||||| |   |||| |||| ||||||||||||||||||  ||||||||||
Sbjct: 104 ggcttccatgtgcatgagtttggcgacaacaccaacggctgcatgtcctctggaccgca 162



to top

>gb|M63003.1|PEACUZNSD Pea Cu-Zn superoxide dismutase mRNA, complete cds
          Length = 738

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| |||||||  ||| ||||||||||||| || ||||| || ||||||||||| 
Sbjct: 358 gctgttgttgtccatgccgatcctgatgatcttgggaaaggtggtcacgagcttagcaaa 417

                            
Query: 504 agcactggaaacgctgg 520
           |  |||||||| |||||
Sbjct: 418 actactggaaatgctgg 434



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 222 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 281
           ||||||||||||||| | || ||  | || |||||||| ||||| ||||| |||||||||
Sbjct: 136 ctccacggcttccatatccatgccttgggagacaccacaaacggttgcatttcaactgga 195

                      
Query: 282 ccgcacttcaa 292
           || || |||||
Sbjct: 196 ccacatttcaa 206



to top

>gb|DQ178940.1| Cucumis sativus Cu/Zn superoxide dismutase 1 mRNA, partial cds
          Length = 283

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 103/128 (80%)
 Strand = Plus / Plus

                                                                       
Query: 174 gatggcccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttc 233
           |||||||| |||||||| ||||| | |||  | || ||||||   ||||| || || |||
Sbjct: 12  gatggcccaaccactgttacgggtaatgtttctggtctcaagcccgggcttcatggattc 71

                                                                       
Query: 234 catgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaac 293
           ||||| |||||  | |||||||| ||||| ||||||||||| ||||| || || ||||||
Sbjct: 72  catgttcacgccttaggtgacacaaccaatggctgcatgtcgactgggccacatttcaac 131

                   
Query: 294 cccgctgg 301
           || |||||
Sbjct: 132 cctgctgg 139



to top

>emb|X95726.1|BJMSOD2GE B.juncea mRNA for Cu/Zn-superoxide dismutase
          Length = 722

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 109/136 (80%)
 Strand = Plus / Plus

                                                                       
Query: 132 agcgagggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtg 191
           ||||||||||| ||||| || ||||||||| ||||||| ||||| |||   |||||||||
Sbjct: 143 agcgagggtgttaaggggactatcttcttcgcccaggaaggagaaggcaaaaccactgtg 202

                                                                       
Query: 192 acgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggt 251
           || ||||  ||  | ||||| ||    || || || || |||||||| || |||||||||
Sbjct: 203 actggaacagtttctggacttaaacctggtctacatggtttccatgtccatgctcttggt 262

                           
Query: 252 gacaccaccaacggct 267
           |||||||| |||||||
Sbjct: 263 gacaccactaacggct 278



to top

>gb|DQ445093.1| Gossypium hirsutum putative cytosolic copper/zinc superoxide
           dismutase mRNA, complete cds
          Length = 682

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 453 gtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaagagcactgga 512
           ||||||| |||| | ||||| ||||||||||| || || ||||||||||| ||||| |||
Sbjct: 471 gtccatgctgatccggatgaccttggcaagggggggcacgagcttagcaaaagcaccgga 530

                   
Query: 513 aacgctgg 520
           || |||||
Sbjct: 531 aatgctgg 538



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 75/92 (81%)
 Strand = Plus / Plus

                                                                       
Query: 267 tgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatggggcacccgaagat 326
           ||||||||||| ||||| |||||||| || |||||  | | |||||| || || ||||||
Sbjct: 285 tgcatgtcaacaggacctcacttcaatcctgctggaaaagggcatggtgctcctgaagat 344

                                           
Query: 327 gaaatccgccatgctggtgacctcggaaatgt 358
           |  |  |||||||||||||| || ||||||||
Sbjct: 345 gtgaatcgccatgctggtgatctaggaaatgt 376



to top

>gb|AF127156.1| Drosophila erecta Cu-Zn superoxide dismutase (Sod) gene, exons 1 and
            2 and complete cds
          Length = 1509

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                        
Query: 225  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
            ||||| ||||| |||||||   |||| |||| ||||||||||||||||||  | ||||||
Sbjct: 1157 cacggattccacgtgcacgagtttggagacaacaccaacggctgcatgtcgtccggaccg 1216

                    
Query: 285  cacttcaa 292
            ||||||||
Sbjct: 1217 cacttcaa 1224



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                      
Query: 462  gatgctgatgatcttggcaagggtggacatgagcttagcaag 503
            ||||| |||||||| ||||||||||| || ||||| ||||||
Sbjct: 1394 gatgccgatgatctcggcaagggtggccacgagctgagcaag 1435



to top

>gb|AY335229.1| Drosophila sucinea clone D.suc23 superoxide dismutase (Sod) gene,
           partial cds
          Length = 706

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 447 gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaa 502
           |||||||| ||||  || ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 628 gttgtcgttcatgccgacgctgatgatctcggcaagggtggacacgagctgagcaa 683



to top

>gb|AY335228.1| Drosophila capricorni clone D.cap3 superoxide dismutase (Sod) gene,
           partial cds
          Length = 706

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 447 gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaa 502
           |||||||| ||||  || ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 628 gttgtcgttcatgccgacgctgatgatctcggcaagggtggacacgagctgagcaa 683



to top

>gb|AY335226.1| Drosophila capricorni clone D.cap1 superoxide dismutase (Sod) gene,
           partial cds
          Length = 706

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 447 gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaa 502
           |||||||| ||||  || ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 628 gttgtcgttcatgccgacgctgatgatctcggcaagggtggacacgagctgagcaa 683



to top

>gb|AF021825.1|AF021825 Drosophila immigrans superoxide dismutase (Sod) gene, partial cds
          Length = 1350

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           ||||| |||||||||||||   |||| || | ||||||||||||||||||| ||||||| 
Sbjct: 500 cacggattccatgtgcacgagtttggcgataacaccaacggctgcatgtcatctggaccc 559

                   
Query: 285 cacttcaa 292
           || |||||
Sbjct: 560 catttcaa 567



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 462 gatgctgatgatcttggcaagggtggacatgagcttagcaa 502
           ||||| |||||||| ||||||||||| || ||||| |||||
Sbjct: 737 gatgccgatgatctgggcaagggtggccacgagctgagcaa 777



to top

>gb|U47868.1|DAU47868 Drosophila ambigua NDSSC 14011-0091.1 Cu,Zn superoxide dismutase
           (Sod) gene, partial cds
          Length = 720

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           ||||| |||||||||||||   | ||||||| ||||||||||||||||||  | || |||
Sbjct: 478 cacggattccatgtgcacgagttcggtgacaacaccaacggctgcatgtcgtccggcccg 537

                   
Query: 285 cacttcaa 292
           ||||||||
Sbjct: 538 cacttcaa 545



to top

>gb|AY257198.1| Lotus corniculatus var. japonicus cytosolic CuZn-superoxide
           dismutase (sodCc) gene, complete cds
          Length = 3172

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 222 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgg 280
           ||||| ||||||||||| || ||  | |||||||||||||| |||||| ||||||||||
Sbjct: 593 ctccatggcttccatgtccatgccttgggtgacaccaccaatggctgcttgtcaactgg 651



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 483  ggtggacatgagcttagcaagagcactggaaacgctgg 520
            ||||| ||||||||||||||||  |||||||| |||||
Sbjct: 2650 ggtggccatgagcttagcaagactactggaaatgctgg 2687



to top

>emb|Z19591.1|DMCZSUDMA D.melanogaster Cu-Zn superoxide dismutase gene
          Length = 1844

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 462  gatgctgatgatcttggcaagggtggacatgagcttagcaag 503
            ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 1499 gatgccgatgatcttggccagggtggacacgagctgagcaag 1540



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 249  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
            ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 1286 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 1329



to top

>emb|Y00367.1|DMSOD Drosophila mRNA for Cu-Zn superoxide dismutase
          Length = 724

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 462 gatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 429 gatgccgatgatcttggccagggtggacacgagctgagcaag 470



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 249 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
           ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 216 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 259



to top

>emb|X17332.1|DMSODG2 Drosophila Cu-Zn superoxide dismutase gene (EC 1.15.1.1)
          Length = 2458

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 462  gatgctgatgatcttggcaagggtggacatgagcttagcaag 503
            ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 2113 gatgccgatgatcttggccagggtggacacgagctgagcaag 2154



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 249  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
            ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 1900 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 1943



to top

>emb|X13780.1|DMSODG Drosophila melanogaster sod gene for Cu-Zn superoxide dismutase (EC
            1.15.1.1)
          Length = 1844

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 462  gatgctgatgatcttggcaagggtggacatgagcttagcaag 503
            ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 1499 gatgccgatgatcttggccagggtggacacgagctgagcaag 1540



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 249  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
            ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 1286 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 1329



to top

>gb|AC010023.6| Drosophila melanogaster 3L BAC RP98-19G23 (Roswell Park Cancer
           Institute Drosophila BAC Library) complete sequence
          Length = 161175

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 462 gatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 346 gatgccgatgatcttggccagggtggacacgagctgagcaag 305



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 249 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
           ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 559 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 516



to top

>gb|AC096692.5| Drosophila melanogaster 3L BAC RP98-48O3 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 173782

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                       
Query: 462   gatgctgatgatcttggcaagggtggacatgagcttagcaag 503
             ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 28573 gatgccgatgatcttggccagggtggacacgagctgagcaag 28614



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 249   ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
             ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 28360 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 28403



to top

>ref|NM_057387.3| Drosophila melanogaster Superoxide dismutase CG11793-RA (Sod), mRNA
          Length = 741

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 462 gatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 460 gatgccgatgatcttggccagggtggacacgagctgagcaag 501



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 249 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
           ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 247 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 290



to top

>gb|AY071435.1| Drosophila melanogaster RE52090 full length cDNA
          Length = 747

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 462 gatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 458 gatgccgatgatcttggccagggtggacacgagctgagcaag 499



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 249 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
           ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 245 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 288



to top

>gb|AF127158.1| Drosophila mauritiana Cu-Zn superoxide dismutase (Sod) gene, exons 1
            and 2 and complete cds
          Length = 1539

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 462  gatgctgatgatcttggcaagggtggacatgagcttagcaag 503
            ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 1424 gatgccgatgatcttggccagggtggacacgagctgagcaag 1465



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 56/68 (82%)
 Strand = Plus / Plus

                                                                        
Query: 225  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
            ||||| ||||| |||||||   |||| |||| |||||| |||||||||||  | || |||
Sbjct: 1187 cacggattccacgtgcacgagtttggagacaacaccaatggctgcatgtcgtccgggccg 1246

                    
Query: 285  cacttcaa 292
            ||||||||
Sbjct: 1247 cacttcaa 1254



to top

>gb|AF127157.1| Drosophila sechellia Cu-Zn superoxide dismutase (Sod) gene, exons 1
            and 2 and complete cds
          Length = 1532

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 462  gatgctgatgatcttggcaagggtggacatgagcttagcaag 503
            ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 1417 gatgccgatgatcttggccagggtggacacgagctgagcaag 1458



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 247  ttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
            |||| |||| ||||||||||||||||||| | ||||| ||||||||
Sbjct: 1202 ttggagacaacaccaacggctgcatgtcatccggaccccacttcaa 1247



to top

>gb|AY335227.1| Drosophila capricorni clone D.cap2 superoxide dismutase (Sod) gene,
           partial cds
          Length = 706

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 447 gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagct 496
           |||||||| ||||  || ||||||||||| |||||||||||||| |||||
Sbjct: 628 gttgtcgttcatgccgacgctgatgatctcggcaagggtggacacgagct 677



to top

>gb|AC006562.8|AC006562 Drosophila melanogaster, chromosome 3L, region 68A1-68B2, BAC clone
              BACR48O03, complete sequence
          Length = 173781

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                        
Query: 462    gatgctgatgatcttggcaagggtggacatgagcttagcaag 503
              ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 145209 gatgccgatgatcttggccagggtggacacgagctgagcaag 145168



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 249    ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
              ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 145422 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 145379



to top

>gb|S72589.1|S72589 Drosophila melanogaster slow superoxide dismutase (Sod) gene, partial
            cds
          Length = 1410

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 462  gatgctgatgatcttggcaagggtggacatgagcttagcaag 503
            ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 1065 gatgccgatgatcttggccagggtggacacgagctgagcaag 1106



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 249 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
           ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 852 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 895



to top

>gb|AE003546.4| Drosophila melanogaster chromosome 3L, section 39 of 83 of the complete
              sequence
          Length = 281589

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                        
Query: 462    gatgctgatgatcttggcaagggtggacatgagcttagcaag 503
              ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 224414 gatgccgatgatcttggccagggtggacacgagctgagcaag 224373



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 249    ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
              ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 224627 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 224584



to top

>gb|U47892.1|DOU47892 Drosophila obscura Cu,Zn superoxide dismutase (Sod) gene, partial
           cds
          Length = 718

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 274
           ||||| |||||||||||||   | ||||||| ||||||||||||||||||
Sbjct: 476 cacggattccatgtgcacgagttcggtgacaacaccaacggctgcatgtc 525



to top

>gb|M24421.1|DROSODCUZN Drosophila melanogaster Cu-Zn superoxide dismutase (SOD) gene,
           complete cds
          Length = 462

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 462 gatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 361 gatgccgatgatcttggccagggtggacacgagctgagcaag 402



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 249 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
           ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 148 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 191



to top

>gb|AY804513.1| Drosophila yakuba strain Tai18 sod (sod) gene, partial cds
          Length = 663

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 252 gacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
           |||| ||||||||||||||||||  | ||||||||||||||
Sbjct: 388 gacaacaccaacggctgcatgtcgtccggaccgcacttcaa 428



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 462 gatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           ||||| |||||||| ||||||||||| || ||||| ||||||
Sbjct: 598 gatgccgatgatctcggcaagggtggccacgagctgagcaag 639



to top

>gb|AY804512.1| Drosophila santomea strain STO.4 sod (sod) gene, partial cds
          Length = 715

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 447 gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
           |||||||| || | |||||| |||||||| ||||||||||| || ||||| ||||||
Sbjct: 635 gttgtcgtgcacgctgatgccgatgatctcggcaagggtggccacgagctgagcaag 691



to top

>emb|X56435.1|PSSODII Pea mRNA for Cu/Zn superoxide dismutase II (SOD9)
          Length = 901

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 468 gatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           ||||| ||||| |||||||||||||| |||||   |||||||||||| |||||
Sbjct: 547 gatgaccttggaaagggtggacatgaacttagtttgagcactggaaatgctgg 599



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 321 gaagatgaaatccgccatgctggtgacctcggaaa 355
           |||||||||||||| ||||| |||||||| |||||
Sbjct: 400 gaagatgaaatccgtcatgcgggtgacctgggaaa 434



to top

>gb|DQ286712.1| Eisenia fetida superoxide dismutase mRNA, partial cds
          Length = 319

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 471 gatcttggcaagggtggacatgagcttagcaagagcactggaaac 515
           ||||||||||| ||||| |||||| | ||||||| ||||||||||
Sbjct: 262 gatcttggcaaaggtggtcatgagttcagcaagaccactggaaac 306



to top

>gb|AF127160.1| Drosophila teissieri Cu-Zn superoxide dismutase (Sod) gene, exons 1
            and 2 and complete cds
          Length = 1617

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 252  gacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
            |||| ||||||||||||||||||  | ||||||||||||||
Sbjct: 1292 gacaacaccaacggctgcatgtcgtccggaccgcacttcaa 1332



to top

>gb|AF127159.1| Drosophila yakuba Cu-Zn superoxide dismutase (Sod) gene, exons 1 and
            2 and complete cds
          Length = 1563

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                     
Query: 447  gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 503
            |||||||| || | |||||| |||||||| ||||||||||| || ||||| ||||||
Sbjct: 1433 gttgtcgtgcacgctgatgccgatgatctcggcaagggtggccacgagctgagcaag 1489



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 252  gacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
            |||| ||||||||||||||||||  | ||||||||||||||
Sbjct: 1238 gacaacaccaacggctgcatgtcgtccggaccgcacttcaa 1278



to top

>gb|AF021830.1|AF021830 Drosophila nebulosa superoxide dismutase (Sod) mRNA, partial cds
          Length = 439

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 462 gatgctgatgatcttggcaagggtggacatgagcttagcaa 502
           ||||| |||||||| |||||||||||||| ||||| |||||
Sbjct: 338 gatgccgatgatctgggcaagggtggacacgagctgagcaa 378



to top

>gb|AF021829.1|AF021829 Drosophila paulistorum superoxide dismutase (Sod) mRNA, partial cds
          Length = 439

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 450 gtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaa 502
           ||||||||||  ||| | |||||||| |||||||||||||| ||||| |||||
Sbjct: 326 gtcgtccatgccgatcccgatgatctgggcaagggtggacacgagctgagcaa 378



to top

>gb|AF021828.1|AF021828 Drosophila teissieri superoxide dismutase (Sod) gene, partial cds
          Length = 1856

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 252 gacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
           |||| ||||||||||||||||||  | ||||||||||||||
Sbjct: 911 gacaacaccaacggctgcatgtcgtccggaccgcacttcaa 951



to top

>gb|AF021824.1|AF021824 Hirtodrosophila pictiventris superoxide dismutase (Sod) gene,
           partial cds
          Length = 890

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           |||||||||||||||||||   |||| |||| |||||| || ||||||||| |||| || 
Sbjct: 648 cacggcttccatgtgcacgaatttggggacaacaccaatggttgcatgtcatctgggcca 707

                
Query: 285 cactt 289
           |||||
Sbjct: 708 cactt 712



to top

>gb|AF021823.1|AF021823 Zaprionus tuberculatus superoxide dismutase (Sod) mRNA, partial cds
          Length = 439

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                       
Query: 432 atcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacat 491
           |||||||| ||  ||||||||||||| | |||| | |||||||| ||||||||||| || 
Sbjct: 308 atcattggacgcactgttgtcgtccacgctgatcccgatgatctgggcaagggtggccac 367

                                        
Query: 492 gagcttagcaagagcactggaaacgctgg 520
           ||| | ||||||   |||||||| |||||
Sbjct: 368 gagttgagcaagtcaactggaaatgctgg 396



to top

>emb|AL670114.17| Mouse DNA sequence from clone RP23-7C19 on chromosome X, complete
             sequence
          Length = 128978

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 152   catcttcttcacccaggagggagat 176
             |||||||||||||||||||||||||
Sbjct: 44816 catcttcttcacccaggagggagat 44792



to top

>gb|U08097.1|PTU08097 Populus tremuloides Cu/Zn-superoxide dismutase preprotein
           (Cu/Zn-SOD) mRNA, complete cds
          Length = 685

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 468 gatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           ||||| ||||| |||||||||||||| |||||   |||||||||||| |||||
Sbjct: 522 gatgaccttggaaagggtggacatgaacttagtttgagcactggaaatgctgg 574



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 321 gaagatgaaatccgccatgctggtgacctcggaaa 355
           |||||||||||||| ||||| |||||||| |||||
Sbjct: 372 gaagatgaaatccgtcatgcgggtgacctgggaaa 406



to top

>gb|J04087.1|PEASOD Pea chloroplastic copper/zinc-superoxide dismutase mRNA, complete
           cds
          Length = 825

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 468 gatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 520
           ||||| ||||| |||||||||||||| |||||   |||||||||||| |||||
Sbjct: 524 gatgaccttggaaagggtggacatgaacttagtttgagcactggaaatgctgg 576



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 321 gaagatgaaatccgccatgctggtgacctcggaaa 355
           |||||||||||||| ||||| |||||||| |||||
Sbjct: 377 gaagatgaaatccgtcatgcgggtgacctgggaaa 411



to top

>gb|DQ088819.1| Gossypium hirsutum chloroplast Cu/ZnSOD mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 762

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 468 gatgatcttggcaagggtggacatgagcttag 499
           ||||||||||| |||||||||||||| |||||
Sbjct: 667 gatgatcttggaaagggtggacatgaacttag 698



to top

>gb|AC156827.4| Medicago truncatula clone mth2-15c17, complete sequence
          Length = 110578

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 243    gctcttggtgacaccaccaacggctgca 270
              |||||||||||||||||||| |||||||
Sbjct: 100894 gctcttggtgacaccaccaatggctgca 100867



to top

>gb|DQ120514.1| Gossypium hirsutum chloroplast Cu/Zn superoxide dismutase mRNA,
           complete cds; nuclear gene for chloroplast product
          Length = 1043

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 468 gatgatcttggcaagggtggacatgagcttag 499
           ||||||||||| |||||||||||||| |||||
Sbjct: 650 gatgatcttggaaagggtggacatgaacttag 681



to top

>emb|X87372.1|LESODCC L.esculentum  SodCc;Le;2 gene
          Length = 11053

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 418  ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
            |||| ||||| || ||||||||  | |||||||| || |||| |||| ||||||||||||
Sbjct: 7285 ctggtccacagtccatcattggaagagctgttgttgttcatgctgatcctgatgatcttg 7344

                    
Query: 478  gcaagggt 485
            | ||||||
Sbjct: 7345 gaaagggt 7352



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 228  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaac 277
            ||||||||||| || || |||||||| ||||| || ||||| ||||||||
Sbjct: 6599 ggcttccatgtccatgcccttggtgataccacaaatggctgtatgtcaac 6648



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 75/92 (81%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                        
Query: 88   agatcacatacacaa-tggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaag 146
            |||||||||||| || |||||||||| || || || |||| | |||| || ||||| |  
Sbjct: 6375 agatcacatacaaaaatggtgaaggccgtcgccgtccttaacagcagtgaaggtgttagt 6434

                                            
Query: 147  ggcaccatcttcttcacccaggagggagatgg 178
            ||||||||| ||||||| || || ||||||||
Sbjct: 6435 ggcaccatcctcttcactcaagatggagatgg 6466



to top

>gb|AY898945.1| Lilium hybrid cultivar superoxide dismutase (SOD) mRNA, complete
           cds
          Length = 872

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 312 ggggcacccgaagatgaaatccgccatgctggtgacctcggaaa 355
           ||||| || |||||||||||||| ||||| |||||||| |||||
Sbjct: 438 ggggctcctgaagatgaaatccgtcatgcgggtgacctgggaaa 481



to top

>dbj|AB066500.1| Barbula unguiculata mRNA for chloroplastic copper/zinc superoxide
           dismutase, complete cds
          Length = 946

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 249 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 292
           |||||||| ||||| ||||||||||| ||||| || ||||||||
Sbjct: 426 ggtgacacaaccaatggctgcatgtcgactggtcctcacttcaa 469



to top

>gb|AF059879.1|AF059879 Drosophila immigrans Cu-Zn superoxide dismutase (Sod) gene, exon 2
           and partial cds
          Length = 282

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           ||||| |||||||||||||   |||| || | |||||||||||||||||||  |||||| 
Sbjct: 46  cacggattccatgtgcacgagtttggcgataacaccaacggctgcatgtcatatggaccc 105

                   
Query: 285 cacttcaa 292
           || |||||
Sbjct: 106 catttcaa 113



to top

>gb|AF021822.1|AF021822 Scaptodrosophila lebanonensis superoxide dismutase (Sod) mRNA,
           partial cds
          Length = 439

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           |||||||||||||||||||   |||| || |  |||||||||||||||||  ||||||| 
Sbjct: 101 cacggcttccatgtgcacgagtttggagataataccaacggctgcatgtccgctggacct 160

                   
Query: 285 cacttcaa 292
           || |||||
Sbjct: 161 catttcaa 168



to top

>gb|L08253.1|TOBCCZSODM Nicotiana plumbaginifolia Cu/Zn-superoxide dismutase gene, 5' end
          Length = 2742

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 76/92 (82%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                        
Query: 88   agatcacatac-acaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaag 146
            ||||||||||| | |||||||||||| || || || |||| | |||| || ||||| |  
Sbjct: 2479 agatcacataccaaaatggtgaaggccgttgccgtccttagcagcagtgaaggtgttagc 2538

                                            
Query: 147  ggcaccatcttcttcacccaggagggagatgg 178
            ||||||||||||||||| || || ||||||||
Sbjct: 2539 ggcaccatcttcttcactcaagatggagatgg 2570



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 228  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 274
            ||||||||||| || || |||||||| ||||| || |||||||||||
Sbjct: 2693 ggcttccatgtccatgcccttggtgataccacaaatggctgcatgtc 2739



to top

>gb|DQ440061.1| Aedes aegypti clone AE-321 Cu2+/Zn2+ superoxide dismutase mRNA,
           complete cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 249 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccc 295
           ||||||| ||||||||| ||||  ||  |||||||||||||||||||
Sbjct: 148 ggtgacaacaccaacggatgcacctcggctggaccgcacttcaaccc 194



to top

>emb|AJ971950.1| Pinus pinea partial mRNA for chloroplast CuZn superoxide dismutase
           (cuZnsodchl gene)
          Length = 233

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 39  ttggtgacacaaccaatggctgcatgtcaac 69



to top

>gb|AY434497.1| Trifolium pratense superoxide dismutase mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1016

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 321 gaagatgaaatccgccatgctggtgacctcggaaa 355
           |||||||||||||| ||||| |||||||| |||||
Sbjct: 447 gaagatgaaatccgtcatgcgggtgacctgggaaa 481



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 480 aagggtggacatgagcttagcaagagcactggaaacgctgg 520
           |||||||||||||| |||||   |||||||||||| |||||
Sbjct: 606 aagggtggacatgaacttagtttgagcactggaaatgctgg 646



to top

>gb|AC126007.16| Medicago truncatula clone mth2-11o4, complete sequence
          Length = 106747

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 321   gaagatgaaatccgccatgctggtgacctcggaaa 355
             |||||||||||||| ||||| |||||||| |||||
Sbjct: 51081 gaagatgaaatccgtcatgcgggtgacctgggaaa 51047



to top

>emb|X58579.1|PSCUZNPST P.sylvestris mRNA for CuZn superoxide dismutase, clone PST13
          Length = 676

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 111 ttggtgacacaaccaatggctgcatgtcaac 141



to top

>emb|X15685.1|DSSOD Drosophila simulans DNA for Cu-Zn superoxide dismutase (EC 1.15.1.1)
          Length = 1793

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                        
Query: 222  ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 281
            |||||||| ||||| |||||||   |||| |||| |||||| |||||||||||  | |||
Sbjct: 1242 ctccacggattccacgtgcacgagtttggagacaacaccaatggctgcatgtcgtccgga 1301

                       
Query: 282  ccgcacttcaa 292
            || ||||||||
Sbjct: 1302 ccccacttcaa 1312



to top

>emb|AJ279694.1|BPE279694 Betula pendula partial mRNA for copper/zinc-superoxide dismutase
           (cu/Zn sod gene)
          Length = 355

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 418 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 477
           ||||||||||||| || |||||  | |||||||| ||||| || ||| | ||||||||||
Sbjct: 293 ctggaccacattctattattggaagggctgttgttgtccacggggatccagatgatcttg 352

              
Query: 478 gca 480
           |||
Sbjct: 353 gca 355



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 68/83 (81%)
 Strand = Plus / Plus

                                                                       
Query: 219 gggctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaact 278
           |||||||| || |||||||| || || ||||| ||||| || || || ||||||||||||
Sbjct: 94  gggctccatgggttccatgtccatgcacttggggacacaacaaatggttgcatgtcaact 153

                                  
Query: 279 ggaccgcacttcaaccccgctgg 301
           || || || ||||| || |||||
Sbjct: 154 gggccacatttcaatcctgctgg 176



to top

>gb|AY867724.1| Pinus taeda isolate FBRC30 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867723.1| Pinus taeda isolate FBRC29 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867722.1| Pinus taeda isolate FBRC28 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867719.1| Pinus taeda isolate FBRC25 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867717.1| Pinus taeda isolate FBRC23 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867714.1| Pinus taeda isolate FBRC20 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867713.1| Pinus taeda isolate FBRC19 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867712.1| Pinus taeda isolate FBRC18 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867710.1| Pinus taeda isolate FBRC16 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867708.1| Pinus taeda isolate FBRC14 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867707.1| Pinus taeda isolate FBRC13 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867706.1| Pinus taeda isolate FBRC12 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867703.1| Pinus taeda isolate FBRC9 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867702.1| Pinus taeda isolate FBRC8 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867700.1| Pinus taeda isolate FBRC6 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867697.1| Pinus taeda isolate FBRC3 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AF434186.1|AF434186 Pinus pinaster Cu-Zn-superoxide dismutase precursor, mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 961

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 247 ttggtgacaccaccaacggctgcatgtcaac 277
           |||||||||| ||||| ||||||||||||||
Sbjct: 332 ttggtgacacaaccaatggctgcatgtcaac 362



to top

>gb|AF056621.1|AF056621 Medicago sativa putative Cu/Zn superoxide dismutase precursor,
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 900

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 468 gatgatcttggcaagggtggacatgagcttagcaagagcactggaaa 514
           ||||| ||||| |||||||||||||| |||||   ||||||||||||
Sbjct: 567 gatgaccttggaaagggtggacatgaacttagtttgagcactggaaa 613



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 321 gaagatgaaatccgccatgctggtgacctcggaaa 355
           |||||||||||||| ||||| |||||||| |||||
Sbjct: 420 gaagatgaaatccgtcatgcgggtgacctgggaaa 454



to top

>gb|AY172569.1| Helianthus annuus cultivar EL64 cytosolic Cu/Zn-superoxide
           dismutase mRNA, partial cds
          Length = 221

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 444 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatga 493
           ||||| || ||||||| |||| ||||||||||||| ||||| || |||||
Sbjct: 169 gctgtggttgtccatgctgatcctgatgatcttggaaagggaggccatga 218



to top

>emb|AJ971949.1| Pinus pinea partial mRNA for cytosolic CuZn superoxide dismutase
           (cuZnsodcyt gene)
          Length = 250

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 222 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 281
           ||||| || |||||||| || || || |||||||| || || || |||||||||||||||
Sbjct: 11  ctccatggtttccatgttcatgcactaggtgacacaacaaatgggtgcatgtcaactgga 70

             
Query: 282 cc 283
           ||
Sbjct: 71  cc 72



to top

>gb|AC130711.3| Mus musculus BAC clone RP23-22M24 from chromosome 17, complete
            sequence
          Length = 226651

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 163  cccaggagggagatggcccgac 184
            ||||||||||||||||||||||
Sbjct: 1583 cccaggagggagatggcccgac 1604



to top

>gb|AC130801.16| Medicago truncatula clone mth2-12p19, complete sequence
          Length = 119328

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 483   ggtggacatgagcttagcaagagcactggaaacgctgg 520
             ||||| ||||||||||||||||  |||||||| |||||
Sbjct: 77374 ggtggtcatgagcttagcaagactactggaaatgctgg 77337



to top

>emb|X61687.1|CASOD C.amoena sod gene for Cu,Zn superoxidase dismutase
          Length = 1920

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 466  ctgatgatcttggcaagggtggacatgagcttagcaag 503
            |||||||| | |||||||||||||||||| | ||||||
Sbjct: 1295 ctgatgatttgggcaagggtggacatgagttgagcaag 1332



to top

>gb|AC158975.9| Mus musculus chromosome 18, clone RP24-192J22, complete sequence
          Length = 178651

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 340    ctggtgacctcggaaatgtgacagct 365
              ||||||||||| ||||||||||||||
Sbjct: 113393 ctggtgacctcagaaatgtgacagct 113368



to top

>dbj|AK144519.1| Mus musculus 13 days embryo brain cDNA, RIKEN full-length enriched
           library, clone:G630087L22 product:unclassifiable, full
           insert sequence
          Length = 1102

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 163 cccaggagggagatggcccgac 184
           ||||||||||||||||||||||
Sbjct: 841 cccaggagggagatggcccgac 862



to top

>gb|AF127155.1| Drosophila orena Cu-Zn superoxide dismutase (Sod) gene, exons 1 and 2
            and complete cds
          Length = 1583

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                      
Query: 462  gatgctgatgatcttggcaagggtggacatgagcttagcaag 503
            ||||| |||||||| ||||||||||| || ||||| ||||||
Sbjct: 1468 gatgccgatgatctcggcaagggtggccacgagctgagcaag 1509



to top

>gb|AF220294.1|AF220294 Mus musculus clone BAC126c8 Rsp29-like protein (Rsp29) and Als splice
              variant 2 (Als) genes, partial cds; Als splice variant 1
              (Als), TCE2 (Tce2), NDK3-like protein (Ndk3), and TCE4
              (Tce4) genes, complete cds; and TCE5 (Tce5) gene, partial
              cds
          Length = 175759

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 163    cccaggagggagatggcccgac 184
              ||||||||||||||||||||||
Sbjct: 151842 cccaggagggagatggcccgac 151863



to top

>gb|AY754566.1| Drosophila miranda strain MSH22 superoxide dismutase (Sod) gene,
           exons 1, 2 and partial cds
          Length = 721

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 274
           ||||| |||||||||||||   | || |||| ||||||||||||||||||
Sbjct: 479 cacggattccatgtgcacgagttcggggacaacaccaacggctgcatgtc 528



to top

>gb|AF021826.1|AF021826 Drosophila guttifera superoxide dismutase (Sod) gene, partial cds
          Length = 960

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 471 gatcttggcaagggtggacatgagcttagcaaga 504
           ||||| |||||||||||||||||| | |||||||
Sbjct: 867 gatctcggcaagggtggacatgagttgagcaaga 900



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 228 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 287
           ||||||||||||||||   |||| |||| ||| || |||||||||||  ||||||| || 
Sbjct: 624 ggcttccatgtgcacgagtttggcgacaacacaaatggctgcatgtcgtctggaccacat 683

                
Query: 288 ttcaa 292
           |||||
Sbjct: 684 ttcaa 688



to top

>gb|AC119259.15| Mus musculus chromosome 18, clone RP24-285N19, complete sequence
          Length = 169310

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 340   ctggtgacctcggaaatgtgacagct 365
             ||||||||||| ||||||||||||||
Sbjct: 10079 ctggtgacctcagaaatgtgacagct 10054



to top

>gb|AC154229.1| Mus musculus BAC clone RP24-155I8 from 17, complete sequence
          Length = 159982

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 163    cccaggagggagatggcccgac 184
              ||||||||||||||||||||||
Sbjct: 121106 cccaggagggagatggcccgac 121127



to top

>gb|U47873.1|DPU47873 Drosophila persimilis NDSSC 14011-0111.2 Cu,Zn superoxide dismutase
           (Sod) gene, partial cds
          Length = 721

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 274
           ||||| |||||||||||||   | || |||| ||||||||||||||||||
Sbjct: 479 cacggattccatgtgcacgagttcggggacaacaccaacggctgcatgtc 528



to top

>gb|U47872.1|DPU47872 Drosophila pseudoobscura bogotana NDSSC 14011-0121.69 Cu,Zn
           superoxide dismutase (Sod) gene, partial cds
          Length = 720

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 274
           ||||| |||||||||||||   | || |||| ||||||||||||||||||
Sbjct: 478 cacggattccatgtgcacgagttcggggacaacaccaacggctgcatgtc 527



to top

>gb|U47871.1|DPU47871 Drosophila pseudoobscura pseudoobscura NDSSC 14011-0121.43 Cu,Zn
           superoxide dismutase (Sod) gene, partial cds
          Length = 721

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 274
           ||||| |||||||||||||   | || |||| ||||||||||||||||||
Sbjct: 479 cacggattccatgtgcacgagttcggggacaacaccaacggctgcatgtc 528



to top

>gb|U47870.1|DMU47870 Drosophila miranda NDSSC 14011-0101.1 Cu,Zn superoxide dismutase
           (Sod) gene, partial cds
          Length = 721

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 274
           ||||| |||||||||||||   | || |||| ||||||||||||||||||
Sbjct: 479 cacggattccatgtgcacgagttcggggacaacaccaacggctgcatgtc 528



to top

>gb|U47869.1|DBU47869 Drosophila bifasciata NDSSC 14012-0181.0 Cu,Zn superoxide dismutase
           (Sod) gene, partial cds
          Length = 739

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 274
           ||||| |||||||||||||   | || |||| ||||||||||||||||||
Sbjct: 497 cacggattccatgtgcacgagttcggggacaacaccaacggctgcatgtc 546



to top

>gb|L36229.1|IPBCCZS Ipomoea batatas cytosolic Cu/Zn-superoxide dismutase gene, complete
            cds
          Length = 3950

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 483  ggtggacatgagcttagcaagagcactggaaacgctgg 520
            ||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 2862 ggtggccatgagctcagcaaaagcactggaaatgctgg 2899



to top

>gb|M61170.2|HUMPEM Human polymorphic epithelial mucin (PEM) gene, complete cds
          Length = 8181

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 27   cttcctcctcctccccaacca 47
            |||||||||||||||||||||
Sbjct: 2753 cttcctcctcctccccaacca 2733



to top

>gb|L41624.1|GIBMUC1A01 Hylobates lar mucin (MUC1) gene, exons 1 through 6
          Length = 5660

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 27   cttcctcctcctccccaacca 47
            |||||||||||||||||||||
Sbjct: 2767 cttcctcctcctccccaacca 2747



to top

>gb|BT012694.1| Lycopersicon esculentum clone 113564F, mRNA sequence
          Length = 1048

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 323 agatgaaatccgccatgctggtgacctcggaaa 355
           |||||||||||| ||||| |||||||| |||||
Sbjct: 461 agatgaaatccgtcatgcgggtgacctgggaaa 493



to top

>gb|AF385581.2| Dichanthelium lanuginosum copper/zinc superoxide dismutase
           precursor (SOD1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 643

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 247 ttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccc 295
           |||||||||||||||| || ||||| || || ||||| || ||||||||
Sbjct: 327 ttggtgacaccaccaatggatgcatatcgacaggaccacatttcaaccc 375



to top

>gb|AY463543.1| Homo sapiens mucin 1, transmembrane (MUC1) gene, complete cds
          Length = 7188

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 27  cttcctcctcctccccaacca 47
           |||||||||||||||||||||
Sbjct: 984 cttcctcctcctccccaacca 964



to top

>gb|AC146631.27| Medicago truncatula clone mth2-7g1, complete sequence
          Length = 132372

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 37     ctccccaaccactccgctctt 57
              |||||||||||||||||||||
Sbjct: 101543 ctccccaaccactccgctctt 101523



to top

>emb|AL713999.28| Human DNA sequence from clone RP11-263K19 on chromosome 1 Contains the
             3' end of the TRIM46 gene for tripartite motif-containing
             46, the MUC1 gene for mucin 1 (transmembrane), the THBS3
             gene for thrombospondin 3, two novel genes, the MTX1 gene
             for metaxin 1, the gene for a novel protein similar to
             glucosidase (beta; acid (includes glucosylceramidase))
             (GBA), a metaxin 1 (MTX1) pseudogene, the GBA gene for
             glucosidase (beta; acid (includes glucosylceramidase)),
             the C1orf2 gene for chromosome 1 open reading frame 2, the
             SCAMP3 gene for secretory carrier membrane protein 3, the
             CLK2 gene for CDC-like kinase 2, the HCN3 gene for
             hyperpolarization activated cyclic nucleotide-gated
             potassium channel 3, the PKLR gene for pyruvate kinase
             (liver and RBC) and three CpG islands, complete sequence
          Length = 133525

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 27    cttcctcctcctccccaacca 47
             |||||||||||||||||||||
Sbjct: 21311 cttcctcctcctccccaacca 21331



to top

>emb|AL359390.14| Human DNA sequence from clone RP11-139E24 on chromosome 1, complete
             sequence
          Length = 83750

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 25    gccttcctcctcctccccaac 45
             |||||||||||||||||||||
Sbjct: 26890 gccttcctcctcctccccaac 26870



to top

>emb|X14041.1|LECHSOD Tomato mRNA for chloroplast Cu-Zn superoxide dismutase (SOD)
          Length = 1033

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 323 agatgaaatccgccatgctggtgacctcggaaa 355
           |||||||||||| ||||| |||||||| |||||
Sbjct: 445 agatgaaatccgtcatgcgggtgacctgggaaa 477



to top

>emb|X13831.1|DVSOD Drosophila sod gene for Cu-Zn superoxide dismutase (EC 1.15.1.1)
          Length = 2103

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 228 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 287
           |||||||||||||| |   | || |||| |||||| |||||||||||  | |||||||||
Sbjct: 830 ggcttccatgtgcatgagttcggcgacaacaccaatggctgcatgtcgtcgggaccgcac 889

                
Query: 288 ttcaa 292
           |||||
Sbjct: 890 ttcaa 894



to top

>gb|AY081436.1| Drosophila guttifera superoxide dismutase (Sod) gene, partial cds
          Length = 282

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 228 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 287
           ||||||||||||||||   |||| |||| ||| || |||||||||||  ||||||| || 
Sbjct: 49  ggcttccatgtgcacgagtttggcgacaacacaaatggctgcatgtcgtctggaccacat 108

                
Query: 288 ttcaa 292
           |||||
Sbjct: 109 ttcaa 113



to top

>gb|AY081435.1| Drosophila flexa superoxide dismutase (Sod) gene, partial cds
          Length = 253

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           ||||||||||||||||| |   |||| ||||  || || |||||||||||  ||||||||
Sbjct: 46  cacggcttccatgtgcatgagtttggggacaatacgaatggctgcatgtcgtctggaccg 105

                
Query: 285 cactt 289
           |||||
Sbjct: 106 cactt 110



to top

>gb|AY081434.1| Drosophila ornatipennis superoxide dismutase (Sod) gene, partial
           cds
          Length = 282

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 222 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 274
           ||||| ||||||||||||||||   |||| |||| ||| || |||||||||||
Sbjct: 43  ctccatggcttccatgtgcacgagtttggcgacaacacaaatggctgcatgtc 95



to top

>gb|AY081433.1| Drosophila nannoptera superoxide dismutase (Sod) gene, partial cds
          Length = 282

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 228 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 287
           ||||||||||||||||   ||||||| | ||| || ||||| |||||  |||||||||| 
Sbjct: 49  ggcttccatgtgcacgagtttggtgataacacgaatggctgtatgtccgctggaccgcat 108

                
Query: 288 ttcaa 292
           |||||
Sbjct: 109 ttcaa 113



to top

>dbj|D49486.1| Solidago canadensis var. scabra mRNA for copper/zinc-superoxide
           dismutase precursor, complete cds, clone: SAcSODpl
          Length = 820

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 464 tgctgatgatcttggcaagggtggacatgagcttagc 500
           ||||||||| || || |||||||| ||||||||||||
Sbjct: 579 tgctgatgacctcggaaagggtggtcatgagcttagc 615



to top

>ref|NM_143372.1| Drosophila melanogaster huntingtin CG9995-RA (huntingtin), mRNA
          Length = 11579

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 458  tggtgatgctgatgatcttgg 478
            |||||||||||||||||||||
Sbjct: 5926 tggtgatgctgatgatcttgg 5906



to top

>gb|AC007827.5|AC007827 Drosophila melanogaster, chromosome 3R, region 98E-98E, BAC clone
              BACR10P23, complete sequence
          Length = 180946

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 458    tggtgatgctgatgatcttgg 478
              |||||||||||||||||||||
Sbjct: 104069 tggtgatgctgatgatcttgg 104049



to top

>gb|L06162.1|HUMDF3Z Homo sapiens breast carcinoma-associated antigen (DF3) gene, promoter
            region and partial cds
          Length = 1725

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 27   cttcctcctcctccccaacca 47
            |||||||||||||||||||||
Sbjct: 1535 cttcctcctcctccccaacca 1515



to top

>gb|AY754565.1| Drosophila affinis superoxide dismutase (Sod) gene, exons 1, 2 and
           partial cds
          Length = 698

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 60/73 (82%)
 Strand = Plus / Plus

                                                                       
Query: 225 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 284
           ||||| |||||||||||||   | || |||| ||||||||| ||||||||  | || || 
Sbjct: 477 cacggattccatgtgcacgagttcggggacaacaccaacggatgcatgtcgtcaggcccc 536

                        
Query: 285 cacttcaaccccg 297
           |||||||||||||
Sbjct: 537 cacttcaaccccg 549



to top

>gb|AF147779.1|AF147779 Drosophila melanogaster Huntington disease protein homolog (Hsap\HD)
             gene, complete cds
          Length = 43125

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 458   tggtgatgctgatgatcttgg 478
             |||||||||||||||||||||
Sbjct: 22957 tggtgatgctgatgatcttgg 22937



to top

>gb|AF146362.1|AF146362 Drosophila melanogaster Huntington disease protein homolog (Hsap\HD)
            mRNA, complete cds
          Length = 11579

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 458  tggtgatgctgatgatcttgg 478
            |||||||||||||||||||||
Sbjct: 5926 tggtgatgctgatgatcttgg 5906



to top

>gb|AF177386.1|AF177386 Drosophila melanogaster huntingtin homolog mRNA, complete cds
          Length = 11572

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 458  tggtgatgctgatgatcttgg 478
            |||||||||||||||||||||
Sbjct: 5904 tggtgatgctgatgatcttgg 5884



to top

>gb|AE003766.2| Drosophila melanogaster chromosome 3R, section 104 of 118 of the complete
              sequence
          Length = 232302

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 458    tggtgatgctgatgatcttgg 478
              |||||||||||||||||||||
Sbjct: 146996 tggtgatgctgatgatcttgg 146976



to top

>emb|X77175.1|LESOD1 L.esculentum (cherry tomato) SOD Cp;Le:1 gene (part 1)
          Length = 3676

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 323  agatgaaatccgccatgctggtgacctcggaaa 355
            |||||||||||| ||||| |||||||| |||||
Sbjct: 2238 agatgaaatccgtcatgcgggtgacctgggaaa 2270



to top

>dbj|AP002832.3| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-651F18, complete
             sequence
          Length = 117898

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 27    cttcctcctcctccccaacca 47
             |||||||||||||||||||||
Sbjct: 68401 cttcctcctcctccccaacca 68381



to top

>gb|U39445.1|DBU39445 Drosophila busckii Cu,Zn superoxide dismutase (Sod) and unknown
           protein genes, partial cds
          Length = 1177

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 228 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 287
           ||||||||||||||||   |||| |||| ||| || |||||||||||  |||| || |||
Sbjct: 459 ggcttccatgtgcacgaatttggcgacaacacaaatggctgcatgtcgtctggcccccac 518

                
Query: 288 ttcaa 292
           |||||
Sbjct: 519 ttcaa 523



to top

>emb|X69118.1|HSMUC1PS H.sapiens promoter sequence of MUC1 gene
          Length = 2941

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 27   cttcctcctcctccccaacca 47
            |||||||||||||||||||||
Sbjct: 2753 cttcctcctcctccccaacca 2733



to top

>gb|M37151.1|TOMSODB Tomato superoxide dismutase (SOD) mRNA, complete cds
          Length = 1034

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 323 agatgaaatccgccatgctggtgacctcggaaa 355
           |||||||||||| ||||| |||||||| |||||
Sbjct: 445 agatgaaatccgtcatgcgggtgacctgggaaa 477



to top

>ref|NM_000730.2| Homo sapiens cholecystokinin A receptor (CCKAR), mRNA
          Length = 1682

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 24   cgccttcctcctcctccccaaccactcc 51
            ||||||||||||||||||| ||| ||||
Sbjct: 1372 cgccttcctcctcctcccccacctctcc 1345



to top

>gb|AC145322.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0096N19, complete sequence
          Length = 178671

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 22    ctcgccttcctcctcctccc 41
             ||||||||||||||||||||
Sbjct: 53586 ctcgccttcctcctcctccc 53567



to top

>gb|BC074987.2| Homo sapiens cholecystokinin A receptor, mRNA (cDNA clone MGC:104068
            IMAGE:30915519), complete cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 24   cgccttcctcctcctccccaaccactcc 51
            ||||||||||||||||||| ||| ||||
Sbjct: 1267 cgccttcctcctcctcccccacctctcc 1240



to top

>gb|DQ497636.1| Thermoascus aurantiacus var. levisporus Cu,Zn-superoxide dismutase
           (CZSOD-1) mRNA, complete cds
          Length = 705

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 249 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 296
           ||||||| ||||||||||||||  ||  | || |||||||||||||||
Sbjct: 154 ggtgacaacaccaacggctgcacctccgccggcccgcacttcaacccc 201



to top

>gb|DQ226932.1| Boechera divaricarpa isolate SLW-E-A10 mRNA sequence
          Length = 519

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 480 aagggtggacatgagcttag 499
           ||||||||||||||||||||
Sbjct: 418 aagggtggacatgagcttag 437



to top

>gb|AY566699.1| Citrullus lanatus copper-zinc superoxide dismutase (CuZn-SOD II)
           mRNA, partial cds
          Length = 444

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 324 gatgaaatccgccatgctggtgacctcggaaa 355
           ||||||||||| ||||| |||||||| |||||
Sbjct: 227 gatgaaatccgtcatgcgggtgacctgggaaa 258



to top

>ref|XM_748622.1| Aspergillus fumigatus Af293 Cu,Zn superoxide dismutase SOD1
           (Afu5g09240) partial mRNA
          Length = 477

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 249 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 296
           ||||||| ||||||||||||||  ||  |||| || ||||||||||||
Sbjct: 166 ggtgacaacaccaacggctgcacctccgctggtcctcacttcaacccc 213



to top

>ref|XM_385171.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG04995.1)
            partial mRNA
          Length = 3447

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 247  ttggtgacaccaccaacggc 266
            ||||||||||||||||||||
Sbjct: 1547 ttggtgacaccaccaacggc 1528



to top

>gb|AF264031.1| Callinectes sapidus extracellular Cu, Zn-superoxide dismutase mRNA,
           complete cds
          Length = 756

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 222 ctccacggcttccatgtgca 241
           ||||||||||||||||||||
Sbjct: 350 ctccacggcttccatgtgca 369



to top

>ref|XM_503850.1| Yarrowia lipolytica CLIB122, YALI0E12133g predicted mRNA
          Length = 465

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 247 ttggtgacaccaccaacggctgca 270
           ||||||||| ||||||||||||||
Sbjct: 152 ttggtgacaacaccaacggctgca 175



to top

>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence
          Length = 2726152

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 23      tcgccttcctcctcctccccaacc 46
               ||||||||||| ||||||||||||
Sbjct: 1828339 tcgccttcctcgtcctccccaacc 1828316



to top

>gb|AY322549.1| Homo sapiens cholecystokinin A receptor mRNA, complete cds
          Length = 1287

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 24   cgccttcctcctcctccccaaccactcc 51
            ||||||||||||||||||| ||| ||||
Sbjct: 1219 cgccttcctcctcctcccccacctctcc 1192



to top

>emb|BX842646.1| Bdellovibrio bacteriovorus complete genome, strain HD100; segment 1/11
          Length = 349761

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 450   gtcgtccatggtgatgctga 469
             ||||||||||||||||||||
Sbjct: 67527 gtcgtccatggtgatgctga 67546



to top

>emb|AJ002604.1|PSAJ2604 Pinus sylvestris mRNA for novel high pI CuZn-superoxide dismutase
          Length = 1038

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 467 tgatgatcttggcaagggtggacatgagcttagcaa 502
           |||||| |||||||  |||||||||||||| |||||
Sbjct: 360 tgatgaccttggcagaggtggacatgagctaagcaa 395



to top

>emb|AJ307586.1|PSY307586 Pinus sylvestris mRNA for superoxide dismutase (sod gene)
          Length = 1072

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 467 tgatgatcttggcaagggtggacatgagcttagcaa 502
           |||||| |||||||  |||||||||||||| |||||
Sbjct: 394 tgatgaccttggcagaggtggacatgagctaagcaa 429



to top

>emb|AJ305146.1|PAN305146 Podospora anserina sod1 gene for copper/zinc superoxide dismutase,
           exons 1-4
          Length = 1586

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 247 ttggtgacaccaccaacggctgca 270
           ||||||||| ||||||||||||||
Sbjct: 604 ttggtgacaacaccaacggctgca 627



to top

>emb|AJ278668.1|PTR278668 Populus tremula x Populus tremuloides chloroplast mRNA for putative
           CuZn-superoxide dismutase (cp-SOD 1 gene)
          Length = 1029

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 324 gatgaaatccgccatgctggtgacctcggaaa 355
           ||||||||||| ||||| |||||||| |||||
Sbjct: 411 gatgaaatccgtcatgcgggtgacctgggaaa 442



to top

>gb|AF401280.1| Aspergillus flavus Cu,Zn-superoxide dismutase mRNA, partial cds
          Length = 463

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 249 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 296
           ||||||| ||||||||||||||  ||  |||| || ||||||||||||
Sbjct: 152 ggtgacaacaccaacggctgcacctccgctggccctcacttcaacccc 199



to top

>dbj|AB226266.1| Aspergillus oryzae cDNA, contig sequence: AoEST3125
          Length = 761

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 249 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 296
           ||||||| ||||||||||||||  ||  |||| || ||||||||||||
Sbjct: 217 ggtgacaacaccaacggctgcacctccgctggccctcacttcaacccc 264



to top

>dbj|AB223448.1| Aspergillus oryzae cDNA, contig sequence: AoEST0280
          Length = 779

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 249 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 296
           ||||||| ||||||||||||||  ||  |||| || ||||||||||||
Sbjct: 195 ggtgacaacaccaacggctgcacctccgctggccctcacttcaacccc 242


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,659,788
Number of Sequences: 3902068
Number of extensions: 4659788
Number of successful extensions: 143694
Number of sequences better than 10.0: 269
Number of HSP's better than 10.0 without gapping: 260
Number of HSP's successfully gapped in prelim test: 11
Number of HSP's that attempted gapping in prelim test: 142565
Number of HSP's gapped (non-prelim): 1082
length of query: 551
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 528
effective length of database: 17,143,297,704
effective search space: 9051661187712
effective search space used: 9051661187712
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top