ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags9f02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X80023.1|TTADPATP T.turgidum mRNA for ADP/ATP carrier 620 e-174
2emb|X95863.1|TTANT1 T.turgidum ant gene (1549bp) 587 e-164
3emb|X95864.1|TTANT2 T.turgidum ant gene (1494bp) 563 e-157
4ref|XM_467495.1| Oryza sativa (japonica cultivar-group), mRNA 309 5e-81
5ref|XM_507526.1| PREDICTED Oryza sativa (japonica cultivar-group... 309 5e-81
6ref|XM_506941.2| PREDICTED Oryza sativa (japonica cultivar-group... 309 5e-81
7dbj|AK119207.1| Oryza sativa (japonica cultivar-group) cDNA clon... 309 5e-81
8dbj|AK100143.1| Oryza sativa (japonica cultivar-group) cDNA clon... 309 5e-81
9dbj|AK073448.1| Oryza sativa (japonica cultivar-group) cDNA clon... 309 5e-81
10dbj|D12637.1|RICATADPT Oryza sativa (japonica cultivar-group) mR... 309 5e-81
11dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 272 1e-69
12dbj|AP004098.3| Oryza sativa (japonica cultivar-group) genomic D... 272 1e-69
13gb|AY104389.1| Zea mays PCO082855 mRNA sequence 192 8e-46
14ref|NM_111692.2| Arabidopsis thaliana AAC1 (ADP/ATP CARRIER 1); ... 188 1e-44
15ref|NM_180210.1| Arabidopsis thaliana AAC1 (ADP/ATP CARRIER 1); ... 188 1e-44
16gb|BT000381.1| Arabidopsis thaliana adenylate translocator (At3g... 188 1e-44
17gb|AY074529.1| Arabidopsis thaliana putative adenylate transloca... 188 1e-44
18emb|X65549.1|ATAT A.thaliana ANT1 mRNA for adenylate translocator 188 1e-44
19gb|AY034933.1| Arabidopsis thaliana putative adenylate transloca... 188 1e-44
20gb|AY054248.1| Arabidopsis thaliana AT3g08580/F17O14_5 mRNA, com... 188 1e-44
21gb|AY042814.1| Arabidopsis thaliana adenylate translocator (F17O... 188 1e-44
22gb|AY089128.1| Arabidopsis thaliana clone 36818 mRNA, complete s... 188 1e-44
23gb|BT002387.1| Arabidopsis thaliana adenylate translocator (At3g... 188 1e-44
24emb|BX831240.1|CNS09YRL Arabidopsis thaliana Full-length cDNA Co... 182 8e-43
25ref|NM_001036799.1| Arabidopsis thaliana AAC2; binding AT5G13490... 174 2e-40
26ref|NM_121352.2| Arabidopsis thaliana AAC2; ATP:ADP antiporter/ ... 174 2e-40
27gb|BT016715.1| Zea mays clone Contig548 mRNA sequence 174 2e-40
28gb|AY079407.1| Arabidopsis thaliana putative adenosine nucleotid... 174 2e-40
29gb|AY050857.1| Arabidopsis thaliana putative adenosine nucleotid... 174 2e-40
30emb|X57556.1|ZMANT1MU Z.mays MANT1 mRNA for adenine nucleotide t... 174 2e-40
31emb|X02842.1|ZMANT1 Zea mays mRNA for adenine nucleotide translo... 174 2e-40
32gb|AY109420.1| Zea mays CL2269_1 mRNA sequence 174 2e-40
33gb|AF006489.1|AF006489 Gossypium hirsutum adenine nucleotide tra... 170 3e-39
34emb|AJ633708.1| Brassica oleracea var. acephala partial mRNA for... 168 1e-38
35gb|BT011953.1| Arabidopsis thaliana At5g13490 mRNA sequence 167 5e-38
36gb|AC012562.5|AC012562 Arabidopsis thaliana chromosome 3 BAC F17... 167 5e-38
37emb|X57557.1|STANT1 S.tuberosum PANT1 mRNA for adenine nucleotid... 157 5e-35
38gb|DQ235188.1| Solanum tuberosum clone 164C11 ADP/ATP translocat... 151 3e-33
39gb|DQ284491.1| Solanum tuberosum clone 046C04 ADP,ATP carrier pr... 151 3e-33
40gb|DQ252510.1| Solanum tuberosum clone 087B08 ADP,ATP carrier pr... 151 3e-33
41dbj|D10430.1|RICT125 Oryza sativa mRNA for adenine nucleotide tr... 149 1e-32
42gb|BT016455.1| Zea mays clone Contig288 mRNA sequence 147 4e-32
43emb|X59086.1|ZMANT2MU Z.mays MANT2 mRNA for adenine nucleotide t... 147 4e-32
44emb|X68592.1|ATANT A.thaliana mRNA for adenosine nucleotide tran... 145 2e-31
45emb|AL391710.1|ATT6I14 Arabidopsis thaliana DNA chromosome 5, BA... 145 2e-31
46gb|BT013912.1| Lycopersicon esculentum clone 132909F, mRNA sequence 143 7e-31
47emb|X62123.1|STANTG S.tuberosum ant gene for ADP/ATP translocator 143 7e-31
48gb|U89839.1|LEU89839 Lycopersicon esculentum ADP/ATP translocato... 143 7e-31
49gb|BT013745.1| Lycopersicon esculentum clone 132608R, mRNA sequence 135 2e-28
50dbj|AK103615.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 2e-28
51dbj|AK103134.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 2e-28
52dbj|AK061642.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 2e-28
53emb|X15711.1|ZMANTG1 Maize gene for mitochondrial adenine nucleo... 133 7e-28
54emb|X15712.1|ZMANTG2 Maize ANT-G2 gene for adenine nucleotide tr... 129 1e-26
55emb|AJ003197.1|LAAJ3197 Lupinus albus mRNA for adenine nucleotid... 125 2e-25
56gb|AC098572.2| Oryza sativa (japonica cultivar-group) chromosome... 115 2e-22
57dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 115 2e-22
58emb|X65194.1|CRANT C.reinhardtii mRNA CRANT for mitochondrial AD... 98 4e-17
59gb|AC182652.2| Populus trichocarpa clone Pop1-120B14, complete s... 96 1e-16
60gb|DQ122872.1| Chlamydomonas incerta mitochondrial ADP/ATP trans... 94 6e-16
61dbj|AB190778.1| Mesembryanthemum crystallinum ANT2 mRNA for puta... 88 4e-14
62ref|XM_386197.1| Gibberella zeae PH-1 chromosome 3 ADT_NEUCR ADP... 86 1e-13
63ref|XM_656576.1| Aspergillus nidulans FGSC A4 ADP/ATP carrier pr... 84 6e-13
64ref|XM_751973.1| Ustilago maydis 521 hypothetical protein (UM009... 84 6e-13
65ref|XM_502564.1| Yarrowia lipolytica CLIB122, YALI0D08228g predi... 84 6e-13
66ref|XM_505633.1| Yarrowia lipolytica CLIB122, YALI0F19712g predi... 84 6e-13
67gb|AF237675.1| Yarrowia lipolytica ADP/ATP carrier protein mRNA,... 84 6e-13
68gb|AY183458.2| Yarrowia lipolytica mitochondrial ADP/ATP carrier... 84 6e-13
69gb|AY186609.1| Yarrowia lipolytica ADP/ATP carrier protein (AAC1... 84 6e-13
70emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 84 6e-13
71emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 84 6e-13
72dbj|AB236784.1| Trifolium pratense RNA for putative ADP,ATP carr... 80 9e-12
73dbj|AB236742.1| Trifolium pratense RNA for putative ADP ATP carr... 80 9e-12
74ref|XM_958108.1| Neurospora crassa OR74A ADP,ATP CARRIER PROTEIN... 78 3e-11
75ref|XM_329835.1| Neurospora crassa OR74A ADP,ATP CARRIER PROTEIN... 78 3e-11
76ref|XM_745195.1| Aspergillus fumigatus Af293 mitochondrial ADP,A... 78 3e-11
77emb|AJ277099.1|CUT277099 Candida utilis anc gene for mitochondri... 78 3e-11
78emb|AJ277098.1|CUT277098 Candida utilis anc gene for mitochondri... 78 3e-11
79gb|AY145013.1| Saccharomyces kluyveri clone P2140+P2205 PET9 gen... 78 3e-11
80emb|AJ132535.1|PAB132535 Picea abies mRNA for ADP, ATP carrier p... 76 1e-10
81ref|NM_118980.2| Arabidopsis thaliana AAC3 (ADP/ATP CARRIER 3); ... 74 5e-10
82emb|AL161572.2|ATCHRIV68 Arabidopsis thaliana DNA chromosome 4, ... 74 5e-10
83emb|AL021749.1|ATF20O9 Arabidopsis thaliana DNA chromosome 4, BA... 74 5e-10
84dbj|AK118017.1| Arabidopsis thaliana At4g28390 mRNA for putative... 74 5e-10
85dbj|AK110815.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 5e-10
86ref|XM_568302.1| Cryptococcus neoformans var. neoformans JEC21 A... 70 8e-09
87ref|XM_499953.1| Yarrowia lipolytica CLIB122, YALI0A10659g predi... 70 8e-09
88gb|AY183457.1| Yarrowia lipolytica ADP/ATP carrier protein (AAC2... 70 8e-09
89dbj|AB091506.1| Penicillium chrysogenum mRNA for ADP/ATP carrier... 70 8e-09
90dbj|AK108179.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 8e-09
91emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1... 70 8e-09
92ref|XM_711736.1| Candida albicans SC5314 putative mitochondrial ... 66 1e-07
93ref|XM_711676.1| Candida albicans SC5314 putative mitochondrial ... 66 1e-07
94gb|AY088151.1| Arabidopsis thaliana clone 42036 mRNA, complete s... 66 1e-07
95gb|AF085429.1|AF085429 Candida parapsilosis ADP/ATP carrier prot... 66 1e-07
96dbj|AK064725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
97gb|BT011069.1| Drosophila melanogaster GH27591 full insert cDNA 64 5e-07
98gb|AF424642.1| Phytophthora infestans clone MY-03-E-01 ADP/ATP t... 64 5e-07
99emb|Y10618.1|DMADPATPT Drosophila melanogaster gene encoding ADP... 64 5e-07
100ref|NM_167248.1| Drosophila melanogaster stress-sensitive B CG16... 64 5e-07
101ref|NM_167247.1| Drosophila melanogaster stress-sensitive B CG16... 64 5e-07
102ref|NM_167246.1| Drosophila melanogaster stress-sensitive B CG16... 64 5e-07
103ref|NM_078554.2| Drosophila melanogaster stress-sensitive B CG16... 64 5e-07
104gb|AY070894.1| Drosophila melanogaster LP02726 full length cDNA 64 5e-07
105gb|AY060978.1| Drosophila melanogaster GM12886 full length cDNA 64 5e-07
106gb|S71762.1| Drosophila melanogaster ADP/ATP translocase (Hmr) m... 64 5e-07
107emb|AL114865.1|CNS01BYX Botrytis cinerea strain T4 cDNA library 64 5e-07
108emb|AL111975.1|CNS019QN Botrytis cinerea strain T4 cDNA library 64 5e-07
109gb|AY144848.1| Saccharomyces bayanus clone Contig3934 AAC3 gene,... 64 5e-07
110gb|AC125292.4| Drosophila melanogaster X BAC CH223-5O10 (Childre... 64 5e-07
111gb|AE003484.3| Drosophila melanogaster chromosome X, section 36 ... 64 5e-07
112gb|BT001519.1| Drosophila melanogaster LP11802 full insert cDNA 64 5e-07
113ref|XM_454505.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E12353g ... 62 2e-06
114ref|XM_446154.1| Candida glabrata CBS138, CAGL0F04213g partial mRNA 62 2e-06
115emb|Z49974.1|SPANC1GN S.pombe ANC1 gene for adenine nucleotide c... 62 2e-06
116emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 62 2e-06
117emb|CR380952.1| Candida glabrata strain CBS138 chromosome F comp... 62 2e-06
118emb|AL023634.1|SPBC530 S.pombe chromosome II cosmid c530 62 2e-06
119dbj|AB226328.1| Aspergillus oryzae cDNA, contig sequence: AoEST3190 62 2e-06
120dbj|AB223194.1| Aspergillus oryzae cDNA, contig sequence: AoEST0025 62 2e-06
121gb|DQ407505.1| Myzus persicae adenine nucleotide translocator mR... 62 2e-06
122dbj|AP007150.1| Aspergillus oryzae RIB40 genomic DNA, SC009 62 2e-06
123gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 62 2e-06
124ref|NM_001021230.1| Schizosaccharomyces pombe 972h- adenine nucl... 62 2e-06
125gb|AY126445.1| Gaeumannomyces graminis var. tritici ADP-ATP tran... 62 2e-06
126ref|NM_210395.1| Eremothecium gossypii AER184Wp (AER184W), mRNA 62 2e-06
127gb|L33797.1|YSKAAC Kluyveromyces lactis ADP/ATP translocase (AAC... 62 2e-06
128dbj|D89102.1| Schizosaccharomyces pombe mRNA, partial cds, clone... 62 2e-06
129ref|XM_370159.1| Magnaporthe grisea 70-15 chromosome II hypothet... 60 8e-06
130gb|BC072091.1| Xenopus laevis hypothetical protein MGC79005, mRN... 60 8e-06
131ref|XM_775642.1| PREDICTED: Strongylocentrotus purpuratus simila... 60 8e-06
132gb|AY752790.1| Culicoides sonorensis clone CsANT ADP/ATP translo... 60 8e-06
133gb|AY849642.1| Magnaporthe grisea ADP/ATP carrier protein-like p... 60 8e-06
134gb|AE017353.1| Cryptococcus neoformans var. neoformans JEC21 chr... 58 3e-05
135emb|X76112.1|CEADPATP C.elegans mRNA for ADP/ATP translocase 58 3e-05
136ref|NM_001027630.2| Caenorhabditis elegans Temporarily Assigned ... 58 3e-05
137ref|NM_001027628.1| Caenorhabditis elegans Temporarily Assigned ... 58 3e-05
138emb|Z82059.1|CET27E9 Caenorhabditis elegans Cosmid T27E9, comple... 58 3e-05
139gb|M34075.1|YSCAAC3 S.cerevisiae ADP/ATP-translocator protein (A... 58 3e-05
140gb|AY691195.1| Leishmania major ATP/ADP translocase mRNA, comple... 56 1e-04
141emb|Z68218.1|CEK01H12 Caenorhabditis elegans Cosmid K01H12, comp... 56 1e-04
142emb|BX019231.1|CNS08N03 Single read from an extremity of a full-... 56 1e-04
143emb|X00363.1|NCADPATP Neurospora crassa precursor mRNA for mitoc... 56 1e-04
144emb|BX842597.1| Neurospora crassa DNA linkage group II BAC clone... 56 1e-04
145emb|BX842596.1| Neurospora crassa DNA linkage group II BAC clone... 56 1e-04
146ref|NM_069326.1| Caenorhabditis elegans K01H12.2 (K01H12.2) mRNA... 56 1e-04
147emb|BX069564.1|CNS09PU8 Single read from an extremity of a full-... 54 5e-04
148dbj|AB227319.1| Aspergillus oryzae cDNA, contig sequence: AoEST4184 54 5e-04
149gb|BC061600.1| Xenopus tropicalis hypothetical protein MGC75662,... 52 0.002
150ref|NM_203578.1| Xenopus tropicalis hypothetical protein MGC7566... 52 0.002
151gb|AF218587.1|AF218587 Lucilia cuprina ADP/ATP translocase mRNA,... 52 0.002
152emb|CR761556.2| Xenopus tropicalis finished cDNA, clone TGas117p06 52 0.002
153gb|AY725780.1| Oncometopia nigricans putative mitochondrial ADP/... 50 0.008
154gb|DQ440004.1| Aedes aegypti clone AE-198 ADP/ATP translocase mR... 50 0.008
155ref|XM_788596.1| PREDICTED: Strongylocentrotus purpuratus simila... 50 0.008
156emb|BX068819.1|CNS09P9J Single read from an extremity of a full-... 50 0.008
157emb|BX067459.1|CNS09O7R Single read from an extremity of a full-... 50 0.008
158emb|BX036624.1|CNS090F8 Single read from an extremity of a full-... 50 0.008
159emb|BX007782.1|CNS08E62 Single read from an extremity of a full-... 50 0.008
160emb|Z35954.1|SCYBR085W S.cerevisiae chromosome II reading frame ... 50 0.008
161emb|CR938588.1| Single read from an extremity of a full-length c... 50 0.008
162emb|CR938334.1| Single read from an extremity of a full-length c... 50 0.008
163emb|CR938254.1| Single read from an extremity of a full-length c... 50 0.008
164emb|CR938077.1| Single read from an extremity of a full-length c... 50 0.008
165emb|CR937989.1| Single read from an extremity of a full-length c... 50 0.008
166emb|CR937962.1| Single read from an extremity of a full-length c... 50 0.008
167gb|S43651.1| ADP/ATP translocase [Drosophila melanogaster, mRNA,... 50 0.008
168ref|XM_312599.2| Anopheles gambiae str. PEST ENSANGP00000024030 ... 50 0.008
169ref|XM_312601.2| Anopheles gambiae str. PEST ENSANGP00000014881 ... 50 0.008
170gb|M34076.1|YSCAAC2A S.cerevisiae ADP/ATP-translocator protein (... 50 0.008
171gb|DQ268539.1| Cryptococcus neoformans var. grubii strain H99 eu... 50 0.008
172gb|AY439863.1| Armigeres subalbatus ASAP ID: 38923 ATP/ADP antip... 48 0.031
173gb|AY238843.1| Drosophila miranda strain MSH38 stress-sensitive ... 48 0.031
174gb|AY238842.1| Drosophila miranda strain MSH22 stress-sensitive ... 48 0.031
175gb|AY238841.1| Drosophila miranda strain SP295 stress-sensitive ... 48 0.031
176gb|AY238840.1| Drosophila miranda strain SP235 stress-sensitive ... 48 0.031
177gb|AY238839.1| Drosophila miranda strain SP138 stress-sensitive ... 48 0.031
178gb|AY238838.1| Drosophila miranda strain MA32 stress-sensitive B... 48 0.031
179gb|AY238837.1| Drosophila miranda strain MA28 stress-sensitive B... 48 0.031
180gb|AY238836.1| Drosophila miranda strain 0101.9 stress-sensitive... 48 0.031
181gb|AY238835.1| Drosophila miranda strain 0101.7 stress-sensitive... 48 0.031
182gb|AY238834.1| Drosophila miranda strain 0101.5 stress-sensitive... 48 0.031
183gb|AY238833.1| Drosophila miranda strain 0101.4 stress-sensitive... 48 0.031
184gb|AY238832.1| Drosophila miranda strain 0101.3 stress-sensitive... 48 0.031
185emb|BX071962.1|CNS09ROU Single read from an extremity of a full-... 48 0.031
186emb|BX071944.1|CNS09ROC Single read from an extremity of a full-... 48 0.031
187emb|BX071896.1|CNS09RN0 Single read from an extremity of a full-... 48 0.031
188emb|BX071872.1|CNS09RMC Single read from an extremity of a full-... 48 0.031
189emb|BX071818.1|CNS09RKU Single read from an extremity of a full-... 48 0.031
190emb|BX071654.1|CNS09RGA Single read from an extremity of a full-... 48 0.031
191emb|BX071031.1|CNS09QYZ Single read from an extremity of a full-... 48 0.031
192emb|BX070618.1|CNS09QNI Single read from an extremity of a full-... 48 0.031
193emb|BX070503.1|CNS09QKB Single read from an extremity of a full-... 48 0.031
194emb|BX070395.1|CNS09QHB Single read from an extremity of a full-... 48 0.031
195emb|BX070224.1|CNS09QCK Single read from an extremity of a full-... 48 0.031
196emb|BX069932.1|CNS09Q4G Single read from an extremity of a full-... 48 0.031
197emb|BX069908.1|CNS09Q3S Single read from an extremity of a full-... 48 0.031
198emb|BX069883.1|CNS09Q33 Single read from an extremity of a full-... 48 0.031
199emb|BX069882.1|CNS09Q32 Single read from an extremity of a full-... 48 0.031
200emb|BX069783.1|CNS09Q0B Single read from an extremity of a full-... 48 0.031
201emb|BX069769.1|CNS09PZX Single read from an extremity of a full-... 48 0.031
202emb|BX069706.1|CNS09PY6 Single read from an extremity of a full-... 48 0.031
203emb|BX069618.1|CNS09PVQ Single read from an extremity of a full-... 48 0.031
204emb|BX060977.1|CNS09J7P Single read from an extremity of a full-... 48 0.031
205emb|BX069508.1|CNS09PSO Single read from an extremity of a full-... 48 0.031
206emb|BX069340.1|CNS09PO0 Single read from an extremity of a full-... 48 0.031
207emb|BX069021.1|CNS09PF5 Single read from an extremity of a full-... 48 0.031
208emb|BX069020.1|CNS09PF4 Single read from an extremity of a full-... 48 0.031
209emb|BX068972.1|CNS09PDS Single read from an extremity of a full-... 48 0.031
210emb|BX068672.1|CNS09P5G Single read from an extremity of a full-... 48 0.031
211emb|BX068399.1|CNS09OXV Single read from an extremity of a full-... 48 0.031
212emb|BX068167.1|CNS09ORF Single read from an extremity of a full-... 48 0.031
213emb|BX068127.1|CNS09OQB Single read from an extremity of a full-... 48 0.031
214emb|BX067885.1|CNS09OJL Single read from an extremity of a full-... 48 0.031
215emb|BX067884.1|CNS09OJK Single read from an extremity of a full-... 48 0.031
216emb|BX067843.1|CNS09OIF Single read from an extremity of a full-... 48 0.031
217emb|BX067544.1|CNS09OA4 Single read from an extremity of a full-... 48 0.031
218emb|BX067029.1|CNS09NVT Single read from an extremity of a full-... 48 0.031
219emb|BX066755.1|CNS09NO7 Single read from an extremity of a full-... 48 0.031
220emb|BX066398.1|CNS09NEA Single read from an extremity of a full-... 48 0.031
221emb|BX066271.1|CNS09NAR Single read from an extremity of a full-... 48 0.031
222emb|BX066125.1|CNS09N6P Single read from an extremity of a full-... 48 0.031
223emb|BX066121.1|CNS09N6L Single read from an extremity of a full-... 48 0.031
224emb|BX066105.1|CNS09N65 Single read from an extremity of a full-... 48 0.031
225emb|BX066075.1|CNS09N5B Single read from an extremity of a full-... 48 0.031
226emb|BX065971.1|CNS09N2F Single read from an extremity of a full-... 48 0.031
227emb|BX065522.1|CNS09MPY Single read from an extremity of a full-... 48 0.031
228emb|BX065510.1|CNS09MPM Single read from an extremity of a full-... 48 0.031
229emb|BX065309.1|CNS09MK1 Single read from an extremity of a full-... 48 0.031
230emb|BX065272.1|CNS09MJ0 Single read from an extremity of a full-... 48 0.031
231emb|BX065217.1|CNS09MHH Single read from an extremity of a full-... 48 0.031
232emb|BX065186.1|CNS09MGM Single read from an extremity of a full-... 48 0.031
233emb|BX065171.1|CNS09MG7 Single read from an extremity of a full-... 48 0.031
234emb|BX064976.1|CNS09MAS Single read from an extremity of a full-... 48 0.031
235emb|BX064688.1|CNS09M2S Single read from an extremity of a full-... 48 0.031
236emb|BX064675.1|CNS09M2F Single read from an extremity of a full-... 48 0.031
237emb|BX064650.1|CNS09M1Q Single read from an extremity of a full-... 48 0.031
238emb|BX064446.1|CNS09LW2 Single read from an extremity of a full-... 48 0.031
239emb|BX064445.1|CNS09LW1 Single read from an extremity of a full-... 48 0.031
240emb|BX064428.1|CNS09LVK Single read from an extremity of a full-... 48 0.031
241emb|BX064417.1|CNS09LV9 Single read from an extremity of a full-... 48 0.031
242emb|BX064382.1|CNS09LUA Single read from an extremity of a full-... 48 0.031
243emb|BX064133.1|CNS09LND Single read from an extremity of a full-... 48 0.031
244emb|BX064132.1|CNS09LNC Single read from an extremity of a full-... 48 0.031
245emb|BX063934.1|CNS09LHU Single read from an extremity of a full-... 48 0.031
246emb|BX063922.1|CNS09LHI Single read from an extremity of a full-... 48 0.031
247emb|BX063876.1|CNS09LG8 Single read from an extremity of a full-... 48 0.031
248emb|BX063832.1|CNS09LF0 Single read from an extremity of a full-... 48 0.031
249emb|BX063607.1|CNS09L8R Single read from an extremity of a full-... 48 0.031
250emb|BX063326.1|CNS09L0Y Single read from an extremity of a full-... 48 0.031
251emb|BX063223.1|CNS09KY3 Single read from an extremity of a full-... 48 0.031
252emb|BX063131.1|CNS09KVJ Single read from an extremity of a full-... 48 0.031
253emb|BX063087.1|CNS09KUB Single read from an extremity of a full-... 48 0.031
254emb|BX062997.1|CNS09KRT Single read from an extremity of a full-... 48 0.031
255emb|BX062776.1|CNS09KLO Single read from an extremity of a full-... 48 0.031
256emb|BX062548.1|CNS09KFC Single read from an extremity of a full-... 48 0.031
257emb|BX062256.1|CNS09K78 Single read from an extremity of a full-... 48 0.031
258emb|BX061790.1|CNS09JUA Single read from an extremity of a full-... 48 0.031
259emb|BX061789.1|CNS09JU9 Single read from an extremity of a full-... 48 0.031
260emb|BX061604.1|CNS09JP4 Single read from an extremity of a full-... 48 0.031
261emb|BX061472.1|CNS09JLG Single read from an extremity of a full-... 48 0.031
262emb|BX061471.1|CNS09JLF Single read from an extremity of a full-... 48 0.031
263emb|BX061318.1|CNS09JH6 Single read from an extremity of a full-... 48 0.031
264emb|BX061228.1|CNS09JEO Single read from an extremity of a full-... 48 0.031
265emb|BX061227.1|CNS09JEN Single read from an extremity of a full-... 48 0.031
266emb|BX061223.1|CNS09JEJ Single read from an extremity of a full-... 48 0.031
267emb|BX060828.1|CNS09J3K Single read from an extremity of a full-... 48 0.031
268emb|BX060436.1|CNS09ISO Single read from an extremity of a full-... 48 0.031
269emb|BX060435.1|CNS09ISN Single read from an extremity of a full-... 48 0.031
270emb|BX060295.1|CNS09IOR Single read from an extremity of a full-... 48 0.031
271emb|BX060232.1|CNS09IN0 Single read from an extremity of a full-... 48 0.031
272emb|BX060231.1|CNS09IMZ Single read from an extremity of a full-... 48 0.031
273emb|BX060153.1|CNS09IKT Single read from an extremity of a full-... 48 0.031
274emb|BX060100.1|CNS09IJC Single read from an extremity of a full-... 48 0.031
275emb|BX060099.1|CNS09IJB Single read from an extremity of a full-... 48 0.031
276emb|BX060042.1|CNS09IHQ Single read from an extremity of a full-... 48 0.031
277emb|BX059969.1|CNS09IFP Single read from an extremity of a full-... 48 0.031
278emb|BX059899.1|CNS09IDR Single read from an extremity of a full-... 48 0.031
279emb|BX059889.1|CNS09IDH Single read from an extremity of a full-... 48 0.031
280emb|BX059477.1|CNS09I21 Single read from an extremity of a full-... 48 0.031
281emb|BX059465.1|CNS09I1P Single read from an extremity of a full-... 48 0.031
282emb|BX059243.1|CNS09HVJ Single read from an extremity of a full-... 48 0.031
283emb|BX059190.1|CNS09HU2 Single read from an extremity of a full-... 48 0.031
284emb|BX059151.1|CNS09HSZ Single read from an extremity of a full-... 48 0.031
285emb|BX059150.1|CNS09HSY Single read from an extremity of a full-... 48 0.031
286emb|BX059074.1|CNS09HQU Single read from an extremity of a full-... 48 0.031
287emb|BX059069.1|CNS09HQP Single read from an extremity of a full-... 48 0.031
288emb|BX059068.1|CNS09HQO Single read from an extremity of a full-... 48 0.031
289emb|BX058746.1|CNS09HHQ Single read from an extremity of a full-... 48 0.031
290emb|BX058644.1|CNS09HEW Single read from an extremity of a full-... 48 0.031
291emb|BX058402.1|CNS09H86 Single read from an extremity of a full-... 48 0.031
292emb|BX058193.1|CNS09H2D Single read from an extremity of a full-... 48 0.031
293emb|BX058163.1|CNS09H1J Single read from an extremity of a full-... 48 0.031
294emb|BX058162.1|CNS09H1I Single read from an extremity of a full-... 48 0.031
295emb|BX058159.1|CNS09H1F Single read from an extremity of a full-... 48 0.031
296emb|BX058158.1|CNS09H1E Single read from an extremity of a full-... 48 0.031
297emb|BX058095.1|CNS09GZN Single read from an extremity of a full-... 48 0.031
298emb|BX058006.1|CNS09GX6 Single read from an extremity of a full-... 48 0.031
299emb|BX058000.1|CNS09GX0 Single read from an extremity of a full-... 48 0.031
300emb|BX057843.1|CNS09GSN Single read from an extremity of a full-... 48 0.031
301emb|BX057013.1|CNS09G5L Single read from an extremity of a full-... 48 0.031
302emb|BX056420.1|CNS09FP4 Single read from an extremity of a full-... 48 0.031
303emb|BX055868.1|CNS09F9S Single read from an extremity of a full-... 48 0.031
304emb|BX055821.1|CNS09F8H Single read from an extremity of a full-... 48 0.031
305emb|BX055727.1|CNS09F5V Single read from an extremity of a full-... 48 0.031
306emb|BX053245.1|CNS09D8X Single read from an extremity of a full-... 48 0.031
307emb|BX053179.1|CNS09D73 Single read from an extremity of a full-... 48 0.031
308emb|BX053123.1|CNS09D5J Single read from an extremity of a full-... 48 0.031
309emb|BX054918.1|CNS09EJE Single read from an extremity of a full-... 48 0.031
310emb|BX054865.1|CNS09EHX Single read from an extremity of a full-... 48 0.031
311emb|BX054838.1|CNS09EH6 Single read from an extremity of a full-... 48 0.031
312emb|BX053092.1|CNS09D4O Single read from an extremity of a full-... 48 0.031
313emb|BX052978.1|CNS09D1I Single read from an extremity of a full-... 48 0.031
314emb|BX052977.1|CNS09D1H Single read from an extremity of a full-... 48 0.031
315emb|BX054518.1|CNS09E8A Single read from an extremity of a full-... 48 0.031
316emb|BX054168.1|CNS09DYK Single read from an extremity of a full-... 48 0.031
317emb|BX053948.1|CNS09DSG Single read from an extremity of a full-... 48 0.031
318emb|BX053633.1|CNS09DJP Single read from an extremity of a full-... 48 0.031
319emb|BX052588.1|CNS09CQO Single read from an extremity of a full-... 48 0.031
320emb|BX052587.1|CNS09CQN Single read from an extremity of a full-... 48 0.031
321emb|BX051933.1|CNS09C8H Single read from an extremity of a full-... 48 0.031
322emb|BX051858.1|CNS09C6E Single read from an extremity of a full-... 48 0.031
323emb|BX051848.1|CNS09C64 Single read from an extremity of a full-... 48 0.031
324emb|BX051535.1|CNS09BXF Single read from an extremity of a full-... 48 0.031
325emb|BX051242.1|CNS09BPA Single read from an extremity of a full-... 48 0.031
326emb|BX051226.1|CNS09BOU Single read from an extremity of a full-... 48 0.031
327emb|BX050941.1|CNS09BGX Single read from an extremity of a full-... 48 0.031
328emb|BX050936.1|CNS09BGS Single read from an extremity of a full-... 48 0.031
329emb|BX050653.1|CNS09B8X Single read from an extremity of a full-... 48 0.031
330emb|BX050382.1|CNS09B1E Single read from an extremity of a full-... 48 0.031
331emb|BX049880.1|CNS09ANG Single read from an extremity of a full-... 48 0.031
332emb|BX030936.1|CNS08W18 Single read from an extremity of a full-... 48 0.031
333emb|BX030935.1|CNS08W17 Single read from an extremity of a full-... 48 0.031
334emb|BX030854.1|CNS08VYY Single read from an extremity of a full-... 48 0.031
335emb|BX049550.1|CNS09AEA Single read from an extremity of a full-... 48 0.031
336emb|BX049470.1|CNS09AC2 Single read from an extremity of a full-... 48 0.031
337emb|BX049440.1|CNS09AB8 Single read from an extremity of a full-... 48 0.031
338emb|BX049411.1|CNS09AAF Single read from an extremity of a full-... 48 0.031
339emb|BX049024.1|CNS099ZO Single read from an extremity of a full-... 48 0.031
340emb|BX049023.1|CNS099ZN Single read from an extremity of a full-... 48 0.031
341emb|BX048619.1|CNS099OF Single read from an extremity of a full-... 48 0.031
342emb|BX048473.1|CNS099KD Single read from an extremity of a full-... 48 0.031
343emb|BX046418.1|CNS097ZA Single read from an extremity of a full-... 48 0.031
344emb|BX046417.1|CNS097Z9 Single read from an extremity of a full-... 48 0.031
345emb|BX048160.1|CNS099BO Single read from an extremity of a full-... 48 0.031
346emb|BX048003.1|CNS0997B Single read from an extremity of a full-... 48 0.031
347emb|BX047965.1|CNS09969 Single read from an extremity of a full-... 48 0.031
348emb|BX047912.1|CNS0994S Single read from an extremity of a full-... 48 0.031
349emb|BX047816.1|CNS09924 Single read from an extremity of a full-... 48 0.031
350emb|BX047601.1|CNS098W5 Single read from an extremity of a full-... 48 0.031
351emb|BX047600.1|CNS098W4 Single read from an extremity of a full-... 48 0.031
352emb|BX047199.1|CNS098KZ Single read from an extremity of a full-... 48 0.031
353emb|BX046989.1|CNS098F5 Single read from an extremity of a full-... 48 0.031
354emb|BX046781.1|CNS0989D Single read from an extremity of a full-... 48 0.031
355emb|BX046640.1|CNS0985G Single read from an extremity of a full-... 48 0.031
356emb|BX046209.1|CNS097TH Single read from an extremity of a full-... 48 0.031
357emb|BX046176.1|CNS097SK Single read from an extremity of a full-... 48 0.031
358emb|BX045963.1|CNS097MN Single read from an extremity of a full-... 48 0.031
359emb|BX045962.1|CNS097MM Single read from an extremity of a full-... 48 0.031
360emb|BX045901.1|CNS097KX Single read from an extremity of a full-... 48 0.031
361emb|BX045900.1|CNS097KW Single read from an extremity of a full-... 48 0.031
362emb|BX045719.1|CNS097FV Single read from an extremity of a full-... 48 0.031
363emb|BX045501.1|CNS0979T Single read from an extremity of a full-... 48 0.031
364emb|BX045124.1|CNS096ZC Single read from an extremity of a full-... 48 0.031
365emb|BX045109.1|CNS096YX Single read from an extremity of a full-... 48 0.031
366emb|BX045103.1|CNS096YR Single read from an extremity of a full-... 48 0.031
367emb|BX045080.1|CNS096Y4 Single read from an extremity of a full-... 48 0.031
368emb|BX044910.1|CNS096TE Single read from an extremity of a full-... 48 0.031
369emb|BX044909.1|CNS096TD Single read from an extremity of a full-... 48 0.031
370emb|BX044795.1|CNS096Q7 Single read from an extremity of a full-... 48 0.031
371emb|BX044785.1|CNS096PX Single read from an extremity of a full-... 48 0.031
372emb|BX044763.1|CNS096PB Single read from an extremity of a full-... 48 0.031
373emb|BX044739.1|CNS096ON Single read from an extremity of a full-... 48 0.031
374emb|BX043078.1|CNS095EI Single read from an extremity of a full-... 48 0.031
375emb|BX043073.1|CNS095ED Single read from an extremity of a full-... 48 0.031
376emb|BX043072.1|CNS095EC Single read from an extremity of a full-... 48 0.031
377emb|BX044645.1|CNS096M1 Single read from an extremity of a full-... 48 0.031
378emb|BX044583.1|CNS096KB Single read from an extremity of a full-... 48 0.031
379emb|BX044410.1|CNS096FI Single read from an extremity of a full-... 48 0.031
380emb|BX044397.1|CNS096F5 Single read from an extremity of a full-... 48 0.031
381emb|BX044304.1|CNS096CK Single read from an extremity of a full-... 48 0.031
382emb|BX044020.1|CNS0964O Single read from an extremity of a full-... 48 0.031
383emb|BX043999.1|CNS09643 Single read from an extremity of a full-... 48 0.031
384emb|BX043889.1|CNS09611 Single read from an extremity of a full-... 48 0.031
385emb|BX043675.1|CNS095V3 Single read from an extremity of a full-... 48 0.031
386emb|BX043644.1|CNS095U8 Single read from an extremity of a full-... 48 0.031
387emb|BX043643.1|CNS095U7 Single read from an extremity of a full-... 48 0.031
388emb|BX043559.1|CNS095RV Single read from an extremity of a full-... 48 0.031
389emb|BX043240.1|CNS095J0 Single read from an extremity of a full-... 48 0.031
390emb|BX042805.1|CNS0956X Single read from an extremity of a full-... 48 0.031
391emb|BX042804.1|CNS0956W Single read from an extremity of a full-... 48 0.031
392emb|BX042698.1|CNS0953Y Single read from an extremity of a full-... 48 0.031
393emb|BX042611.1|CNS0951J Single read from an extremity of a full-... 48 0.031
394emb|BX042517.1|CNS094YX Single read from an extremity of a full-... 48 0.031
395emb|BX042493.1|CNS094Y9 Single read from an extremity of a full-... 48 0.031
396emb|BX041856.1|CNS094GK Single read from an extremity of a full-... 48 0.031
397emb|BX041855.1|CNS094GJ Single read from an extremity of a full-... 48 0.031
398emb|BX042058.1|CNS094M6 Single read from an extremity of a full-... 48 0.031
399emb|BX041988.1|CNS094K8 Single read from an extremity of a full-... 48 0.031
400emb|BX041570.1|CNS0948M Single read from an extremity of a full-... 48 0.031
401emb|BX041516.1|CNS09474 Single read from an extremity of a full-... 48 0.031
402emb|BX041231.1|CNS093Z7 Single read from an extremity of a full-... 48 0.031
403emb|BX041049.1|CNS093U5 Single read from an extremity of a full-... 48 0.031
404emb|BX041038.1|CNS093TU Single read from an extremity of a full-... 48 0.031
405emb|BX040985.1|CNS093SD Single read from an extremity of a full-... 48 0.031
406emb|BX040904.1|CNS093Q4 Single read from an extremity of a full-... 48 0.031
407emb|BX040169.1|CNS0935P Single read from an extremity of a full-... 48 0.031
408emb|BX039764.1|CNS092UG Single read from an extremity of a full-... 48 0.031
409emb|BX039710.1|CNS092SY Single read from an extremity of a full-... 48 0.031
410emb|BX039709.1|CNS092SX Single read from an extremity of a full-... 48 0.031
411emb|BX039429.1|CNS092L5 Single read from an extremity of a full-... 48 0.031
412emb|BX039427.1|CNS092L3 Single read from an extremity of a full-... 48 0.031
413emb|BX039235.1|CNS092FR Single read from an extremity of a full-... 48 0.031
414emb|BX039234.1|CNS092FQ Single read from an extremity of a full-... 48 0.031
415emb|BX037496.1|CNS0913G Single read from an extremity of a full-... 48 0.031
416emb|BX037495.1|CNS0913F Single read from an extremity of a full-... 48 0.031
417emb|BX037479.1|CNS0912Z Single read from an extremity of a full-... 48 0.031
418emb|BX037443.1|CNS0911Z Single read from an extremity of a full-... 48 0.031
419emb|BX037400.1|CNS0910S Single read from an extremity of a full-... 48 0.031
420emb|BX037339.1|CNS090Z3 Single read from an extremity of a full-... 48 0.031
421emb|BX036720.1|CNS090HW Single read from an extremity of a full-... 48 0.031
422emb|BX036561.1|CNS090DH Single read from an extremity of a full-... 48 0.031
423emb|BX037154.1|CNS090TY Single read from an extremity of a full-... 48 0.031
424emb|BX037153.1|CNS090TX Single read from an extremity of a full-... 48 0.031
425emb|BX037128.1|CNS090T8 Single read from an extremity of a full-... 48 0.031
426emb|BX037111.1|CNS090SR Single read from an extremity of a full-... 48 0.031
427emb|BX037110.1|CNS090SQ Single read from an extremity of a full-... 48 0.031
428emb|BX037057.1|CNS090R9 Single read from an extremity of a full-... 48 0.031
429emb|BX037056.1|CNS090R8 Single read from an extremity of a full-... 48 0.031
430emb|BX036966.1|CNS090OQ Single read from an extremity of a full-... 48 0.031
431emb|BX036965.1|CNS090OP Single read from an extremity of a full-... 48 0.031
432emb|BX036949.1|CNS090O9 Single read from an extremity of a full-... 48 0.031
433emb|BX036945.1|CNS090O5 Single read from an extremity of a full-... 48 0.031
434emb|BX036907.1|CNS090N3 Single read from an extremity of a full-... 48 0.031
435emb|BX036906.1|CNS090N2 Single read from an extremity of a full-... 48 0.031
436emb|BX036896.1|CNS090MS Single read from an extremity of a full-... 48 0.031
437emb|BX036830.1|CNS090KY Single read from an extremity of a full-... 48 0.031
438emb|BX036829.1|CNS090KX Single read from an extremity of a full-... 48 0.031
439emb|BX036508.1|CNS090C0 Single read from an extremity of a full-... 48 0.031
440emb|BX036483.1|CNS090BB Single read from an extremity of a full-... 48 0.031
441emb|BX036464.1|CNS090AS Single read from an extremity of a full-... 48 0.031
442emb|BX036354.1|CNS0907Q Single read from an extremity of a full-... 48 0.031
443emb|BX036287.1|CNS0905V Single read from an extremity of a full-... 48 0.031
444emb|BX036286.1|CNS0905U Single read from an extremity of a full-... 48 0.031
445emb|BX036170.1|CNS0902M Single read from an extremity of a full-... 48 0.031
446emb|BX036140.1|CNS0901S Single read from an extremity of a full-... 48 0.031
447emb|BX035967.1|CNS08ZWZ Single read from an extremity of a full-... 48 0.031
448emb|BX035966.1|CNS08ZWY Single read from an extremity of a full-... 48 0.031
449emb|BX035918.1|CNS08ZVM Single read from an extremity of a full-... 48 0.031
450emb|BX035917.1|CNS08ZVL Single read from an extremity of a full-... 48 0.031
451emb|BX035888.1|CNS08ZUS Single read from an extremity of a full-... 48 0.031
452emb|BX035624.1|CNS08ZNG Single read from an extremity of a full-... 48 0.031
453emb|BX035575.1|CNS08ZM3 Single read from an extremity of a full-... 48 0.031
454emb|BX035524.1|CNS08ZKO Single read from an extremity of a full-... 48 0.031
455emb|BX035497.1|CNS08ZJX Single read from an extremity of a full-... 48 0.031
456emb|BX035468.1|CNS08ZJ4 Single read from an extremity of a full-... 48 0.031
457emb|BX035410.1|CNS08ZHI Single read from an extremity of a full-... 48 0.031
458emb|BX035380.1|CNS08ZGO Single read from an extremity of a full-... 48 0.031
459emb|BX035309.1|CNS08ZEP Single read from an extremity of a full-... 48 0.031
460emb|BX035308.1|CNS08ZEO Single read from an extremity of a full-... 48 0.031
461emb|BX035115.1|CNS08Z9B Single read from an extremity of a full-... 48 0.031
462emb|BX035087.1|CNS08Z8J Single read from an extremity of a full-... 48 0.031
463emb|BX035086.1|CNS08Z8I Single read from an extremity of a full-... 48 0.031
464emb|BX035084.1|CNS08Z8G Single read from an extremity of a full-... 48 0.031
465emb|BX035078.1|CNS08Z8A Single read from an extremity of a full-... 48 0.031
466emb|BX034837.1|CNS08Z1L Single read from an extremity of a full-... 48 0.031
467emb|BX035045.1|CNS08Z7D Single read from an extremity of a full-... 48 0.031
468emb|BX034942.1|CNS08Z4I Single read from an extremity of a full-... 48 0.031
469emb|BX034593.1|CNS08YUT Single read from an extremity of a full-... 48 0.031
470emb|BX034573.1|CNS08YU9 Single read from an extremity of a full-... 48 0.031
471emb|BX034537.1|CNS08YT9 Single read from an extremity of a full-... 48 0.031
472emb|BX034536.1|CNS08YT8 Single read from an extremity of a full-... 48 0.031
473emb|BX034346.1|CNS08YNY Single read from an extremity of a full-... 48 0.031
474emb|BX034105.1|CNS08YH9 Single read from an extremity of a full-... 48 0.031
475emb|BX034104.1|CNS08YH8 Single read from an extremity of a full-... 48 0.031
476emb|BX034033.1|CNS08YF9 Single read from an extremity of a full-... 48 0.031
477emb|BX033908.1|CNS08YBS Single read from an extremity of a full-... 48 0.031
478emb|BX033888.1|CNS08YB8 Single read from an extremity of a full-... 48 0.031
479emb|BX033844.1|CNS08YA0 Single read from an extremity of a full-... 48 0.031
480emb|BX033809.1|CNS08Y91 Single read from an extremity of a full-... 48 0.031
481emb|BX033774.1|CNS08Y82 Single read from an extremity of a full-... 48 0.031
482emb|BX033706.1|CNS08Y66 Single read from an extremity of a full-... 48 0.031
483emb|BX033705.1|CNS08Y65 Single read from an extremity of a full-... 48 0.031
484emb|BX033703.1|CNS08Y63 Single read from an extremity of a full-... 48 0.031
485emb|BX033603.1|CNS08Y3B Single read from an extremity of a full-... 48 0.031
486emb|BX033558.1|CNS08Y22 Single read from an extremity of a full-... 48 0.031
487emb|BX033542.1|CNS08Y1M Single read from an extremity of a full-... 48 0.031
488emb|BX033420.1|CNS08XY8 Single read from an extremity of a full-... 48 0.031
489emb|BX033419.1|CNS08XY7 Single read from an extremity of a full-... 48 0.031
490emb|BX033398.1|CNS08XXM Single read from an extremity of a full-... 48 0.031
491emb|BX033397.1|CNS08XXL Single read from an extremity of a full-... 48 0.031
492emb|BX033295.1|CNS08XUR Single read from an extremity of a full-... 48 0.031
493emb|BX033270.1|CNS08XU2 Single read from an extremity of a full-... 48 0.031
494emb|BX033256.1|CNS08XTO Single read from an extremity of a full-... 48 0.031
495emb|BX033203.1|CNS08XS7 Single read from an extremity of a full-... 48 0.031
496emb|BX033142.1|CNS08XQI Single read from an extremity of a full-... 48 0.031
497emb|BX033120.1|CNS08XPW Single read from an extremity of a full-... 48 0.031
498emb|BX033112.1|CNS08XPO Single read from an extremity of a full-... 48 0.031
499emb|BX033059.1|CNS08XO7 Single read from an extremity of a full-... 48 0.031
500emb|BX033032.1|CNS08XNG Single read from an extremity of a full-... 48 0.031

>emb|X80023.1|TTADPATP T.turgidum mRNA for ADP/ATP carrier
          Length = 1035

 Score =  620 bits (313), Expect = e-174
 Identities = 358/373 (95%)
 Strand = Plus / Plus

                                                                       
Query: 169 aggcgcttcaccacaagcagctacatgactcagagccttggcatcagagccccaatgatg 228
           |||||||||||||||||||||||||||||||||| |||||||||||| | |||||| |||
Sbjct: 13  aggcgcttcaccacaagcagctacatgactcagaaccttggcatcagtgtcccaatcatg 72

                                                                       
Query: 229 tcatcttctccactgtttgccaatgcacccccggagaagaaaggcgccaagaactttgcg 288
           |||||||||||| ||||||||||||||||||| ||||||||||| | |||||||||||||
Sbjct: 73  tcatcttctccaatgtttgccaatgcaccccctgagaagaaaggtgtcaagaactttgcg 132

                                                                       
Query: 289 atcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccatt 348
           || ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 133 attgatttcctcatgggaggagtgtcagctgcagtttccaagactgctgcagctcctatt 192

                                                                       
Query: 349 gagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctct 408
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 193 gagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctct 252

                                                                       
Query: 409 gagccatacaagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggc 468
           |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 253 gagccatacaagggtattggtgactgctttggccgcaccatcaaggatgaaggctttggc 312

                                                                       
Query: 469 tcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaac 528
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 313 tcattgtggagaggaaacactgccaacgtcatccgttacttcccaactcaggctttgaac 372

                        
Query: 529 tttgcattcaagg 541
           |||||||| ||||
Sbjct: 373 tttgcatttaagg 385



to top

>emb|X95863.1|TTANT1 T.turgidum ant gene (1549bp)
          Length = 1549

 Score =  587 bits (296), Expect = e-164
 Identities = 338/352 (96%)
 Strand = Plus / Plus

                                                                       
Query: 169 aggcgcttcaccacaagcagctacatgactcagagccttggcatcagagccccaatgatg 228
           |||||||||||||||||||||||||||||||||| |||||||||||| | |||||| |||
Sbjct: 13  aggcgcttcaccacaagcagctacatgactcagaaccttggcatcagtgtcccaatcatg 72

                                                                       
Query: 229 tcatcttctccactgtttgccaatgcacccccggagaagaaaggcgccaagaactttgcg 288
           ||| |||||||| ||||||||||||||||||| ||||||||||| | |||||||||||||
Sbjct: 73  tcaccttctccaatgtttgccaatgcaccccctgagaagaaaggtgtcaagaactttgcg 132

                                                                       
Query: 289 atcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccatt 348
           || ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 133 attgatttcctcatgggaggagtgtcagctgcagtttccaagactgctgcagctcccatt 192

                                                                       
Query: 349 gagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctct 408
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 193 gagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctct 252

                                                                       
Query: 409 gagccatacaagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggc 468
           |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 253 gagccatacaagggtattggtgactgctttggccgcaccatcaaggatgaaggctttggc 312

                                                               
Query: 469 tcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcagg 520
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 313 tcattgtggagaggaaacactgccaacgtcatccgttacttcccaactcagg 364



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 32/34 (94%), Gaps = 1/34 (2%)
 Strand = Plus / Plus

                                             
Query: 518 aggctttgaactttgcattcaagggattacttca 551
           |||||||||||||||| ||||| |||||||||||
Sbjct: 763 aggctttgaactttgctttcaa-ggattacttca 795



to top

>emb|X95864.1|TTANT2 T.turgidum ant gene (1494bp)
          Length = 1494

 Score =  563 bits (284), Expect = e-157
 Identities = 335/352 (95%)
 Strand = Plus / Plus

                                                                       
Query: 169 aggcgcttcaccacaagcagctacatgactcagagccttggcatcagagccccaatgatg 228
           |||||||||||||||||| ||||||||||||||| |||||||||||| | ||| ||||||
Sbjct: 13  aggcgcttcaccacaagctgctacatgactcagaaccttggcatcagtgtccccatgatg 72

                                                                       
Query: 229 tcatcttctccactgtttgccaatgcacccccggagaagaaaggcgccaagaactttgcg 288
           |||||||||||| |||||||||||||||| || ||||||||||| | |||||||||||||
Sbjct: 73  tcatcttctccattgtttgccaatgcaccacctgagaagaaaggtgtcaagaactttgcg 132

                                                                       
Query: 289 atcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccatt 348
           || ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 133 attgatttcctcatgggaggagtgtccgctgcagtttccaagactgctgcagctcctatt 192

                                                                       
Query: 349 gagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctct 408
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 193 gagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctct 252

                                                                       
Query: 409 gagccatacaagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggc 468
           |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 253 gagccatacaagggtattggtgactgctttggccgcaccatcaaggatgaaggctttggc 312

                                                               
Query: 469 tcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcagg 520
           ||||||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 313 tcattgtggagaggaaacactgctaacgtcatccgttacttcccaactcagg 364



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 33/34 (97%), Gaps = 1/34 (2%)
 Strand = Plus / Plus

                                             
Query: 518 aggctttgaactttgcattcaagggattacttca 551
           |||||||||||||||||||||| |||||||||||
Sbjct: 709 aggctttgaactttgcattcaa-ggattacttca 741



to top

>ref|XM_467495.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1577

 Score =  309 bits (156), Expect = 5e-81
 Identities = 235/260 (90%), Gaps = 1/260 (0%)
 Strand = Plus / Plus

                                                                       
Query: 292 gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
           |||||||||||||| |||||||| || |||||||| ||||||||||| ||||| ||||||
Sbjct: 377 gatttcctcatgggtggagtgtcagccgcagtttcaaagactgctgctgctccgattgag 436

                                                                       
Query: 352 cgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgag 411
           ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 437 cgtgtgaagctgcttatccagaaccaggatgaaatgatcaaggctggtaggctctcagag 496

                                                                       
Query: 412 ccatacaagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggctca 471
           ||||||||||||||||| |||||||| |||||||| |||||||| || || ||||  |||
Sbjct: 497 ccatacaagggtattggggactgcttcggacgcactatcaaggatgagggttttgcttca 556

                                                                       
Query: 472 ttgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaacttt 531
           |||||||||||||| |||||||| || |||||||||||||| || |||||||||||||||
Sbjct: 557 ttgtggagaggaaacactgccaatgtgatccgttacttccccacccaggctttgaacttt 616

                               
Query: 532 gcattcaagggattacttca 551
           || ||||| |||||||||||
Sbjct: 617 gctttcaa-ggattacttca 635



 Score =  149 bits (75), Expect = 1e-32
 Identities = 132/151 (87%)
 Strand = Plus / Plus

                                                                       
Query: 58  gctaaccacccgtctgtcatgcagaagttcggtgggcagttccacctcagctccagcttc 117
           ||||| || ||| ||||| | |||||||||||||| |||||||||||  |||||||||| 
Sbjct: 137 gctaatcaaccgactgtccttcagaagttcggtggccagttccaccttggctccagcttt 196

                                                                       
Query: 118 tctgagggtgtacgagctcgcaacatctgcccttctgtgccatcctatgagaggcgcttc 177
           ||||| |||||||| ||||||||||||||||| |||||  |||||||||| |||||||| 
Sbjct: 197 tctgaaggtgtacgggctcgcaacatctgcccatctgtctcatcctatgacaggcgcttt 256

                                          
Query: 178 accacaagcagctacatgactcagagccttg 208
           |||||||| ||||||||||| ||| ||||||
Sbjct: 257 accacaaggagctacatgacccagggccttg 287



to top

>ref|XM_507526.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ2056_H01.33
           mRNA
          Length = 1578

 Score =  309 bits (156), Expect = 5e-81
 Identities = 235/260 (90%), Gaps = 1/260 (0%)
 Strand = Plus / Plus

                                                                       
Query: 292 gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
           |||||||||||||| |||||||| || |||||||| ||||||||||| ||||| ||||||
Sbjct: 378 gatttcctcatgggtggagtgtcagccgcagtttcaaagactgctgctgctccgattgag 437

                                                                       
Query: 352 cgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgag 411
           ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 438 cgtgtgaagctgcttatccagaaccaggatgaaatgatcaaggctggtaggctctcagag 497

                                                                       
Query: 412 ccatacaagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggctca 471
           ||||||||||||||||| |||||||| |||||||| |||||||| || || ||||  |||
Sbjct: 498 ccatacaagggtattggggactgcttcggacgcactatcaaggatgagggttttgcttca 557

                                                                       
Query: 472 ttgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaacttt 531
           |||||||||||||| |||||||| || |||||||||||||| || |||||||||||||||
Sbjct: 558 ttgtggagaggaaacactgccaatgtgatccgttacttccccacccaggctttgaacttt 617

                               
Query: 532 gcattcaagggattacttca 551
           || ||||| |||||||||||
Sbjct: 618 gctttcaa-ggattacttca 636



 Score =  149 bits (75), Expect = 1e-32
 Identities = 132/151 (87%)
 Strand = Plus / Plus

                                                                       
Query: 58  gctaaccacccgtctgtcatgcagaagttcggtgggcagttccacctcagctccagcttc 117
           ||||| || ||| ||||| | |||||||||||||| |||||||||||  |||||||||| 
Sbjct: 138 gctaatcaaccgactgtccttcagaagttcggtggccagttccaccttggctccagcttt 197

                                                                       
Query: 118 tctgagggtgtacgagctcgcaacatctgcccttctgtgccatcctatgagaggcgcttc 177
           ||||| |||||||| ||||||||||||||||| |||||  |||||||||| |||||||| 
Sbjct: 198 tctgaaggtgtacgggctcgcaacatctgcccatctgtctcatcctatgacaggcgcttt 257

                                          
Query: 178 accacaagcagctacatgactcagagccttg 208
           |||||||| ||||||||||| ||| ||||||
Sbjct: 258 accacaaggagctacatgacccagggccttg 288



to top

>ref|XM_506941.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ2056_H01.33
           mRNA
          Length = 1619

 Score =  309 bits (156), Expect = 5e-81
 Identities = 235/260 (90%), Gaps = 1/260 (0%)
 Strand = Plus / Plus

                                                                       
Query: 292 gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
           |||||||||||||| |||||||| || |||||||| ||||||||||| ||||| ||||||
Sbjct: 419 gatttcctcatgggtggagtgtcagccgcagtttcaaagactgctgctgctccgattgag 478

                                                                       
Query: 352 cgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgag 411
           ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 479 cgtgtgaagctgcttatccagaaccaggatgaaatgatcaaggctggtaggctctcagag 538

                                                                       
Query: 412 ccatacaagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggctca 471
           ||||||||||||||||| |||||||| |||||||| |||||||| || || ||||  |||
Sbjct: 539 ccatacaagggtattggggactgcttcggacgcactatcaaggatgagggttttgcttca 598

                                                                       
Query: 472 ttgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaacttt 531
           |||||||||||||| |||||||| || |||||||||||||| || |||||||||||||||
Sbjct: 599 ttgtggagaggaaacactgccaatgtgatccgttacttccccacccaggctttgaacttt 658

                               
Query: 532 gcattcaagggattacttca 551
           || ||||| |||||||||||
Sbjct: 659 gctttcaa-ggattacttca 677



 Score =  149 bits (75), Expect = 1e-32
 Identities = 132/151 (87%)
 Strand = Plus / Plus

                                                                       
Query: 58  gctaaccacccgtctgtcatgcagaagttcggtgggcagttccacctcagctccagcttc 117
           ||||| || ||| ||||| | |||||||||||||| |||||||||||  |||||||||| 
Sbjct: 179 gctaatcaaccgactgtccttcagaagttcggtggccagttccaccttggctccagcttt 238

                                                                       
Query: 118 tctgagggtgtacgagctcgcaacatctgcccttctgtgccatcctatgagaggcgcttc 177
           ||||| |||||||| ||||||||||||||||| |||||  |||||||||| |||||||| 
Sbjct: 239 tctgaaggtgtacgggctcgcaacatctgcccatctgtctcatcctatgacaggcgcttt 298

                                          
Query: 178 accacaagcagctacatgactcagagccttg 208
           |||||||| ||||||||||| ||| ||||||
Sbjct: 299 accacaaggagctacatgacccagggccttg 329



to top

>dbj|AK119207.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-E01, full
           insert sequence
          Length = 1578

 Score =  309 bits (156), Expect = 5e-81
 Identities = 235/260 (90%), Gaps = 1/260 (0%)
 Strand = Plus / Plus

                                                                       
Query: 292 gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
           |||||||||||||| |||||||| || |||||||| ||||||||||| ||||| ||||||
Sbjct: 378 gatttcctcatgggtggagtgtcagccgcagtttcaaagactgctgctgctccgattgag 437

                                                                       
Query: 352 cgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgag 411
           ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 438 cgtgtgaagctgcttatccagaaccaggatgaaatgatcaaggctggtaggctctcagag 497

                                                                       
Query: 412 ccatacaagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggctca 471
           ||||||||||||||||| |||||||| |||||||| |||||||| || || ||||  |||
Sbjct: 498 ccatacaagggtattggggactgcttcggacgcactatcaaggatgagggttttgcttca 557

                                                                       
Query: 472 ttgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaacttt 531
           |||||||||||||| |||||||| || |||||||||||||| || |||||||||||||||
Sbjct: 558 ttgtggagaggaaacactgccaatgtgatccgttacttccccacccaggctttgaacttt 617

                               
Query: 532 gcattcaagggattacttca 551
           || ||||| |||||||||||
Sbjct: 618 gctttcaa-ggattacttca 636



 Score =  141 bits (71), Expect = 3e-30
 Identities = 131/151 (86%)
 Strand = Plus / Plus

                                                                       
Query: 58  gctaaccacccgtctgtcatgcagaagttcggtgggcagttccacctcagctccagcttc 117
           ||||| || ||| ||||| | |||||||||||||| |||||||||||  |||||||||| 
Sbjct: 138 gctaatcaaccgactgtccttcagaagttcggtggccagttccaccttggctccagcttt 197

                                                                       
Query: 118 tctgagggtgtacgagctcgcaacatctgcccttctgtgccatcctatgagaggcgcttc 177
           ||||| |||||||| ||||||||||||||||| |||||  |||||||||| |||||||| 
Sbjct: 198 tctgaaggtgtacgggctcgcaacatctgcccatctgtctcatcctatgacaggcgcttt 257

                                          
Query: 178 accacaagcagctacatgactcagagccttg 208
           |||||||| |||||| |||| ||| ||||||
Sbjct: 258 accacaaggagctacgtgacccagggccttg 288



to top

>dbj|AK100143.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023011P12, full
           insert sequence
          Length = 1577

 Score =  309 bits (156), Expect = 5e-81
 Identities = 235/260 (90%), Gaps = 1/260 (0%)
 Strand = Plus / Plus

                                                                       
Query: 292 gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
           |||||||||||||| |||||||| || |||||||| ||||||||||| ||||| ||||||
Sbjct: 377 gatttcctcatgggtggagtgtcagccgcagtttcaaagactgctgctgctccgattgag 436

                                                                       
Query: 352 cgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgag 411
           ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 437 cgtgtgaagctgcttatccagaaccaggatgaaatgatcaaggctggtaggctctcagag 496

                                                                       
Query: 412 ccatacaagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggctca 471
           ||||||||||||||||| |||||||| |||||||| |||||||| || || ||||  |||
Sbjct: 497 ccatacaagggtattggggactgcttcggacgcactatcaaggatgagggttttgcttca 556

                                                                       
Query: 472 ttgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaacttt 531
           |||||||||||||| |||||||| || |||||||||||||| || |||||||||||||||
Sbjct: 557 ttgtggagaggaaacactgccaatgtgatccgttacttccccacccaggctttgaacttt 616

                               
Query: 532 gcattcaagggattacttca 551
           || ||||| |||||||||||
Sbjct: 617 gctttcaa-ggattacttca 635



 Score =  141 bits (71), Expect = 3e-30
 Identities = 131/151 (86%)
 Strand = Plus / Plus

                                                                       
Query: 58  gctaaccacccgtctgtcatgcagaagttcggtgggcagttccacctcagctccagcttc 117
           ||||| || ||| ||||| | |||||||||||||| |||||||||||  |||||||||| 
Sbjct: 137 gctaatcaaccgactgtccttcagaagttcggtggccagttccaccttggctccagcttt 196

                                                                       
Query: 118 tctgagggtgtacgagctcgcaacatctgcccttctgtgccatcctatgagaggcgcttc 177
           ||||| |||||||| ||||| ||||||||||| |||||  |||||||||| |||||||| 
Sbjct: 197 tctgaaggtgtacgggctcgtaacatctgcccatctgtctcatcctatgacaggcgcttt 256

                                          
Query: 178 accacaagcagctacatgactcagagccttg 208
           |||||||| ||||||||||| ||| ||||||
Sbjct: 257 accacaaggagctacatgacccagggccttg 287



to top

>dbj|AK073448.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033045A20, full
           insert sequence
          Length = 1618

 Score =  309 bits (156), Expect = 5e-81
 Identities = 235/260 (90%), Gaps = 1/260 (0%)
 Strand = Plus / Plus

                                                                       
Query: 292 gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
           |||||||||||||| |||||||| || |||||||| ||||||||||| ||||| ||||||
Sbjct: 418 gatttcctcatgggtggagtgtcagccgcagtttcaaagactgctgctgctccgattgag 477

                                                                       
Query: 352 cgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgag 411
           ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 478 cgtgtgaagctgcttatccagaaccaggatgaaatgatcaaggctggtaggctctcagag 537

                                                                       
Query: 412 ccatacaagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggctca 471
           ||||||||||||||||| |||||||| |||||||| |||||||| || || ||||  |||
Sbjct: 538 ccatacaagggtattggggactgcttcggacgcactatcaaggatgagggttttgcttca 597

                                                                       
Query: 472 ttgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaacttt 531
           |||||||||||||| |||||||| || |||||||||||||| || |||||||||||||||
Sbjct: 598 ttgtggagaggaaacactgccaatgtgatccgttacttccccacccaggctttgaacttt 657

                               
Query: 532 gcattcaagggattacttca 551
           || ||||| |||||||||||
Sbjct: 658 gctttcaa-ggattacttca 676



 Score =  149 bits (75), Expect = 1e-32
 Identities = 132/151 (87%)
 Strand = Plus / Plus

                                                                       
Query: 58  gctaaccacccgtctgtcatgcagaagttcggtgggcagttccacctcagctccagcttc 117
           ||||| || ||| ||||| | |||||||||||||| |||||||||||  |||||||||| 
Sbjct: 178 gctaatcaaccgactgtccttcagaagttcggtggccagttccaccttggctccagcttt 237

                                                                       
Query: 118 tctgagggtgtacgagctcgcaacatctgcccttctgtgccatcctatgagaggcgcttc 177
           ||||| |||||||| ||||||||||||||||| |||||  |||||||||| |||||||| 
Sbjct: 238 tctgaaggtgtacgggctcgcaacatctgcccatctgtctcatcctatgacaggcgcttt 297

                                          
Query: 178 accacaagcagctacatgactcagagccttg 208
           |||||||| ||||||||||| ||| ||||||
Sbjct: 298 accacaaggagctacatgacccagggccttg 328



to top

>dbj|D12637.1|RICATADPT Oryza sativa (japonica cultivar-group) mRNA for ATP/ADP
           translocator, complete cds
          Length = 1564

 Score =  309 bits (156), Expect = 5e-81
 Identities = 235/260 (90%), Gaps = 1/260 (0%)
 Strand = Plus / Plus

                                                                       
Query: 292 gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
           |||||||||||||| |||||||| || |||||||| ||||||||||| ||||| ||||||
Sbjct: 365 gatttcctcatgggtggagtgtcagccgcagtttcaaagactgctgctgctccgattgag 424

                                                                       
Query: 352 cgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgag 411
           ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 425 cgtgtgaagctgcttatccagaaccaggatgaaatgatcaaggctggtaggctctcagag 484

                                                                       
Query: 412 ccatacaagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggctca 471
           ||||||||||||||||| |||||||| |||||||| |||||||| || || ||||  |||
Sbjct: 485 ccatacaagggtattggggactgcttcggacgcactatcaaggatgagggttttgcttca 544

                                                                       
Query: 472 ttgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaacttt 531
           |||||||||||||| |||||||| || |||||||||||||| || |||||||||||||||
Sbjct: 545 ttgtggagaggaaacactgccaatgtgatccgttacttccccacccaggctttgaacttt 604

                               
Query: 532 gcattcaagggattacttca 551
           || ||||| |||||||||||
Sbjct: 605 gctttcaa-ggattacttca 623



 Score =  149 bits (75), Expect = 1e-32
 Identities = 132/151 (87%)
 Strand = Plus / Plus

                                                                       
Query: 58  gctaaccacccgtctgtcatgcagaagttcggtgggcagttccacctcagctccagcttc 117
           ||||| || ||| ||||| | |||||||||||||| |||||||||||  |||||||||| 
Sbjct: 125 gctaatcaaccgactgtccttcagaagttcggtggccagttccaccttggctccagcttt 184

                                                                       
Query: 118 tctgagggtgtacgagctcgcaacatctgcccttctgtgccatcctatgagaggcgcttc 177
           ||||| |||||||| ||||||||||||||||| |||||  |||||||||| |||||||| 
Sbjct: 185 tctgaaggtgtacgggctcgcaacatctgcccatctgtctcatcctatgacaggcgcttt 244

                                          
Query: 178 accacaagcagctacatgactcagagccttg 208
           |||||||| ||||||||||| ||| ||||||
Sbjct: 245 accacaaggagctacatgacccagggccttg 275



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  272 bits (137), Expect = 1e-69
 Identities = 200/221 (90%)
 Strand = Plus / Plus

                                                                            
Query: 292      gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
                |||||||||||||| |||||||| || |||||||| ||||||||||| ||||| ||||||
Sbjct: 29842053 gatttcctcatgggtggagtgtcagccgcagtttcaaagactgctgctgctccgattgag 29842112

                                                                            
Query: 352      cgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgag 411
                ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 29842113 cgtgtgaagctgcttatccagaaccaggatgaaatgatcaaggctggtaggctctcagag 29842172

                                                                            
Query: 412      ccatacaagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggctca 471
                ||||||||||||||||| |||||||| |||||||| |||||||| || || ||||  |||
Sbjct: 29842173 ccatacaagggtattggggactgcttcggacgcactatcaaggatgagggttttgcttca 29842232

                                                         
Query: 472      ttgtggagaggaaatactgccaacgtcatccgttacttccc 512
                |||||||||||||| |||||||| || ||||||||||||||
Sbjct: 29842233 ttgtggagaggaaacactgccaatgtgatccgttacttccc 29842273



 Score =  149 bits (75), Expect = 1e-32
 Identities = 132/151 (87%)
 Strand = Plus / Plus

                                                                            
Query: 58       gctaaccacccgtctgtcatgcagaagttcggtgggcagttccacctcagctccagcttc 117
                ||||| || ||| ||||| | |||||||||||||| |||||||||||  |||||||||| 
Sbjct: 29841813 gctaatcaaccgactgtccttcagaagttcggtggccagttccaccttggctccagcttt 29841872

                                                                            
Query: 118      tctgagggtgtacgagctcgcaacatctgcccttctgtgccatcctatgagaggcgcttc 177
                ||||| |||||||| ||||||||||||||||| |||||  |||||||||| |||||||| 
Sbjct: 29841873 tctgaaggtgtacgggctcgcaacatctgcccatctgtctcatcctatgacaggcgcttt 29841932

                                               
Query: 178      accacaagcagctacatgactcagagccttg 208
                |||||||| ||||||||||| ||| ||||||
Sbjct: 29841933 accacaaggagctacatgacccagggccttg 29841963



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 32/34 (94%), Gaps = 1/34 (2%)
 Strand = Plus / Plus

                                                  
Query: 518      aggctttgaactttgcattcaagggattacttca 551
                |||||||||||||||| ||||| |||||||||||
Sbjct: 29842557 aggctttgaactttgctttcaa-ggattacttca 29842589



to top

>dbj|AP004098.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ2056_H01
          Length = 123428

 Score =  272 bits (137), Expect = 1e-69
 Identities = 200/221 (90%)
 Strand = Plus / Plus

                                                                         
Query: 292   gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
             |||||||||||||| |||||||| || |||||||| ||||||||||| ||||| ||||||
Sbjct: 98398 gatttcctcatgggtggagtgtcagccgcagtttcaaagactgctgctgctccgattgag 98457

                                                                         
Query: 352   cgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgag 411
             ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 98458 cgtgtgaagctgcttatccagaaccaggatgaaatgatcaaggctggtaggctctcagag 98517

                                                                         
Query: 412   ccatacaagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggctca 471
             ||||||||||||||||| |||||||| |||||||| |||||||| || || ||||  |||
Sbjct: 98518 ccatacaagggtattggggactgcttcggacgcactatcaaggatgagggttttgcttca 98577

                                                      
Query: 472   ttgtggagaggaaatactgccaacgtcatccgttacttccc 512
             |||||||||||||| |||||||| || ||||||||||||||
Sbjct: 98578 ttgtggagaggaaacactgccaatgtgatccgttacttccc 98618



 Score =  149 bits (75), Expect = 1e-32
 Identities = 132/151 (87%)
 Strand = Plus / Plus

                                                                         
Query: 58    gctaaccacccgtctgtcatgcagaagttcggtgggcagttccacctcagctccagcttc 117
             ||||| || ||| ||||| | |||||||||||||| |||||||||||  |||||||||| 
Sbjct: 98158 gctaatcaaccgactgtccttcagaagttcggtggccagttccaccttggctccagcttt 98217

                                                                         
Query: 118   tctgagggtgtacgagctcgcaacatctgcccttctgtgccatcctatgagaggcgcttc 177
             ||||| |||||||| ||||||||||||||||| |||||  |||||||||| |||||||| 
Sbjct: 98218 tctgaaggtgtacgggctcgcaacatctgcccatctgtctcatcctatgacaggcgcttt 98277

                                            
Query: 178   accacaagcagctacatgactcagagccttg 208
             |||||||| ||||||||||| ||| ||||||
Sbjct: 98278 accacaaggagctacatgacccagggccttg 98308



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 32/34 (94%), Gaps = 1/34 (2%)
 Strand = Plus / Plus

                                               
Query: 518   aggctttgaactttgcattcaagggattacttca 551
             |||||||||||||||| ||||| |||||||||||
Sbjct: 98902 aggctttgaactttgctttcaa-ggattacttca 98934



to top

>gb|AY104389.1| Zea mays PCO082855 mRNA sequence
          Length = 1612

 Score =  192 bits (97), Expect = 8e-46
 Identities = 205/241 (85%)
 Strand = Plus / Plus

                                                                       
Query: 301 atgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgtgttaag 360
           ||||| ||||| |||||||| || |||||||| ||||||||||| ||||||||||| |||
Sbjct: 459 atgggtggagtttctgctgctgtctccaagacagctgcagctccgattgagcgtgtcaag 518

                                                                       
Query: 361 ctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgagccatacaag 420
           ||  | || |||||||||||||| ||| ||||| |||||||||| ||||| || ||||||
Sbjct: 519 cttttgattcagaaccaggatgaaatgctcaagactggcaggctttctgaaccgtacaag 578

                                                                       
Query: 421 ggtattggtgactgctttggacgcaccatcaaggaagaaggctttggctcattgtggaga 480
           |||||||| ||||||||||| || || ||||  || || || |||| |||| ||||||||
Sbjct: 579 ggtattggggactgctttggccggacaatcagagatgagggttttgtctcactgtggaga 638

                                                                       
Query: 481 ggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaag 540
           ||||| || || || ||||||||||||||||| || ||||| ||||||||||| ||||||
Sbjct: 639 ggaaacacagctaatgtcatccgttacttccccacacaggcattgaactttgcgttcaag 698

            
Query: 541 g 541
           |
Sbjct: 699 g 699



to top

>ref|NM_111692.2| Arabidopsis thaliana AAC1 (ADP/ATP CARRIER 1); ATP:ADP antiporter/
           binding AT3G08580 (AAC1) transcript variant AT3G08580.1
           mRNA, complete cds
          Length = 1457

 Score =  188 bits (95), Expect = 1e-44
 Identities = 194/227 (85%)
 Strand = Plus / Plus

                                                                       
Query: 313 tctgctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatccag 372
           |||||||| || |||||||||||||| ||||| ||||| |||||||||||  | ||||||
Sbjct: 315 tctgctgccgtctccaagactgctgctgctcctattgaacgtgttaagcttttgatccag 374

                                                                       
Query: 373 aaccaggatgagatgatcaaggctggcaggctctctgagccatacaagggtattggtgac 432
           ||||||||||||||||| || ||||||||||| ||||| || ||||||||||||||||||
Sbjct: 375 aaccaggatgagatgattaaagctggcaggctttctgaaccctacaagggtattggtgac 434

                                                                       
Query: 433 tgctttggacgcaccatcaaggaagaaggctttggctcattgtggagaggaaatactgcc 492
           || || ||  | || || ||||| ||||| ||||| ||  | ||||||||||| ||||||
Sbjct: 435 tgtttcggcaggacgattaaggatgaaggttttggttctctatggagaggaaacactgcc 494

                                                          
Query: 493 aacgtcatccgttacttcccaactcaggctttgaactttgcattcaa 539
           || || |||||||| ||||| |||||||| ||||||||||| |||||
Sbjct: 495 aatgttatccgttatttccccactcaggccttgaactttgccttcaa 541



to top

>ref|NM_180210.1| Arabidopsis thaliana AAC1 (ADP/ATP CARRIER 1); binding AT3G08580
           (AAC1) transcript variant AT3G08580.2 mRNA, complete cds
          Length = 1572

 Score =  188 bits (95), Expect = 1e-44
 Identities = 194/227 (85%)
 Strand = Plus / Plus

                                                                       
Query: 313 tctgctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatccag 372
           |||||||| || |||||||||||||| ||||| ||||| |||||||||||  | ||||||
Sbjct: 430 tctgctgccgtctccaagactgctgctgctcctattgaacgtgttaagcttttgatccag 489

                                                                       
Query: 373 aaccaggatgagatgatcaaggctggcaggctctctgagccatacaagggtattggtgac 432
           ||||||||||||||||| || ||||||||||| ||||| || ||||||||||||||||||
Sbjct: 490 aaccaggatgagatgattaaagctggcaggctttctgaaccctacaagggtattggtgac 549

                                                                       
Query: 433 tgctttggacgcaccatcaaggaagaaggctttggctcattgtggagaggaaatactgcc 492
           || || ||  | || || ||||| ||||| ||||| ||  | ||||||||||| ||||||
Sbjct: 550 tgtttcggcaggacgattaaggatgaaggttttggttctctatggagaggaaacactgcc 609

                                                          
Query: 493 aacgtcatccgttacttcccaactcaggctttgaactttgcattcaa 539
           || || |||||||| ||||| |||||||| ||||||||||| |||||
Sbjct: 610 aatgttatccgttatttccccactcaggccttgaactttgccttcaa 656



to top

>gb|BT000381.1| Arabidopsis thaliana adenylate translocator (At3g08580) mRNA,
           complete cds
          Length = 1183

 Score =  188 bits (95), Expect = 1e-44
 Identities = 194/227 (85%)
 Strand = Plus / Plus

                                                                       
Query: 313 tctgctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatccag 372
           |||||||| || |||||||||||||| ||||| ||||| |||||||||||  | ||||||
Sbjct: 268 tctgctgccgtctccaagactgctgctgctcctattgaacgtgttaagcttttgatccag 327

                                                                       
Query: 373 aaccaggatgagatgatcaaggctggcaggctctctgagccatacaagggtattggtgac 432
           ||||||||||||||||| || ||||||||||| ||||| || ||||||||||||||||||
Sbjct: 328 aaccaggatgagatgattaaagctggcaggctttctgaaccctacaagggtattggtgac 387

                                                                       
Query: 433 tgctttggacgcaccatcaaggaagaaggctttggctcattgtggagaggaaatactgcc 492
           || || ||  | || || ||||| ||||| ||||| ||  | ||||||||||| ||||||
Sbjct: 388 tgtttcggcaggacgattaaggatgaaggttttggttctctatggagaggaaacactgcc 447

                                                          
Query: 493 aacgtcatccgttacttcccaactcaggctttgaactttgcattcaa 539
           || || |||||||| ||||| |||||||| ||||||||||| |||||
Sbjct: 448 aatgttatccgttatttccccactcaggccttgaactttgccttcaa 494



to top

>gb|AY074529.1| Arabidopsis thaliana putative adenylate translocator protein
           (At3g08580) mRNA, complete cds
          Length = 1177

 Score =  188 bits (95), Expect = 1e-44
 Identities = 194/227 (85%)
 Strand = Plus / Plus

                                                                       
Query: 313 tctgctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatccag 372
           |||||||| || |||||||||||||| ||||| ||||| |||||||||||  | ||||||
Sbjct: 268 tctgctgccgtctccaagactgctgctgctcctattgaacgtgttaagcttttgatccag 327

                                                                       
Query: 373 aaccaggatgagatgatcaaggctggcaggctctctgagccatacaagggtattggtgac 432
           ||||||||||||||||| || ||||||||||| ||||| || ||||||||||||||||||
Sbjct: 328 aaccaggatgagatgattaaagctggcaggctttctgaaccctacaagggtattggtgac 387

                                                                       
Query: 433 tgctttggacgcaccatcaaggaagaaggctttggctcattgtggagaggaaatactgcc 492
           || || ||  | || || ||||| ||||| ||||| ||  | ||||||||||| ||||||
Sbjct: 388 tgtttcggcaggacgattaaggatgaaggttttggttctctatggagaggaaacactgcc 447

                                                          
Query: 493 aacgtcatccgttacttcccaactcaggctttgaactttgcattcaa 539
           || || |||||||| ||||| |||||||| ||||||||||| |||||
Sbjct: 448 aatgttatccgttatttccccactcaggccttgaactttgccttcaa 494



to top

>emb|X65549.1|ATAT A.thaliana ANT1 mRNA for adenylate translocator
          Length = 1393

 Score =  188 bits (95), Expect = 1e-44
 Identities = 194/227 (85%)
 Strand = Plus / Plus

                                                                       
Query: 313 tctgctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatccag 372
           |||||||| || |||||||||||||| ||||| ||||| |||||||||||  | ||||||
Sbjct: 262 tctgctgccgtctccaagactgctgctgctcctattgaacgtgttaagcttttgatccag 321

                                                                       
Query: 373 aaccaggatgagatgatcaaggctggcaggctctctgagccatacaagggtattggtgac 432
           ||||||||||||||||| || ||||||||||| ||||| || ||||||||||||||||||
Sbjct: 322 aaccaggatgagatgattaaagctggcaggctttctgaaccctacaagggtattggtgac 381

                                                                       
Query: 433 tgctttggacgcaccatcaaggaagaaggctttggctcattgtggagaggaaatactgcc 492
           || || ||  | || || ||||| ||||| ||||| ||  | ||||||||||| ||||||
Sbjct: 382 tgtttcggcaggacgattaaggatgaaggttttggttctctatggagaggaaacactgcc 441

                                                          
Query: 493 aacgtcatccgttacttcccaactcaggctttgaactttgcattcaa 539
           || || |||||||| ||||| |||||||| ||||||||||| |||||
Sbjct: 442 aatgttatccgttatttccccactcaggccttgaactttgccttcaa 488



to top

>gb|AY034933.1| Arabidopsis thaliana putative adenylate translocator protein
           (At3g08580) mRNA, complete cds
          Length = 1450

 Score =  188 bits (95), Expect = 1e-44
 Identities = 194/227 (85%)
 Strand = Plus / Plus

                                                                       
Query: 313 tctgctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatccag 372
           |||||||| || |||||||||||||| ||||| ||||| |||||||||||  | ||||||
Sbjct: 381 tctgctgccgtctccaagactgctgctgctcctattgaacgtgttaagcttttgatccag 440

                                                                       
Query: 373 aaccaggatgagatgatcaaggctggcaggctctctgagccatacaagggtattggtgac 432
           ||||||||||||||||| || ||||||||||| ||||| || ||||||||||||||||||
Sbjct: 441 aaccaggatgagatgattaaagctggcaggctttctgaaccctacaagggtattggtgac 500

                                                                       
Query: 433 tgctttggacgcaccatcaaggaagaaggctttggctcattgtggagaggaaatactgcc 492
           || || ||  | || || ||||| ||||| ||||| ||  | ||||||||||| ||||||
Sbjct: 501 tgtttcggcaggacgattaaggatgaaggttttggttctctatggagaggaaacactgcc 560

                                                          
Query: 493 aacgtcatccgttacttcccaactcaggctttgaactttgcattcaa 539
           || || |||||||| ||||| |||||||| ||||||||||| |||||
Sbjct: 561 aatgttatccgttatttccccactcaggccttgaactttgccttcaa 607



to top

>gb|AY054248.1| Arabidopsis thaliana AT3g08580/F17O14_5 mRNA, complete cds
          Length = 1492

 Score =  188 bits (95), Expect = 1e-44
 Identities = 194/227 (85%)
 Strand = Plus / Plus

                                                                       
Query: 313 tctgctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatccag 372
           |||||||| || |||||||||||||| ||||| ||||| |||||||||||  | ||||||
Sbjct: 378 tctgctgccgtctccaagactgctgctgctcctattgaacgtgttaagcttttgatccag 437

                                                                       
Query: 373 aaccaggatgagatgatcaaggctggcaggctctctgagccatacaagggtattggtgac 432
           ||||||||||||||||| || ||||||||||| ||||| || ||||||||||||||||||
Sbjct: 438 aaccaggatgagatgattaaagctggcaggctttctgaaccctacaagggtattggtgac 497

                                                                       
Query: 433 tgctttggacgcaccatcaaggaagaaggctttggctcattgtggagaggaaatactgcc 492
           || || ||  | || || ||||| ||||| ||||| ||  | ||||||||||| ||||||
Sbjct: 498 tgtttcggcaggacgattaaggatgaaggttttggttctctatggagaggaaacactgcc 557

                                                          
Query: 493 aacgtcatccgttacttcccaactcaggctttgaactttgcattcaa 539
           || || |||||||| ||||| |||||||| ||||||||||| |||||
Sbjct: 558 aatgttatccgttatttccccactcaggccttgaactttgccttcaa 604



to top

>gb|AY042814.1| Arabidopsis thaliana adenylate translocator (F17O14.5) mRNA,
           complete cds
          Length = 1481

 Score =  188 bits (95), Expect = 1e-44
 Identities = 194/227 (85%)
 Strand = Plus / Plus

                                                                       
Query: 313 tctgctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatccag 372
           |||||||| || |||||||||||||| ||||| ||||| |||||||||||  | ||||||
Sbjct: 389 tctgctgccgtctccaagactgctgctgctcctattgaacgtgttaagcttttgatccag 448

                                                                       
Query: 373 aaccaggatgagatgatcaaggctggcaggctctctgagccatacaagggtattggtgac 432
           ||||||||||||||||| || ||||||||||| ||||| || ||||||||||||||||||
Sbjct: 449 aaccaggatgagatgattaaagctggcaggctttctgaaccctacaagggtattggtgac 508

                                                                       
Query: 433 tgctttggacgcaccatcaaggaagaaggctttggctcattgtggagaggaaatactgcc 492
           || || ||  | || || ||||| ||||| ||||| ||  | ||||||||||| ||||||
Sbjct: 509 tgtttcggcaggacgattaaggatgaaggttttggttctctatggagaggaaacactgcc 568

                                                          
Query: 493 aacgtcatccgttacttcccaactcaggctttgaactttgcattcaa 539
           || || |||||||| ||||| |||||||| ||||||||||| |||||
Sbjct: 569 aatgttatccgttatttccccactcaggccttgaactttgccttcaa 615



to top

>gb|AY089128.1| Arabidopsis thaliana clone 36818 mRNA, complete sequence
          Length = 1390

 Score =  188 bits (95), Expect = 1e-44
 Identities = 194/227 (85%)
 Strand = Plus / Plus

                                                                       
Query: 313 tctgctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatccag 372
           |||||||| || |||||||||||||| ||||| ||||| |||||||||||  | ||||||
Sbjct: 315 tctgctgccgtctccaagactgctgctgctcctattgaacgtgttaagcttttgatccag 374

                                                                       
Query: 373 aaccaggatgagatgatcaaggctggcaggctctctgagccatacaagggtattggtgac 432
           ||||||||||||||||| || ||||||||||| ||||| || ||||||||||||||||||
Sbjct: 375 aaccaggatgagatgattaaagctggcaggctttctgaaccctacaagggtattggtgac 434

                                                                       
Query: 433 tgctttggacgcaccatcaaggaagaaggctttggctcattgtggagaggaaatactgcc 492
           || || ||  | || || ||||| ||||| ||||| ||  | ||||||||||| ||||||
Sbjct: 435 tgtttcggcaggacgattaaggatgaaggttttggttctctatggagaggaaacactgcc 494

                                                          
Query: 493 aacgtcatccgttacttcccaactcaggctttgaactttgcattcaa 539
           || || |||||||| ||||| |||||||| ||||||||||| |||||
Sbjct: 495 aatgttatccgttatttccccactcaggccttgaactttgccttcaa 541



to top

>gb|BT002387.1| Arabidopsis thaliana adenylate translocator (At3g08580) mRNA,
           complete cds
          Length = 1476

 Score =  188 bits (95), Expect = 1e-44
 Identities = 194/227 (85%)
 Strand = Plus / Plus

                                                                       
Query: 313 tctgctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatccag 372
           |||||||| || |||||||||||||| ||||| ||||| |||||||||||  | ||||||
Sbjct: 381 tctgctgccgtctccaagactgctgctgctcctattgaacgtgttaagcttttgatccag 440

                                                                       
Query: 373 aaccaggatgagatgatcaaggctggcaggctctctgagccatacaagggtattggtgac 432
           ||||||||||||||||| || ||||||||||| ||||| || ||||||||||||||||||
Sbjct: 441 aaccaggatgagatgattaaagctggcaggctttctgaaccctacaagggtattggtgac 500

                                                                       
Query: 433 tgctttggacgcaccatcaaggaagaaggctttggctcattgtggagaggaaatactgcc 492
           || || ||  | || || ||||| ||||| ||||| ||  | ||||||||||| ||||||
Sbjct: 501 tgtttcggcaggacgattaaggatgaaggttttggttctctatggagaggaaacactgcc 560

                                                          
Query: 493 aacgtcatccgttacttcccaactcaggctttgaactttgcattcaa 539
           || || |||||||| ||||| |||||||| ||||||||||| |||||
Sbjct: 561 aatgttatccgttatttccccactcaggccttgaactttgccttcaa 607



to top

>emb|BX831240.1|CNS09YRL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS70ZH09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1437

 Score =  182 bits (92), Expect = 8e-43
 Identities = 228/272 (83%), Gaps = 1/272 (0%)
 Strand = Plus / Plus

                                                                       
Query: 280 aactttgcgatcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgca 339
           |||||||| || |||||| | ||||| || || |||||||| || || ||||||||||| 
Sbjct: 342 aactttgctattgatttcatgatgggtggtgtttctgctgctgtgtcaaagactgctgct 401

                                                                       
Query: 340 gctcccattgagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggc 399
           ||||||||||||||||| |||||  | || |||||||||||||||||| | |||||||| 
Sbjct: 402 gctcccattgagcgtgtcaagcttttgattcagaaccaggatgagatgcttaaggctgga 461

                                                                       
Query: 400 aggctctctgagccatacaagggtattggtgactgctttggacgcaccatcaaggaagaa 459
           |||||  |||||||||||||||||||| ||||||| || ||  | || || | ||| |||
Sbjct: 462 aggcttactgagccatacaagggtattcgtgactgtttcggcaggacaattagggatgaa 521

                                                                       
Query: 460 ggctttggctcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcag 519
           ||  |||| || |||||||||||||| || || || || |||||||||||||| ||||||
Sbjct: 522 ggtattggttcgttgtggagaggaaacaccgctaatgttatccgttacttccccactcag 581

                                           
Query: 520 gctttgaactttgcattcaagggattacttca 551
           || ||||||||||||||| || ||||||||||
Sbjct: 582 gccttgaactttgcattc-agagattacttca 612



to top

>ref|NM_001036799.1| Arabidopsis thaliana AAC2; binding AT5G13490 (AAC2) transcript
           variant AT5G13490.2 mRNA, complete cds
          Length = 1504

 Score =  174 bits (88), Expect = 2e-40
 Identities = 217/260 (83%)
 Strand = Plus / Plus

                                                                       
Query: 280 aactttgcgatcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgca 339
           |||||||| || |||||| | ||||| || || |||||||| || || ||||||||||| 
Sbjct: 292 aactttgctattgatttcatgatgggtggtgtttctgctgctgtgtcaaagactgctgct 351

                                                                       
Query: 340 gctcccattgagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggc 399
           ||||||||||||||||| |||||  | || || ||||||||||||||| | |||||||| 
Sbjct: 352 gctcccattgagcgtgtcaagcttttgattcaaaaccaggatgagatgcttaaggctgga 411

                                                                       
Query: 400 aggctctctgagccatacaagggtattggtgactgctttggacgcaccatcaaggaagaa 459
           |||||  |||||||||||||||||||| ||||||| || ||  | || || | ||| |||
Sbjct: 412 aggcttactgagccatacaagggtattcgtgactgtttcggcaggacaattagggatgaa 471

                                                                       
Query: 460 ggctttggctcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcag 519
           ||  |||| || |||||||||||||| || || || || |||||||||||||| ||||||
Sbjct: 472 ggtattggttcgttgtggagaggaaacaccgctaatgttatccgttacttccccactcag 531

                               
Query: 520 gctttgaactttgcattcaa 539
           || |||||||||||||||||
Sbjct: 532 gccttgaactttgcattcaa 551



to top

>ref|NM_121352.2| Arabidopsis thaliana AAC2; ATP:ADP antiporter/ binding AT5G13490
           (AAC2) transcript variant AT5G13490.1 mRNA, complete cds
          Length = 1513

 Score =  174 bits (88), Expect = 2e-40
 Identities = 217/260 (83%)
 Strand = Plus / Plus

                                                                       
Query: 280 aactttgcgatcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgca 339
           |||||||| || |||||| | ||||| || || |||||||| || || ||||||||||| 
Sbjct: 353 aactttgctattgatttcatgatgggtggtgtttctgctgctgtgtcaaagactgctgct 412

                                                                       
Query: 340 gctcccattgagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggc 399
           ||||||||||||||||| |||||  | || || ||||||||||||||| | |||||||| 
Sbjct: 413 gctcccattgagcgtgtcaagcttttgattcaaaaccaggatgagatgcttaaggctgga 472

                                                                       
Query: 400 aggctctctgagccatacaagggtattggtgactgctttggacgcaccatcaaggaagaa 459
           |||||  |||||||||||||||||||| ||||||| || ||  | || || | ||| |||
Sbjct: 473 aggcttactgagccatacaagggtattcgtgactgtttcggcaggacaattagggatgaa 532

                                                                       
Query: 460 ggctttggctcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcag 519
           ||  |||| || |||||||||||||| || || || || |||||||||||||| ||||||
Sbjct: 533 ggtattggttcgttgtggagaggaaacaccgctaatgttatccgttacttccccactcag 592

                               
Query: 520 gctttgaactttgcattcaa 539
           || |||||||||||||||||
Sbjct: 593 gccttgaactttgcattcaa 612



to top

>gb|BT016715.1| Zea mays clone Contig548 mRNA sequence
          Length = 1584

 Score =  174 bits (88), Expect = 2e-40
 Identities = 229/276 (82%)
 Strand = Plus / Plus

                                                                       
Query: 266 agaaaggcgccaagaactttgcgatcgatttcctcatgggaggagtgtctgctgcagttt 325
           ||||||| | |||||||||   ||| |||||| | ||||| || || || ||||| ||||
Sbjct: 327 agaaaggaggcaagaacttcatgattgatttcatgatgggcggtgtttcagctgctgttt 386

                                                                       
Query: 326 ccaagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgaga 385
           | ||||||||||| |||||||| |||||||| ||||||||||| |||||||| |||||||
Sbjct: 387 caaagactgctgctgctcccatcgagcgtgtgaagctgcttattcagaaccaagatgaga 446

                                                                       
Query: 386 tgatcaaggctggcaggctctctgagccatacaagggtattggtgactgctttggacgca 445
           |||| ||| |||| ||||| || ||||| ||||||||||||| |||||||||   ||| |
Sbjct: 447 tgattaagtctggtaggctatcagagccgtacaagggtattgttgactgcttcaaacgta 506

                                                                       
Query: 446 ccatcaaggaagaaggctttggctcattgtggagaggaaatactgccaacgtcatccgtt 505
           |||| ||||| ||||| ||    || |||||||| || || ||||| || || || ||||
Sbjct: 507 ccattaaggatgaaggtttctcttccttgtggaggggtaacactgctaatgttattcgtt 566

                                               
Query: 506 acttcccaactcaggctttgaactttgcattcaagg 541
           ||||||| ||||||||||||||||||||||| ||||
Sbjct: 567 acttccctactcaggctttgaactttgcatttaagg 602



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 46  atggcggaccgtgctaaccacccgtctgtcatgcagaagttcggtgggcagttccacctc 105
           ||||||||||  |||||||| ||  ||||| | || ||| ||||||| ||||||||||| 
Sbjct: 86  atggcggaccaggctaaccaacccactgtccttcataagctcggtggccagttccacctg 145

                                                                       
Query: 106 agctccagcttctctgagggtgtacgagctcgcaacatctgcccttctgtgccatcctat 165
            |||| | | ||||||| |||||||| || || ||||| ||||| |||||  |||| |||
Sbjct: 146 cgctcgatcatctctgaaggtgtacgggcccgtaacatatgcccatctgtctcatcttat 205

                                                     
Query: 166 gagaggcgcttcaccacaagcagctacatgactcagagcctt 207
           || ||| | ||  ||||||| | ||||||||| |||||||||
Sbjct: 206 gaaaggagatttgccacaaggaactacatgacccagagcctt 247



to top

>gb|AY079407.1| Arabidopsis thaliana putative adenosine nucleotide translocator
           protein (At5g13490) mRNA, complete cds
          Length = 1189

 Score =  174 bits (88), Expect = 2e-40
 Identities = 217/260 (83%)
 Strand = Plus / Plus

                                                                       
Query: 280 aactttgcgatcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgca 339
           |||||||| || |||||| | ||||| || || |||||||| || || ||||||||||| 
Sbjct: 247 aactttgctattgatttcatgatgggtggtgtttctgctgctgtgtcaaagactgctgct 306

                                                                       
Query: 340 gctcccattgagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggc 399
           ||||||||||||||||| |||||  | || || ||||||||||||||| | |||||||| 
Sbjct: 307 gctcccattgagcgtgtcaagcttttgattcaaaaccaggatgagatgcttaaggctgga 366

                                                                       
Query: 400 aggctctctgagccatacaagggtattggtgactgctttggacgcaccatcaaggaagaa 459
           |||||  |||||||||||||||||||| ||||||| || ||  | || || | ||| |||
Sbjct: 367 aggcttactgagccatacaagggtattcgtgactgtttcggcaggacaattagggatgaa 426

                                                                       
Query: 460 ggctttggctcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcag 519
           ||  |||| || |||||||||||||| || || || || |||||||||||||| ||||||
Sbjct: 427 ggtattggttcgttgtggagaggaaacaccgctaatgttatccgttacttccccactcag 486

                               
Query: 520 gctttgaactttgcattcaa 539
           || |||||||||||||||||
Sbjct: 487 gccttgaactttgcattcaa 506



to top

>gb|AY050857.1| Arabidopsis thaliana putative adenosine nucleotide translocator
           protein (At5g13490) mRNA, complete cds
          Length = 1480

 Score =  174 bits (88), Expect = 2e-40
 Identities = 217/260 (83%)
 Strand = Plus / Plus

                                                                       
Query: 280 aactttgcgatcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgca 339
           |||||||| || |||||| | ||||| || || |||||||| || || ||||||||||| 
Sbjct: 353 aactttgctattgatttcatgatgggtggtgtttctgctgctgtgtcaaagactgctgct 412

                                                                       
Query: 340 gctcccattgagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggc 399
           ||||||||||||||||| |||||  | || || ||||||||||||||| | |||||||| 
Sbjct: 413 gctcccattgagcgtgtcaagcttttgattcaaaaccaggatgagatgcttaaggctgga 472

                                                                       
Query: 400 aggctctctgagccatacaagggtattggtgactgctttggacgcaccatcaaggaagaa 459
           |||||  |||||||||||||||||||| ||||||| || ||  | || || | ||| |||
Sbjct: 473 aggcttactgagccatacaagggtattcgtgactgtttcggcaggacaattagggatgaa 532

                                                                       
Query: 460 ggctttggctcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcag 519
           ||  |||| || |||||||||||||| || || || || |||||||||||||| ||||||
Sbjct: 533 ggtattggttcgttgtggagaggaaacaccgctaatgttatccgttacttccccactcag 592

                               
Query: 520 gctttgaactttgcattcaa 539
           || |||||||||||||||||
Sbjct: 593 gccttgaactttgcattcaa 612



to top

>emb|X57556.1|ZMANT1MU Z.mays MANT1 mRNA for adenine nucleotide translocator (also called
           ADP/ATP translocase)
          Length = 1579

 Score =  174 bits (88), Expect = 2e-40
 Identities = 229/276 (82%)
 Strand = Plus / Plus

                                                                       
Query: 266 agaaaggcgccaagaactttgcgatcgatttcctcatgggaggagtgtctgctgcagttt 325
           ||||||| | |||||||||   ||| |||||| | ||||| || || || ||||| ||||
Sbjct: 326 agaaaggaggcaagaacttcatgattgatttcatgatgggcggtgtttcagctgctgttt 385

                                                                       
Query: 326 ccaagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgaga 385
           | ||||||||||| |||||||| |||||||| ||||||||||| |||||||| |||||||
Sbjct: 386 caaagactgctgctgctcccatcgagcgtgtgaagctgcttattcagaaccaagatgaga 445

                                                                       
Query: 386 tgatcaaggctggcaggctctctgagccatacaagggtattggtgactgctttggacgca 445
           |||| ||| |||| ||||| || ||||| ||||||||||||| |||||||||   ||| |
Sbjct: 446 tgattaagtctggtaggctatcagagccgtacaagggtattgttgactgcttcaaacgta 505

                                                                       
Query: 446 ccatcaaggaagaaggctttggctcattgtggagaggaaatactgccaacgtcatccgtt 505
           |||| ||||| ||||| ||    || |||||||| || || ||||| || || || ||||
Sbjct: 506 ccattaaggatgaaggtttctcttccttgtggaggggtaacactgctaatgttattcgtt 565

                                               
Query: 506 acttcccaactcaggctttgaactttgcattcaagg 541
           ||||||| ||||||||||||||||||||||| ||||
Sbjct: 566 acttccctactcaggctttgaactttgcatttaagg 601



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 46  atggcggaccgtgctaaccacccgtctgtcatgcagaagttcggtgggcagttccacctc 105
           ||||||||||  |||||||| ||  ||||| | || ||| ||||||| ||||||||||| 
Sbjct: 85  atggcggaccaggctaaccaacccactgtccttcataagctcggtggccagttccacctg 144

                                                                       
Query: 106 agctccagcttctctgagggtgtacgagctcgcaacatctgcccttctgtgccatcctat 165
            |||| | | ||||||| |||||||| || || ||||| ||||| |||||  |||| |||
Sbjct: 145 cgctcgatcatctctgaaggtgtacgggcccgtaacatatgcccatctgtctcatcttat 204

                                                     
Query: 166 gagaggcgcttcaccacaagcagctacatgactcagagcctt 207
           || ||| | ||  ||||||| | ||||||||| |||||||||
Sbjct: 205 gaaaggagatttgccacaaggaactacatgacccagagcctt 246



to top

>emb|X02842.1|ZMANT1 Zea mays mRNA for adenine nucleotide translocator (ATP/ADP
           translocator)
          Length = 1136

 Score =  174 bits (88), Expect = 2e-40
 Identities = 229/276 (82%)
 Strand = Plus / Plus

                                                                       
Query: 266 agaaaggcgccaagaactttgcgatcgatttcctcatgggaggagtgtctgctgcagttt 325
           ||||||| | |||||||||   ||| |||||| | ||||| || || || ||||| ||||
Sbjct: 37  agaaaggaggcaagaacttcatgattgatttcatgatgggcggtgtttcagctgctgttt 96

                                                                       
Query: 326 ccaagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgaga 385
           | ||||||||||| |||||||| |||||||| ||||||||||| |||||||| |||||||
Sbjct: 97  caaagactgctgctgctcccatcgagcgtgtgaagctgcttattcagaaccaagatgaga 156

                                                                       
Query: 386 tgatcaaggctggcaggctctctgagccatacaagggtattggtgactgctttggacgca 445
           |||| ||| |||| ||||| || ||||| ||||||||||||| |||||||||   ||| |
Sbjct: 157 tgattaagtctggtaggctatcagagccgtacaagggtattgttgactgcttcaaacgta 216

                                                                       
Query: 446 ccatcaaggaagaaggctttggctcattgtggagaggaaatactgccaacgtcatccgtt 505
           |||| ||||| ||||| ||    || |||||||| ||| | ||||| || || || ||||
Sbjct: 217 ccattaaggatgaaggtttctcttccttgtggaggggatacactgctaatgttattcgtt 276

                                               
Query: 506 acttcccaactcaggctttgaactttgcattcaagg 541
           ||||||| ||||||||||||||||||||||| ||||
Sbjct: 277 acttccctactcaggctttgaactttgcatttaagg 312



to top

>gb|AY109420.1| Zea mays CL2269_1 mRNA sequence
          Length = 1883

 Score =  174 bits (88), Expect = 2e-40
 Identities = 229/276 (82%)
 Strand = Plus / Plus

                                                                       
Query: 266 agaaaggcgccaagaactttgcgatcgatttcctcatgggaggagtgtctgctgcagttt 325
           ||||||| | |||||||||   ||| |||||| | ||||| || || || ||||| ||||
Sbjct: 343 agaaaggaggcaagaacttcatgattgatttcatgatgggcggtgtttcagctgctgttt 402

                                                                       
Query: 326 ccaagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgaga 385
           | |||||||||||||||||||| |||||||| ||||||||||| |||||||| |||||||
Sbjct: 403 cgaagactgctgcagctcccatcgagcgtgtgaagctgcttattcagaaccaagatgaga 462

                                                                       
Query: 386 tgatcaaggctggcaggctctctgagccatacaagggtattggtgactgctttggacgca 445
           |||| ||| |||| ||||| || ||||| ||||||||||||| |||||||||   ||| |
Sbjct: 463 tgattaagtctggtaggctatcagagccgtacaagggtattgttgactgcttcaaacgta 522

                                                                       
Query: 446 ccatcaaggaagaaggctttggctcattgtggagaggaaatactgccaacgtcatccgtt 505
           |||| ||||| || || ||    || |||||||| || || ||||| || || || ||||
Sbjct: 523 ccattaaggatgagggtttctcttccttgtggaggggtaacactgctaatgttattcgtt 582

                                               
Query: 506 acttcccaactcaggctttgaactttgcattcaagg 541
           ||||||| ||||||||||||||||||||||| ||||
Sbjct: 583 acttccctactcaggctttgaactttgcatttaagg 618



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 46  atggcggaccgtgctaaccacccgtctgtcatgcagaagttcggtgggcagttccacctc 105
           ||||||||||  |||||||| ||  ||||| | || ||| ||||||| ||||||||||| 
Sbjct: 102 atggcggaccaggctaaccaacccactgtccttcataagctcggtggccagttccacctg 161

                                                                       
Query: 106 agctccagcttctctgagggtgtacgagctcgcaacatctgcccttctgtgccatcctat 165
            |||| | | ||||||| |||||||| || || ||||| ||||| |||||  |||| |||
Sbjct: 162 cgctcgatcatctctgaaggtgtacgggcccgtaacatatgcccatctgtctcatcttat 221

                                                     
Query: 166 gagaggcgcttcaccacaagcagctacatgactcagagcctt 207
           || ||| | ||  ||||||| | ||||||||| |||||||||
Sbjct: 222 gaaaggagatttgccacaaggaactacatgacccagagcctt 263



to top

>gb|AF006489.1|AF006489 Gossypium hirsutum adenine nucleotide translocator 1 (CANT1) mRNA,
           complete cds
          Length = 1515

 Score =  170 bits (86), Expect = 3e-39
 Identities = 225/270 (83%), Gaps = 1/270 (0%)
 Strand = Plus / Plus

                                                                       
Query: 282 ctttgcgatcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagc 341
           |||||| || |||||||||||||| ||||| |||||||| || || || || ||||| ||
Sbjct: 353 ctttgctattgatttcctcatgggtggagtttctgctgctgtatcaaaaacagctgctgc 412

                                                                       
Query: 342 tcccattgagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcag 401
            || |||||||||||||||||  | || |||||||| ||||| ||||||||   ||| ||
Sbjct: 413 accaattgagcgtgttaagcttttgattcagaaccaagatgaaatgatcaaaagtggaag 472

                                                                       
Query: 402 gctctctgagccatacaagggtattggtgactgctttggacgcaccatcaaggaagaagg 461
           ||||||||| || ||||||||||||||||| || ||    || || |||||||| |||||
Sbjct: 473 gctctctgaaccttacaagggtattggtgattgtttcaagcgaacaatcaaggatgaagg 532

                                                                       
Query: 462 ctttggctcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggc 521
            ||||| || |||||||||||||| |||||||| || || ||||| ||||| ||||||||
Sbjct: 533 atttggttctttgtggagaggaaacactgccaatgttattcgttatttccccactcaggc 592

                                         
Query: 522 tttgaactttgcattcaagggattacttca 551
            ||||||||||| ||||| |||||||||||
Sbjct: 593 cttgaactttgccttcaa-ggattacttca 621



to top

>emb|AJ633708.1| Brassica oleracea var. acephala partial mRNA for adenosine
           nucleotide translocator (ANT gene)
          Length = 1195

 Score =  168 bits (85), Expect = 1e-38
 Identities = 166/193 (86%)
 Strand = Plus / Plus

                                                                       
Query: 340 gctcccattgagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggc 399
           ||||| ||||||||||| |||||  | || |||||||||||||||||| | |||||||| 
Sbjct: 124 gctccaattgagcgtgtgaagcttttgattcagaaccaggatgagatgcttaaggctggt 183

                                                                       
Query: 400 aggctctctgagccatacaagggtattggtgactgctttggacgcaccatcaaggaagaa 459
           ||| | |||||||| ||||||||||||||||| || || ||| | ||||| ||||| |||
Sbjct: 184 aggttatctgagccttacaagggtattggtgattgtttcggaaggaccattaaggatgaa 243

                                                                       
Query: 460 ggctttggctcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcag 519
           || ||||| || |||||||||||||| ||||| ||||| |||||||||||||| ||||||
Sbjct: 244 gggtttggttctttgtggagaggaaacactgctaacgttatccgttacttccccactcag 303

                        
Query: 520 gctttgaactttg 532
           || ||||||||||
Sbjct: 304 gcattgaactttg 316



to top

>gb|BT011953.1| Arabidopsis thaliana At5g13490 mRNA sequence
          Length = 1155

 Score =  167 bits (84), Expect = 5e-38
 Identities = 216/260 (83%)
 Strand = Plus / Plus

                                                                       
Query: 280 aactttgcgatcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgca 339
           |||||||| || |||||| | ||||| || || |||||||| || || ||||||||||| 
Sbjct: 244 aactttgctattgatttcatgatgggtggtgtttctgctgctgtgtcaaagactgctgct 303

                                                                       
Query: 340 gctcccattgagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggc 399
           ||||||||||||||||| |||||  | || || ||||||| ||||||| | |||||||| 
Sbjct: 304 gctcccattgagcgtgtcaagcttttgattcaaaaccagggtgagatgcttaaggctgga 363

                                                                       
Query: 400 aggctctctgagccatacaagggtattggtgactgctttggacgcaccatcaaggaagaa 459
           |||||  |||||||||||||||||||| ||||||| || ||  | || || | ||| |||
Sbjct: 364 aggcttactgagccatacaagggtattcgtgactgtttcggcaggacaattagggatgaa 423

                                                                       
Query: 460 ggctttggctcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcag 519
           ||  |||| || |||||||||||||| || || || || |||||||||||||| ||||||
Sbjct: 424 ggtattggttcgttgtggagaggaaacaccgctaatgttatccgttacttccccactcag 483

                               
Query: 520 gctttgaactttgcattcaa 539
           || |||||||||||||||||
Sbjct: 484 gccttgaactttgcattcaa 503



to top

>gb|AC012562.5|AC012562 Arabidopsis thaliana chromosome 3 BAC F17O14 genomic sequence, complete
             sequence
          Length = 90721

 Score =  167 bits (84), Expect = 5e-38
 Identities = 177/208 (85%)
 Strand = Plus / Minus

                                                                         
Query: 313   tctgctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatccag 372
             |||||||| || |||||||||||||| ||||| ||||| |||||||||||  | ||||||
Sbjct: 17686 tctgctgccgtctccaagactgctgctgctcctattgaacgtgttaagcttttgatccag 17627

                                                                         
Query: 373   aaccaggatgagatgatcaaggctggcaggctctctgagccatacaagggtattggtgac 432
             ||||||||||||||||| || ||||||||||| ||||| || ||||||||||||||||||
Sbjct: 17626 aaccaggatgagatgattaaagctggcaggctttctgaaccctacaagggtattggtgac 17567

                                                                         
Query: 433   tgctttggacgcaccatcaaggaagaaggctttggctcattgtggagaggaaatactgcc 492
             || || ||  | || || ||||| ||||| ||||| ||  | ||||||||||| ||||||
Sbjct: 17566 tgtttcggcaggacgattaaggatgaaggttttggttctctatggagaggaaacactgcc 17507

                                         
Query: 493   aacgtcatccgttacttcccaactcagg 520
             || || |||||||| ||||| |||||||
Sbjct: 17506 aatgttatccgttatttccccactcagg 17479



to top

>emb|X57557.1|STANT1 S.tuberosum PANT1 mRNA for adenine nucleotide translocator (also
           called ADP/ATP translocase)
          Length = 1453

 Score =  157 bits (79), Expect = 5e-35
 Identities = 205/247 (82%)
 Strand = Plus / Plus

                                                                       
Query: 295 ttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgt 354
           ||||||||||| || || |||||||| || || ||||||||||| || || |||||||||
Sbjct: 266 ttcctcatgggtggtgtttctgctgctgtgtcaaagactgctgctgcccctattgagcgt 325

                                                                       
Query: 355 gttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgagcca 414
           || |||||  | ||||| ||||| ||||||||||| |||||||| || ||||| || |||
Sbjct: 326 gtgaagcttttgatccaaaaccaagatgagatgattaaggctggtagactctcagaacca 385

                                                                       
Query: 415 tacaagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggctcattg 474
           |||||||| ||||| ||||| ||| |  | || || ||||| ||||| ||||   | |||
Sbjct: 386 tacaagggaattggagactgttttagtaggacaattaaggatgaaggatttgctgccttg 445

                                                                       
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
           ||||||||||| || || || ||||| |||||||||||||||||||| ||||||||||||
Sbjct: 446 tggagaggaaacaccgctaatgtcattcgttacttcccaactcaggcattgaactttgca 505

                  
Query: 535 ttcaagg 541
           || ||||
Sbjct: 506 tttaagg 512



to top

>gb|DQ235188.1| Solanum tuberosum clone 164C11 ADP/ATP translocator-like mRNA,
           complete cds
          Length = 1533

 Score =  151 bits (76), Expect = 3e-33
 Identities = 202/244 (82%)
 Strand = Plus / Plus

                                                                       
Query: 298 ctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgtgtt 357
           |||||||| ||||| |||||||| || || ||||| ||||| || || ||||||||||| 
Sbjct: 347 ctcatgggtggagtttctgctgctgtatcaaagaccgctgctgcccctattgagcgtgtg 406

                                                                       
Query: 358 aagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgagccatac 417
           || ||  | ||||| || || ||||||||| |||||||||| |||||||| || ||||||
Sbjct: 407 aaactattgatccaaaatcaagatgagatgctcaaggctggtaggctctcagaaccatac 466

                                                                       
Query: 418 aagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggctcattgtgg 477
           ||||| ||||| || || |||||  | || || ||||||||||| ||||| || || |||
Sbjct: 467 aagggaattggcgaatgttttgggaggacaattaaggaagaaggttttgggtctttatgg 526

                                                                       
Query: 478 agaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgcattc 537
           |||||||| ||||| || || |||||||| ||||| ||||||||  ||||||||||||||
Sbjct: 527 agaggaaacactgctaatgttatccgttatttccccactcaggccctgaactttgcattc 586

               
Query: 538 aagg 541
           ||||
Sbjct: 587 aagg 590



to top

>gb|DQ284491.1| Solanum tuberosum clone 046C04 ADP,ATP carrier protein
           precursor-like mRNA, complete cds
          Length = 1306

 Score =  151 bits (76), Expect = 3e-33
 Identities = 202/244 (82%)
 Strand = Plus / Plus

                                                                       
Query: 298 ctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgtgtt 357
           |||||||| ||||| |||||||| || || ||||| ||||| || || ||||||||||| 
Sbjct: 338 ctcatgggtggagtttctgctgctgtatcaaagaccgctgctgcccctattgagcgtgtg 397

                                                                       
Query: 358 aagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgagccatac 417
           || ||  | ||||| || || ||||||||| |||||||||| |||||||| || ||||||
Sbjct: 398 aaactattgatccaaaatcaagatgagatgctcaaggctggtaggctctcagaaccatac 457

                                                                       
Query: 418 aagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggctcattgtgg 477
           ||||| ||||| || || |||||  | || || ||||||||||| ||||| || || |||
Sbjct: 458 aagggaattggcgaatgttttgggaggacaattaaggaagaaggttttgggtctttatgg 517

                                                                       
Query: 478 agaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgcattc 537
           |||||||| ||||| || || |||||||| ||||| ||||||||  ||||||||||||||
Sbjct: 518 agaggaaacactgctaatgttatccgttatttccccactcaggccctgaactttgcattc 577

               
Query: 538 aagg 541
           ||||
Sbjct: 578 aagg 581



to top

>gb|DQ252510.1| Solanum tuberosum clone 087B08 ADP,ATP carrier protein
           precursor-like mRNA, complete cds
          Length = 1524

 Score =  151 bits (76), Expect = 3e-33
 Identities = 202/244 (82%)
 Strand = Plus / Plus

                                                                       
Query: 298 ctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgtgtt 357
           |||||||| ||||| |||||||| || || ||||| ||||| || || ||||||||||| 
Sbjct: 334 ctcatgggtggagtttctgctgctgtatcaaagaccgctgctgcccctattgagcgtgtg 393

                                                                       
Query: 358 aagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgagccatac 417
           || ||  | ||||| || || ||||||||| |||||||||| |||||||| || ||||||
Sbjct: 394 aaactattgatccaaaatcaagatgagatgctcaaggctggtaggctctcagaaccatac 453

                                                                       
Query: 418 aagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggctcattgtgg 477
           ||||| ||||| || || |||||  | || || ||||||||||| ||||| || || |||
Sbjct: 454 aagggaattggcgaatgttttgggaggacaattaaggaagaaggttttgggtctttatgg 513

                                                                       
Query: 478 agaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgcattc 537
           |||||||| ||||| || || |||||||| ||||| ||||||||  ||||||||||||||
Sbjct: 514 agaggaaacactgctaatgttatccgttatttccccactcaggccctgaactttgcattc 573

               
Query: 538 aagg 541
           ||||
Sbjct: 574 aagg 577



to top

>dbj|D10430.1|RICT125 Oryza sativa mRNA for adenine nucleotide translocator (T125 gene),
           partial sequence
          Length = 404

 Score =  149 bits (75), Expect = 1e-32
 Identities = 132/151 (87%)
 Strand = Plus / Plus

                                                                       
Query: 58  gctaaccacccgtctgtcatgcagaagttcggtgggcagttccacctcagctccagcttc 117
           ||||| || ||| ||||| | |||||||||||||| |||||||||||  |||||||||| 
Sbjct: 124 gctaatcaaccgactgtccttcagaagttcggtggccagttccaccttggctccagcttt 183

                                                                       
Query: 118 tctgagggtgtacgagctcgcaacatctgcccttctgtgccatcctatgagaggcgcttc 177
           ||||| |||||||| ||||||||||||||||| |||||  |||||||||| |||||||| 
Sbjct: 184 tctgaaggtgtacgggctcgcaacatctgcccatctgtctcatcctatgacaggcgcttt 243

                                          
Query: 178 accacaagcagctacatgactcagagccttg 208
           |||||||| ||||||||||| ||| ||||||
Sbjct: 244 accacaaggagctacatgacccagggccttg 274



to top

>gb|BT016455.1| Zea mays clone Contig288 mRNA sequence
          Length = 1550

 Score =  147 bits (74), Expect = 4e-32
 Identities = 182/218 (83%)
 Strand = Plus / Plus

                                                                       
Query: 316 gctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatccagaac 375
           ||||| ||||| |||||||| || ||||||||||| || || ||||||||||| ||||| 
Sbjct: 384 gctgctgtttcgaagactgcagctgctcccattgaacgagtgaagctgcttattcagaat 443

                                                                       
Query: 376 caggatgagatgatcaaggctggcaggctctctgagccatacaagggtattggtgactgc 435
           |||||||||||||||||| |||| ||||| || ||||| ||||||||||||| ||| |||
Sbjct: 444 caggatgagatgatcaagtctggtaggctatcagagccgtacaagggtattgctgattgc 503

                                                                       
Query: 436 tttggacgcaccatcaaggaagaaggctttggctcattgtggagaggaaatactgccaac 495
           ||   ||| ||||||||||| || || ||    || |||||||| || || ||||| || 
Sbjct: 504 ttcaaacgtaccatcaaggatgagggtttctcttccttgtggaggggtaacactgctaat 563

                                                 
Query: 496 gtcatccgttacttcccaactcaggctttgaactttgc 533
           || || ||||||||||| ||||||||||||||||||||
Sbjct: 564 gttattcgttacttccctactcaggctttgaactttgc 601



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 46  atggcggaccgtgctaaccacccgtctgtcatgcagaagttcggtgggcagttccacctc 105
           ||||||||||  |||||||| ||  ||||| | || ||| | ||||| ||||||||||| 
Sbjct: 93  atggcggaccaggctaaccaacccactgtccttcataagctaggtggccagttccacctg 152

                                                           
Query: 106 agctccagcttctctgagggtgtacgagctcgcaacatctgcccttct 153
           ||||||||||||||||| |||||||| || || |||||||||||||||
Sbjct: 153 agctccagcttctctgaaggtgtacgggcccgtaacatctgcccttct 200



to top

>emb|X59086.1|ZMANT2MU Z.mays MANT2 mRNA for adenine nucleotide translocator (ADP/ATP
           translocase)
          Length = 1511

 Score =  147 bits (74), Expect = 4e-32
 Identities = 182/218 (83%)
 Strand = Plus / Plus

                                                                       
Query: 316 gctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatccagaac 375
           ||||| ||||| |||||||| || ||||||||||| || || ||||||||||| ||||| 
Sbjct: 369 gctgctgtttcgaagactgcagctgctcccattgaacgagtgaagctgcttattcagaat 428

                                                                       
Query: 376 caggatgagatgatcaaggctggcaggctctctgagccatacaagggtattggtgactgc 435
           |||||||||||||||||| |||| ||||| || ||||| ||||||||||||| ||| |||
Sbjct: 429 caggatgagatgatcaagtctggtaggctatcagagccgtacaagggtattgctgattgc 488

                                                                       
Query: 436 tttggacgcaccatcaaggaagaaggctttggctcattgtggagaggaaatactgccaac 495
           ||   ||| ||||||||||| || || ||    || |||||||| || || ||||| || 
Sbjct: 489 ttcaaacgtaccatcaaggatgagggtttctcttccttgtggaggggtaacactgctaat 548

                                                 
Query: 496 gtcatccgttacttcccaactcaggctttgaactttgc 533
           || || ||||||||||| ||||||||||||||||||||
Sbjct: 549 gttattcgttacttccctactcaggctttgaactttgc 586



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 46  atggcggaccgtgctaaccacccgtctgtcatgcagaagttcggtgggcagttccacctc 105
           ||||||||||  |||||||| ||  ||||| | || ||| | ||||| ||||||||||| 
Sbjct: 78  atggcggaccaggctaaccaacccactgtccttcataagctaggtggccagttccacctg 137

                                                           
Query: 106 agctccagcttctctgagggtgtacgagctcgcaacatctgcccttct 153
           ||||||||||||||||| |||||||| || || |||||||||||||||
Sbjct: 138 agctccagcttctctgaaggtgtacgggcccgtaacatctgcccttct 185



to top

>emb|X68592.1|ATANT A.thaliana mRNA for adenosine nucleotide translocator
          Length = 2179

 Score =  145 bits (73), Expect = 2e-31
 Identities = 199/241 (82%)
 Strand = Plus / Plus

                                                                        
Query: 280  aactttgcgatcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgca 339
            |||||||| || |||||| | ||||| || || |||||||| || || ||||||||||| 
Sbjct: 930  aactttgctattgatttcatgatgggtggtgtttctgctgctgtgtcaaagactgctgct 989

                                                                        
Query: 340  gctcccattgagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggc 399
            ||||||||||||||||| |||||  | || || ||||||||||||||| | |||||||| 
Sbjct: 990  gctcccattgagcgtgtcaagcttttgattcaaaaccaggatgagatgcttaaggctgga 1049

                                                                        
Query: 400  aggctctctgagccatacaagggtattggtgactgctttggacgcaccatcaaggaagaa 459
            |||||  |||||||||||||||||||| ||||||| || ||  | || || | ||| |||
Sbjct: 1050 aggcttactgagccatacaagggtattcgtgactgtttcggcaggacaattagggatgaa 1109

                                                                        
Query: 460  ggctttggctcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcag 519
            ||  |||| || |||||||||||||| || || || || |||||||||||||| ||||||
Sbjct: 1110 ggtattggttcgttgtggagaggaaacaccgctaatgttatccgttacttccccactcag 1169

             
Query: 520  g 520
            |
Sbjct: 1170 g 1170



to top

>emb|AL391710.1|ATT6I14 Arabidopsis thaliana DNA chromosome 5, BAC clone T6I14 (ESSA project)
          Length = 90472

 Score =  145 bits (73), Expect = 2e-31
 Identities = 199/241 (82%)
 Strand = Plus / Plus

                                                                         
Query: 280   aactttgcgatcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgca 339
             |||||||| || |||||| | ||||| || || |||||||| || || ||||||||||| 
Sbjct: 18744 aactttgctattgatttcatgatgggtggtgtttctgctgctgtgtcaaagactgctgct 18803

                                                                         
Query: 340   gctcccattgagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggc 399
             ||||||||||||||||| |||||  | || || ||||||||||||||| | |||||||| 
Sbjct: 18804 gctcccattgagcgtgtcaagcttttgattcaaaaccaggatgagatgcttaaggctgga 18863

                                                                         
Query: 400   aggctctctgagccatacaagggtattggtgactgctttggacgcaccatcaaggaagaa 459
             |||||  |||||||||||||||||||| ||||||| || ||  | || || | ||| |||
Sbjct: 18864 aggcttactgagccatacaagggtattcgtgactgtttcggcaggacaattagggatgaa 18923

                                                                         
Query: 460   ggctttggctcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcag 519
             ||  |||| || |||||||||||||| || || || || |||||||||||||| ||||||
Sbjct: 18924 ggtattggttcgttgtggagaggaaacaccgctaatgttatccgttacttccccactcag 18983

              
Query: 520   g 520
             |
Sbjct: 18984 g 18984



to top

>gb|BT013912.1| Lycopersicon esculentum clone 132909F, mRNA sequence
          Length = 1520

 Score =  143 bits (72), Expect = 7e-31
 Identities = 201/244 (82%)
 Strand = Plus / Plus

                                                                       
Query: 298 ctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgtgtt 357
           |||||||| || || |||||||| || || ||||| ||||| || || ||||||||||| 
Sbjct: 360 ctcatgggtggtgtttctgctgctgtatcaaagaccgctgctgcccctattgagcgtgtg 419

                                                                       
Query: 358 aagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgagccatac 417
           || ||  | ||||| || || ||||||||| |||||||||| |||||||| || ||||||
Sbjct: 420 aaactattgatccaaaatcaagatgagatgctcaaggctggtaggctctcagaaccatac 479

                                                                       
Query: 418 aagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggctcattgtgg 477
           ||||| |||||||| || || ||  | || || ||||||||||| ||||| || || |||
Sbjct: 480 aagggaattggtgattgtttcggtaggacaattaaggaagaaggttttgggtctttatgg 539

                                                                       
Query: 478 agaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgcattc 537
           |||||||| ||||| || || |||||||| ||||| ||||||||  ||||||||||||||
Sbjct: 540 agaggaaacactgctaatgttatccgttatttccccactcaggccctgaactttgcattc 599

               
Query: 538 aagg 541
           ||||
Sbjct: 600 aagg 603



to top

>emb|X62123.1|STANTG S.tuberosum ant gene for ADP/ATP translocator
          Length = 1531

 Score =  143 bits (72), Expect = 7e-31
 Identities = 201/244 (82%)
 Strand = Plus / Plus

                                                                       
Query: 298 ctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgtgtt 357
           |||||||| || || |||||||| || || ||||| ||||| || || ||||||||||| 
Sbjct: 336 ctcatgggtggggtttctgctgctgtatcaaagacagctgctgcccctattgagcgtgtg 395

                                                                       
Query: 358 aagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgagccatac 417
           || ||  | ||||| || || ||||||||| |||||||||| |||||||| || ||||||
Sbjct: 396 aaactattgatccaaaatcaagatgagatgctcaaggctgggaggctctcagaaccatac 455

                                                                       
Query: 418 aagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggctcattgtgg 477
           ||||| ||||| || || |||||  | || || ||||||||||| ||||| || || |||
Sbjct: 456 aagggaattggcgaatgttttgggaggacaattaaggaagaaggttttgggtctttatgg 515

                                                                       
Query: 478 agaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgcattc 537
           |||||||| ||||| || || |||||||| ||||| ||||||||  ||||||||||||||
Sbjct: 516 agaggaaacactgctaatgttatccgttatttccccactcaggccctgaactttgcattc 575

               
Query: 538 aagg 541
           ||||
Sbjct: 576 aagg 579



to top

>gb|U89839.1|LEU89839 Lycopersicon esculentum ADP/ATP translocator mRNA, complete cds
          Length = 1613

 Score =  143 bits (72), Expect = 7e-31
 Identities = 201/244 (82%)
 Strand = Plus / Plus

                                                                       
Query: 298 ctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgtgtt 357
           |||||||| || || |||||||| || || ||||| ||||| || || ||||||||||| 
Sbjct: 336 ctcatgggtggtgtttctgctgctgtatcaaagaccgctgctgcccctattgagcgtgtg 395

                                                                       
Query: 358 aagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgagccatac 417
           || ||  | ||||| || || ||||||||| |||||||||| |||||||| || ||||||
Sbjct: 396 aaactattgatccaaaatcaagatgagatgctcaaggctggtaggctctcagaaccatac 455

                                                                       
Query: 418 aagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggctcattgtgg 477
           ||||| |||||||| || || ||  | || || ||||||||||| ||||| || || |||
Sbjct: 456 aagggaattggtgattgtttcggtaggacaattaaggaagaaggttttgggtctttatgg 515

                                                                       
Query: 478 agaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgcattc 537
           |||||||| ||||| || || |||||||| ||||| ||||||||  ||||||||||||||
Sbjct: 516 agaggaaacactgctaatgttatccgttatttccccactcaggccctgaactttgcattc 575

               
Query: 538 aagg 541
           ||||
Sbjct: 576 aagg 579



to top

>gb|BT013745.1| Lycopersicon esculentum clone 132608R, mRNA sequence
          Length = 1533

 Score =  135 bits (68), Expect = 2e-28
 Identities = 200/244 (81%)
 Strand = Plus / Plus

                                                                       
Query: 298 ctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgtgtt 357
           |||||||| ||||| |||||||| || || ||||| ||||| || || ||||||||||| 
Sbjct: 371 ctcatgggtggagtttctgctgctgtatcaaagaccgctgctgcccctattgagcgtgtg 430

                                                                       
Query: 358 aagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgagccatac 417
           || ||  | ||||| || || ||||||||| |||||||||| ||||| || || ||||||
Sbjct: 431 aaactattgatccaaaatcaagatgagatgctcaaggctggtaggctgtcagaaccatac 490

                                                                       
Query: 418 aagggtattggtgactgctttggacgcaccatcaaggaagaaggctttggctcattgtgg 477
           ||||| ||||| || || || ||  | || || ||||||||||| ||||| || || |||
Sbjct: 491 aagggaattggcgattgtttcgggaggacaattaaggaagaaggttttgggtctttatgg 550

                                                                       
Query: 478 agaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgcattc 537
           |||||||| ||||| || || |||||||| ||||| ||||||||  ||||||||||||||
Sbjct: 551 agaggaaacactgctaatgttatccgttatttccccactcaggccctgaactttgcattc 610

               
Query: 538 aagg 541
           ||||
Sbjct: 611 aagg 614



to top

>dbj|AK103615.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033133K22, full
           insert sequence
          Length = 1559

 Score =  135 bits (68), Expect = 2e-28
 Identities = 199/240 (82%), Gaps = 2/240 (0%)
 Strand = Plus / Plus

                                                                       
Query: 301 atgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgtgttaag 360
           ||||| ||||| || ||||| || |||||||||||||| ||||||||||||||  | |||
Sbjct: 394 atgggtggagtttcagctgctgtctccaagactgctgctgctcccattgagcgaatcaag 453

                                                                       
Query: 361 ctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgagccatacaag 420
           || || || || ||||||||||| |||||||||  ||| ||||||||| | |||||||| 
Sbjct: 454 cttctcattcaaaaccaggatgaaatgatcaagagtggtaggctctctcacccatacaaa 513

                                                                       
Query: 421 ggtattggtgactgctttggacgcaccatcaaggaagaaggctttggct-cattgtggag 479
           |||||||  ||||||||||| ||||| || ||||| ||||| | ||  | || |||||||
Sbjct: 514 ggtattgcggactgctttggccgcacaattaaggatgaagg-tgtgattgcactgtggag 572

                                                                       
Query: 480 aggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaa 539
           ||| || ||||| || |||||||||||||| || || ||||| ||||||||||| |||||
Sbjct: 573 agggaacactgctaatgtcatccgttactttcctacccaggccttgaactttgccttcaa 632



to top

>dbj|AK103134.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033120D07, full
           insert sequence
          Length = 1606

 Score =  135 bits (68), Expect = 2e-28
 Identities = 199/240 (82%), Gaps = 2/240 (0%)
 Strand = Plus / Plus

                                                                       
Query: 301 atgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgtgttaag 360
           ||||| ||||| || ||||| || |||||||||||||| ||||||||||||||  | |||
Sbjct: 390 atgggtggagtttcagctgctgtctccaagactgctgctgctcccattgagcgaatcaag 449

                                                                       
Query: 361 ctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgagccatacaag 420
           || || || || ||||||||||| |||||||||  ||| ||||||||| | |||||||| 
Sbjct: 450 cttctcattcaaaaccaggatgaaatgatcaagagtggtaggctctctcacccatacaaa 509

                                                                       
Query: 421 ggtattggtgactgctttggacgcaccatcaaggaagaaggctttggct-cattgtggag 479
           |||||||  ||||||||||| ||||| || ||||| ||||| | ||  | || |||||||
Sbjct: 510 ggtattgcggactgctttggccgcacaattaaggatgaagg-tgtgattgcactgtggag 568

                                                                       
Query: 480 aggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaa 539
           ||| || ||||| || |||||||||||||| || || ||||| ||||||||||| |||||
Sbjct: 569 agggaacactgctaatgtcatccgttactttcctacccaggccttgaactttgccttcaa 628



to top

>dbj|AK061642.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-036-B04, full
           insert sequence
          Length = 1568

 Score =  135 bits (68), Expect = 2e-28
 Identities = 199/240 (82%), Gaps = 2/240 (0%)
 Strand = Plus / Plus

                                                                       
Query: 301 atgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgtgttaag 360
           ||||| ||||| || ||||| || |||||||||||||| ||||||||||||||  | |||
Sbjct: 387 atgggtggagtttcagctgctgtctccaagactgctgctgctcccattgagcgaatcaag 446

                                                                       
Query: 361 ctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgagccatacaag 420
           || || || || ||||||||||| |||||||||  ||| ||||||||| | |||||||| 
Sbjct: 447 cttctcattcaaaaccaggatgaaatgatcaagagtggtaggctctctcacccatacaaa 506

                                                                       
Query: 421 ggtattggtgactgctttggacgcaccatcaaggaagaaggctttggct-cattgtggag 479
           |||||||  ||||||||||| ||||| || ||||| ||||| | ||  | || |||||||
Sbjct: 507 ggtattgcggactgctttggccgcacaattaaggatgaagg-tgtgattgcactgtggag 565

                                                                       
Query: 480 aggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaa 539
           ||| || ||||| || |||||||||||||| || || ||||| ||||||||||| |||||
Sbjct: 566 agggaacactgctaatgtcatccgttactttcctacccaggccttgaactttgccttcaa 625



to top

>emb|X15711.1|ZMANTG1 Maize gene for mitochondrial adenine nucleotide translocator
           (ANT-G1)
          Length = 2056

 Score =  133 bits (67), Expect = 7e-28
 Identities = 208/255 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 agaaaggcgccaagaactttgcgatcgatttcctcatgggaggagtgtctgctgcagttt 325
           ||||||| | |||||||||   ||| |||||| | ||||| || || || ||||| ||||
Sbjct: 703 agaaaggtggcaagaacttcatgattgatttcatgatgggcggtgtttcagctgctgttt 762

                                                                       
Query: 326 ccaagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgaga 385
           |  |||||||||| |||||||| |||||||| ||||||||||| |||||||| |||||||
Sbjct: 763 cggagactgctgctgctcccatcgagcgtgtgaagctgcttattcagaaccaagatgaga 822

                                                                       
Query: 386 tgatcaaggctggcaggctctctgagccatacaagggtattggtgactgctttggacgca 445
           |||| ||| |||| ||||| || ||||| ||||||||||||| |||||||||   ||| |
Sbjct: 823 tgattaagtctggtaggctatcagagccgtacaagggtattgttgactgcttcaaacgta 882

                                                                       
Query: 446 ccatcaaggaagaaggctttggctcattgtggagaggaaatactgccaacgtcatccgtt 505
           |||| ||||| ||||| ||    || |||||||| || || ||||| || || || ||||
Sbjct: 883 ccattaaggatgaaggtttctcttccttgtggaggggtaacactgctaatgttattcgtt 942

                          
Query: 506 acttcccaactcagg 520
           ||||||| |||||||
Sbjct: 943 acttccctactcagg 957



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 46  atggcggaccgtgctaaccacccgtctgtcatgcagaagttcggtgggcagttccacctc 105
           ||||||||||  |||||||| ||  ||||| | || ||| ||||||| ||||||||||| 
Sbjct: 462 atggcggaccaggctaaccaacccactgtccttcataagctcggtggccagttccacctg 521

                                                                       
Query: 106 agctccagcttctctgagggtgtacgagctcgcaacatctgcccttctgtgccatcctat 165
            |||| | | ||||||| |||||||| || || ||||| ||||| |||||  |||| |||
Sbjct: 522 cgctcgatcatctctgaaggtgtacgggcccgtaacatatgcccatctgtctcatcttat 581

                                                     
Query: 166 gagaggcgcttcaccacaagcagctacatgactcagagcctt 207
           || ||| | ||  ||||||| | ||||||||| |||||||||
Sbjct: 582 gaaaggagatttgccacaaggaactacatgacccagagcctt 623



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 517  caggctttgaactttgcattcaagg 541
            |||||||||||||||||||| ||||
Sbjct: 1128 caggctttgaactttgcatttaagg 1152



to top

>emb|X15712.1|ZMANTG2 Maize ANT-G2 gene for adenine nucleotide translocator
          Length = 2098

 Score =  129 bits (65), Expect = 1e-26
 Identities = 170/205 (82%)
 Strand = Plus / Plus

                                                                        
Query: 316  gctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatccagaac 375
            ||||| ||||| ||||||||||||||||||||||| || || ||||||||||| ||||| 
Sbjct: 862  gctgctgtttcgaagactgctgcagctcccattgaacgagtgaagctgcttattcagaat 921

                                                                        
Query: 376  caggatgagatgatcaaggctggcaggctctctgagccatacaagggtattggtgactgc 435
            || ||||||||||||||| |||| ||||| || ||||| ||||||||||||| ||| |||
Sbjct: 922  caagatgagatgatcaagtctggtaggctatcagagccgtacaagggtattgctgattgc 981

                                                                        
Query: 436  tttggacgcaccatcaaggaagaaggctttggctcattgtggagaggaaatactgccaac 495
            ||   ||| ||||||||||| || || ||    || |||||||| || || ||||| || 
Sbjct: 982  ttcaaacgtaccatcaaggatgagggtttctcttccttgtggaggggtaacactgctaat 1041

                                     
Query: 496  gtcatccgttacttcccaactcagg 520
            || || ||||||||||| |||||||
Sbjct: 1042 gttattcgttacttccctactcagg 1066



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 46  atggcggaccgtgctaaccacccgtctgtcatgcagaagttcggtgggcagttccacctc 105
           ||||||||||  |||||||| ||  ||||| | || ||| | ||||| ||||||||||| 
Sbjct: 571 atggcggaccaggctaaccaacccactgtccttcataagctaggtggccagttccacctg 630

                                                           
Query: 106 agctccagcttctctgagggtgtacgagctcgcaacatctgcccttct 153
           ||||||||||||||||| |||||||| || || |||||||||||||||
Sbjct: 631 agctccagcttctctgaaggtgtacgggcccgtaacatctgcccttct 678



to top

>emb|AJ003197.1|LAAJ3197 Lupinus albus mRNA for adenine nucleotide translocator
          Length = 1606

 Score =  125 bits (63), Expect = 2e-25
 Identities = 123/143 (86%)
 Strand = Plus / Plus

                                                                       
Query: 289 atcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccatt 348
           ||||| || |||||||| ||||| || ||||| || || || |||||||| |||||||||
Sbjct: 418 atcgactttctcatgggtggagtttcagctgctgtgtctaaaactgctgctgctcccatt 477

                                                                       
Query: 349 gagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctct 408
           || |||||||| ||  | ||||||||||||||||||||||||||| |||| || || |||
Sbjct: 478 gaacgtgttaaacttttgatccagaaccaggatgagatgatcaagtctggtagactttct 537

                                  
Query: 409 gagccatacaagggtattggtga 431
           ||||||||||||||||| |||||
Sbjct: 538 gagccatacaagggtatcggtga 560



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 487 actgccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||| |||||||| ||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 616 actgctaacgtcattcgttatttccctactcaggctttgaactttgcattcaagg 670



to top

>gb|AC098572.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone
             OJ1234_D05, complete sequence
          Length = 107476

 Score =  115 bits (58), Expect = 2e-22
 Identities = 174/210 (82%), Gaps = 2/210 (0%)
 Strand = Plus / Minus

                                                                         
Query: 301   atgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgtgttaag 360
             ||||| ||||| || ||||| || |||||||||||||| ||||||||||||||  | |||
Sbjct: 22678 atgggtggagtttcagctgctgtctccaagactgctgctgctcccattgagcgaatcaag 22619

                                                                         
Query: 361   ctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgagccatacaag 420
             || || || || ||||||||||| |||||||||  ||| ||||||||| | |||||||| 
Sbjct: 22618 cttctcattcaaaaccaggatgaaatgatcaagagtggtaggctctctcacccatacaaa 22559

                                                                         
Query: 421   ggtattggtgactgctttggacgcaccatcaaggaagaaggctttggct-cattgtggag 479
             |||||||  ||||||||||| ||||| || ||||| ||||| | ||  | || |||||||
Sbjct: 22558 ggtattgcggactgctttggccgcacaattaaggatgaagg-tgtgattgcactgtggag 22500

                                           
Query: 480   aggaaatactgccaacgtcatccgttactt 509
             ||| || ||||| || ||||||||||||||
Sbjct: 22499 agggaacactgctaatgtcatccgttactt 22470



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  115 bits (58), Expect = 2e-22
 Identities = 174/210 (82%), Gaps = 2/210 (0%)
 Strand = Plus / Minus

                                                                            
Query: 301      atgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgtgttaag 360
                ||||| ||||| || ||||| || |||||||||||||| ||||||||||||||  | |||
Sbjct: 13478632 atgggtggagtttcagctgctgtctccaagactgctgctgctcccattgagcgaatcaag 13478573

                                                                            
Query: 361      ctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgagccatacaag 420
                || || || || ||||||||||| |||||||||  ||| ||||||||| | |||||||| 
Sbjct: 13478572 cttctcattcaaaaccaggatgaaatgatcaagagtggtaggctctctcacccatacaaa 13478513

                                                                            
Query: 421      ggtattggtgactgctttggacgcaccatcaaggaagaaggctttggct-cattgtggag 479
                |||||||  ||||||||||| ||||| || ||||| ||||| | ||  | || |||||||
Sbjct: 13478512 ggtattgcggactgctttggccgcacaattaaggatgaagg-tgtgattgcactgtggag 13478454

                                              
Query: 480      aggaaatactgccaacgtcatccgttactt 509
                ||| || ||||| || ||||||||||||||
Sbjct: 13478453 agggaacactgctaatgtcatccgttactt 13478424



to top

>emb|X65194.1|CRANT C.reinhardtii mRNA CRANT for mitochondrial ADP/ATP translocator
           protein
          Length = 1584

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 73/81 (90%)
 Strand = Plus / Plus

                                                                       
Query: 313 tctgctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatccag 372
           |||||||| || |||||||| ||||| || || ||||||||||| |||||||| ||||||
Sbjct: 309 tctgctgccgtgtccaagacagctgccgcgcctattgagcgtgtgaagctgctgatccag 368

                                
Query: 373 aaccaggatgagatgatcaag 393
           |||||||||||||||||||||
Sbjct: 369 aaccaggatgagatgatcaag 389



to top

>gb|AC182652.2| Populus trichocarpa clone Pop1-120B14, complete sequence
          Length = 103155

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 135/164 (82%)
 Strand = Plus / Plus

                                                                        
Query: 292  gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
            ||||| ||||||||||||||||| ||||| ||||| ||||| ||||| ||||| ||||||
Sbjct: 6581 gattttctcatgggaggagtgtcagctgctgtttcaaagacagctgctgctccaattgag 6640

                                                                        
Query: 352  cgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgag 411
            || ||||| ||  | || || || |||||||| ||||||||||||||  |  | ||||| 
Sbjct: 6641 cgggttaaactcttgattcaaaatcaggatgaaatgatcaaggctggtcgattatctgaa 6700

                                                        
Query: 412  ccatacaagggtattggtgactgctttggacgcaccatcaagga 455
            ||||||||||||||   |||||||||||   | |||||||||||
Sbjct: 6701 ccatacaagggtatcactgactgctttgccagaaccatcaagga 6744



to top

>gb|DQ122872.1| Chlamydomonas incerta mitochondrial ADP/ATP translocator (ANT)
           mRNA, complete cds; nuclear gene for mitochondrial
           product
          Length = 1598

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 74/83 (89%)
 Strand = Plus / Plus

                                                                       
Query: 311 tgtctgctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatcc 370
           |||| ||||| || |||||||| ||||| ||||| |||||||| || |||||||| ||||
Sbjct: 140 tgtccgctgccgtgtccaagacggctgccgctcctattgagcgcgtgaagctgctgatcc 199

                                  
Query: 371 agaaccaggatgagatgatcaag 393
           |||||||||||||||||||||||
Sbjct: 200 agaaccaggatgagatgatcaag 222



to top

>dbj|AB190778.1| Mesembryanthemum crystallinum ANT2 mRNA for putative mitochondrial
           adenylate transporter, complete cds
          Length = 1695

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 72/80 (90%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 472 ttgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaacttt 531
           |||||||||||||| ||||| || ||||||||||||||||| |||||||| |||||||||
Sbjct: 607 ttgtggagaggaaacactgctaatgtcatccgttacttccctactcaggccttgaacttt 666

                               
Query: 532 gcattcaagggattacttca 551
           || || || |||||||||||
Sbjct: 667 gcctttaa-ggattacttca 685



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 130/159 (81%)
 Strand = Plus / Plus

                                                                       
Query: 276 caagaactttgcgatcgatttcctcatgggaggagtgtctgctgcagtttccaagactgc 335
           ||||| |||||| || |||||| | ||||||||||| |||||||| || |||||||||||
Sbjct: 411 caagacctttgcaattgatttcatgatgggaggagtttctgctgctgtctccaagactgc 470

                                                                       
Query: 336 tgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggc 395
            || ||||| ||||| ||||| |||||  | || |||||||| ||||| ||| |||    
Sbjct: 471 cgctgctcctattgaacgtgtgaagcttttgattcagaaccaagatgaaatgctcagaag 530

                                                  
Query: 396 tggcaggctctctgagccatacaagggtattggtgactg 434
           |||| | |||||||| || |||||||| |||||||||||
Sbjct: 531 tggccgtctctctgaaccctacaagggcattggtgactg 569



to top

>ref|XM_386197.1| Gibberella zeae PH-1 chromosome 3 ADT_NEUCR ADP,ATP CARRIER PROTEIN
           (ADP/ATP TRANSLOCASE) (ADENINE NUCLEOTIDE TRANSLOCATOR)
           (ANT) (FG06021.1) partial mRNA
          Length = 936

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 85/99 (85%)
 Strand = Plus / Plus

                                                                       
Query: 295 ttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgt 354
           ||||||||||| || || || || || || |||||||||||||| || ||||| ||||||
Sbjct: 55  ttcctcatgggtggtgtctccgccgctgtctccaagactgctgctgcccccatcgagcgt 114

                                                  
Query: 355 gttaagctgcttatccagaaccaggatgagatgatcaag 393
           || ||||| || ||||||||||||||||||||| |||||
Sbjct: 115 gtcaagctcctcatccagaaccaggatgagatgctcaag 153



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 479 gaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactt 530
           ||||||| || |||||||||||||| |||||||| || |||||| |||||||
Sbjct: 239 gaggaaacaccgccaacgtcatccgatacttccctacccaggctctgaactt 290



to top

>ref|XM_656576.1| Aspergillus nidulans FGSC A4 ADP/ATP carrier protein (AN4064.2),
           mRNA
          Length = 936

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 290 tcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattg 349
           |||| ||||| ||||| || || || ||||| || |||||||||||||| || ||||| |
Sbjct: 50  tcgacttcctgatgggtggtgtttccgctgccgtctccaagactgctgctgcccccatcg 109

                                                 
Query: 350 agcgtgttaagctgcttatccagaaccaggatgagatg 387
           ||||||||||||| || ||||||| |||||||||||||
Sbjct: 110 agcgtgttaagctcctcatccagacccaggatgagatg 147



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactt 530
           |||||||| || |||||||||||||||||||||||||| ||||||||  |||||||
Sbjct: 235 tggagaggtaacactgccaacgtcatccgttacttccctactcaggccctgaactt 290



to top

>ref|XM_751973.1| Ustilago maydis 521 hypothetical protein (UM00919.1) partial mRNA
          Length = 954

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 87/102 (85%)
 Strand = Plus / Plus

                                                                       
Query: 292 gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
           |||||||||||||| || || || || || || |||||||| ||||| || ||||| |||
Sbjct: 58  gatttcctcatgggtggtgtttccgccgccgtctccaagacggctgccgcccccatcgag 117

                                                     
Query: 352 cgtgttaagctgcttatccagaaccaggatgagatgatcaag 393
           ||||| ||||| || |||||||||||||| ||||||||||||
Sbjct: 118 cgtgtcaagcttctcatccagaaccaggacgagatgatcaag 159



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 493 aacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| ||||||||||| ||||||||| | ||||| || |||||||
Sbjct: 259 aacgtcattcgttacttccccactcaggctcttaacttcgccttcaagg 307



to top

>ref|XM_502564.1| Yarrowia lipolytica CLIB122, YALI0D08228g predicted mRNA
          Length = 918

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 60/66 (90%)
 Strand = Plus / Plus

                                                                       
Query: 328 aagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgagatg 387
           ||||||||||| |||||||||||||| || ||||| || |||||||||||||| ||||||
Sbjct: 64  aagactgctgccgctcccattgagcgagtcaagctcctgatccagaaccaggaggagatg 123

                 
Query: 388 atcaag 393
           ||||||
Sbjct: 124 atcaag 129



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 493 aacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||||||||| |||||||| || |||||| | ||||| || |||||||
Sbjct: 229 aacgtcatccgatacttccctacccaggctcttaacttcgccttcaagg 277



to top

>ref|XM_505633.1| Yarrowia lipolytica CLIB122, YALI0F19712g predicted mRNA
          Length = 939

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 87/102 (85%)
 Strand = Plus / Plus

                                                                       
Query: 292 gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
           ||||||||||||||||| |||||||| || || || ||||| || || |||||||| |||
Sbjct: 37  gatttcctcatgggaggtgtgtctgccgccgtgtctaagaccgccgccgctcccatcgag 96

                                                     
Query: 352 cgtgttaagctgcttatccagaaccaggatgagatgatcaag 393
           || || ||||||||  |||| |||||||| ||||||||||||
Sbjct: 97  cgagtcaagctgctgctccaaaaccaggaggagatgatcaag 138



to top

>gb|AF237675.1| Yarrowia lipolytica ADP/ATP carrier protein mRNA, complete cds;
           nuclear gene for mitochondrial product
          Length = 961

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 60/66 (90%)
 Strand = Plus / Plus

                                                                       
Query: 328 aagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgagatg 387
           ||||||||||| |||||||||||||| || ||||| || |||||||||||||| ||||||
Sbjct: 82  aagactgctgccgctcccattgagcgagtcaagctcctgatccagaaccaggaggagatg 141

                 
Query: 388 atcaag 393
           ||||||
Sbjct: 142 atcaag 147



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 493 aacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||||||||| |||||||| || |||||| | ||||| || |||||||
Sbjct: 247 aacgtcatccgatacttccctacccaggctcttaacttcgccttcaagg 295



to top

>gb|AY183458.2| Yarrowia lipolytica mitochondrial ADP/ATP carrier protein (AAC3)
           gene, complete cds; nuclear gene for mitochondrial
           product
          Length = 1871

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 87/102 (85%)
 Strand = Plus / Plus

                                                                       
Query: 292 gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
           ||||||||||||||||| |||||||| || || || ||||| || || |||||||| |||
Sbjct: 769 gatttcctcatgggaggtgtgtctgccgccgtgtctaagaccgccgccgctcccatcgag 828

                                                     
Query: 352 cgtgttaagctgcttatccagaaccaggatgagatgatcaag 393
           || || ||||||||  |||| |||||||| ||||||||||||
Sbjct: 829 cgagtcaagctgctgctccaaaaccaggaggagatgatcaag 870



to top

>gb|AY186609.1| Yarrowia lipolytica ADP/ATP carrier protein (AAC1) gene, complete
           cds; nuclear gene for mitochondrial product
          Length = 953

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 60/66 (90%)
 Strand = Plus / Plus

                                                                       
Query: 328 aagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgagatg 387
           ||||||||||| |||||||||||||| || ||||| || |||||||||||||| ||||||
Sbjct: 77  aagactgctgccgctcccattgagcgagtcaagctcctgatccagaaccaggaggagatg 136

                 
Query: 388 atcaag 393
           ||||||
Sbjct: 137 atcaag 142



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 493 aacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||||||||| |||||||| || |||||| | ||||| || |||||||
Sbjct: 242 aacgtcatccgatacttccctacccaggctcttaacttcgccttcaagg 290



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                           
Query: 292     gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
               ||||||||||||||||| |||||||| || || || ||||| || || |||||||| |||
Sbjct: 2622358 gatttcctcatgggaggtgtgtctgccgccgtgtctaagaccgccgccgctcccatcgag 2622299

                                                         
Query: 352     cgtgttaagctgcttatccagaaccaggatgagatgatcaag 393
               || || ||||||||  |||| |||||||| ||||||||||||
Sbjct: 2622298 cgagtcaagctgctgctccaaaaccaggaggagatgatcaag 2622257



to top

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 60/66 (90%)
 Strand = Plus / Minus

                                                                           
Query: 328     aagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgagatg 387
               ||||||||||| |||||||||||||| || ||||| || |||||||||||||| ||||||
Sbjct: 1053272 aagactgctgccgctcccattgagcgagtcaagctcctgatccagaaccaggaggagatg 1053213

                     
Query: 388     atcaag 393
               ||||||
Sbjct: 1053212 atcaag 1053207



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                                
Query: 493     aacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
               ||||||||||| |||||||| || |||||| | ||||| || |||||||
Sbjct: 1053107 aacgtcatccgatacttccctacccaggctcttaacttcgccttcaagg 1053059



to top

>dbj|AB236784.1| Trifolium pratense RNA for putative ADP,ATP carrier-like protein,
           complete cds, clone: C1802
          Length = 1367

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 115/140 (82%)
 Strand = Plus / Plus

                                                                       
Query: 292 gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
           ||||| || |||||||||||||||||||| || || ||||| || || || || ||||| 
Sbjct: 236 gattttctgatgggaggagtgtctgctgctgtgtcaaagacagccgctgcgcctattgaa 295

                                                                       
Query: 352 cgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgag 411
           || |||||  | |||||||| ||||||||||| ||| ||||   ||||||| | ||||||
Sbjct: 296 cgagttaaattacttatccaaaaccaggatgaaatgctcaaaagtggcaggttatctgag 355

                               
Query: 412 ccatacaagggtattggtga 431
           ||||| ||||| ||||||||
Sbjct: 356 ccatataagggaattggtga 375



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 67/79 (84%), Gaps = 1/79 (1%)
 Strand = Plus / Plus

                                                                       
Query: 473 tgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttg 532
           |||||||||| |||||||| || || ||  | || ||||| ||||||||| |||||||||
Sbjct: 417 tgtggagaggcaatactgctaatgttattagatatttccctactcaggctctgaactttg 476

                              
Query: 533 cattcaagggattacttca 551
           |||| || |||||||||||
Sbjct: 477 catttaa-ggattacttca 494



to top

>dbj|AB236742.1| Trifolium pratense RNA for putative ADP ATP carrier protein,
           complete cds, clone: C139
          Length = 1373

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 115/140 (82%)
 Strand = Plus / Plus

                                                                       
Query: 292 gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
           ||||| || |||||||| ||||||||||| || || ||||| || || ||||| ||||| 
Sbjct: 242 gattttctgatgggaggcgtgtctgctgctgtatcaaagacagccgctgctcctattgaa 301

                                                                       
Query: 352 cgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctctgag 411
           || |||||  | |||||||| ||||||||||| ||| ||||   ||||||| | ||||||
Sbjct: 302 cgagttaaattacttatccaaaaccaggatgaaatgctcaaaagtggcaggttatctgag 361

                               
Query: 412 ccatacaagggtattggtga 431
           ||||| ||||| ||||||||
Sbjct: 362 ccatataagggaattggtga 381



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 68/79 (86%), Gaps = 1/79 (1%)
 Strand = Plus / Plus

                                                                       
Query: 473 tgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttg 532
           |||||||||| |||||||| || || ||| | || ||||| ||||||||| |||||||||
Sbjct: 423 tgtggagaggcaatactgctaatgttatcagatatttccctactcaggctctgaactttg 482

                              
Query: 533 cattcaagggattacttca 551
           |||| || |||||||||||
Sbjct: 483 catttaa-ggattacttca 500



to top

>ref|XM_958108.1| Neurospora crassa OR74A ADP,ATP CARRIER PROTEIN (ADP/ATP
           TRANSLOCASE) (ADENINE NUCLEOTIDE TRANSLOCATOR) (ANT)
           (NCU09477.1) partial mRNA
          Length = 942

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Plus

                                                                       
Query: 328 aagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgagatg 387
           ||||||||||| ||||||||||||||| | ||||| ||  ||||||||||||||||||||
Sbjct: 82  aagactgctgccgctcccattgagcgtatcaagctcctcgtccagaaccaggatgagatg 141

              
Query: 388 atc 390
           |||
Sbjct: 142 atc 144



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactt 530
           ||||||||||||||||||||||| || |||||  |||||||
Sbjct: 244 gccaacgtcatccgttacttccctacccaggccctgaactt 284



to top

>ref|XM_329835.1| Neurospora crassa OR74A ADP,ATP CARRIER PROTEIN (ADP/ATP
           TRANSLOCASE) (ADENINE NUCLEOTIDE TRANSLOCATOR) (ANT)
           (NCU09477.1) partial mRNA
          Length = 942

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Plus

                                                                       
Query: 328 aagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgagatg 387
           ||||||||||| ||||||||||||||| | ||||| ||  ||||||||||||||||||||
Sbjct: 82  aagactgctgccgctcccattgagcgtatcaagctcctcgtccagaaccaggatgagatg 141

              
Query: 388 atc 390
           |||
Sbjct: 142 atc 144



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactt 530
           ||||||||||||||||||||||| || |||||  |||||||
Sbjct: 244 gccaacgtcatccgttacttccctacccaggccctgaactt 284



to top

>ref|XM_745195.1| Aspergillus fumigatus Af293 mitochondrial ADP,ATP carrier protein
           Ant (Afu1g05390) partial mRNA
          Length = 927

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                       
Query: 316 gctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatccagaac 375
           ||||| || |||||||||||||| || ||||| |||||| | ||||| ||| ||||||||
Sbjct: 55  gctgccgtctccaagactgctgctgcccccatcgagcgtatcaagctccttgtccagaac 114

                          
Query: 376 caggatgagatgatc 390
           |||||||||||||||
Sbjct: 115 caggatgagatgatc 129



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactt 530
           ||||||||||||||||||||||| || |||||| |||||||
Sbjct: 229 gccaacgtcatccgttacttccctacccaggctctgaactt 269



to top

>emb|AJ277099.1|CUT277099 Candida utilis anc gene for mitochondrial ADP/ATP carrier, isoform
           2
          Length = 1940

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 60/67 (89%)
 Strand = Plus / Plus

                                                                       
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
           |||||||| || || |||||||| ||||||||||||||||| || |||||||||||||| 
Sbjct: 320 tggagaggtaacaccgccaacgttatccgttacttcccaacccaagctttgaactttgct 379

                  
Query: 535 ttcaagg 541
           |||||||
Sbjct: 380 ttcaagg 386



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                       
Query: 328 aagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgagatg 387
           ||||| ||||| ||||| ||||||||||| ||| || | ||||| ||||| |||||||||
Sbjct: 173 aagaccgctgctgctccaattgagcgtgtcaagttgttgatccaaaaccaagatgagatg 232

                 
Query: 388 atcaag 393
           ||||||
Sbjct: 233 atcaag 238



to top

>emb|AJ277098.1|CUT277098 Candida utilis anc gene for mitochondrial ADP/ATP carrier, isoform
           1
          Length = 2194

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 60/67 (89%)
 Strand = Plus / Plus

                                                                       
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
           |||||||| || || |||||||| ||||||||||||||||| || |||||||||||||| 
Sbjct: 436 tggagaggtaacaccgccaacgttatccgttacttcccaacccaagctttgaactttgct 495

                  
Query: 535 ttcaagg 541
           |||||||
Sbjct: 496 ttcaagg 502



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 328 aagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgagatg 387
           ||||| ||||| ||||| ||||||||||| ||| || | ||||| |||||||||||||||
Sbjct: 289 aagaccgctgctgctccaattgagcgtgtcaagttgttgatccaaaaccaggatgagatg 348

                 
Query: 388 atcaag 393
           ||||||
Sbjct: 349 atcaag 354



to top

>gb|AY145013.1| Saccharomyces kluyveri clone P2140+P2205 PET9 gene, complete cds
          Length = 915

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 60/67 (89%)
 Strand = Plus / Plus

                                                                       
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
           |||||||| || ||||| ||||| ||||||||||||||||| || |||||||||||||| 
Sbjct: 217 tggagaggtaacactgctaacgttatccgttacttcccaacccaagctttgaactttgcc 276

                  
Query: 535 ttcaagg 541
           |||||||
Sbjct: 277 ttcaagg 283



to top

>emb|AJ132535.1|PAB132535 Picea abies mRNA for ADP, ATP carrier protein precursor, partial
          Length = 1036

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 472 ttgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaacttt 531
           |||||||||||||| ||||| || || |||||||| || || ||||||||||||||||||
Sbjct: 75  ttgtggagaggaaacactgcaaatgttatccgttattttcccactcaggctttgaacttt 134

                     
Query: 532 gcattcaagg 541
           || |||||||
Sbjct: 135 gccttcaagg 144



to top

>ref|NM_118980.2| Arabidopsis thaliana AAC3 (ADP/ATP CARRIER 3); ATP:ADP antiporter/
           binding AT4G28390 (AAC3) mRNA, complete cds
          Length = 1960

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 106/129 (82%)
 Strand = Plus / Plus

                                                                       
Query: 288 gatcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccat 347
           |||||||||||| ||||||||||| || ||||| ||||| ||||| || || || || ||
Sbjct: 313 gatcgatttccttatgggaggagtctcagctgctgtttcgaagacggcagccgcgcctat 372

                                                                       
Query: 348 tgagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctc 407
            |||||||| |||||  | || ||||| || ||||| |||||||| |||||  | |||||
Sbjct: 373 agagcgtgtgaagctcttgattcagaatcaagatgaaatgatcaaagctgggcgtctctc 432

                    
Query: 408 tgagccata 416
           |||||||||
Sbjct: 433 tgagccata 441



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
           ||||||||||| |||||||| || ||| | |||||||| ||||||||||| |||||||| 
Sbjct: 500 tggagaggaaacactgccaatgttatcagatacttccccactcaggctttaaactttgcg 559

                
Query: 535 ttcaa 539
           |||||
Sbjct: 560 ttcaa 564



to top

>emb|AL161572.2|ATCHRIV68 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 68
          Length = 199749

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 106/129 (82%)
 Strand = Plus / Minus

                                                                          
Query: 288    gatcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccat 347
              |||||||||||| ||||||||||| || ||||| ||||| ||||| || || || || ||
Sbjct: 158025 gatcgatttccttatgggaggagtctcagctgctgtttcgaagacggcagccgcgcctat 157966

                                                                          
Query: 348    tgagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctc 407
               |||||||| |||||  | || ||||| || ||||| |||||||| |||||  | |||||
Sbjct: 157965 agagcgtgtgaagctcttgattcagaatcaagatgaaatgatcaaagctgggcgtctctc 157906

                       
Query: 408    tgagccata 416
              |||||||||
Sbjct: 157905 tgagccata 157897



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                            
Query: 475    tggagaggaaatactgccaacgtcatccgttacttcccaactcagg 520
              ||||||||||| |||||||| || ||| | |||||||| |||||||
Sbjct: 157838 tggagaggaaacactgccaatgttatcagatacttccccactcagg 157793



to top

>emb|AL021749.1|ATF20O9 Arabidopsis thaliana DNA chromosome 4, BAC clone F20O9 (ESSA project)
          Length = 93695

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 106/129 (82%)
 Strand = Plus / Minus

                                                                         
Query: 288   gatcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccat 347
             |||||||||||| ||||||||||| || ||||| ||||| ||||| || || || || ||
Sbjct: 20108 gatcgatttccttatgggaggagtctcagctgctgtttcgaagacggcagccgcgcctat 20049

                                                                         
Query: 348   tgagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctc 407
              |||||||| |||||  | || ||||| || ||||| |||||||| |||||  | |||||
Sbjct: 20048 agagcgtgtgaagctcttgattcagaatcaagatgaaatgatcaaagctgggcgtctctc 19989

                      
Query: 408   tgagccata 416
             |||||||||
Sbjct: 19988 tgagccata 19980



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                           
Query: 475   tggagaggaaatactgccaacgtcatccgttacttcccaactcagg 520
             ||||||||||| |||||||| || ||| | |||||||| |||||||
Sbjct: 19921 tggagaggaaacactgccaatgttatcagatacttccccactcagg 19876



to top

>dbj|AK118017.1| Arabidopsis thaliana At4g28390 mRNA for putative ADP,ATP carrier,
           complete cds, clone: RAFL19-23-E15
          Length = 1411

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 106/129 (82%)
 Strand = Plus / Plus

                                                                       
Query: 288 gatcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccat 347
           |||||||||||| ||||||||||| || ||||| ||||| ||||| || || || || ||
Sbjct: 313 gatcgatttccttatgggaggagtctcagctgctgtttcgaagacggcagccgcgcctat 372

                                                                       
Query: 348 tgagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctc 407
            |||||||| |||||  | || ||||| || ||||| |||||||| |||||  | |||||
Sbjct: 373 agagcgtgtgaagctcttgattcagaatcaagatgaaatgatcaaagctgggcgtctctc 432

                    
Query: 408 tgagccata 416
           |||||||||
Sbjct: 433 tgagccata 441



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
           ||||||||||| |||||||| || ||| | |||||||| ||||||||||| |||||||| 
Sbjct: 500 tggagaggaaacactgccaatgttatcagatacttccccactcaggctttaaactttgcg 559

                
Query: 535 ttcaa 539
           |||||
Sbjct: 560 ttcaa 564



to top

>dbj|AK110815.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-171-F09, full
           insert sequence
          Length = 1232

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 325 tccaagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgag 384
           |||||||| ||||| || |||||||||||| | ||||| || |||||||||||||| |||
Sbjct: 150 tccaagaccgctgctgcccccattgagcgtatcaagctcctgatccagaaccaggacgag 209

                        
Query: 385 atgatcaaggctg 397
           ||| |||||||||
Sbjct: 210 atgctcaaggctg 222



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactt 530
           ||||||||||||||||||||||| || |||||  |||||||
Sbjct: 314 gccaacgtcatccgttacttccctacccaggccctgaactt 354



to top

>ref|XM_568302.1| Cryptococcus neoformans var. neoformans JEC21 ATP:ADP antiporter
           (CNM01080) partial mRNA
          Length = 1222

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 83/99 (83%)
 Strand = Plus / Plus

                                                                       
Query: 295 ttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgt 354
           ||||||||||| || || ||||| || || || ||||||||||| || ||||||||||||
Sbjct: 104 ttcctcatgggtggtgtctctgccgctgtctctaagactgctgctgcccccattgagcgt 163

                                                  
Query: 355 gttaagctgcttatccagaaccaggatgagatgatcaag 393
            |||||||  |  |||| |||||||| ||||||||||||
Sbjct: 164 attaagctcttggtccaaaaccaggacgagatgatcaag 202



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||||||||| |||||||| ||||||||| | ||||| || |||||||
Sbjct: 299 gccaacgtcatccgatacttccctactcaggctcttaacttcgccttcaagg 350



to top

>ref|XM_499953.1| Yarrowia lipolytica CLIB122, YALI0A10659g predicted mRNA
          Length = 909

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                       
Query: 479 gaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgcattca 538
           ||||||| || |||||||||||||| |||||||| ||||||||| | |||||||| ||||
Sbjct: 206 gaggaaacaccgccaacgtcatccgatacttccccactcaggctcttaactttgccttca 265

              
Query: 539 agg 541
           |||
Sbjct: 266 agg 268



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 328 aagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgagatg 387
           ||||| ||||| ||||| |||||||| || ||||| || |||||||||||||| ||||||
Sbjct: 55  aagaccgctgctgctcctattgagcgagtcaagctcctcatccagaaccaggaggagatg 114

                 
Query: 388 atcaag 393
           ||||||
Sbjct: 115 atcaag 120



to top

>gb|AY183457.1| Yarrowia lipolytica ADP/ATP carrier protein (AAC2) gene, complete
           cds; nuclear gene for mitochondrial product
          Length = 1198

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                       
Query: 479 gaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgcattca 538
           ||||||| || |||||||||||||| |||||||| ||||||||| | |||||||| ||||
Sbjct: 416 gaggaaacaccgccaacgtcatccgatacttccccactcaggctcttaactttgccttca 475

              
Query: 539 agg 541
           |||
Sbjct: 476 agg 478



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 328 aagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgagatg 387
           ||||| ||||| ||||| |||||||| || ||||| || |||||||||||||| ||||||
Sbjct: 265 aagaccgctgctgctcctattgagcgagtcaagctcctcatccagaaccaggaggagatg 324

                 
Query: 388 atcaag 393
           ||||||
Sbjct: 325 atcaag 330



to top

>dbj|AB091506.1| Penicillium chrysogenum mRNA for ADP/ATP carrier protein, complete
           cds
          Length = 1629

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                       
Query: 325 tccaagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgag 384
           |||||||| ||||| || |||||||||||| | ||||| || ||||||||||||||||||
Sbjct: 183 tccaagaccgctgctgcccccattgagcgtatcaagctcctgatccagaaccaggatgag 242

              
Query: 385 atg 387
           |||
Sbjct: 243 atg 245



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactt 530
           ||||||||||||||||||||||| || |||||  |||||||
Sbjct: 693 gccaacgtcatccgttacttccccacccaggccctgaactt 733



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactt 530
           ||||||||||||||||||||||| || |||||  |||||||
Sbjct: 348 gccaacgtcatccgttacttccccacccaggccctgaactt 388



to top

>dbj|AK108179.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-140-A09, full
           insert sequence
          Length = 1100

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 83/99 (83%)
 Strand = Plus / Plus

                                                                       
Query: 295 ttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgt 354
           ||||||||||| || || || || || || |||||||| ||||| || ||||||||||| 
Sbjct: 97  ttcctcatgggtggtgtttccgccgccgtctccaagacggctgctgcccccattgagcga 156

                                                  
Query: 355 gttaagctgcttatccagaaccaggatgagatgatcaag 393
            | ||||| || |||||||||||||| ||||||||||||
Sbjct: 157 atcaagctcctcatccagaaccaggacgagatgatcaag 195



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 493 aacgtcatccgttacttcccaactcaggc 521
           |||||||||||||||||||| || |||||
Sbjct: 295 aacgtcatccgttacttccccacccaggc 323



to top

>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica
          Length = 2303261

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                           
Query: 479     gaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgcattca 538
               ||||||| || |||||||||||||| |||||||| ||||||||| | |||||||| ||||
Sbjct: 1109864 gaggaaacaccgccaacgtcatccgatacttccccactcaggctcttaactttgccttca 1109805

                  
Query: 539     agg 541
               |||
Sbjct: 1109804 agg 1109802



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                           
Query: 328     aagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgagatg 387
               ||||| ||||| ||||| |||||||| || ||||| || |||||||||||||| ||||||
Sbjct: 1110015 aagaccgctgctgctcctattgagcgagtcaagctcctcatccagaaccaggaggagatg 1109956

                     
Query: 388     atcaag 393
               ||||||
Sbjct: 1109955 atcaag 1109950



to top

>ref|XM_711736.1| Candida albicans SC5314 putative mitochondrial inner membrane
           ATP/ADP translocator (CaO19_8545), mRNA
          Length = 906

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
           |||||||| || ||||| ||||| ||| | |||||||||||||| |||||||||||||| 
Sbjct: 208 tggagaggtaacactgctaacgttatcagatacttcccaactcaagctttgaactttgct 267

                
Query: 535 ttcaa 539
           |||||
Sbjct: 268 ttcaa 272



to top

>ref|XM_711676.1| Candida albicans SC5314 putative mitochondrial inner membrane
           ATP/ADP translocator (CaO19_930), mRNA
          Length = 906

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
           |||||||| || ||||| ||||| ||| | |||||||||||||| |||||||||||||| 
Sbjct: 208 tggagaggtaacactgctaacgttatcagatacttcccaactcaagctttgaactttgct 267

                
Query: 535 ttcaa 539
           |||||
Sbjct: 268 ttcaa 272



to top

>gb|AY088151.1| Arabidopsis thaliana clone 42036 mRNA, complete sequence
          Length = 1388

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
           ||||||||||| |||||||| || ||| | |||||||| ||||||||||| |||||||| 
Sbjct: 492 tggagaggaaacactgccaatgttatcagatacttccccactcaggctttaaactttgcg 551

                
Query: 535 ttcaa 539
           |||||
Sbjct: 552 ttcaa 556



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 105/129 (81%)
 Strand = Plus / Plus

                                                                       
Query: 288 gatcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccat 347
           |||| ||||||| ||||||||||| || ||||| ||||| ||||| || || || || ||
Sbjct: 305 gatctatttccttatgggaggagtctcagctgctgtttcgaagacggcagccgcgcctat 364

                                                                       
Query: 348 tgagcgtgttaagctgcttatccagaaccaggatgagatgatcaaggctggcaggctctc 407
            |||||||| |||||  | || ||||| || ||||| |||||||| |||||  | |||||
Sbjct: 365 agagcgtgtgaagctcttgattcagaatcaagatgaaatgatcaaagctgggcgtctctc 424

                    
Query: 408 tgagccata 416
           |||||||||
Sbjct: 425 tgagccata 433



to top

>gb|AF085429.1|AF085429 Candida parapsilosis ADP/ATP carrier protein gene, nuclear gene
           encoding mitochondrial protein, complete cds
          Length = 1996

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                       
Query: 469 tcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaac 528
           ||||| |||||||| || |||||||| || ||| | ||||||||||| || |||||||||
Sbjct: 900 tcattctggagaggtaacactgccaatgttatcagatacttcccaacccaagctttgaac 959

                        
Query: 529 tttgcattcaagg 541
           ||||| |||||||
Sbjct: 960 tttgctttcaagg 972



to top

>dbj|AK064725.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-118-G12, full
           insert sequence
          Length = 1598

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaaggg 542
           ||||| |||||||| |||||||| ||||||||||| ||||| |||||||||||
Sbjct: 367 gccaatgtcatccgatacttccccactcaggcttttaacttcgcattcaaggg 419



to top

>gb|BT011069.1| Drosophila melanogaster GH27591 full insert cDNA
          Length = 3117

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                                
Query: 490  gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
            |||||||||||| | ||||||||||| |||||| |||||||||| |||||||
Sbjct: 1801 gccaacgtcatcagatacttcccaacccaggctctgaactttgccttcaagg 1852



to top

>gb|AF424642.1| Phytophthora infestans clone MY-03-E-01 ADP/ATP translocase mRNA,
           complete cds
          Length = 1157

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||||||||||||||||||||| || ||||| |||||||| || |||||||
Sbjct: 306 gccaacgtcatccgttacttcccgacgcaggccttgaacttcgccttcaagg 357



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 343 cccattgagcgtgttaagctgctt 366
           |||||||||||||| |||||||||
Sbjct: 162 cccattgagcgtgtcaagctgctt 185



to top

>emb|Y10618.1|DMADPATPT Drosophila melanogaster gene encoding ADP/ATP translocase
          Length = 10291

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                                
Query: 490  gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
            |||||||||||| | ||||||||||| |||||| |||||||||| |||||||
Sbjct: 5422 gccaacgtcatcagatacttcccaacccaggctctgaactttgccttcaagg 5473



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                
Query: 490  gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
            |||||||| ||||| |||||||||||||| ||  | |||||||| |||||||
Sbjct: 7602 gccaacgtaatccgatacttcccaactcaagcccttaactttgccttcaagg 7653



to top

>ref|NM_167248.1| Drosophila melanogaster stress-sensitive B CG16944-RB, transcript
           variant B (sesB), mRNA
          Length = 1643

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||||||| | ||||||||||| |||||| |||||||||| |||||||
Sbjct: 340 gccaacgtcatcagatacttcccaacccaggctctgaactttgccttcaagg 391



to top

>ref|NM_167247.1| Drosophila melanogaster stress-sensitive B CG16944-RD, transcript
           variant D (sesB), mRNA
          Length = 1756

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||||||| | ||||||||||| |||||| |||||||||| |||||||
Sbjct: 453 gccaacgtcatcagatacttcccaacccaggctctgaactttgccttcaagg 504



to top

>ref|NM_167246.1| Drosophila melanogaster stress-sensitive B CG16944-RC, transcript
           variant C (sesB), mRNA
          Length = 1792

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||||||| | ||||||||||| |||||| |||||||||| |||||||
Sbjct: 489 gccaacgtcatcagatacttcccaacccaggctctgaactttgccttcaagg 540



to top

>ref|NM_078554.2| Drosophila melanogaster stress-sensitive B CG16944-RA, transcript
           variant A (sesB), mRNA
          Length = 1679

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||||||| | ||||||||||| |||||| |||||||||| |||||||
Sbjct: 376 gccaacgtcatcagatacttcccaacccaggctctgaactttgccttcaagg 427



to top

>gb|AY070894.1| Drosophila melanogaster LP02726 full length cDNA
          Length = 1760

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                                
Query: 490  gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
            |||||||||||| | ||||||||||| |||||| |||||||||| |||||||
Sbjct: 1021 gccaacgtcatcagatacttcccaacccaggctctgaactttgccttcaagg 1072



to top

>gb|AY060978.1| Drosophila melanogaster GM12886 full length cDNA
          Length = 1635

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||||||| | ||||||||||| |||||| |||||||||| |||||||
Sbjct: 321 gccaacgtcatcagatacttcccaacccaggctctgaactttgccttcaagg 372



to top

>gb|S71762.1| Drosophila melanogaster ADP/ATP translocase (Hmr) mRNA, complete
           cds
          Length = 1744

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||||||| | ||||||||||| |||||| |||||||||| |||||||
Sbjct: 336 gccaacgtcatcagatacttcccaacccaggctctgaactttgccttcaagg 387



to top

>emb|AL114865.1|CNS01BYX Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 316 gctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatccagaac 375
           ||||| || |||||||| ||||| |||||||| |||||||| |||||  | ||||| |||
Sbjct: 139 gctgccgtctccaagaccgctgctgctcccatcgagcgtgtcaagctcttgatccaaaac 198

                       
Query: 376 caggatgagatg 387
           ||||||||||||
Sbjct: 199 caggatgagatg 210



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactt 530
           |||||||| || ||||||||||| |||||||||||||| || || || ||||||||
Sbjct: 298 tggagaggtaacactgccaacgttatccgttacttccctacacaagccttgaactt 353



to top

>emb|AL111975.1|CNS019QN Botrytis cinerea strain T4 cDNA library
          Length = 780

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 316 gctgcagtttccaagactgctgcagctcccattgagcgtgttaagctgcttatccagaac 375
           ||||| || |||||||| ||||| |||||||| |||||||| |||||  | ||||| |||
Sbjct: 59  gctgccgtctccaagaccgctgctgctcccatcgagcgtgtcaagctcttgatccaaaac 118

                       
Query: 376 caggatgagatg 387
           ||||||||||||
Sbjct: 119 caggatgagatg 130



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactt 530
           |||||||| || ||||||||||| |||||||||||||| || || || ||||||||
Sbjct: 218 tggagaggtaacactgccaacgttatccgttacttccctacacaagccttgaactt 273



to top

>gb|AY144848.1| Saccharomyces bayanus clone Contig3934 AAC3 gene, complete cds
          Length = 924

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 468 ctcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaa 527
           |||||| ||||||||||||||||| ||||| || ||||| ||||| || |||||||| ||
Sbjct: 219 ctcattttggagaggaaatactgcaaacgttattcgttatttccccacccaggctttaaa 278

                       
Query: 528 ctttgcattcaa 539
            ||||| |||||
Sbjct: 279 ttttgccttcaa 290



to top

>gb|AC125292.4| Drosophila melanogaster X BAC CH223-5O10 (Children's Hospital Oakland
            Research Institute Drosophila melanogaster sheared DNA
            BAC Library) complete sequence
          Length = 95026

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                
Query: 490  gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
            |||||||||||| | ||||||||||| |||||| |||||||||| |||||||
Sbjct: 9565 gccaacgtcatcagatacttcccaacccaggctctgaactttgccttcaagg 9514



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 490  gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
            |||||||| ||||| |||||||||||||| ||  | |||||||| |||||||
Sbjct: 7382 gccaacgtaatccgatacttcccaactcaagcccttaactttgccttcaagg 7331



to top

>gb|AE003484.3| Drosophila melanogaster chromosome X, section 36 of 74 of the
            complete sequence
          Length = 314111

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                
Query: 490  gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
            |||||||||||| | ||||||||||| |||||| |||||||||| |||||||
Sbjct: 9975 gccaacgtcatcagatacttcccaacccaggctctgaactttgccttcaagg 9924



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 490  gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
            |||||||| ||||| |||||||||||||| ||  | |||||||| |||||||
Sbjct: 7792 gccaacgtaatccgatacttcccaactcaagcccttaactttgccttcaagg 7741



to top

>gb|BT001519.1| Drosophila melanogaster LP11802 full insert cDNA
          Length = 2683

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                                
Query: 490  gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
            |||||||||||| | ||||||||||| |||||| |||||||||| |||||||
Sbjct: 1366 gccaacgtcatcagatacttcccaacccaggctctgaactttgccttcaagg 1417



to top

>ref|XM_454505.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E12353g predicted mRNA
          Length = 918

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                       
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
           |||||||| || ||||| ||||| ||| | |||||||||||||| || ||||||||||| 
Sbjct: 220 tggagaggtaacactgctaacgttatcagatacttcccaactcaagccttgaactttgcc 279

                  
Query: 535 ttcaagg 541
           |||||||
Sbjct: 280 ttcaagg 286



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 92/114 (80%)
 Strand = Plus / Plus

                                                                       
Query: 280 aactttgcgatcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgca 339
           |||||||| ||||||||| | ||||| || || || || || ||||||||||| ||||| 
Sbjct: 25  aactttgctatcgatttcttgatgggtggtgtttccgccgccgtttccaagaccgctgct 84

                                                                 
Query: 340 gctcccattgagcgtgttaagctgcttatccagaaccaggatgagatgatcaag 393
           ||||| |||||| | || ||| || | || || ||||| ||||| |||||||||
Sbjct: 85  gctccaattgagagagtcaagttgttgattcaaaaccaagatgaaatgatcaag 138



to top

>ref|XM_446154.1| Candida glabrata CBS138, CAGL0F04213g partial mRNA
          Length = 921

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                       
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
           |||||||| || || || ||||| ||||||||||||||||| || ||||||||||| || 
Sbjct: 223 tggagaggtaacaccgctaacgttatccgttacttcccaacccaagctttgaacttcgcc 282

                  
Query: 535 ttcaagg 541
           |||||||
Sbjct: 283 ttcaagg 289



to top

>emb|Z49974.1|SPANC1GN S.pombe ANC1 gene for adenine nucleotide carrier
          Length = 1209

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                       
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
           |||||||| ||||| || || ||| | ||||||||||| |||||||| ||||||||||| 
Sbjct: 419 tggagaggtaataccgctaatgtcttacgttacttccccactcaggccttgaactttgct 478

                  
Query: 535 ttcaagg 541
           |||||||
Sbjct: 479 ttcaagg 485



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 292 gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
           |||||| | ||||| || || |||||||| || || || || ||||| ||||||||||||
Sbjct: 236 gatttcatgatgggtggtgtttctgctgctgtatctaaaaccgctgccgctcccattgag 295

                      
Query: 352 cgtgttaagct 362
           ||||| |||||
Sbjct: 296 cgtgtcaagct 306



to top

>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 2234072

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                           
Query: 475     tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
               |||||||| || ||||| ||||| ||| | |||||||||||||| || ||||||||||| 
Sbjct: 1093001 tggagaggtaacactgctaacgttatcagatacttcccaactcaagccttgaactttgcc 1092942

                      
Query: 535     ttcaagg 541
               |||||||
Sbjct: 1092941 ttcaagg 1092935



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 92/114 (80%)
 Strand = Plus / Minus

                                                                           
Query: 280     aactttgcgatcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgca 339
               |||||||| ||||||||| | ||||| || || || || || ||||||||||| ||||| 
Sbjct: 1093196 aactttgctatcgatttcttgatgggtggtgtttccgccgccgtttccaagaccgctgct 1093137

                                                                     
Query: 340     gctcccattgagcgtgttaagctgcttatccagaaccaggatgagatgatcaag 393
               ||||| |||||| | || ||| || | || || ||||| ||||| |||||||||
Sbjct: 1093136 gctccaattgagagagtcaagttgttgattcaaaaccaagatgaaatgatcaag 1093083



to top

>emb|CR380952.1| Candida glabrata strain CBS138 chromosome F complete sequence
          Length = 927101

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                          
Query: 475    tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
              |||||||| || || || ||||| ||||||||||||||||| || ||||||||||| || 
Sbjct: 419695 tggagaggtaacaccgctaacgttatccgttacttcccaacccaagctttgaacttcgcc 419754

                     
Query: 535    ttcaagg 541
              |||||||
Sbjct: 419755 ttcaagg 419761



to top

>emb|AL023634.1|SPBC530 S.pombe chromosome II cosmid c530
          Length = 46843

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                         
Query: 475   tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
             |||||||| ||||| || || ||| | ||||||||||| |||||||| ||||||||||| 
Sbjct: 28813 tggagaggtaataccgctaatgtcttacgttacttccccactcaggccttgaactttgct 28754

                    
Query: 535   ttcaagg 541
             |||||||
Sbjct: 28753 ttcaagg 28747



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                         
Query: 292   gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
             |||||| | ||||| || || |||||||| || || || || ||||| ||||||||||||
Sbjct: 28996 gatttcatgatgggtggtgtttctgctgctgtatctaaaaccgctgccgctcccattgag 28937

                        
Query: 352   cgtgttaagct 362
             ||||| |||||
Sbjct: 28936 cgtgtcaagct 28926



to top

>dbj|AB226328.1| Aspergillus oryzae cDNA, contig sequence: AoEST3190
          Length = 1263

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 487 actgccaacgtcatccgttacttcccaactcaggctttgaactttgc 533
           |||||||||||||||||||||||||| || |||||| | ||||||||
Sbjct: 322 actgccaacgtcatccgttacttccccacccaggctcttaactttgc 368



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                       
Query: 325 tccaagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgag 384
           |||||||| ||||| || ||||| |||||| | ||||| || ||||||||||||||||||
Sbjct: 160 tccaagaccgctgccgcccccatcgagcgtatcaagctcctcatccagaaccaggatgag 219

              
Query: 385 atg 387
           |||
Sbjct: 220 atg 222



to top

>dbj|AB223194.1| Aspergillus oryzae cDNA, contig sequence: AoEST0025
          Length = 412

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 487 actgccaacgtcatccgttacttcccaactcaggctttgaactttgc 533
           |||||||||||||||||||||||||| || |||||| | ||||||||
Sbjct: 4   actgccaacgtcatccgttacttccccacccaggctcttaactttgc 50



to top

>gb|DQ407505.1| Myzus persicae adenine nucleotide translocator mRNA, complete cds
          Length = 1200

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                       
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
           ||||||||||| |  |||||||| ||  | |||||||| ||||| |||||||||||||||
Sbjct: 310 tggagaggaaacatggccaacgtgattaggtacttcccgactcaagctttgaactttgca 369

                  
Query: 535 ttcaagg 541
           |||||||
Sbjct: 370 ttcaagg 376



to top

>dbj|AP007150.1| Aspergillus oryzae RIB40 genomic DNA, SC009
          Length = 1913118

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                              
Query: 487     actgccaacgtcatccgttacttcccaactcaggctttgaactttgc 533
               |||||||||||||||||||||||||| || |||||| | ||||||||
Sbjct: 1074185 actgccaacgtcatccgttacttccccacccaggctcttaactttgc 1074231



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                           
Query: 325     tccaagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgag 384
               |||||||| ||||| || ||||| |||||| | ||||| || ||||||||||||||||||
Sbjct: 1074023 tccaagaccgctgccgcccccatcgagcgtatcaagctcctcatccagaaccaggatgag 1074082

                  
Query: 385     atg 387
               |||
Sbjct: 1074083 atg 1074085



to top

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
              complete sequence
          Length = 1519138

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                          
Query: 475    tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
              |||||||| || || |||||||| |||||||||||||| || ||||| |||||||| || 
Sbjct: 978997 tggagaggcaacacggccaacgtgatccgttacttccccacgcaggcgttgaacttcgcg 979056

                     
Query: 535    ttcaagg 541
              |||||||
Sbjct: 979057 ttcaagg 979063



to top

>ref|NM_001021230.1| Schizosaccharomyces pombe 972h- adenine nucleotide carrier
           (SPBC530.10c), partial mRNA
          Length = 969

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                       
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
           |||||||| ||||| || || ||| | ||||||||||| |||||||| ||||||||||| 
Sbjct: 271 tggagaggtaataccgctaatgtcttacgttacttccccactcaggccttgaactttgct 330

                  
Query: 535 ttcaagg 541
           |||||||
Sbjct: 331 ttcaagg 337



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 292 gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
           |||||| | ||||| || || |||||||| || || || || ||||| ||||||||||||
Sbjct: 88  gatttcatgatgggtggtgtttctgctgctgtatctaaaaccgctgccgctcccattgag 147

                      
Query: 352 cgtgttaagct 362
           ||||| |||||
Sbjct: 148 cgtgtcaagct 158



to top

>gb|AY126445.1| Gaeumannomyces graminis var. tritici ADP-ATP translocase (atl1) gene,
            complete cds
          Length = 2962

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                           
Query: 487  actgccaacgtcatccgttacttcccaactcaggctttgaactttgc 533
            |||||||||||||||||||||||||| || |||||  ||||||||||
Sbjct: 1855 actgccaacgtcatccgttacttccccacccaggccctgaactttgc 1901



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                                
Query: 328  aagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccagg 379
            |||||||| || |||||||| |||||| | ||||| ||  ||||||||||||
Sbjct: 1518 aagactgccgctgctcccatcgagcgtatcaagctcctcgtccagaaccagg 1569



to top

>ref|NM_210395.1| Eremothecium gossypii AER184Wp (AER184W), mRNA
          Length = 918

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                       
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
           |||||||| || || |||||||| |||||||||||||| || ||||| |||||||| || 
Sbjct: 217 tggagaggcaacacggccaacgtgatccgttacttccccacgcaggcgttgaacttcgcg 276

                  
Query: 535 ttcaagg 541
           |||||||
Sbjct: 277 ttcaagg 283



to top

>gb|L33797.1|YSKAAC Kluyveromyces lactis ADP/ATP translocase (AAC) gene, complete cds
          Length = 3345

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                        
Query: 475  tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
            |||||||| || ||||| ||||| ||| | |||||||||||||| || ||||||||||| 
Sbjct: 1853 tggagaggtaacactgctaacgttatcagatacttcccaactcaagccttgaactttgcc 1912

                   
Query: 535  ttcaagg 541
            |||||||
Sbjct: 1913 ttcaagg 1919



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 92/114 (80%)
 Strand = Plus / Plus

                                                                        
Query: 280  aactttgcgatcgatttcctcatgggaggagtgtctgctgcagtttccaagactgctgca 339
            |||||||| ||||||||| | ||||| || || || || || ||||||||||| ||||| 
Sbjct: 1658 aactttgctatcgatttcttgatgggtggtgtttccgccgccgtttccaagaccgctgct 1717

                                                                  
Query: 340  gctcccattgagcgtgttaagctgcttatccagaaccaggatgagatgatcaag 393
            ||||| |||||| | || ||| || | || || ||||| ||||| |||||||||
Sbjct: 1718 gctccaattgagagagtcaagttgttgattcaaaaccaagatgaaatgatcaag 1771



to top

>dbj|D89102.1| Schizosaccharomyces pombe mRNA, partial cds, clone: SY 0141
          Length = 1111

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                       
Query: 475 tggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgca 534
           |||||||| ||||| || || ||| | ||||||||||| |||||||| ||||||||||| 
Sbjct: 466 tggagaggtaataccgctaatgtcttacgttacttccccactcaggccttgaactttgct 525

                  
Query: 535 ttcaagg 541
           |||||||
Sbjct: 526 ttcaagg 532



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 292 gatttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgag 351
           |||||| | ||||| || || |||||||| || || || || ||||| ||||||||||||
Sbjct: 283 gatttcatgatgggtggtgtttctgctgctgtatctaaaaccgctgccgctcccattgag 342

                      
Query: 352 cgtgttaagct 362
           ||||| |||||
Sbjct: 343 cgtgtcaagct 353



to top

>ref|XM_370159.1| Magnaporthe grisea 70-15 chromosome II hypothetical protein
           (MG06656.4) partial mRNA
          Length = 921

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 481 ggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactt 530
           ||||| |||||||||||||||||||||||||| || |||||  |||||||
Sbjct: 214 ggaaacactgccaacgtcatccgttacttccccacccaggccctgaactt 263



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 340 gctcccattgagcgtgttaagctgcttatccagaaccaggatgagatgatc 390
           |||||||| |||||||| ||||| ||  ||||||||||||| |||||||||
Sbjct: 73  gctcccatcgagcgtgtgaagcttctggtccagaaccaggaggagatgatc 123



to top

>gb|BC072091.1| Xenopus laevis hypothetical protein MGC79005, mRNA (cDNA clone
           MGC:79005 IMAGE:4407069), complete cds
          Length = 1101

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 468 ctcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaa 527
           |||||| |||||||| ||   |||||||||||||||||||||||| || || ||| | ||
Sbjct: 289 ctcattctggagagggaaccttgccaacgtcatccgttacttccccacacaagctcttaa 348

                         
Query: 528 ctttgcattcaagg 541
           |||||| |||||||
Sbjct: 349 ctttgccttcaagg 362



to top

>ref|XM_775642.1| PREDICTED: Strongylocentrotus purpuratus similar to CG16944-PA,
           isoform A (LOC575225), mRNA
          Length = 1928

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaa 539
           |||||||||||| | ||||||||||| |||||| |||||||||| |||||
Sbjct: 249 gccaacgtcatcagatacttcccaacacaggctctgaactttgccttcaa 298



to top

>gb|AY752790.1| Culicoides sonorensis clone CsANT ADP/ATP translocase mRNA, partial
           cds
          Length = 669

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 496 gtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||||||||| |||||||| || || |||||||||||||||||||
Sbjct: 310 gtcatccgttatttcccaacacaagcattgaactttgcattcaagg 355



to top

>gb|AY849642.1| Magnaporthe grisea ADP/ATP carrier protein-like protein mRNA,
           complete cds
          Length = 1577

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 481 ggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactt 530
           ||||| |||||||||||||||||||||||||| || |||||  |||||||
Sbjct: 469 ggaaacactgccaacgtcatccgttacttccccacccaggccctgaactt 518



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 340 gctcccattgagcgtgttaagctgcttatccagaaccaggatgagatgatc 390
           |||||||| |||||||| ||||| ||  ||||||||||||| |||||||||
Sbjct: 328 gctcccatcgagcgtgtgaagcttctggtccagaaccaggaggagatgatc 378



to top

>gb|AE017353.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 13, complete
              sequence
          Length = 787999

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                          
Query: 295    ttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgt 354
              ||||||||||| || || ||||| || || || ||||||||||| || ||||||||||||
Sbjct: 322871 ttcctcatgggtggtgtctctgccgctgtctctaagactgctgctgcccccattgagcgt 322812

                                               
Query: 355    gttaagctgcttatccagaaccaggatgagatg 387
               |||||||  |  |||| |||||||| ||||||
Sbjct: 322811 attaagctcttggtccaaaaccaggacgagatg 322779



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                  
Query: 490    gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
              |||||||||||||| |||||||| ||||||||| | ||||| || |||||||
Sbjct: 322624 gccaacgtcatccgatacttccctactcaggctcttaacttcgccttcaagg 322573



to top

>emb|X76112.1|CEADPATP C.elegans mRNA for ADP/ATP translocase
          Length = 1252

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 493 aacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||||||||| |||||||||||||||||  ||||||| || |||||||
Sbjct: 244 aacgtcatccggtacttcccaactcaggccatgaacttcgccttcaagg 292



to top

>ref|NM_001027630.2| Caenorhabditis elegans Temporarily Assigned Gene name family member
           (tag-61) (tag-61) mRNA, complete cds
          Length = 903

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 493 aacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||||||||| |||||||||||||||||  ||||||| || |||||||
Sbjct: 291 aacgtcatccggtacttcccaactcaggccatgaacttcgccttcaagg 339



to top

>ref|NM_001027628.1| Caenorhabditis elegans Temporarily Assigned Gene name family member
           (tag-61) (tag-61) mRNA, complete cds
          Length = 1103

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 493 aacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||||||||| |||||||||||||||||  ||||||| || |||||||
Sbjct: 283 aacgtcatccggtacttcccaactcaggccatgaacttcgccttcaagg 331



to top

>emb|Z82059.1|CET27E9 Caenorhabditis elegans Cosmid T27E9, complete sequence
          Length = 22245

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                             
Query: 493  aacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
            ||||||||||| |||||||||||||||||  ||||||| || |||||||
Sbjct: 1691 aacgtcatccggtacttcccaactcaggccatgaacttcgccttcaagg 1739



to top

>gb|M34075.1|YSCAAC3 S.cerevisiae ADP/ATP-translocator protein (AAC2) gene, complete cds
          Length = 1308

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                       
Query: 479 gaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgcattca 538
           |||||||||||||||| || || ||||| ||||| ||||| ||||||||||| || ||||
Sbjct: 340 gaggaaatactgccaatgttattcgttatttccccactcaagctttgaacttcgccttca 399

            
Query: 539 a 539
           |
Sbjct: 400 a 400



to top

>gb|AY691195.1| Leishmania major ATP/ADP translocase mRNA, complete cds
          Length = 3275

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 326 ccaagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccaggatgaga 385
           ||||||| ||||| || || || |||||||| ||||||||  | |||||||||| |||||
Sbjct: 143 ccaagacggctgcggcgccgatcgagcgtgtgaagctgctggtgcagaaccagggtgaga 202

                   
Query: 386 tgatcaag 393
           ||||||||
Sbjct: 203 tgatcaag 210



to top

>emb|Z68218.1|CEK01H12 Caenorhabditis elegans Cosmid K01H12, complete sequence
          Length = 18925

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                
Query: 490  gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
            ||||| |||||||| ||||||||||| |||||  ||||||| ||||||||||
Sbjct: 8896 gccaatgtcatccgatacttcccaacccaggcgctgaacttcgcattcaagg 8845



to top

>emb|BX019231.1|CNS08N03 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29BB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 555

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| ||||||||||
Sbjct: 283 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcattcaagg 334



to top

>emb|X00363.1|NCADPATP Neurospora crassa precursor mRNA for mitochondrial ADP/ATP carrier
           protein
          Length = 1937

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 328 aagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccagg 379
           ||||||||||| ||||||||||||||| | ||||| ||  ||||||||||||
Sbjct: 568 aagactgctgccgctcccattgagcgtatcaagctcctcgtccagaaccagg 619



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactt 530
           ||||||||||||||||||||||| || |||||  |||||||
Sbjct: 922 gccaacgtcatccgttacttccctacccaggccctgaactt 962



to top

>emb|BX842597.1| Neurospora crassa DNA linkage group II BAC clone B22K18
          Length = 75214

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                 
Query: 328   aagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccagg 379
             ||||||||||| ||||||||||||||| | ||||| ||  ||||||||||||
Sbjct: 67397 aagactgctgccgctcccattgagcgtatcaagctcctcgtccagaaccagg 67346



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                      
Query: 490   gccaacgtcatccgttacttcccaactcaggctttgaactt 530
             ||||||||||||||||||||||| || |||||  |||||||
Sbjct: 67043 gccaacgtcatccgttacttccctacccaggccctgaactt 67003



to top

>emb|BX842596.1| Neurospora crassa DNA linkage group II BAC clone B10K17
          Length = 77292

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                 
Query: 328   aagactgctgcagctcccattgagcgtgttaagctgcttatccagaaccagg 379
             ||||||||||| ||||||||||||||| | ||||| ||  ||||||||||||
Sbjct: 50448 aagactgctgccgctcccattgagcgtatcaagctcctcgtccagaaccagg 50499



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 490   gccaacgtcatccgttacttcccaactcaggctttgaactt 530
             ||||||||||||||||||||||| || |||||  |||||||
Sbjct: 50802 gccaacgtcatccgttacttccctacccaggccctgaactt 50842



to top

>ref|NM_069326.1| Caenorhabditis elegans K01H12.2 (K01H12.2) mRNA, complete cds
          Length = 942

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||| |||||||| ||||||||||| |||||  ||||||| ||||||||||
Sbjct: 277 gccaatgtcatccgatacttcccaacccaggcgctgaacttcgcattcaagg 328



to top

>emb|BX069564.1|CNS09PU8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 427

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagggat 544
           |||||||| |||||||||||||| || |||||  ||||||| || ||||||||||
Sbjct: 329 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagggat 383



to top

>dbj|AB227319.1| Aspergillus oryzae cDNA, contig sequence: AoEST4184
          Length = 735

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 488 ctgccaacgtcatccgttacttcccaactcaggct 522
           ||||||||||||||||||||||||| || ||||||
Sbjct: 298 ctgccaacgtcatccgttacttccccacccaggct 332



to top

>gb|BC061600.1| Xenopus tropicalis hypothetical protein MGC75662, mRNA (cDNA clone
           MGC:75662 IMAGE:5379849), complete cds
          Length = 1311

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 468 ctcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaa 527
           |||||| |||||||| ||   |||||| ||||||||||||||||| || || ||| | ||
Sbjct: 262 ctcattctggagagggaaccttgccaatgtcatccgttacttccccacacaagctcttaa 321

                         
Query: 528 ctttgcattcaagg 541
           |||||| |||||||
Sbjct: 322 ctttgccttcaagg 335



to top

>ref|NM_203578.1| Xenopus tropicalis hypothetical protein MGC75662 (MGC75662), mRNA
          Length = 1311

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 468 ctcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaa 527
           |||||| |||||||| ||   |||||| ||||||||||||||||| || || ||| | ||
Sbjct: 262 ctcattctggagagggaaccttgccaatgtcatccgttacttccccacacaagctcttaa 321

                         
Query: 528 ctttgcattcaagg 541
           |||||| |||||||
Sbjct: 322 ctttgccttcaagg 335



to top

>gb|AF218587.1|AF218587 Lucilia cuprina ADP/ATP translocase mRNA, complete cds
          Length = 1536

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 508 ttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| ||||||||||||||||| |||||||
Sbjct: 366 ttcccaacccaggctttgaactttgccttcaagg 399



to top

>emb|CR761556.2| Xenopus tropicalis finished cDNA, clone TGas117p06
          Length = 1328

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 468 ctcattgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaa 527
           |||||| |||||||| ||   |||||| ||||||||||||||||| || || ||| | ||
Sbjct: 282 ctcattctggagagggaaccttgccaatgtcatccgttacttccccacacaagctcttaa 341

                         
Query: 528 ctttgcattcaagg 541
           |||||| |||||||
Sbjct: 342 ctttgccttcaagg 355



to top

>gb|AY725780.1| Oncometopia nigricans putative mitochondrial ADP/ATP translocase
           mRNA, complete cds; nuclear gene for mitochondrial
           product
          Length = 930

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 489 tgccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||||||||||| | ||||||||||| || ||| | |||||||| |||||||
Sbjct: 255 tgccaacgtcatcagatacttcccaacccaagctctcaactttgccttcaagg 307



to top

>gb|DQ440004.1| Aedes aegypti clone AE-198 ADP/ATP translocase mRNA, complete cds
          Length = 909

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 489 tgccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||||||| ||||| ||||||||||| |||||  ||||||| || |||||||
Sbjct: 234 tgccaacgtgatccggtacttcccaacccaggcgctgaacttcgccttcaagg 286



to top

>ref|XM_788596.1| PREDICTED: Strongylocentrotus purpuratus similar to CG16944-PA,
           isoform A (LOC588937), mRNA
          Length = 924

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 490 gccaacgtcatccgttacttcccaactcaggct 522
           |||||||||||||| |||||||| |||||||||
Sbjct: 259 gccaacgtcatccgatacttcccgactcaggct 291



to top

>emb|BX068819.1|CNS09P9J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1023

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 489 tgccaacgtcatccgttacttcccaactcaggc 521
           |||||||||||||||||||||||| || |||||
Sbjct: 389 tgccaacgtcatccgttacttcccgacgcaggc 421



to top

>emb|BX067459.1|CNS09O7R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 489 tgccaacgtcatccgttacttcccaactcaggc 521
           |||||||||||||||||||||||| || |||||
Sbjct: 366 tgccaacgtcatccgttacttcccgacgcaggc 398



to top

>emb|BX036624.1|CNS090F8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8CH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 255

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 489 tgccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 179 tgccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 231



to top

>emb|BX007782.1|CNS08E62 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 489 tgccaacgtcatccgttacttcccaactcaggc 521
           |||||||||||||||||||||||| || |||||
Sbjct: 246 tgccaacgtcatccgttacttcccgacgcaggc 278



to top

>emb|Z35954.1|SCYBR085W S.cerevisiae chromosome II reading frame ORF YBR085w
          Length = 6225

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 479  gaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgcattca 538
            |||||||||||||||| || || ||||| || || ||||| ||||||||||| || ||||
Sbjct: 2234 gaggaaatactgccaatgttattcgttattttcccactcaagctttgaacttcgccttca 2293

             
Query: 539  a 539
            |
Sbjct: 2294 a 2294



to top

>emb|CR938588.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YF19AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 551

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 489 tgccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||||||| ||||| ||||||||||| |||||  ||||||| || |||||||
Sbjct: 333 tgccaacgtgatccggtacttcccaacccaggcgctgaacttcgccttcaagg 385



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 322 gtttccaagactgctgcagctcccattgagcgtgttaagctgct 365
           ||||||||||||||||  || || |||||||| || ||||||||
Sbjct: 169 gtttccaagactgctgtggccccaattgagcgcgtcaagctgct 212



to top

>emb|CR938334.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YC20AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 809

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 489 tgccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||||||| ||||| ||||||||||| |||||  ||||||| || |||||||
Sbjct: 338 tgccaacgtgatccggtacttcccaacccaggcgctgaacttcgccttcaagg 390



to top

>emb|CR938254.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YF12AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 810

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 489 tgccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||||||| ||||| ||||||||||| |||||  ||||||| || |||||||
Sbjct: 338 tgccaacgtgatccggtacttcccaacccaggcgctgaacttcgccttcaagg 390



to top

>emb|CR938077.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YL06AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 786

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 489 tgccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||||||| ||||| ||||||||||| |||||  ||||||| || |||||||
Sbjct: 338 tgccaacgtgatccggtacttcccaacccaggcgctgaacttcgccttcaagg 390



to top

>emb|CR937989.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YO03AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 811

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 489 tgccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||||||| ||||| ||||||||||| |||||  ||||||| || |||||||
Sbjct: 337 tgccaacgtgatccggtacttcccaacccaggcgctgaacttcgccttcaagg 389



to top

>emb|CR937962.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YP01AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 794

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 489 tgccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||||||| ||||| ||||||||||| |||||  ||||||| || |||||||
Sbjct: 341 tgccaacgtgatccggtacttcccaacccaggcgctgaacttcgccttcaagg 393



to top

>gb|S43651.1| ADP/ATP translocase [Drosophila melanogaster, mRNA, 1523 nt]
          Length = 1523

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 505 tacttcccaactcaggctttgaactttgcattcaagg 541
           ||||||||||| |||||| |||||||||| |||||||
Sbjct: 284 tacttcccaacccaggctctgaactttgccttcaagg 320



to top

>ref|XM_312599.2| Anopheles gambiae str. PEST ENSANGP00000024030
           (ENSANGG00000012392), partial mRNA
          Length = 714

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 489 tgccaacgtcatccgttacttcccaactcaggc 521
           |||||||||||||||||||||||| || |||||
Sbjct: 305 tgccaacgtcatccgttacttcccgacgcaggc 337



to top

>ref|XM_312601.2| Anopheles gambiae str. PEST ENSANGP00000014881
           (ENSANGG00000012392), mRNA
          Length = 1394

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 489 tgccaacgtcatccgttacttcccaactcaggc 521
           |||||||||||||||||||||||| || |||||
Sbjct: 371 tgccaacgtcatccgttacttcccgacgcaggc 403



to top

>gb|M34076.1|YSCAAC2A S.cerevisiae ADP/ATP-translocator protein (AAC3) gene, complete cds
          Length = 1333

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 479 gaggaaatactgccaacgtcatccgttacttcccaactcaggctttgaactttgcattca 538
           |||||||||||||||| || || ||||| || || ||||| ||||||||||| || ||||
Sbjct: 464 gaggaaatactgccaatgttattcgttattttcccactcaagctttgaacttcgccttca 523

            
Query: 539 a 539
           |
Sbjct: 524 a 524



to top

>gb|DQ268539.1| Cryptococcus neoformans var. grubii strain H99 eukaryotic ADP/ATP
            carrier (AAC1) and eukaryotic ADP/ATP carrier (AAC2)
            genes, complete cds
          Length = 5290

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 76/93 (81%)
 Strand = Plus / Plus

                                                                        
Query: 295  ttcctcatgggaggagtgtctgctgcagtttccaagactgctgcagctcccattgagcgt 354
            ||||||||||| || || ||||| || || || ||||| || || || ||||||||||||
Sbjct: 3193 ttcctcatgggtggtgtctctgccgctgtctctaagaccgccgccgcgcccattgagcgt 3252

                                             
Query: 355  gttaagctgcttatccagaaccaggatgagatg 387
             |||||||  |  ||||||||||||| ||||||
Sbjct: 3253 attaagctcttggtccagaaccaggacgagatg 3285



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                                
Query: 490  gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
            ||||||||||| || |||||||| || |||||| | ||||| || |||||||
Sbjct: 3441 gccaacgtcattcgatacttccctacccaggctcttaacttcgccttcaagg 3492



to top

>gb|AY439863.1| Armigeres subalbatus ASAP ID: 38923 ATP/ADP antiporter mRNA
           sequence
          Length = 1462

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||||||||| |||||||| || |||||  ||||||| || |||||||
Sbjct: 402 gccaacgtcatccggtacttccctacccaggcactgaacttcgccttcaagg 453



to top

>gb|AY238843.1| Drosophila miranda strain MSH38 stress-sensitive B (sesB) gene,
           partial cds
          Length = 869

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||| |||||| | ||||||||||| |||||  |||||||||| |||||||
Sbjct: 139 gccaatgtcatcagatacttcccaacccaggccctgaactttgccttcaagg 190



to top

>gb|AY238842.1| Drosophila miranda strain MSH22 stress-sensitive B (sesB) gene,
           partial cds
          Length = 869

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||| |||||| | ||||||||||| |||||  |||||||||| |||||||
Sbjct: 139 gccaatgtcatcagatacttcccaacccaggccctgaactttgccttcaagg 190



to top

>gb|AY238841.1| Drosophila miranda strain SP295 stress-sensitive B (sesB) gene,
           partial cds
          Length = 869

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||| |||||| | ||||||||||| |||||  |||||||||| |||||||
Sbjct: 139 gccaatgtcatcagatacttcccaacccaggccctgaactttgccttcaagg 190



to top

>gb|AY238840.1| Drosophila miranda strain SP235 stress-sensitive B (sesB) gene,
           partial cds
          Length = 869

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||| |||||| | ||||||||||| |||||  |||||||||| |||||||
Sbjct: 139 gccaatgtcatcagatacttcccaacccaggccctgaactttgccttcaagg 190



to top

>gb|AY238839.1| Drosophila miranda strain SP138 stress-sensitive B (sesB) gene,
           partial cds
          Length = 869

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||| |||||| | ||||||||||| |||||  |||||||||| |||||||
Sbjct: 139 gccaatgtcatcagatacttcccaacccaggccctgaactttgccttcaagg 190



to top

>gb|AY238838.1| Drosophila miranda strain MA32 stress-sensitive B (sesB) gene,
           partial cds
          Length = 869

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||| |||||| | ||||||||||| |||||  |||||||||| |||||||
Sbjct: 139 gccaatgtcatcagatacttcccaacccaggccctgaactttgccttcaagg 190



to top

>gb|AY238837.1| Drosophila miranda strain MA28 stress-sensitive B (sesB) gene,
           partial cds
          Length = 869

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||| |||||| | ||||||||||| |||||  |||||||||| |||||||
Sbjct: 139 gccaatgtcatcagatacttcccaacccaggccctgaactttgccttcaagg 190



to top

>gb|AY238836.1| Drosophila miranda strain 0101.9 stress-sensitive B (sesB) gene,
           partial cds
          Length = 869

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||| |||||| | ||||||||||| |||||  |||||||||| |||||||
Sbjct: 139 gccaatgtcatcagatacttcccaacccaggccctgaactttgccttcaagg 190



to top

>gb|AY238835.1| Drosophila miranda strain 0101.7 stress-sensitive B (sesB) gene,
           partial cds
          Length = 869

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||| |||||| | ||||||||||| |||||  |||||||||| |||||||
Sbjct: 139 gccaatgtcatcagatacttcccaacccaggccctgaactttgccttcaagg 190



to top

>gb|AY238834.1| Drosophila miranda strain 0101.5 stress-sensitive B (sesB) gene,
           partial cds
          Length = 869

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||| |||||| | ||||||||||| |||||  |||||||||| |||||||
Sbjct: 139 gccaatgtcatcagatacttcccaacccaggccctgaactttgccttcaagg 190



to top

>gb|AY238833.1| Drosophila miranda strain 0101.4 stress-sensitive B (sesB) gene,
           partial cds
          Length = 869

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||| |||||| | ||||||||||| |||||  |||||||||| |||||||
Sbjct: 139 gccaatgtcatcagatacttcccaacccaggccctgaactttgccttcaagg 190



to top

>gb|AY238832.1| Drosophila miranda strain 0101.3 stress-sensitive B (sesB) gene,
           partial cds
          Length = 869

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           ||||| |||||| | ||||||||||| |||||  |||||||||| |||||||
Sbjct: 139 gccaatgtcatcagatacttcccaacccaggccctgaactttgccttcaagg 190



to top

>emb|BX071962.1|CNS09ROU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 116 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 167



to top

>emb|BX071944.1|CNS09ROC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 92  gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 143



to top

>emb|BX071896.1|CNS09RN0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 876

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 115 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 166



to top

>emb|BX071872.1|CNS09RMC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 115 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 166



to top

>emb|BX071818.1|CNS09RKU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 324 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 375



to top

>emb|BX071654.1|CNS09RGA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 307 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 358



to top

>emb|BX071031.1|CNS09QYZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 547

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 349 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 400



to top

>emb|BX070618.1|CNS09QNI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 691

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 320 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 371



to top

>emb|BX070503.1|CNS09QKB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 821 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 770



to top

>emb|BX070395.1|CNS09QHB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 590

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 324 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 375



to top

>emb|BX070224.1|CNS09QCK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 547

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 345 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 396



to top

>emb|BX069932.1|CNS09Q4G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 332 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 383



to top

>emb|BX069908.1|CNS09Q3S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1051

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 323 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 374



to top

>emb|BX069883.1|CNS09Q33 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 889

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 821 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 770



to top

>emb|BX069882.1|CNS09Q32 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 331 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 382



to top

>emb|BX069783.1|CNS09Q0B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 313 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 364



to top

>emb|BX069769.1|CNS09PZX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 329 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 380



to top

>emb|BX069706.1|CNS09PY6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 458

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 322 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 373



to top

>emb|BX069618.1|CNS09PVQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 459

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 323 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 374



to top

>emb|BX060977.1|CNS09J7P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 251 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 302



to top

>emb|BX069508.1|CNS09PSO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 211 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 262



to top

>emb|BX069340.1|CNS09PO0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 274 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 325



to top

>emb|BX069021.1|CNS09PF5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 926

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 821 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 770



to top

>emb|BX069020.1|CNS09PF4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 329 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 380



to top

>emb|BX068972.1|CNS09PDS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 839

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 346 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 397



to top

>emb|BX068672.1|CNS09P5G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 514

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 250 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 301



to top

>emb|BX068399.1|CNS09OXV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 458

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 335 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 386



to top

>emb|BX068167.1|CNS09ORF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1017

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 340 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 391



to top

>emb|BX068127.1|CNS09OQB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 366

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 266 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 317



to top

>emb|BX067885.1|CNS09OJL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 566 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 515



to top

>emb|BX067884.1|CNS09OJK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 234 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 285



to top

>emb|BX067843.1|CNS09OIF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 144

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 7   gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 58



to top

>emb|BX067544.1|CNS09OA4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 319 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 370



to top

>emb|BX067029.1|CNS09NVT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 504

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 340 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 391



to top

>emb|BX066755.1|CNS09NO7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 340 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 391



to top

>emb|BX066398.1|CNS09NEA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 330 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 381



to top

>emb|BX066271.1|CNS09NAR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 340 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 391



to top

>emb|BX066125.1|CNS09N6P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 333 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 384



to top

>emb|BX066121.1|CNS09N6L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 342 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 393



to top

>emb|BX066105.1|CNS09N65 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 284 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 335



to top

>emb|BX066075.1|CNS09N5B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 281 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 332



to top

>emb|BX065971.1|CNS09N2F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 321 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 372



to top

>emb|BX065522.1|CNS09MPY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 326 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 377



to top

>emb|BX065510.1|CNS09MPM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 904 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 853



to top

>emb|BX065309.1|CNS09MK1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1021

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 302 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 353



to top

>emb|BX065272.1|CNS09MJ0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 332 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 383



to top

>emb|BX065217.1|CNS09MHH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 252 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 303



to top

>emb|BX065186.1|CNS09MGM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 117 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 168



to top

>emb|BX065171.1|CNS09MG7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 309 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 360



to top

>emb|BX064976.1|CNS09MAS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 316 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 367



to top

>emb|BX064688.1|CNS09M2S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 623

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 288 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 339



to top

>emb|BX064675.1|CNS09M2F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 556

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 130 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 181



to top

>emb|BX064650.1|CNS09M1Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 548

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 322 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 373



to top

>emb|BX064446.1|CNS09LW2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46CH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 823 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 772



to top

>emb|BX064445.1|CNS09LW1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 323 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 374



to top

>emb|BX064428.1|CNS09LVK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46CG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 821 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 770



to top

>emb|BX064417.1|CNS09LV9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 591

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 300 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 351



to top

>emb|BX064382.1|CNS09LUA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1038

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 342 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 393



to top

>emb|BX064133.1|CNS09LND Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 821 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 770



to top

>emb|BX064132.1|CNS09LNC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 319 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 370



to top

>emb|BX063934.1|CNS09LHU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 317 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 368



to top

>emb|BX063922.1|CNS09LHI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 342 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 393



to top

>emb|BX063876.1|CNS09LG8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 333 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 384



to top

>emb|BX063832.1|CNS09LF0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 395 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 446



to top

>emb|BX063607.1|CNS09L8R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 597

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 280 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 331



to top

>emb|BX063326.1|CNS09L0Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 490 gccaacgtcatccgttacttcccaactcaggctttgaactttgcattcaagg 541
           |||||||| |||||||||||||| || |||||  ||||||| || |||||||
Sbjct: 347 gccaacgtgatccgttacttcccgacccaggccctgaacttcgcgttcaagg 398


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,688,912
Number of Sequences: 3902068
Number of extensions: 4688912
Number of successful extensions: 94397
Number of sequences better than 10.0: 1074
Number of HSP's better than 10.0 without gapping: 1074
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 92934
Number of HSP's gapped (non-prelim): 1433
length of query: 551
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 528
effective length of database: 17,143,297,704
effective search space: 9051661187712
effective search space used: 9051661187712
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top