ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags8p18
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK060781.1| Oryza sativa (japonica cultivar-group) cDNA clon... 414 e-112
2dbj|AK104537.1| Oryza sativa (japonica cultivar-group) cDNA clon... 406 e-110
3dbj|AK065882.1| Oryza sativa (japonica cultivar-group) cDNA clon... 406 e-110
4dbj|AK061577.1| Oryza sativa (japonica cultivar-group) cDNA clon... 398 e-108
5ref|NM_194962.1| Oryza sativa (japonica cultivar-group) putative... 224 3e-55
6dbj|AK061007.1| Oryza sativa (japonica cultivar-group) cDNA clon... 168 1e-38
7ref|NM_194963.1| Oryza sativa (japonica cultivar-group) putative... 167 5e-38
8gb|AC116600.1| Oryza sativa (japonica cultivar-group) chromosome... 121 3e-24
9gb|AC098696.3| Oryza sativa (japonica cultivar-group) chromosome... 121 3e-24
10dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 121 3e-24
11gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 121 3e-24
12emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 52 0.002
13dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 52 0.002
14gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 52 0.002
15ref|NM_103012.2| Arabidopsis thaliana oxidoreductase/ zinc ion b... 48 0.033
16gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence 48 0.033
17gb|AE009614.1| Brucella melitensis 16M chromosome I, section 171... 48 0.033
18gb|AY087044.1| Arabidopsis thaliana clone 30996 mRNA, complete s... 48 0.033
19gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I... 48 0.033
20emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,... 48 0.033
21emb|AJ243941.1|PSP243941 Pseudomonas sp. strain HR199 partial va... 46 0.13
22emb|CR733082.2|CNS0GSJL Tetraodon nigroviridis full-length cDNA 46 0.13
23emb|CR729985.2|CNS0GQ7B Tetraodon nigroviridis full-length cDNA 46 0.13
24emb|CR727846.2|CNS0GOJW Tetraodon nigroviridis full-length cDNA 46 0.13
25emb|CR721062.2|CNS0GJBG Tetraodon nigroviridis full-length cDNA 46 0.13
26emb|CR641155.2|CNS0ETOP Tetraodon nigroviridis full-length cDNA 46 0.13
27gb|AF403348.1| Gossypium hirsutum D-subgenome TX119 alcohol dehy... 46 0.13
28gb|AF403345.1| Gossypium hirsutum D-subgenome TX111 alcohol dehy... 46 0.13
29gb|AF403343.1| Gossypium hirsutum D-subgenome TX98 alcohol dehyd... 46 0.13
30gb|AF403341.1| Gossypium hirsutum D-subgenome TX94 alcohol dehyd... 46 0.13
31gb|AF403337.1| Gossypium hirsutum D-subgenome TX51 alcohol dehyd... 46 0.13
32gb|AF403336.1| Gossypium hirsutum D-subgenome TX44 alcohol dehyd... 46 0.13
33gb|AF403335.1| Gossypium hirsutum D-subgenome TX44 alcohol dehyd... 46 0.13
34gb|AF403334.1| Gossypium hirsutum D-subgenome TX21 alcohol dehyd... 46 0.13
35gb|AF403333.1| Gossypium hirsutum D-subgenome TX21 alcohol dehyd... 46 0.13
36gb|AF403331.1| Gossypium hirsutum D-subgenome TX1 alcohol dehydr... 46 0.13
37gb|AF403330.1| Gossypium hirsutum D-subgenome TX1 alcohol dehydr... 46 0.13
38gb|AF403308.1| Gossypium barbadense D-subgenome B559 alcohol deh... 46 0.13
39gb|AF403307.1| Gossypium barbadense D-subgenome B444 alcohol deh... 46 0.13
40gb|AF403306.1| Gossypium barbadense D-subgenome B250 alcohol deh... 46 0.13
41gb|AF403305.1| Gossypium barbadense D-subgenome B106 alcohol deh... 46 0.13
42gb|AF403304.1| Gossypium barbadense D-subgenome Pima_S5 alcohol ... 46 0.13
43gb|AC017118.3|AC017118 Genomic sequence for Arabidopsis thaliana... 46 0.13
44gb|AF036573.1|AF036573 Gossypium darwinii D-subgenome alcohol de... 46 0.13
45gb|AF036570.1|AF036570 Gossypium barbadense D-subgenome alcohol ... 46 0.13
46dbj|AK112362.1| Ciona intestinalis cDNA, clone:ciad038h13, full ... 46 0.13
47gb|U49061.1|GHU49061 Gossypium hirsutum alcohol dehydrogenase 2a... 46 0.13
48ref|NM_118332.1| Arabidopsis thaliana oxidoreductase/ zinc ion b... 44 0.52
49ref|NM_202860.1| Arabidopsis thaliana oxidoreductase/ zinc ion b... 44 0.52
50gb|AE017140.1| Yersinia pestis biovar Medievalis str. 91001 sect... 44 0.52
51gb|AC113988.8| Mus musculus chromosome 3, clone RP24-129H9, comp... 44 0.52
52ref|NM_007410.2| Mus musculus alcohol dehydrogenase 5 (class III... 44 0.52
53gb|AE009952.1| Yersinia pestis KIM, complete genome 44 0.52
54ref|XM_847120.1| PREDICTED: Canis familiaris similar to Alcohol ... 44 0.52
55ref|XM_910462.2| PREDICTED: Mus musculus similar to alcohol dehy... 44 0.52
56gb|BC062879.1| Mus musculus alcohol dehydrogenase 5 (class III),... 44 0.52
57ref|XM_532181.2| PREDICTED: Canis familiaris similar to Alcohol ... 44 0.52
58ref|XM_861465.1| PREDICTED: Canis familiaris similar to Alcohol ... 44 0.52
59emb|CR734511.2|CNS0GTJ2 Tetraodon nigroviridis full-length cDNA 44 0.52
60emb|CR733295.2|CNS0GSMY Tetraodon nigroviridis full-length cDNA 44 0.52
61emb|CR733206.2|CNS0GSLK Tetraodon nigroviridis full-length cDNA 44 0.52
62emb|CR732391.2|CNS0GS24 Tetraodon nigroviridis full-length cDNA 44 0.52
63emb|CR732020.2|CNS0GRRT Tetraodon nigroviridis full-length cDNA 44 0.52
64emb|CR731150.2|CNS0GR3N Tetraodon nigroviridis full-length cDNA 44 0.52
65emb|CR731098.2|CNS0GR27 Tetraodon nigroviridis full-length cDNA 44 0.52
66emb|CR730661.2|CNS0GQQ2 Tetraodon nigroviridis full-length cDNA 44 0.52
67emb|CR729939.2|CNS0GQ61 Tetraodon nigroviridis full-length cDNA 44 0.52
68emb|CR729103.2|CNS0GPIT Tetraodon nigroviridis full-length cDNA 44 0.52
69emb|CR728964.2|CNS0GPEY Tetraodon nigroviridis full-length cDNA 44 0.52
70emb|CR728872.2|CNS0GPCE Tetraodon nigroviridis full-length cDNA 44 0.52
71emb|CR728460.2|CNS0GP0Y Tetraodon nigroviridis full-length cDNA 44 0.52
72emb|CR728295.2|CNS0GOWD Tetraodon nigroviridis full-length cDNA 44 0.52
73emb|CR728026.2|CNS0GOOW Tetraodon nigroviridis full-length cDNA 44 0.52
74emb|CR727908.2|CNS0GOLM Tetraodon nigroviridis full-length cDNA 44 0.52
75emb|CR727754.2|CNS0GOHC Tetraodon nigroviridis full-length cDNA 44 0.52
76emb|CR727720.2|CNS0GOGE Tetraodon nigroviridis full-length cDNA 44 0.52
77emb|CR727612.2|CNS0GODE Tetraodon nigroviridis full-length cDNA 44 0.52
78emb|CR726766.2|CNS0GNPW Tetraodon nigroviridis full-length cDNA 44 0.52
79emb|CR726482.2|CNS0GNI0 Tetraodon nigroviridis full-length cDNA 44 0.52
80emb|CR726365.2|CNS0GNER Tetraodon nigroviridis full-length cDNA 44 0.52
81emb|CR726288.2|CNS0GNCM Tetraodon nigroviridis full-length cDNA 44 0.52
82emb|CR726219.2|CNS0GNAP Tetraodon nigroviridis full-length cDNA 44 0.52
83emb|CR724094.2|CNS0GLNO Tetraodon nigroviridis full-length cDNA 44 0.52
84emb|CR723329.2|CNS0GL2F Tetraodon nigroviridis full-length cDNA 44 0.52
85emb|CR704563.2|CNS0G6LB Tetraodon nigroviridis full-length cDNA 44 0.52
86emb|CR654733.2|CNS0F45V Tetraodon nigroviridis full-length cDNA 44 0.52
87emb|CR654293.2|CNS0F3TN Tetraodon nigroviridis full-length cDNA 44 0.52
88emb|CR653759.2|CNS0F3ET Tetraodon nigroviridis full-length cDNA 44 0.52
89emb|CR653547.2|CNS0F38X Tetraodon nigroviridis full-length cDNA 44 0.52
90emb|CR653505.2|CNS0F37R Tetraodon nigroviridis full-length cDNA 44 0.52
91emb|CR653438.2|CNS0F35W Tetraodon nigroviridis full-length cDNA 44 0.52
92emb|CR652814.2|CNS0F2OK Tetraodon nigroviridis full-length cDNA 44 0.52
93emb|CR652161.2|CNS0F26F Tetraodon nigroviridis full-length cDNA 44 0.52
94emb|CR651988.2|CNS0F21M Tetraodon nigroviridis full-length cDNA 44 0.52
95emb|CR651551.2|CNS0F1PH Tetraodon nigroviridis full-length cDNA 44 0.52
96emb|CR650163.2|CNS0F0MX Tetraodon nigroviridis full-length cDNA 44 0.52
97emb|CR648928.2|CNS0EZOM Tetraodon nigroviridis full-length cDNA 44 0.52
98emb|CR648046.2|CNS0EZ04 Tetraodon nigroviridis full-length cDNA 44 0.52
99emb|CR647200.2|CNS0EYCM Tetraodon nigroviridis full-length cDNA 44 0.52
100emb|CR646757.2|CNS0EY0B Tetraodon nigroviridis full-length cDNA 44 0.52
101emb|CR646390.2|CNS0EXQ4 Tetraodon nigroviridis full-length cDNA 44 0.52
102emb|CR646059.2|CNS0EXGX Tetraodon nigroviridis full-length cDNA 44 0.52
103emb|CR644153.2|CNS0EVZZ Tetraodon nigroviridis full-length cDNA 44 0.52
104emb|CR643668.2|CNS0EVMI Tetraodon nigroviridis full-length cDNA 44 0.52
105emb|CR642035.2|CNS0EUD5 Tetraodon nigroviridis full-length cDNA 44 0.52
106emb|CR641585.2|CNS0EU0N Tetraodon nigroviridis full-length cDNA 44 0.52
107emb|CR640922.2|CNS0ETI8 Tetraodon nigroviridis full-length cDNA 44 0.52
108emb|CR640098.2|CNS0ESVC Tetraodon nigroviridis full-length cDNA 44 0.52
109emb|CR639110.2|CNS0ES3W Tetraodon nigroviridis full-length cDNA 44 0.52
110emb|CR638319.2|CNS0ERHX Tetraodon nigroviridis full-length cDNA 44 0.52
111emb|CR638285.2|CNS0ERGZ Tetraodon nigroviridis full-length cDNA 44 0.52
112emb|CR637679.2|CNS0ER05 Tetraodon nigroviridis full-length cDNA 44 0.52
113emb|CR634616.2|CNS0EON2 Tetraodon nigroviridis full-length cDNA 44 0.52
114emb|CR634501.2|CNS0EOJV Tetraodon nigroviridis full-length cDNA 44 0.52
115emb|CR634119.2|CNS0EO99 Tetraodon nigroviridis full-length cDNA 44 0.52
116emb|CR633724.2|CNS0ENYA Tetraodon nigroviridis full-length cDNA 44 0.52
117emb|AL391500.13| Human DNA sequence from clone RP11-707M13 on ch... 44 0.52
118emb|Y15406.1|OCY15406 Oryctolagus cuniculus mRNA for class III a... 44 0.52
119emb|X02915.1|ZMADH2N Zea mays Adh2-N gene for alcohol dehydrogen... 44 0.52
120emb|X01965.1|ZMADH2NR Maize Adh2-N mRNA for alcohol dehydrogenase 2 44 0.52
121emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, comp... 44 0.52
122emb|AJ414145.1| Yersinia pestis strain CO92 complete genome; seg... 44 0.52
123gb|AC079845.31| Mus musculus clone rp23-461a12, complete sequence 44 0.52
124dbj|AK146949.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 44 0.52
125gb|AF344170.1|AF344170 Branchiostoma floridae clone 6121.2 alcoh... 44 0.52
126ref|XM_942836.1| PREDICTED: Homo sapiens similar to Alcohol dehy... 44 0.52
127ref|XM_936495.1| PREDICTED: Homo sapiens similar to Alcohol dehy... 44 0.52
128ref|XM_926158.1| PREDICTED: Homo sapiens similar to Alcohol dehy... 44 0.52
129ref|XM_931030.1| PREDICTED: Homo sapiens similar to Alcohol dehy... 44 0.52
130dbj|AK159803.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 44 0.52
131gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 44 0.52
132dbj|AK002790.1| Mus musculus adult male kidney cDNA, RIKEN full-... 44 0.52
133dbj|AK076507.1| Mus musculus 0 day neonate head cDNA, RIKEN full... 44 0.52
134ref|NG_001339.1| Mus musculus alcohol dehydrogenase 5 (class III... 44 0.52
135emb|BX829257.1|CNS0A3KY Arabidopsis thaliana Full-length cDNA Co... 44 0.52
136dbj|AB191337.1| Wisteria floribunda Wfadh1 mRNA for alcohol dehy... 44 0.52
137gb|AY084215.1| Arabidopsis thaliana clone 100047 mRNA, complete ... 44 0.52
138dbj|AK101288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.52
139gb|AY104300.1| Zea mays PCO072749 mRNA sequence 44 0.52
140gb|AC079832.18| Mus musculus strain C57BL/6J chromosome 3 clone ... 44 0.52
141gb|U48968.1|MMADH2S05 Mus musculus class III alcohol dehydrogena... 44 0.52
142gb|U48971.1|MMU48971 Mus musculus class III alcohol dehydrogenas... 44 0.52
143gb|AY609557.1| Sus scrofa clone Clu_1785.scr.msk.p1.Contig2, mRN... 44 0.52
144gb|BC090978.1| Mus musculus alcohol dehydrogenase 5 (class III),... 44 0.52
145gb|DQ120658.1| Gorilla gorilla rcADH5 gene, partial cds 44 0.52
146gb|DQ120656.1| Homo sapiens rcADH5 gene, partial cds 44 0.52
147gb|M84147.1|MUSADHYD Mouse alcohol dehydrogenase-B2 (Adh-2) mRNA... 44 0.52
148gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 42 2.0
149gb|AY125060.1| Gossypium schwendimanii alcohol dehydrogenase C (... 42 2.0
150emb|CR723665.2|CNS0GLBR Tetraodon nigroviridis full-length cDNA 42 2.0
151emb|CR656355.2|CNS0F5EX Tetraodon nigroviridis full-length cDNA 42 2.0
152emb|CR641168.2|CNS0ETP2 Tetraodon nigroviridis full-length cDNA 42 2.0
153emb|CR639644.2|CNS0ESIQ Tetraodon nigroviridis full-length cDNA 42 2.0
154gb|CP000316.1| Polaromonas sp. JS666, complete genome 42 2.0
155gb|AC123515.2| Oryza sativa (japonica cultivar-group) chromosome... 42 2.0
156gb|AY699123.1| Gossypium lobatum voucher DRD 157 (ISC) alcohol d... 42 2.0
157gb|AY699122.1| Gossypium laxum voucher IA 40-4 (ISC) alcohol deh... 42 2.0
158gb|AY699121.1| Gossypium laxum voucher IA 25-2 (ISC) alcohol deh... 42 2.0
159gb|AY699119.1| Gossypium laxum voucher L. Phillips (ISC) alcohol... 42 2.0
160gb|AY699116.1| Gossypium schwendimanii voucher DRD 56-3 (ISC) al... 42 2.0
161gb|AY699115.1| Gossypium lobatum voucher DRD 161 (ISC) alcohol d... 42 2.0
162gb|AY699110.1| Gossypium armourianum voucher D2-1-7 (ISC) alcoho... 42 2.0
163gb|AY699109.1| Gossypium aridum voucher IA 36-1 (ISC) alcohol de... 42 2.0
164gb|AY699108.1| Gossypium sp. IA 64-1 alcohol dehydrogenase C (Ad... 42 2.0
165gb|AY699106.1| Gossypium aridum voucher IA 1-4 (ISC) alcohol deh... 42 2.0
166gb|AY699105.1| Gossypium aridum voucher DRD 168 (ISC) alcohol de... 42 2.0
167gb|AY699104.1| Gossypium aridum voucher DRD 185 (ISC) alcohol de... 42 2.0
168gb|AF419968.1| Gossypium bickii alcohol dehydrogenase C (AdhC) g... 42 2.0
169gb|AF419966.1| Gossypium anomalum alcohol dehydrogenase C (AdhC)... 42 2.0
170gb|AF403367.1| Gossypium hirsutum D-subgenome BR115 alcohol dehy... 42 2.0
171gb|AF403366.1| Gossypium hirsutum D-subgenome BR115 alcohol dehy... 42 2.0
172gb|AF403365.1| Gossypium hirsutum D-subgenome Deltapine alcohol ... 42 2.0
173gb|AF403364.1| Gossypium hirsutum D-subgenome Deltapine alcohol ... 42 2.0
174gb|AF403363.1| Gossypium hirsutum D-subgenome Paymaster alcohol ... 42 2.0
175gb|AF403362.1| Gossypium hirsutum D-subgenome Paymaster alcohol ... 42 2.0
176gb|AF403361.1| Gossypium hirsutum D-subgenome TX766 alcohol dehy... 42 2.0
177gb|AF403360.1| Gossypium hirsutum D-subgenome TX766 alcohol dehy... 42 2.0
178gb|AF403359.1| Gossypium hirsutum D-subgenome TX706 alcohol dehy... 42 2.0
179gb|AF403358.1| Gossypium hirsutum D-subgenome TX706 alcohol dehy... 42 2.0
180gb|AF403357.1| Gossypium hirsutum D-subgenome TX481 alcohol dehy... 42 2.0
181gb|AF403356.1| Gossypium hirsutum D-subgenome TX367 alcohol dehy... 42 2.0
182gb|AF403355.1| Gossypium hirsutum D-subgenome TX367 alcohol dehy... 42 2.0
183gb|AF403354.1| Gossypium hirsutum D-subgenome TX192 alcohol dehy... 42 2.0
184gb|AF403353.1| Gossypium hirsutum D-subgenome TX192 alcohol dehy... 42 2.0
185gb|AF403352.1| Gossypium hirsutum D-subgenome TX188 alcohol dehy... 42 2.0
186gb|AF403351.1| Gossypium hirsutum D-subgenome TX188 alcohol dehy... 42 2.0
187gb|AF403350.1| Gossypium hirsutum D-subgenome TX166 alcohol dehy... 42 2.0
188gb|AF403349.1| Gossypium hirsutum D-subgenome TX166 alcohol dehy... 42 2.0
189gb|AF403347.1| Gossypium hirsutum D-subgenome TX119 alcohol dehy... 42 2.0
190gb|AF403346.1| Gossypium hirsutum D-subgenome TX116 alcohol dehy... 42 2.0
191gb|AF403344.1| Gossypium hirsutum D-subgenome TX111 alcohol dehy... 42 2.0
192gb|AF403342.1| Gossypium hirsutum D-subgenome TX98 alcohol dehyd... 42 2.0
193gb|AF403340.1| Gossypium hirsutum D-subgenome TX94 alcohol dehyd... 42 2.0
194gb|AF403339.1| Gossypium hirsutum D-subgenome TX93 alcohol dehyd... 42 2.0
195gb|AF403338.1| Gossypium hirsutum D-subgenome TX93 alcohol dehyd... 42 2.0
196gb|AF403332.1| Gossypium hirsutum D-subgenome TX6 alcohol dehydr... 42 2.0
197gb|AF403329.1| Gossypium hirsutum A-subgenome BR115 alcohol dehy... 42 2.0
198gb|AF403328.1| Gossypium hirsutum A-subgenome Deltapine alcohol ... 42 2.0
199gb|AF403327.1| Gossypium hirsutum A-subgenome Paymaster alcohol ... 42 2.0
200gb|AF403326.1| Gossypium hirsutum A-subgenome TX766 alcohol dehy... 42 2.0
201gb|AF403325.1| Gossypium hirsutum A-subgenome TX706 alcohol dehy... 42 2.0
202gb|AF403324.1| Gossypium hirsutum A-subgenome TX481 alcohol dehy... 42 2.0
203gb|AF403323.1| Gossypium hirsutum A-subgenome TX367 alcohol dehy... 42 2.0
204gb|AF403322.1| Gossypium hirsutum A-subgenome TX192 alcohol dehy... 42 2.0
205gb|AF403321.1| Gossypium hirsutum A-subgenome TX188 alcohol dehy... 42 2.0
206gb|AF403320.1| Gossypium hirsutum A-subgenome TX166 alcohol dehy... 42 2.0
207gb|AF403319.1| Gossypium hirsutum A-subgenome TX119 alcohol dehy... 42 2.0
208gb|AF403318.1| Gossypium hirsutum A-subgenome TX116 alcohol dehy... 42 2.0
209gb|AF403317.1| Gossypium hirsutum A-subgenome TX111 alcohol dehy... 42 2.0
210gb|AF403316.1| Gossypium hirsutum A-subgenome TX98 alcohol dehyd... 42 2.0
211gb|AF403315.1| Gossypium hirsutum A-subgenome TX94 alcohol dehyd... 42 2.0
212gb|AF403314.1| Gossypium hirsutum A-subgenome TX93 alcohol dehyd... 42 2.0
213gb|AF403313.1| Gossypium hirsutum A-subgenome TX51 alcohol dehyd... 42 2.0
214gb|AF403312.1| Gossypium hirsutum A-subgenome TX44 alcohol dehyd... 42 2.0
215gb|AF403311.1| Gossypium hirsutum A-subgenome TX21 alcohol dehyd... 42 2.0
216gb|AF403310.1| Gossypium hirsutum A-subgenome TX6 alcohol dehydr... 42 2.0
217gb|AF403309.1| Gossypium hirsutum A-subgenome TX1 alcohol dehydr... 42 2.0
218gb|AF403303.1| Gossypium barbadense A-subgenome B559 alcohol deh... 42 2.0
219gb|AF403302.1| Gossypium barbadense A-subgenome B444 alcohol deh... 42 2.0
220gb|AF403301.1| Gossypium barbadense A-subgenome B250 alcohol deh... 42 2.0
221gb|AF403300.1| Gossypium barbadense A-subgenome B106 alcohol deh... 42 2.0
222gb|AF403299.1| Gossypium barbadense A-subgenome Pima_S5 alcohol ... 42 2.0
223gb|AF326715.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 ... 42 2.0
224gb|AF326714.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 ... 42 2.0
225gb|AF326713.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 ... 42 2.0
226gb|AF326712.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 ... 42 2.0
227gb|AF326711.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 ... 42 2.0
228gb|AF326710.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 ... 42 2.0
229gb|AF326709.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 ... 42 2.0
230gb|AF326708.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 ... 42 2.0
231gb|AF326707.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 ... 42 2.0
232gb|AF326706.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 ... 42 2.0
233gb|AF326705.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 ... 42 2.0
234gb|AF326704.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 ... 42 2.0
235dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
236dbj|AK214149.1| Mus musculus cDNA, clone:Y2G0130N04, strand:minu... 42 2.0
237gb|AY104598.1| Zea mays PCO147721 mRNA sequence 42 2.0
238gb|AF036579.1|AF036579 Gossypium darwinii A-subgenome alcohol de... 42 2.0
239gb|AF036578.1|AF036578 Gossypium barbadense A-subgenome alcohol ... 42 2.0
240gb|AF036577.1|AF036577 Gossypium mustelinum A-subgenome alcohol ... 42 2.0
241gb|AF036576.1|AF036576 Gossypium tomentosum A-subgenome alcohol ... 42 2.0
242gb|AF036575.1|AF036575 Gossypium hirsutum A-subgenome alcohol de... 42 2.0
243gb|AF036574.1|AF036574 Gossypium arboreum alcohol dehydrogenase ... 42 2.0
244gb|AF036572.1|AF036572 Gossypium mustelinum D-subgenome alcohol ... 42 2.0
245gb|AF036571.1|AF036571 Gossypium tomentosum D-subgenome alcohol ... 42 2.0
246gb|AF036569.1|AF036569 Gossypium hirsutum D-subgenome alcohol de... 42 2.0
247gb|AF036568.1|AF036568 Gossypium raimondii alcohol dehydrogenase... 42 2.0
248gb|AF036567.1|AF036567 Gossypium robinsonii alcohol dehydrogenas... 42 2.0
249gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 42 2.0
250gb|BC038239.1| Homo sapiens tyrosine kinase with immunoglobulin-... 40 8.1
251ref|NM_105146.4| Arabidopsis thaliana S-adenosylmethionine-depen... 40 8.1
252gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence 40 8.1
253ref|XM_522246.1| PREDICTED: Pan troglodytes similar to ATP-sensi... 40 8.1
254ref|NM_005424.2| Homo sapiens tyrosine kinase with immunoglobuli... 40 8.1
255ref|NM_187678.1| Oryza sativa (japonica cultivar-group), predic... 40 8.1
256ref|XM_362223.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 8.1
257gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 40 8.1
258ref|XM_425910.1| PREDICTED: Gallus gallus similar to TR4 orphan ... 40 8.1
259gb|BC046452.1| Mus musculus tyrosine kinase receptor 1, mRNA (cD... 40 8.1
260gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 8.1
261gb|AC146699.5| Mus musculus chromosome 6, clone RP24-211G11, com... 40 8.1
262gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complet... 40 8.1
263gb|AY125061.1| Gossypium trilobum alcohol dehydrogenase C (AdhC)... 40 8.1
264gb|AF355139.1| Saimiri sciureus clone SSCTUB beta-tubulin 4Q (TU... 40 8.1
265gb|AY434519.1| Bouteloua dimorpha haplotype 1 specimen voucher C... 40 8.1
266gb|AY434517.1| Bouteloua dimorpha haplotype 1 specimen voucher C... 40 8.1
267gb|AY434515.1| Bouteloua dimorpha haplotype 1 specimen voucher C... 40 8.1
268gb|AY434514.1| Bouteloua dimorpha haplotype 3 specimen voucher C... 40 8.1
269gb|AY434513.1| Bouteloua dimorpha haplotype 2 specimen voucher C... 40 8.1
270gb|AY434512.1| Bouteloua dimorpha haplotype 1 specimen voucher C... 40 8.1
271gb|AY434508.1| Bouteloua dimorpha haplotype 1 specimen voucher C... 40 8.1
272gb|AY434503.1| Bouteloua dimorpha haplotype 3 specimen voucher C... 40 8.1
273gb|AY434502.1| Bouteloua dimorpha haplotype 2 specimen voucher C... 40 8.1
274gb|AY434501.1| Bouteloua dimorpha haplotype 1 specimen voucher C... 40 8.1
275gb|BC046853.1| Xenopus laevis similar to tubulin, beta, 2, mRNA ... 40 8.1
276gb|BC060182.1| Mus musculus tyrosine kinase receptor 1, mRNA (cD... 40 8.1
277emb|CR733643.2|CNS0GSUY Tetraodon nigroviridis full-length cDNA 40 8.1
278gb|AC123686.11| Mus musculus chromosome 5, clone RP23-301L9, com... 40 8.1
279gb|BC057004.1| Mus musculus tyrosine kinase receptor 1, mRNA (cD... 40 8.1
280emb|CR644821.2|CNS0EWIJ Tetraodon nigroviridis full-length cDNA 40 8.1
281emb|X60957.1|HSTIEMR Human tie mRNA for putative receptor tyrosi... 40 8.1
282emb|AL139289.6| Human DNA sequence from clone RP1-92O14 on chrom... 40 8.1
283emb|X80764.1|MMTIE1 M.musculus TIE1 mRNA 40 8.1
284emb|X73960.1|MMTIERTK M.musculus mRNA for TIE receptor tyrosine ... 40 8.1
285emb|X71425.1|MMTIE1A M.musculus Tie 1 mRNA 40 8.1
286gb|AY065250.1| Arabidopsis thaliana putative alcohol dehydrogena... 40 8.1
287emb|BX640451.1| Bordetella bronchiseptica strain RB50, complete ... 40 8.1
288emb|BX640436.1| Bordetella parapertussis strain 12822, complete ... 40 8.1
289emb|BX640422.1| Bordetella pertussis strain Tohama I, complete g... 40 8.1
290dbj|AK061930.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.1
291gb|AC093420.2| Homo sapiens chromosome 1 clone RP11-282K6, compl... 40 8.1
292emb|CR601214.1| full-length cDNA clone CS0DI005YC03 of Placenta ... 40 8.1
293ref|NM_011587.1| Mus musculus tyrosine kinase receptor 1 (Tie1),... 40 8.1
294dbj|AK161898.1| Mus musculus adult male medulla oblongata cDNA, ... 40 8.1
295gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 255... 40 8.1
296gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 8.1
297dbj|AK052413.1| Mus musculus 13 days embryo lung cDNA, RIKEN ful... 40 8.1
298dbj|AK052192.1| Mus musculus 13 days embryo heart cDNA, RIKEN fu... 40 8.1
299gb|BT006064.1| Arabidopsis thaliana clone U18874 putative alcoho... 40 8.1
300dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
301emb|BX815187.1|CNS0ABHD Arabidopsis thaliana Full-length cDNA Co... 40 8.1
302emb|BX815807.1|CNS0AAGM Arabidopsis thaliana Full-length cDNA Co... 40 8.1
303gb|AF217976.1|AF217976 Homo sapiens clone PP1440 unknown mRNA 40 8.1
304ref|XM_233462.3| PREDICTED: Rattus norvegicus tyrosine kinase re... 40 8.1
305gb|AF201888.1|AF201888 Gossypioides kirkii alcohol dehydrogenase... 40 8.1
306dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 8.1
307gb|AY893044.1| Synthetic construct Homo sapiens clone FLH140313.... 40 8.1
308ref|NM_210000.1| Eremothecium gossypii AEL214Cp (AEL214C), mRNA 40 8.1
309dbj|AK066331.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.1
310gb|CP000009.1| Gluconobacter oxydans 621H, complete genome 40 8.1
311gb|BC085911.1| Rattus norvegicus tyrosine kinase with immunoglob... 40 8.1
312emb|AL627212.21| Mouse DNA sequence from clone RP23-145E1 on chr... 40 8.1
313gb|AC118226.7| Mus musculus chromosome 5, clone RP23-372N19, com... 40 8.1
314gb|AC121489.2| Oryza sativa (japonica cultivar-group) chromosome... 40 8.1
315dbj|D85134.1| Bombyx mori mRNA for Bm cdc2, complete cds 40 8.1
316dbj|AP000426.3| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 8.1

>dbj|AK060781.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-C06, full
           insert sequence
          Length = 1318

 Score =  414 bits (209), Expect = e-112
 Identities = 476/564 (84%), Gaps = 1/564 (0%)
 Strand = Plus / Plus

                                                                       
Query: 5   ctcaacacgtccaccttcgccgantacaccgtgctcgacgccgcctgcgccgtcaagnat 64
           |||||||| |||||||| || || ||||| ||| | ||| |||| ||||| |||||| ||
Sbjct: 282 ctcaacacttccacctttgctgagtacactgtgattgactccgcttgcgctgtcaag-at 340

                                                                       
Query: 65  caaccccgccgccccgctggagaagatgtgcctcctcagctgtggcatctcaaccggagt 124
           ||||||    || ||  ||||||||||| | ||||||||||||||  |||| || |||||
Sbjct: 341 caaccctaaggctcccttggagaagatgagtctcctcagctgtggggtctccacaggagt 400

                                                                       
Query: 125 gggagctgcatggaacactgcaaacgtgtccaagggatccacggtcgcaatatttggact 184
           ||||||||||||||||||||||||||| |||||||| ||||| || ||||||||||| ||
Sbjct: 401 gggagctgcatggaacactgcaaacgtctccaaggggtccacagtggcaatatttgggct 460

                                                                       
Query: 185 tggtgcagttggtcttgcggttggtgaaggcgcaagaataaggggggcatcccggatcat 244
           ||||||  |||||||||||||||  ||||| || ||| |||| || ||||| || |||||
Sbjct: 461 tggtgccattggtcttgcggttgccgaaggtgccagattaagaggagcatctcgaatcat 520

                                                                       
Query: 245 cggcgtggacatcaatcctgaaaagttcgccaaaggcaaagagatgggcatcacggattt 304
           ||| || ||||| || |||||||| ||| ||||||||||||||||||||||||| || ||
Sbjct: 521 cggagttgacataaaccctgaaaaattctccaaaggcaaagagatgggcatcactgactt 580

                                                                       
Query: 305 catcaacgcaaaggcgtgcggcaaacctgtccacgaggtgatcagggagttgacagatgg 364
           ||||||| | ||||| |  ||||| |||||||||||||| |||| |||| ||||||||||
Sbjct: 581 catcaactcgaaggcatctggcaagcctgtccacgaggttatcatggagatgacagatgg 640

                                                                       
Query: 365 gggcgtcgactacagcttcgagtgcagtggcaacgttgatgtgcttcgagaggccttcgt 424
            || ||||||||||||||||||||||  |||| |   ||||| || || |||||||||||
Sbjct: 641 cggtgtcgactacagcttcgagtgcaccggcatcaccgatgttctacgggaggccttcgt 700

                                                                       
Query: 425 ttccacacacgacggttggggattgaccgtggtgctggggatccatccgacccccaggat 484
           ||||||||| || || |||||  ||||||| ||||||||||||||| | || ||||||||
Sbjct: 701 ttccacacatgatggatggggcctgaccgttgtgctggggatccatgcaacgcccaggat 760

                                                                       
Query: 485 gatgccgctgcatcccatggagctcttcgacggccgtcggatcacaggatccgtctttgg 544
           | ||||||||||||| |||||| | || ||||||||||||||||| || | ||| |||||
Sbjct: 761 gctgccgctgcatccaatggagttatttgacggccgtcggatcactggctgcgtttttgg 820

                                   
Query: 545 tgacttcaagggcaagtcgcagct 568
           |||||||||||| ||||| |||||
Sbjct: 821 tgacttcaagggaaagtcccagct 844



to top

>dbj|AK104537.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-G02, full
            insert sequence
          Length = 1323

 Score =  406 bits (205), Expect = e-110
 Identities = 475/564 (84%), Gaps = 1/564 (0%)
 Strand = Plus / Plus

                                                                        
Query: 5    ctcaacacgtccaccttcgccgantacaccgtgctcgacgccgcctgcgccgtcaagnat 64
            |||||||| |||||||| || || ||||| ||| | ||| |||| ||||| |||||| ||
Sbjct: 553  ctcaacacttccacctttgctgagtacactgtgattgactccgcttgcgctgtcaag-at 611

                                                                        
Query: 65   caaccccgccgccccgctggagaagatgtgcctcctcagctgtggcatctcaaccggagt 124
            ||||||    || ||  ||||||||||| | ||||||||||||||  |||| || |||||
Sbjct: 612  caaccctaaggctcccttggagaagatgagtctcctcagctgtggggtctccacaggagt 671

                                                                        
Query: 125  gggagctgcatggaacactgcaaacgtgtccaagggatccacggtcgcaatatttggact 184
            ||||||||||||||||||||||||||| |||||||| ||||| || ||||||||||| ||
Sbjct: 672  gggagctgcatggaacactgcaaacgtctccaaggggtccacagtggcaatatttgggct 731

                                                                        
Query: 185  tggtgcagttggtcttgcggttggtgaaggcgcaagaataaggggggcatcccggatcat 244
            ||||||  |||||||||||||||  ||||| || ||| | || || ||||| || |||||
Sbjct: 732  tggtgccattggtcttgcggttgccgaaggtgccagattgagaggagcatctcgaatcat 791

                                                                        
Query: 245  cggcgtggacatcaatcctgaaaagttcgccaaaggcaaagagatgggcatcacggattt 304
            ||| || ||||| || |||||||| ||| ||||||||||||||||||||||||| || ||
Sbjct: 792  cggagttgacataaaccctgaaaaattctccaaaggcaaagagatgggcatcactgactt 851

                                                                        
Query: 305  catcaacgcaaaggcgtgcggcaaacctgtccacgaggtgatcagggagttgacagatgg 364
            ||||||| | ||||| |  ||||| |||||||||||||| |||| |||| ||||||||||
Sbjct: 852  catcaactcgaaggcatctggcaagcctgtccacgaggttatcatggagatgacagatgg 911

                                                                        
Query: 365  gggcgtcgactacagcttcgagtgcagtggcaacgttgatgtgcttcgagaggccttcgt 424
             || ||||||||||||||||||||||  |||| |   ||||| || || |||||||||||
Sbjct: 912  cggtgtcgactacagcttcgagtgcaccggcatcaccgatgttctacgggaggccttcgt 971

                                                                        
Query: 425  ttccacacacgacggttggggattgaccgtggtgctggggatccatccgacccccaggat 484
            ||||||||| || || |||||  ||||||| ||||||||||||||| | || ||||||||
Sbjct: 972  ttccacacatgatggatggggcctgaccgttgtgctggggatccatgcaacgcccaggat 1031

                                                                        
Query: 485  gatgccgctgcatcccatggagctcttcgacggccgtcggatcacaggatccgtctttgg 544
            | ||||||||||||| |||||| | || ||||||||||||||||| || | ||| |||||
Sbjct: 1032 gctgccgctgcatccaatggagttatttgacggccgtcggatcactggctgcgtttttgg 1091

                                    
Query: 545  tgacttcaagggcaagtcgcagct 568
            |||||||||||| ||||| |||||
Sbjct: 1092 tgacttcaagggaaagtcccagct 1115



to top

>dbj|AK065882.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013048H02, full
            insert sequence
          Length = 1506

 Score =  406 bits (205), Expect = e-110
 Identities = 475/564 (84%), Gaps = 1/564 (0%)
 Strand = Plus / Plus

                                                                        
Query: 5    ctcaacacgtccaccttcgccgantacaccgtgctcgacgccgcctgcgccgtcaagnat 64
            |||||||| |||||||| || || ||||| ||| | ||| |||| ||||| |||||| ||
Sbjct: 552  ctcaacacttccacctttgctgagtacactgtgattgactccgcttgcgctgtcaag-at 610

                                                                        
Query: 65   caaccccgccgccccgctggagaagatgtgcctcctcagctgtggcatctcaaccggagt 124
            ||||||    || ||  ||||||||||| | ||||||||||||||  |||| || |||||
Sbjct: 611  caaccctaaggctcccttggagaagatgagtctcctcagctgtggggtctccacaggagt 670

                                                                        
Query: 125  gggagctgcatggaacactgcaaacgtgtccaagggatccacggtcgcaatatttggact 184
            ||||||||||||||||||||||||||| |||||||| ||||| || ||||||||||| ||
Sbjct: 671  gggagctgcatggaacactgcaaacgtctccaaggggtccacagtggcaatatttgggct 730

                                                                        
Query: 185  tggtgcagttggtcttgcggttggtgaaggcgcaagaataaggggggcatcccggatcat 244
            ||||||  |||||||||||||||  ||||| || ||| | || || ||||| || |||||
Sbjct: 731  tggtgccattggtcttgcggttgccgaaggtgccagattgagaggagcatctcgaatcat 790

                                                                        
Query: 245  cggcgtggacatcaatcctgaaaagttcgccaaaggcaaagagatgggcatcacggattt 304
            ||| || ||||| || |||||||| ||| ||||||||||||||||||||||||| || ||
Sbjct: 791  cggagttgacataaaccctgaaaaattctccaaaggcaaagagatgggcatcactgactt 850

                                                                        
Query: 305  catcaacgcaaaggcgtgcggcaaacctgtccacgaggtgatcagggagttgacagatgg 364
            ||||||| | ||||| |  ||||| |||||||||||||| |||| |||| ||||||||||
Sbjct: 851  catcaactcgaaggcatctggcaagcctgtccacgaggttatcatggagatgacagatgg 910

                                                                        
Query: 365  gggcgtcgactacagcttcgagtgcagtggcaacgttgatgtgcttcgagaggccttcgt 424
             || ||||||||||||||||||||||  |||| |   ||||| || || |||||||||||
Sbjct: 911  cggtgtcgactacagcttcgagtgcaccggcatcaccgatgttctacgggaggccttcgt 970

                                                                        
Query: 425  ttccacacacgacggttggggattgaccgtggtgctggggatccatccgacccccaggat 484
            ||||||||| || || |||||  ||||||| ||||||||||||||| | || ||||||||
Sbjct: 971  ttccacacatgatggatggggcctgaccgttgtgctggggatccatgcaacgcccaggat 1030

                                                                        
Query: 485  gatgccgctgcatcccatggagctcttcgacggccgtcggatcacaggatccgtctttgg 544
            | ||||||||||||| |||||| | || ||||||||||||||||| || | ||| |||||
Sbjct: 1031 gctgccgctgcatccaatggagttatttgacggccgtcggatcactggctgcgtttttgg 1090

                                    
Query: 545  tgacttcaagggcaagtcgcagct 568
            |||||||||||| ||||| |||||
Sbjct: 1091 tgacttcaagggaaagtcccagct 1114



to top

>dbj|AK061577.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-G11, full
            insert sequence
          Length = 1323

 Score =  398 bits (201), Expect = e-108
 Identities = 474/564 (84%), Gaps = 1/564 (0%)
 Strand = Plus / Plus

                                                                        
Query: 5    ctcaacacgtccaccttcgccgantacaccgtgctcgacgccgcctgcgccgtcaagnat 64
            |||||||| |||||||| || || ||||| ||| | ||| |||| ||||| |||||| ||
Sbjct: 551  ctcaacacttccacctttgctgagtacactgtgattgactccgcttgcgctgtcaag-at 609

                                                                        
Query: 65   caaccccgccgccccgctggagaagatgtgcctcctcagctgtggcatctcaaccggagt 124
            ||||||    || ||  ||||||||||| | ||||||||||||||  |||| || |||||
Sbjct: 610  caaccctaaggctcccttggagaagatgagtctcctcagctgtggggtctccacaggagt 669

                                                                        
Query: 125  gggagctgcatggaacactgcaaacgtgtccaagggatccacggtcgcaatatttggact 184
            ||||||||||||||||||||||||||| |||||||| ||||| || ||||||||||| ||
Sbjct: 670  gggagctgcatggaacactgcaaacgtctccaaggggtccacagtggcaatatttgggct 729

                                                                        
Query: 185  tggtgcagttggtcttgcggttggtgaaggcgcaagaataaggggggcatcccggatcat 244
            ||||||   ||||||||||||||  ||||| || ||| | || || ||||| || |||||
Sbjct: 730  tggtgccactggtcttgcggttgccgaaggtgccagattgagaggagcatctcgaatcat 789

                                                                        
Query: 245  cggcgtggacatcaatcctgaaaagttcgccaaaggcaaagagatgggcatcacggattt 304
            ||| || ||||| || |||||||| ||| ||||||||||||||||||||||||| || ||
Sbjct: 790  cggagttgacataaaccctgaaaaattctccaaaggcaaagagatgggcatcactgactt 849

                                                                        
Query: 305  catcaacgcaaaggcgtgcggcaaacctgtccacgaggtgatcagggagttgacagatgg 364
            ||||||| | ||||| |  ||||| |||||||||||||| |||| |||| ||||||||||
Sbjct: 850  catcaactcgaaggcatctggcaagcctgtccacgaggttatcatggagatgacagatgg 909

                                                                        
Query: 365  gggcgtcgactacagcttcgagtgcagtggcaacgttgatgtgcttcgagaggccttcgt 424
             || ||||||||||||||||||||||  |||| |   ||||| || || |||||||||||
Sbjct: 910  cggtgtcgactacagcttcgagtgcaccggcatcaccgatgttctacgggaggccttcgt 969

                                                                        
Query: 425  ttccacacacgacggttggggattgaccgtggtgctggggatccatccgacccccaggat 484
            ||||||||| || || |||||  ||||||| ||||||||||||||| | || ||||||||
Sbjct: 970  ttccacacatgatggatggggcctgaccgttgtgctggggatccatgcaacgcccaggat 1029

                                                                        
Query: 485  gatgccgctgcatcccatggagctcttcgacggccgtcggatcacaggatccgtctttgg 544
            | ||||||||||||| |||||| | || ||||||||||||||||| || | ||| |||||
Sbjct: 1030 gctgccgctgcatccaatggagttatttgacggccgtcggatcactggctgcgtttttgg 1089

                                    
Query: 545  tgacttcaagggcaagtcgcagct 568
            |||||||||||| ||||| |||||
Sbjct: 1090 tgacttcaaggggaagtcccagct 1113



to top

>ref|NM_194962.1| Oryza sativa (japonica cultivar-group) putative alcohol
           dehydrogenase (OSJNAa0036D19.15), mRNA
          Length = 429

 Score =  224 bits (113), Expect = 3e-55
 Identities = 239/281 (85%)
 Strand = Plus / Plus

                                                                       
Query: 288 atgggcatcacggatttcatcaacgcaaaggcgtgcggcaaacctgtccacgaggtgatc 347
           ||||||||||| || ||||||||| | ||||| |  ||||| |||||||||||||| |||
Sbjct: 1   atgggcatcactgacttcatcaactcgaaggcatctggcaagcctgtccacgaggttatc 60

                                                                       
Query: 348 agggagttgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgttgatgtg 407
           | |||| |||||||||| || ||||||||||||||||||||||  |||| |   ||||| 
Sbjct: 61  atggagatgacagatggcggtgtcgactacagcttcgagtgcaccggcatcaccgatgtt 120

                                                                       
Query: 408 cttcgagaggccttcgtttccacacacgacggttggggattgaccgtggtgctggggatc 467
           || || |||||||||||||||||||| || || |||||  ||||||| ||||||||||||
Sbjct: 121 ctacgggaggccttcgtttccacacatgatggatggggcctgaccgttgtgctggggatc 180

                                                                       
Query: 468 catccgacccccaggatgatgccgctgcatcccatggagctcttcgacggccgtcggatc 527
           ||| | || ||||||||| ||||||||||||| |||||| | || |||||||||||||||
Sbjct: 181 catgcaacgcccaggatgctgccgctgcatccaatggagttatttgacggccgtcggatc 240

                                                    
Query: 528 acaggatccgtctttggtgacttcaagggcaagtcgcagct 568
           || || | ||| ||||||||||||||||| ||||| |||||
Sbjct: 241 actggctgcgtttttggtgacttcaagggaaagtcccagct 281



to top

>dbj|AK061007.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-204-A07, full
           insert sequence
          Length = 1295

 Score =  168 bits (85), Expect = 1e-38
 Identities = 229/276 (82%), Gaps = 1/276 (0%)
 Strand = Plus / Plus

                                                                       
Query: 5   ctcaacacgtccaccttcgccgantacaccgtgctcgacgccgcctgcgccgtcaagnat 64
           |||||||| |||||||| || || ||||| ||| | ||| |||| ||||| |||||| ||
Sbjct: 551 ctcaacacttccacctttgctgagtacactgtgattgactccgcttgcgctgtcaag-at 609

                                                                       
Query: 65  caaccccgccgccccgctggagaagatgtgcctcctcagctgtggcatctcaaccggagt 124
           ||||||    || ||  ||||||||||| | ||||||||||||||  |||| || |||||
Sbjct: 610 caaccctaaggctcccttggagaagatgagtctcctcagctgtggggtctccacaggagt 669

                                                                       
Query: 125 gggagctgcatggaacactgcaaacgtgtccaagggatccacggtcgcaatatttggact 184
           ||||||||||||||||||||||||||| |||||||| ||||| || ||||||||||| ||
Sbjct: 670 gggagctgcatggaacactgcaaacgtctccaaggggtccacagtggcaatatttgggct 729

                                                                       
Query: 185 tggtgcagttggtcttgcggttggtgaaggcgcaagaataaggggggcatcccggatcat 244
           ||||||  |||||||||||||||  ||||| || ||| | || || ||||| || |||||
Sbjct: 730 tggtgccattggtcttgcggttgccgaaggtgccagattgagaggagcatctcgaatcat 789

                                               
Query: 245 cggcgtggacatcaatcctgaaaagttcgccaaagg 280
           ||| || ||||| || |||||||| ||| |||||||
Sbjct: 790 cggagttgacataaaccctgaaaaattctccaaagg 825



to top

>ref|NM_194963.1| Oryza sativa (japonica cultivar-group) putative alcohol
           dehydrogenase (OSJNBa0050E08.9), mRNA
          Length = 1014

 Score =  167 bits (84), Expect = 5e-38
 Identities = 228/275 (82%), Gaps = 1/275 (0%)
 Strand = Plus / Plus

                                                                       
Query: 5   ctcaacacgtccaccttcgccgantacaccgtgctcgacgccgcctgcgccgtcaagnat 64
           |||||||| |||||||| || || ||||| ||| | ||| |||| ||||| |||||| ||
Sbjct: 502 ctcaacacttccacctttgctgagtacactgtgattgactccgcttgcgctgtcaag-at 560

                                                                       
Query: 65  caaccccgccgccccgctggagaagatgtgcctcctcagctgtggcatctcaaccggagt 124
           ||||||    || ||  ||||||||||| | ||||||||||||||  |||| || |||||
Sbjct: 561 caaccctaaggctcccttggagaagatgagtctcctcagctgtggggtctccacaggagt 620

                                                                       
Query: 125 gggagctgcatggaacactgcaaacgtgtccaagggatccacggtcgcaatatttggact 184
           ||||||||||||||||||||||||||| |||||||| ||||| || ||||||||||| ||
Sbjct: 621 gggagctgcatggaacactgcaaacgtctccaaggggtccacagtggcaatatttgggct 680

                                                                       
Query: 185 tggtgcagttggtcttgcggttggtgaaggcgcaagaataaggggggcatcccggatcat 244
           ||||||  |||||||||||||||  ||||| || ||| | || || ||||| || |||||
Sbjct: 681 tggtgccattggtcttgcggttgccgaaggtgccagattgagaggagcatctcgaatcat 740

                                              
Query: 245 cggcgtggacatcaatcctgaaaagttcgccaaag 279
           ||| || ||||| || |||||||| ||| ||||||
Sbjct: 741 cggagttgacataaaccctgaaaaattctccaaag 775



to top

>gb|AC116600.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNAa0036D19,
              complete sequence
          Length = 126686

 Score =  121 bits (61), Expect = 3e-24
 Identities = 106/121 (87%)
 Strand = Plus / Minus

                                                                          
Query: 448    tgaccgtggtgctggggatccatccgacccccaggatgatgccgctgcatcccatggagc 507
              ||||||| ||||||||||||||| | || ||||||||| ||||||||||||| |||||| 
Sbjct: 122109 tgaccgttgtgctggggatccatgcaacgcccaggatgctgccgctgcatccaatggagt 122050

                                                                          
Query: 508    tcttcgacggccgtcggatcacaggatccgtctttggtgacttcaagggcaagtcgcagc 567
              | || ||||||||||||||||| || | ||| ||||||||||||||||| ||||| ||||
Sbjct: 122049 tatttgacggccgtcggatcactggctgcgtttttggtgacttcaagggaaagtcccagc 121990

               
Query: 568    t 568
              |
Sbjct: 121989 t 121989



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 80/94 (85%)
 Strand = Plus / Minus

                                                                          
Query: 340    aggtgatcagggagttgacagatgggggcgtcgactacagcttcgagtgcagtggcaacg 399
              |||| |||| |||| |||||||||| || ||||||||||||||||||||||  |||| | 
Sbjct: 122337 aggttatcatggagatgacagatggcggtgtcgactacagcttcgagtgcaccggcatca 122278

                                                
Query: 400    ttgatgtgcttcgagaggccttcgtttccacaca 433
                ||||| || || ||||||||||||||||||||
Sbjct: 122277 ccgatgttctacgggaggccttcgtttccacaca 122244



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 278    aggcaaagagatgggcatcacggatttcatcaacgcaaaggcgtgcggcaaacctgtcca 337
              ||||||||||||||||||||| || ||||||||| | ||||| |  ||||| ||||||||
Sbjct: 122501 aggcaaagagatgggcatcactgacttcatcaactcgaaggcatctggcaagcctgtcca 122442

                    
Query: 338    cgaggt 343
              ||||||
Sbjct: 122441 cgaggt 122436



to top

>gb|AC098696.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone
             OSJNBa0050E08, complete sequence
          Length = 180499

 Score =  121 bits (61), Expect = 3e-24
 Identities = 106/121 (87%)
 Strand = Plus / Minus

                                                                         
Query: 448   tgaccgtggtgctggggatccatccgacccccaggatgatgccgctgcatcccatggagc 507
             ||||||| ||||||||||||||| | || ||||||||| ||||||||||||| |||||| 
Sbjct: 55423 tgaccgttgtgctggggatccatgcaacgcccaggatgctgccgctgcatccaatggagt 55364

                                                                         
Query: 508   tcttcgacggccgtcggatcacaggatccgtctttggtgacttcaagggcaagtcgcagc 567
             | || ||||||||||||||||| || | ||| ||||||||||||||||| ||||| ||||
Sbjct: 55363 tatttgacggccgtcggatcactggctgcgtttttggtgacttcaagggaaagtcccagc 55304

              
Query: 568   t 568
             |
Sbjct: 55303 t 55303



 Score =  115 bits (58), Expect = 2e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                         
Query: 120   ggagtgggagctgcatggaacactgcaaacgtgtccaagggatccacggtcgcaatattt 179
             |||||||||||||||||||||||||||||||| |||||||| ||||| || |||||||||
Sbjct: 61085 ggagtgggagctgcatggaacactgcaaacgtctccaaggggtccacagtggcaatattt 61026

                                       
Query: 180   ggacttggtgcagttggtcttgcggt 205
             || ||||||||  |||||||||||||
Sbjct: 61025 gggcttggtgccattggtcttgcggt 61000



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 80/94 (85%)
 Strand = Plus / Minus

                                                                         
Query: 340   aggtgatcagggagttgacagatgggggcgtcgactacagcttcgagtgcagtggcaacg 399
             |||| |||| |||| |||||||||| || ||||||||||||||||||||||  |||| | 
Sbjct: 55651 aggttatcatggagatgacagatggcggtgtcgactacagcttcgagtgcaccggcatca 55592

                                               
Query: 400   ttgatgtgcttcgagaggccttcgtttccacaca 433
               ||||| || || ||||||||||||||||||||
Sbjct: 55591 ccgatgttctacgggaggccttcgtttccacaca 55558



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                         
Query: 278   aggcaaagagatgggcatcacggatttcatcaacgcaaaggcgtgcggcaaacctgtcca 337
             ||||||||||||||||||||| || ||||||||| | ||||| |  ||||| ||||||||
Sbjct: 55815 aggcaaagagatgggcatcactgacttcatcaactcgaaggcatctggcaagcctgtcca 55756

                   
Query: 338   cgaggt 343
             ||||||
Sbjct: 55755 cgaggt 55750



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 85/105 (80%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                         
Query: 5     ctcaacacgtccaccttcgccgantacaccgtgctcgacgccgcctgcgccgtcaagnat 64
             |||||||| |||||||| || || ||||| ||| | ||| |||| ||||| |||||| ||
Sbjct: 62366 ctcaacacttccacctttgctgagtacactgtgattgactccgcttgcgctgtcaag-at 62308

                                                          
Query: 65    caaccccgccgccccgctggagaagatgtgcctcctcagctgtgg 109
             ||||||    || ||  ||||||||||| | ||||||||||||||
Sbjct: 62307 caaccctaaggctcccttggagaagatgagtctcctcagctgtgg 62263



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score =  121 bits (61), Expect = 3e-24
 Identities = 106/121 (87%)
 Strand = Plus / Minus

                                                                           
Query: 448     tgaccgtggtgctggggatccatccgacccccaggatgatgccgctgcatcccatggagc 507
               ||||||| ||||||||||||||| | || ||||||||| ||||||||||||| |||||| 
Sbjct: 3773627 tgaccgttgtgctggggatccatgcaacgcccaggatgctgccgctgcatccaatggagt 3773568

                                                                           
Query: 508     tcttcgacggccgtcggatcacaggatccgtctttggtgacttcaagggcaagtcgcagc 567
               | || ||||||||||||||||| || | ||| ||||||||||||||||| ||||| ||||
Sbjct: 3773567 tatttgacggccgtcggatcactggctgcgtttttggtgacttcaagggaaagtcccagc 3773508

                
Query: 568     t 568
               |
Sbjct: 3773507 t 3773507



 Score =  115 bits (58), Expect = 2e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                           
Query: 120     ggagtgggagctgcatggaacactgcaaacgtgtccaagggatccacggtcgcaatattt 179
               |||||||||||||||||||||||||||||||| |||||||| ||||| || |||||||||
Sbjct: 3779289 ggagtgggagctgcatggaacactgcaaacgtctccaaggggtccacagtggcaatattt 3779230

                                         
Query: 180     ggacttggtgcagttggtcttgcggt 205
               || ||||||||  |||||||||||||
Sbjct: 3779229 gggcttggtgccattggtcttgcggt 3779204



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 80/94 (85%)
 Strand = Plus / Minus

                                                                           
Query: 340     aggtgatcagggagttgacagatgggggcgtcgactacagcttcgagtgcagtggcaacg 399
               |||| |||| |||| |||||||||| || ||||||||||||||||||||||  |||| | 
Sbjct: 3773855 aggttatcatggagatgacagatggcggtgtcgactacagcttcgagtgcaccggcatca 3773796

                                                 
Query: 400     ttgatgtgcttcgagaggccttcgtttccacaca 433
                 ||||| || || ||||||||||||||||||||
Sbjct: 3773795 ccgatgttctacgggaggccttcgtttccacaca 3773762



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                           
Query: 278     aggcaaagagatgggcatcacggatttcatcaacgcaaaggcgtgcggcaaacctgtcca 337
               ||||||||||||||||||||| || ||||||||| | ||||| |  ||||| ||||||||
Sbjct: 3774019 aggcaaagagatgggcatcactgacttcatcaactcgaaggcatctggcaagcctgtcca 3773960

                     
Query: 338     cgaggt 343
               ||||||
Sbjct: 3773959 cgaggt 3773954



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 85/105 (80%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                           
Query: 5       ctcaacacgtccaccttcgccgantacaccgtgctcgacgccgcctgcgccgtcaagnat 64
               |||||||| |||||||| || || ||||| ||| | ||| |||| ||||| |||||| ||
Sbjct: 3780570 ctcaacacttccacctttgctgagtacactgtgattgactccgcttgcgctgtcaag-at 3780512

                                                            
Query: 65      caaccccgccgccccgctggagaagatgtgcctcctcagctgtgg 109
               ||||||    || ||  ||||||||||| | ||||||||||||||
Sbjct: 3780511 caaccctaaggctcccttggagaagatgagtctcctcagctgtgg 3780467



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  121 bits (61), Expect = 3e-24
 Identities = 106/121 (87%)
 Strand = Plus / Minus

                                                                           
Query: 448     tgaccgtggtgctggggatccatccgacccccaggatgatgccgctgcatcccatggagc 507
               ||||||| ||||||||||||||| | || ||||||||| ||||||||||||| |||||| 
Sbjct: 3773548 tgaccgttgtgctggggatccatgcaacgcccaggatgctgccgctgcatccaatggagt 3773489

                                                                           
Query: 508     tcttcgacggccgtcggatcacaggatccgtctttggtgacttcaagggcaagtcgcagc 567
               | || ||||||||||||||||| || | ||| ||||||||||||||||| ||||| ||||
Sbjct: 3773488 tatttgacggccgtcggatcactggctgcgtttttggtgacttcaagggaaagtcccagc 3773429

                
Query: 568     t 568
               |
Sbjct: 3773428 t 3773428



 Score =  115 bits (58), Expect = 2e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                           
Query: 120     ggagtgggagctgcatggaacactgcaaacgtgtccaagggatccacggtcgcaatattt 179
               |||||||||||||||||||||||||||||||| |||||||| ||||| || |||||||||
Sbjct: 3779210 ggagtgggagctgcatggaacactgcaaacgtctccaaggggtccacagtggcaatattt 3779151

                                         
Query: 180     ggacttggtgcagttggtcttgcggt 205
               || ||||||||  |||||||||||||
Sbjct: 3779150 gggcttggtgccattggtcttgcggt 3779125



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 80/94 (85%)
 Strand = Plus / Minus

                                                                           
Query: 340     aggtgatcagggagttgacagatgggggcgtcgactacagcttcgagtgcagtggcaacg 399
               |||| |||| |||| |||||||||| || ||||||||||||||||||||||  |||| | 
Sbjct: 3773776 aggttatcatggagatgacagatggcggtgtcgactacagcttcgagtgcaccggcatca 3773717

                                                 
Query: 400     ttgatgtgcttcgagaggccttcgtttccacaca 433
                 ||||| || || ||||||||||||||||||||
Sbjct: 3773716 ccgatgttctacgggaggccttcgtttccacaca 3773683



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                           
Query: 278     aggcaaagagatgggcatcacggatttcatcaacgcaaaggcgtgcggcaaacctgtcca 337
               ||||||||||||||||||||| || ||||||||| | ||||| |  ||||| ||||||||
Sbjct: 3773940 aggcaaagagatgggcatcactgacttcatcaactcgaaggcatctggcaagcctgtcca 3773881

                     
Query: 338     cgaggt 343
               ||||||
Sbjct: 3773880 cgaggt 3773875



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 85/105 (80%), Gaps = 1/105 (0%)
 Strand = Plus / Minus

                                                                           
Query: 5       ctcaacacgtccaccttcgccgantacaccgtgctcgacgccgcctgcgccgtcaagnat 64
               |||||||| |||||||| || || ||||| ||| | ||| |||| ||||| |||||| ||
Sbjct: 3780491 ctcaacacttccacctttgctgagtacactgtgattgactccgcttgcgctgtcaag-at 3780433

                                                            
Query: 65      caaccccgccgccccgctggagaagatgtgcctcctcagctgtgg 109
               ||||||    || ||  ||||||||||| | ||||||||||||||
Sbjct: 3780432 caaccctaaggctcccttggagaagatgagtctcctcagctgtgg 3780388



to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 351    gagttgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgt 400
              |||||||| ||||| ||||| |||| ||||||||||||||  ||||||||
Sbjct: 901622 gagttgaccgatggcggcgtggacttcagcttcgagtgcatcggcaacgt 901671



to top

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                 
Query: 351     gagttgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgt 400
               |||||||| ||||| ||||| |||| ||||||||||||||  ||||||||
Sbjct: 4124423 gagttgaccgatggcggcgtggacttcagcttcgagtgcatcggcaacgt 4124374



to top

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                 
Query: 351     gagttgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgt 400
               |||||||| ||||| ||||| |||| ||||||||||||||  ||||||||
Sbjct: 4129009 gagttgaccgatggcggcgtggacttcagcttcgagtgcatcggcaacgt 4128960



to top

>ref|NM_103012.2| Arabidopsis thaliana oxidoreductase/ zinc ion binding AT1G32780 mRNA,
            complete cds
          Length = 1532

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 138/176 (78%)
 Strand = Plus / Plus

                                                                        
Query: 396  aacgttgatgtgcttcgagaggccttcgtttccacacacgacggttggggattgaccgtg 455
            ||||||||||| ||||| || |||||  | ||||| |||| ||||||||||| ||| || 
Sbjct: 1052 aacgttgatgttcttcgcgaagcctttttatccactcacgtcggttggggatcgacagta 1111

                                                                        
Query: 456  gtgctggggatccatccgacccccaggatgatgccgctgcatcccatggagctcttcgac 515
             |  | |||||| ||||||| || || |   |||| || || || |||||||| ||||||
Sbjct: 1112 cttgttgggatctatccgacgccaagaacattgcctcttcacccaatggagcttttcgac 1171

                                                                    
Query: 516  ggccgtcggatcacaggatccgtctttggtgacttcaagggcaagtcgcagcttcc 571
            |||||| | ||||| || || || ||||||| |||||||  ||| || ||||||||
Sbjct: 1172 ggccgtagaatcaccggttctgtgtttggtggcttcaagcccaaatctcagcttcc 1227



to top

>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence
          Length = 2107794

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 239    gatcatcggcgtggacatcaatcc 262
              ||||||||||||||||||||||||
Sbjct: 145218 gatcatcggcgtggacatcaatcc 145195



to top

>gb|AE009614.1| Brucella melitensis 16M chromosome I, section 171 of 195 of the
            complete sequence
          Length = 11683

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 239  gatcatcggcgtggacatcaatcc 262
            ||||||||||||||||||||||||
Sbjct: 9052 gatcatcggcgtggacatcaatcc 9075



to top

>gb|AY087044.1| Arabidopsis thaliana clone 30996 mRNA, complete sequence
          Length = 1529

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 138/176 (78%)
 Strand = Plus / Plus

                                                                        
Query: 396  aacgttgatgtgcttcgagaggccttcgtttccacacacgacggttggggattgaccgtg 455
            ||||||||||| ||||| || |||||  | ||||| |||| ||||||||||| ||| || 
Sbjct: 1049 aacgttgatgttcttcgcgaagcctttttatccactcacgtcggttggggatcgacagta 1108

                                                                        
Query: 456  gtgctggggatccatccgacccccaggatgatgccgctgcatcccatggagctcttcgac 515
             |  | |||||| ||||||| || || |   |||| || || || |||||||| ||||||
Sbjct: 1109 cttgttgggatctatccgacgccaagaacattgcctcttcacccaatggagcttttcgac 1168

                                                                    
Query: 516  ggccgtcggatcacaggatccgtctttggtgacttcaagggcaagtcgcagcttcc 571
            |||||| | ||||| || || || ||||||| |||||||  ||| || ||||||||
Sbjct: 1169 ggccgtagaatcaccggttctgtgtttggtggcttcaagcccaaatctcagcttcc 1224



to top

>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence
          Length = 2124241

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 239    gatcatcggcgtggacatcaatcc 262
              ||||||||||||||||||||||||
Sbjct: 146570 gatcatcggcgtggacatcaatcc 146547



to top

>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence,
              strain 2308
          Length = 2121359

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 239    gatcatcggcgtggacatcaatcc 262
              ||||||||||||||||||||||||
Sbjct: 142937 gatcatcggcgtggacatcaatcc 142914



to top

>emb|AJ243941.1|PSP243941 Pseudomonas sp. strain HR199 partial vanB, fdh, gcs, ehyA and ehyB
            genes
          Length = 6500

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 355  tgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgtt 401
            |||| ||||| || || |||||||||||||||||||  |||||||||
Sbjct: 1360 tgactgatggcggtgtggactacagcttcgagtgcatcggcaacgtt 1406



to top

>emb|CR733082.2|CNS0GSJL Tetraodon nigroviridis full-length cDNA
          Length = 1248

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 238 ggatcatcggcgtggacatcaatcctg 264
           |||||||||||||||||||||| ||||
Sbjct: 640 ggatcatcggcgtggacatcaaccctg 666



to top

>emb|CR729985.2|CNS0GQ7B Tetraodon nigroviridis full-length cDNA
          Length = 1232

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 238 ggatcatcggcgtggacatcaatcctg 264
           |||||||||||||||||||||| ||||
Sbjct: 633 ggatcatcggcgtggacatcaaccctg 659



to top

>emb|CR727846.2|CNS0GOJW Tetraodon nigroviridis full-length cDNA
          Length = 1059

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 238 ggatcatcggcgtggacatcaatcctg 264
           |||||||||||||||||||||| ||||
Sbjct: 198 ggatcatcggcgtggacatcaaccctg 224



to top

>emb|CR721062.2|CNS0GJBG Tetraodon nigroviridis full-length cDNA
          Length = 1140

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 238 ggatcatcggcgtggacatcaatcctg 264
           |||||||||||||||||||||| ||||
Sbjct: 533 ggatcatcggcgtggacatcaaccctg 559



to top

>emb|CR641155.2|CNS0ETOP Tetraodon nigroviridis full-length cDNA
          Length = 1276

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 238 ggatcatcggcgtggacatcaatcctg 264
           |||||||||||||||||||||| ||||
Sbjct: 683 ggatcatcggcgtggacatcaaccctg 709



to top

>gb|AF403348.1| Gossypium hirsutum D-subgenome TX119 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggt 205
           ||||| |||||||||||||| || |||||||||||
Sbjct: 815 gcaatttttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403345.1| Gossypium hirsutum D-subgenome TX111 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggt 205
           ||||| |||||||||||||| || |||||||||||
Sbjct: 815 gcaatttttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403343.1| Gossypium hirsutum D-subgenome TX98 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggt 205
           ||||| |||||||||||||| || |||||||||||
Sbjct: 815 gcaatttttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403341.1| Gossypium hirsutum D-subgenome TX94 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggt 205
           ||||| |||||||||||||| || |||||||||||
Sbjct: 815 gcaatttttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403337.1| Gossypium hirsutum D-subgenome TX51 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggt 205
           ||||| |||||||||||||| || |||||||||||
Sbjct: 815 gcaatttttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403336.1| Gossypium hirsutum D-subgenome TX44 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggt 205
           ||||| |||||||||||||| || |||||||||||
Sbjct: 815 gcaatttttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403335.1| Gossypium hirsutum D-subgenome TX44 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggt 205
           ||||| |||||||||||||| || |||||||||||
Sbjct: 815 gcaatttttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403334.1| Gossypium hirsutum D-subgenome TX21 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggt 205
           ||||| |||||||||||||| || |||||||||||
Sbjct: 815 gcaatttttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403333.1| Gossypium hirsutum D-subgenome TX21 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggt 205
           ||||| |||||||||||||| || |||||||||||
Sbjct: 815 gcaatttttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403331.1| Gossypium hirsutum D-subgenome TX1 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggt 205
           ||||| |||||||||||||| || |||||||||||
Sbjct: 815 gcaatttttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403330.1| Gossypium hirsutum D-subgenome TX1 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggt 205
           ||||| |||||||||||||| || |||||||||||
Sbjct: 815 gcaatttttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403308.1| Gossypium barbadense D-subgenome B559 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggt 205
           ||||| |||||||||||||| || |||||||||||
Sbjct: 815 gcaatttttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403307.1| Gossypium barbadense D-subgenome B444 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggt 205
           ||||| |||||||||||||| || |||||||||||
Sbjct: 815 gcaatttttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403306.1| Gossypium barbadense D-subgenome B250 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggt 205
           ||||| |||||||||||||| || |||||||||||
Sbjct: 815 gcaatttttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403305.1| Gossypium barbadense D-subgenome B106 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggt 205
           ||||| |||||||||||||| || |||||||||||
Sbjct: 815 gcaatttttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403304.1| Gossypium barbadense D-subgenome Pima_S5 alcohol dehydrogenase
           (AdhC) gene, partial cds
          Length = 1322

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggt 205
           ||||| |||||||||||||| || |||||||||||
Sbjct: 815 gcaatttttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AC017118.3|AC017118 Genomic sequence for Arabidopsis thaliana BAC F6N18 from chromosome I,
             complete sequence
          Length = 92219

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                         
Query: 501   atggagctcttcgacggccgtcggatcacaggatccgtctttggtgacttcaagggcaag 560
             |||||||| |||||||||||| | ||||| || || || ||||||| |||||||  ||| 
Sbjct: 80408 atggagcttttcgacggccgtagaatcaccggttctgtgtttggtggcttcaagcccaaa 80349

                        
Query: 561   tcgcagcttcc 571
             || ||||||||
Sbjct: 80348 tctcagcttcc 80338



to top

>gb|AF036573.1|AF036573 Gossypium darwinii D-subgenome alcohol dehydrogenase (AdhC) gene,
           partial cds
          Length = 1645

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggt 205
           ||||| |||||||||||||| || |||||||||||
Sbjct: 948 gcaatttttggacttggtgctgtaggtcttgcggt 982



to top

>gb|AF036570.1|AF036570 Gossypium barbadense D-subgenome alcohol dehydrogenase (AdhC) gene,
           partial cds
          Length = 1645

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggt 205
           ||||| |||||||||||||| || |||||||||||
Sbjct: 948 gcaatttttggacttggtgctgtaggtcttgcggt 982



to top

>dbj|AK112362.1| Ciona intestinalis cDNA, clone:ciad038h13, full insert sequence
          Length = 2042

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 184  ttggtgcagttggtcttgcggttggtg 210
            |||||||||||||||| ||||||||||
Sbjct: 1332 ttggtgcagttggtctggcggttggtg 1306



to top

>gb|U49061.1|GHU49061 Gossypium hirsutum alcohol dehydrogenase 2a mRNA, complete cds
          Length = 1508

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 171 gcaatatttggacttggtgcagttggtcttgcggttggtgaaggcgcaaga 221
           |||||||||||||| ||||| || |||||||| | || |||||| ||||||
Sbjct: 626 gcaatatttggactaggtgctgtcggtcttgctgctgctgaaggagcaaga 676



to top

>ref|NM_118332.1| Arabidopsis thaliana oxidoreductase/ zinc ion binding AT4G22110
           transcript variant AT4G22110.1 mRNA, complete cds
          Length = 1391

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 177 tttggacttggtgcagttggtcttgcggttggtgaagg 214
           ||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 763 tttggccttggtgctgttggacttgcggttggagaagg 800



to top

>ref|NM_202860.1| Arabidopsis thaliana oxidoreductase/ zinc ion binding AT4G22110
           transcript variant AT4G22110.2 mRNA, complete cds
          Length = 1414

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 177 tttggacttggtgcagttggtcttgcggttggtgaagg 214
           ||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 764 tttggccttggtgctgttggacttgcggttggagaagg 801



to top

>gb|AE017140.1| Yersinia pestis biovar Medievalis str. 91001 section 14 of 16 of the
              complete genome
          Length = 290393

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 231    gcatcccggatcatcggcgtgg 252
              ||||||||||||||||||||||
Sbjct: 254668 gcatcccggatcatcggcgtgg 254647



to top

>gb|AC113988.8| Mus musculus chromosome 3, clone RP24-129H9, complete sequence
          Length = 181881

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                          
Query: 355  tgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgt 400
            |||||||||||||||| || |||  ||| ||||||| |||||||||
Sbjct: 7823 tgacagatgggggcgtggattactcctttgagtgcattggcaacgt 7868



to top

>ref|NM_007410.2| Mus musculus alcohol dehydrogenase 5 (class III), chi polypeptide
           (Adh5), mRNA
          Length = 1533

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 355 tgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgt 400
           |||||||||||||||| || |||  ||| ||||||| |||||||||
Sbjct: 788 tgacagatgggggcgtggattactcctttgagtgcattggcaacgt 833



to top

>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 231     gcatcccggatcatcggcgtgg 252
               ||||||||||||||||||||||
Sbjct: 3561800 gcatcccggatcatcggcgtgg 3561779



to top

>ref|XM_847120.1| PREDICTED: Canis familiaris similar to Alcohol dehydrogenase class
            III chi chain (Glutathione-dependent formaldehyde
            dehydrogenase) (FDH) (LOC609781), mRNA
          Length = 1752

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 231  gcatcccggatcatcggcgtggacatcaat 260
            |||||||||||||| || ||||||||||||
Sbjct: 988  gcatcccggatcattggtgtggacatcaat 1017



to top

>ref|XM_910462.2| PREDICTED: Mus musculus similar to alcohol dehydrogenase 5 (class
           III), chi polypeptide (LOC635419), mRNA
          Length = 1393

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 355 tgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgt 400
           |||||||||||||||| || |||  ||| ||||||| |||||||||
Sbjct: 824 tgacagatgggggcgtggattactcctttgagtgcattggcaacgt 869



to top

>gb|BC062879.1| Mus musculus alcohol dehydrogenase 5 (class III), chi polypeptide,
           mRNA (cDNA clone IMAGE:5691327), partial cds
          Length = 1364

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 355 tgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgt 400
           |||||||||||||||| || |||  ||| ||||||| |||||||||
Sbjct: 785 tgacagatgggggcgtggattactcctttgagtgcattggcaacgt 830



to top

>ref|XM_532181.2| PREDICTED: Canis familiaris similar to Alcohol dehydrogenase class
           III chi chain (Glutathione-dependent formaldehyde
           dehydrogenase) (FDH), transcript variant 1 (LOC474946),
           mRNA
          Length = 1447

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 231 gcatcccggatcatcggcgtggacatcaat 260
           |||||||||||||| || ||||||||||||
Sbjct: 668 gcatcccggatcattggtgtggacatcaat 697



to top

>ref|XM_861465.1| PREDICTED: Canis familiaris similar to Alcohol dehydrogenase class
           III chi chain (Glutathione-dependent formaldehyde
           dehydrogenase) (FDH), transcript variant 2 (LOC474946),
           mRNA
          Length = 1399

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 231 gcatcccggatcatcggcgtggacatcaat 260
           |||||||||||||| || ||||||||||||
Sbjct: 620 gcatcccggatcattggtgtggacatcaat 649



to top

>emb|CR734511.2|CNS0GTJ2 Tetraodon nigroviridis full-length cDNA
          Length = 1197

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 713 ggatcattgccgtggacatcaatcctgacaagtt 746



to top

>emb|CR733295.2|CNS0GSMY Tetraodon nigroviridis full-length cDNA
          Length = 1221

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 686 ggatcattgccgtggacatcaatcctgacaagtt 719



to top

>emb|CR733206.2|CNS0GSLK Tetraodon nigroviridis full-length cDNA
          Length = 1205

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 671 ggatcattgccgtggacatcaatcctgacaagtt 704



to top

>emb|CR732391.2|CNS0GS24 Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 718 ggatcattgccgtggacatcaatcctgacaagtt 751



to top

>emb|CR732020.2|CNS0GRRT Tetraodon nigroviridis full-length cDNA
          Length = 1253

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 718 ggatcattgccgtggacatcaatcctgacaagtt 751



to top

>emb|CR731150.2|CNS0GR3N Tetraodon nigroviridis full-length cDNA
          Length = 1256

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 722 ggatcattgccgtggacatcaatcctgacaagtt 755



to top

>emb|CR731098.2|CNS0GR27 Tetraodon nigroviridis full-length cDNA
          Length = 1253

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 720 ggatcattgccgtggacatcaatcctgacaagtt 753



to top

>emb|CR730661.2|CNS0GQQ2 Tetraodon nigroviridis full-length cDNA
          Length = 1208

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 674 ggatcattgccgtggacatcaatcctgacaagtt 707



to top

>emb|CR729939.2|CNS0GQ61 Tetraodon nigroviridis full-length cDNA
          Length = 1220

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 715 ggatcattgccgtggacatcaatcctgacaagtt 748



to top

>emb|CR729103.2|CNS0GPIT Tetraodon nigroviridis full-length cDNA
          Length = 1243

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 710 ggatcattgccgtggacatcaatcctgacaagtt 743



to top

>emb|CR728964.2|CNS0GPEY Tetraodon nigroviridis full-length cDNA
          Length = 1227

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 693 ggatcattgccgtggacatcaatcctgacaagtt 726



to top

>emb|CR728872.2|CNS0GPCE Tetraodon nigroviridis full-length cDNA
          Length = 1242

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 709 ggatcattgccgtggacatcaatcctgacaagtt 742



to top

>emb|CR728460.2|CNS0GP0Y Tetraodon nigroviridis full-length cDNA
          Length = 1230

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 697 ggatcattgccgtggacatcaatcctgacaagtt 730



to top

>emb|CR728295.2|CNS0GOWD Tetraodon nigroviridis full-length cDNA
          Length = 1235

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 701 ggatcattgccgtggacatcaatcctgacaagtt 734



to top

>emb|CR728026.2|CNS0GOOW Tetraodon nigroviridis full-length cDNA
          Length = 1254

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 720 ggatcattgccgtggacatcaatcctgacaagtt 753



to top

>emb|CR727908.2|CNS0GOLM Tetraodon nigroviridis full-length cDNA
          Length = 1255

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 721 ggatcattgccgtggacatcaatcctgacaagtt 754



to top

>emb|CR727754.2|CNS0GOHC Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 719 ggatcattgccgtggacatcaatcctgacaagtt 752



to top

>emb|CR727720.2|CNS0GOGE Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 719 ggatcattgccgtggacatcaatcctgacaagtt 752



to top

>emb|CR727612.2|CNS0GODE Tetraodon nigroviridis full-length cDNA
          Length = 1216

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 682 ggatcattgccgtggacatcaatcctgacaagtt 715



to top

>emb|CR726766.2|CNS0GNPW Tetraodon nigroviridis full-length cDNA
          Length = 1253

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 717 ggatcattgccgtggacatcaatcctgacaagtt 750



to top

>emb|CR726482.2|CNS0GNI0 Tetraodon nigroviridis full-length cDNA
          Length = 1259

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 725 ggatcattgccgtggacatcaatcctgacaagtt 758



to top

>emb|CR726365.2|CNS0GNER Tetraodon nigroviridis full-length cDNA
          Length = 1242

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 708 ggatcattgccgtggacatcaatcctgacaagtt 741



to top

>emb|CR726288.2|CNS0GNCM Tetraodon nigroviridis full-length cDNA
          Length = 1244

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 710 ggatcattgccgtggacatcaatcctgacaagtt 743



to top

>emb|CR726219.2|CNS0GNAP Tetraodon nigroviridis full-length cDNA
          Length = 1216

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 682 ggatcattgccgtggacatcaatcctgacaagtt 715



to top

>emb|CR724094.2|CNS0GLNO Tetraodon nigroviridis full-length cDNA
          Length = 1119

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 676 ggatcattgccgtggacatcaatcctgacaagtt 709



to top

>emb|CR723329.2|CNS0GL2F Tetraodon nigroviridis full-length cDNA
          Length = 1254

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 720 ggatcattgccgtggacatcaatcctgacaagtt 753



to top

>emb|CR704563.2|CNS0G6LB Tetraodon nigroviridis full-length cDNA
          Length = 1237

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 703 ggatcattgccgtggacatcaatcctgacaagtt 736



to top

>emb|CR654733.2|CNS0F45V Tetraodon nigroviridis full-length cDNA
          Length = 1241

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 707 ggatcattgccgtggacatcaatcctgacaagtt 740



to top

>emb|CR654293.2|CNS0F3TN Tetraodon nigroviridis full-length cDNA
          Length = 1243

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 709 ggatcattgccgtggacatcaatcctgacaagtt 742



to top

>emb|CR653759.2|CNS0F3ET Tetraodon nigroviridis full-length cDNA
          Length = 1241

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 707 ggatcattgccgtggacatcaatcctgacaagtt 740



to top

>emb|CR653547.2|CNS0F38X Tetraodon nigroviridis full-length cDNA
          Length = 1235

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 701 ggatcattgccgtggacatcaatcctgacaagtt 734



to top

>emb|CR653505.2|CNS0F37R Tetraodon nigroviridis full-length cDNA
          Length = 1239

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 705 ggatcattgccgtggacatcaatcctgacaagtt 738



to top

>emb|CR653438.2|CNS0F35W Tetraodon nigroviridis full-length cDNA
          Length = 1158

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 624 ggatcattgccgtggacatcaatcctgacaagtt 657



to top

>emb|CR652814.2|CNS0F2OK Tetraodon nigroviridis full-length cDNA
          Length = 1081

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 546 ggatcattgccgtggacatcaatcctgacaagtt 579



to top

>emb|CR652161.2|CNS0F26F Tetraodon nigroviridis full-length cDNA
          Length = 1214

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 680 ggatcattgccgtggacatcaatcctgacaagtt 713



to top

>emb|CR651988.2|CNS0F21M Tetraodon nigroviridis full-length cDNA
          Length = 1240

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 706 ggatcattgccgtggacatcaatcctgacaagtt 739



to top

>emb|CR651551.2|CNS0F1PH Tetraodon nigroviridis full-length cDNA
          Length = 1249

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 715 ggatcattgccgtggacatcaatcctgacaagtt 748



to top

>emb|CR650163.2|CNS0F0MX Tetraodon nigroviridis full-length cDNA
          Length = 1243

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 709 ggatcattgccgtggacatcaatcctgacaagtt 742



to top

>emb|CR648928.2|CNS0EZOM Tetraodon nigroviridis full-length cDNA
          Length = 1237

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 703 ggatcattgccgtggacatcaatcctgacaagtt 736



to top

>emb|CR648046.2|CNS0EZ04 Tetraodon nigroviridis full-length cDNA
          Length = 1147

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 713 ggatcattgccgtggacatcaatcctgacaagtt 746



to top

>emb|CR647200.2|CNS0EYCM Tetraodon nigroviridis full-length cDNA
          Length = 1245

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 711 ggatcattgccgtggacatcaatcctgacaagtt 744



to top

>emb|CR646757.2|CNS0EY0B Tetraodon nigroviridis full-length cDNA
          Length = 1242

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 708 ggatcattgccgtggacatcaatcctgacaagtt 741



to top

>emb|CR646390.2|CNS0EXQ4 Tetraodon nigroviridis full-length cDNA
          Length = 1247

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 713 ggatcattgccgtggacatcaatcctgacaagtt 746



to top

>emb|CR646059.2|CNS0EXGX Tetraodon nigroviridis full-length cDNA
          Length = 1232

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 698 ggatcattgccgtggacatcaatcctgacaagtt 731



to top

>emb|CR644153.2|CNS0EVZZ Tetraodon nigroviridis full-length cDNA
          Length = 1244

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 710 ggatcattgccgtggacatcaatcctgacaagtt 743



to top

>emb|CR643668.2|CNS0EVMI Tetraodon nigroviridis full-length cDNA
          Length = 974

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 719 ggatcattgccgtggacatcaatcctgacaagtt 752



to top

>emb|CR642035.2|CNS0EUD5 Tetraodon nigroviridis full-length cDNA
          Length = 1253

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 719 ggatcattgccgtggacatcaatcctgacaagtt 752



to top

>emb|CR641585.2|CNS0EU0N Tetraodon nigroviridis full-length cDNA
          Length = 549

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 15  ggatcattgccgtggacatcaatcctgacaagtt 48



to top

>emb|CR640922.2|CNS0ETI8 Tetraodon nigroviridis full-length cDNA
          Length = 1261

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 726 ggatcattgccgtggacatcaatcctgacaagtt 759



to top

>emb|CR640098.2|CNS0ESVC Tetraodon nigroviridis full-length cDNA
          Length = 1059

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 525 ggatcattgccgtggacatcaatcctgacaagtt 558



to top

>emb|CR639110.2|CNS0ES3W Tetraodon nigroviridis full-length cDNA
          Length = 1241

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 707 ggatcattgccgtggacatcaatcctgacaagtt 740



to top

>emb|CR638319.2|CNS0ERHX Tetraodon nigroviridis full-length cDNA
          Length = 1239

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 705 ggatcattgccgtggacatcaatcctgacaagtt 738



to top

>emb|CR638285.2|CNS0ERGZ Tetraodon nigroviridis full-length cDNA
          Length = 1237

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 703 ggatcattgccgtggacatcaatcctgacaagtt 736



to top

>emb|CR637679.2|CNS0ER05 Tetraodon nigroviridis full-length cDNA
          Length = 933

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 399 ggatcattgccgtggacatcaatcctgacaagtt 432



to top

>emb|CR634616.2|CNS0EON2 Tetraodon nigroviridis full-length cDNA
          Length = 1241

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 707 ggatcattgccgtggacatcaatcctgacaagtt 740



to top

>emb|CR634501.2|CNS0EOJV Tetraodon nigroviridis full-length cDNA
          Length = 1245

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 711 ggatcattgccgtggacatcaatcctgacaagtt 744



to top

>emb|CR634119.2|CNS0EO99 Tetraodon nigroviridis full-length cDNA
          Length = 1242

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 708 ggatcattgccgtggacatcaatcctgacaagtt 741



to top

>emb|CR633724.2|CNS0ENYA Tetraodon nigroviridis full-length cDNA
          Length = 931

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 238 ggatcatcggcgtggacatcaatcctgaaaagtt 271
           ||||||| | |||||||||||||||||| |||||
Sbjct: 397 ggatcattgccgtggacatcaatcctgacaagtt 430



to top

>emb|AL391500.13| Human DNA sequence from clone RP11-707M13 on chromosome 6 Contains a
             novel pseudogene and an ADH5 (alcohol dehydrogenase 5
             (class III) chi polypeptide) pseudogene, complete sequence
          Length = 171220

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 231   gcatcccggatcatcggcgtggacatcaat 260
             |||||||||||||| || ||||||||||||
Sbjct: 64596 gcatcccggatcattggtgtggacatcaat 64567



to top

>emb|Y15406.1|OCY15406 Oryctolagus cuniculus mRNA for class III alcohol dehydrogenase
          Length = 1363

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 231 gcatcccggatcatcggcgtggacatcaat 260
           |||||||||||||| | |||||||||||||
Sbjct: 660 gcatcccggatcattgccgtggacatcaat 689



to top

>emb|X02915.1|ZMADH2N Zea mays Adh2-N gene for alcohol dehydrogenase 2
          Length = 3535

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 238  ggatcatcggcgtggacatcaa 259
            ||||||||||||||||||||||
Sbjct: 1945 ggatcatcggcgtggacatcaa 1966



to top

>emb|X01965.1|ZMADH2NR Maize Adh2-N mRNA for alcohol dehydrogenase 2
          Length = 1600

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 238 ggatcatcggcgtggacatcaa 259
           ||||||||||||||||||||||
Sbjct: 788 ggatcatcggcgtggacatcaa 809



to top

>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 231     gcatcccggatcatcggcgtgg 252
               ||||||||||||||||||||||
Sbjct: 3650080 gcatcccggatcatcggcgtgg 3650059



to top

>emb|AJ414145.1| Yersinia pestis strain CO92 complete genome; segment 5/20
          Length = 208050

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 231   gcatcccggatcatcggcgtgg 252
             ||||||||||||||||||||||
Sbjct: 20777 gcatcccggatcatcggcgtgg 20756



to top

>gb|AC079845.31| Mus musculus clone rp23-461a12, complete sequence
          Length = 206117

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                            
Query: 355    tgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgt 400
              |||||||||||||||| || |||  ||| ||||||| |||||||||
Sbjct: 167486 tgacagatgggggcgtggattactcctttgagtgcattggcaacgt 167531



to top

>dbj|AK146949.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920078O04 product:alcohol dehydrogenase
           5 (class III), chi polypeptide, full insert sequence
          Length = 1364

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 355 tgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgt 400
           |||||||||||||||| || |||  ||| ||||||| |||||||||
Sbjct: 803 tgacagatgggggcgtggattactcctttgagtgcattggcaacgt 848



to top

>gb|AF344170.1|AF344170 Branchiostoma floridae clone 6121.2 alcohol dehydrogenase class 3
           (Adh3) mRNA, complete cds
          Length = 1366

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 228 ggggcatcccggatcatcggcgtggacatcaatcctga 265
           |||||||| || |||||||| ||||||||||| |||||
Sbjct: 660 ggggcatctcgcatcatcggagtggacatcaaccctga 697



to top

>ref|XM_942836.1| PREDICTED: Homo sapiens similar to Alcohol dehydrogenase class III
           chi chain (Glutathione-dependent formaldehyde
           dehydrogenase) (FDH), transcript variant 2 (LOC647346),
           mRNA
          Length = 1939

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 231 gcatcccggatcatcggcgtggacatcaat 260
           |||||||||||||| || ||||||||||||
Sbjct: 621 gcatcccggatcattggtgtggacatcaat 650



to top

>ref|XM_936495.1| PREDICTED: Homo sapiens similar to Alcohol dehydrogenase class III
           chi chain (Glutathione-dependent formaldehyde
           dehydrogenase) (FDH), transcript variant 1 (LOC647346),
           mRNA
          Length = 2582

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 231 gcatcccggatcatcggcgtggacatcaat 260
           |||||||||||||| || ||||||||||||
Sbjct: 657 gcatcccggatcattggtgtggacatcaat 686



to top

>ref|XM_926158.1| PREDICTED: Homo sapiens similar to Alcohol dehydrogenase class III
           chi chain (Glutathione-dependent formaldehyde
           dehydrogenase) (FDH), transcript variant 1 (LOC642443),
           mRNA
          Length = 2285

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 231 gcatcccggatcatcggcgtggacatcaat 260
           |||||||||||||| || ||||||||||||
Sbjct: 654 gcatcccggatcattggtgtggacatcaat 683



to top

>ref|XM_931030.1| PREDICTED: Homo sapiens similar to Alcohol dehydrogenase class III
           chi chain (Glutathione-dependent formaldehyde
           dehydrogenase) (FDH), transcript variant 2 (LOC642443),
           mRNA
          Length = 1939

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 231 gcatcccggatcatcggcgtggacatcaat 260
           |||||||||||||| || ||||||||||||
Sbjct: 621 gcatcccggatcattggtgtggacatcaat 650



to top

>dbj|AK159803.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420031K10 product:alcohol dehydrogenase
           5 (class III), chi polypeptide, full insert sequence
          Length = 1398

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 355 tgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgt 400
           |||||||||||||||| || |||  ||| ||||||| |||||||||
Sbjct: 839 tgacagatgggggcgtggattactcctttgagtgcattggcaacgt 884



to top

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 237     cggatcatcggcgtggacatcaatcc 262
               |||||||||||||| |||||||||||
Sbjct: 3922423 cggatcatcggcgttgacatcaatcc 3922448



to top

>dbj|AK002790.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610038D07 product:alcohol dehydrogenase
           5, full insert sequence
          Length = 1342

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 355 tgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgt 400
           |||||||||||||||| || |||  ||| ||||||| |||||||||
Sbjct: 781 tgacagatgggggcgtggattactcctttgagtgcattggcaacgt 826



to top

>dbj|AK076507.1| Mus musculus 0 day neonate head cDNA, RIKEN full-length enriched
           library, clone:4833432L15 product:alcohol dehydrogenase
           5, full insert sequence
          Length = 1533

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 355 tgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgt 400
           |||||||||||||||| || |||  ||| ||||||| |||||||||
Sbjct: 788 tgacagatgggggcgtggattactcctttgagtgcattggcaacgt 833



to top

>ref|NG_001339.1| Mus musculus alcohol dehydrogenase 5 (class III), chi polypeptide,
           pseudogene 1 (Adh5-ps1) on chromosome 3
          Length = 1462

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 355 tgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgt 400
           |||||||||||||||| || |||  ||| ||||||| |||||||||
Sbjct: 900 tgacagatgggggcgtggattactcctttgagtgcattggcaacgt 945



to top

>emb|BX829257.1|CNS0A3KY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL84ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1415

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 177 tttggacttggtgcagttggtcttgcggttggtgaagg 214
           ||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 765 tttggccttggtgctgttggacttgcggttggagaagg 802



to top

>dbj|AB191337.1| Wisteria floribunda Wfadh1 mRNA for alcohol dehydrogenase, partial
           cds
          Length = 709

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 97  tcctcagctgtggcatctcaaccggagtgggagc 130
           ||||||| |||||||||||||| ||| |||||||
Sbjct: 369 tcctcagttgtggcatctcaacaggattgggagc 402



to top

>gb|AY084215.1| Arabidopsis thaliana clone 100047 mRNA, complete sequence
          Length = 1391

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 177 tttggacttggtgcagttggtcttgcggttggtgaagg 214
           ||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 763 tttggccttggtgctgttggacttgcggttggagaagg 800



to top

>dbj|AK101288.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033033F16, full
           insert sequence
          Length = 1298

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 97  tcctcagctgtggcatctcaaccgga 122
           ||||||||||||||||||| ||||||
Sbjct: 277 tcctcagctgtggcatctccaccgga 302



to top

>gb|AY104300.1| Zea mays PCO072749 mRNA sequence
          Length = 1621

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 238 ggatcatcggcgtggacatcaa 259
           ||||||||||||||||||||||
Sbjct: 783 ggatcatcggcgtggacatcaa 804



to top

>gb|AC079832.18| Mus musculus strain C57BL/6J chromosome 3 clone rp23-393j8, complete
              sequence
          Length = 194354

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                            
Query: 355    tgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgt 400
              |||||||||||||||| || |||  ||| ||||||| |||||||||
Sbjct: 167318 tgacagatgggggcgtggattactcctttgagtgcattggcaacgt 167363



to top

>gb|U48968.1|MMADH2S05 Mus musculus class III alcohol dehydrogenase (Adh-2) gene, exons 5
           and 6
          Length = 685

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 355 tgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgt 400
           |||||||||||||||| || |||  ||| ||||||| |||||||||
Sbjct: 615 tgacagatgggggcgtggattactcctttgagtgcattggcaacgt 660



to top

>gb|U48971.1|MMU48971 Mus musculus class III alcohol dehydrogenase pseudogene
          Length = 1517

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                          
Query: 355  tgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgt 400
            |||||||||||||||| || |||  ||| ||||||| |||||||||
Sbjct: 955  tgacagatgggggcgtggattactcctttgagtgcattggcaacgt 1000



to top

>gb|AY609557.1| Sus scrofa clone Clu_1785.scr.msk.p1.Contig2, mRNA sequence
          Length = 1502

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 231 gcatcccggatcatcggcgtggacatcaat 260
           |||||||||||||| || ||||||||||||
Sbjct: 734 gcatcccggatcattggtgtggacatcaat 763



to top

>gb|BC090978.1| Mus musculus alcohol dehydrogenase 5 (class III), chi polypeptide,
           mRNA (cDNA clone MGC:107163 IMAGE:30313517), complete
           cds
          Length = 1374

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 355 tgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgt 400
           |||||||||||||||| || |||  ||| ||||||| |||||||||
Sbjct: 782 tgacagatgggggcgtggattactcctttgagtgcattggcaacgt 827



to top

>gb|DQ120658.1| Gorilla gorilla rcADH5 gene, partial cds
          Length = 1104

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 231 gcatcccggatcatcggcgtggacatcaat 260
           |||||||||||||| || ||||||||||||
Sbjct: 646 gcatcccggatcattggtgtggacatcaat 675



to top

>gb|DQ120656.1| Homo sapiens rcADH5 gene, partial cds
          Length = 1104

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 231 gcatcccggatcatcggcgtggacatcaat 260
           |||||||||||||| || ||||||||||||
Sbjct: 646 gcatcccggatcattggtgtggacatcaat 675



to top

>gb|M84147.1|MUSADHYD Mouse alcohol dehydrogenase-B2 (Adh-2) mRNA, putative cds
          Length = 1360

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 355 tgacagatgggggcgtcgactacagcttcgagtgcagtggcaacgt 400
           |||||||||||||||| || |||  ||| ||||||| |||||||||
Sbjct: 809 tgacagatgggggcgtggattactcctttgagtgcattggcaacgt 854



to top

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 239     gatcatcggcgtggacatcaa 259
               |||||||||||||||||||||
Sbjct: 1901312 gatcatcggcgtggacatcaa 1901332



to top

>gb|AY125060.1| Gossypium schwendimanii alcohol dehydrogenase C (AdhC) gene,
           partial cds
          Length = 929

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 254 tttggacttggtgctgtaggtcttgcggt 282



to top

>emb|CR723665.2|CNS0GLBR Tetraodon nigroviridis full-length cDNA
          Length = 1216

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 239 gatcatcggcgtggacatcaatcctgaaaagtt 271
           |||||| | |||||||||||||||||| |||||
Sbjct: 713 gatcattgccgtggacatcaatcctgacaagtt 745



to top

>emb|CR656355.2|CNS0F5EX Tetraodon nigroviridis full-length cDNA
          Length = 982

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 238 ggatcatcggcgtggacatcaatcctgaa 266
           ||||||| | |||||||||||||||||||
Sbjct: 708 ggatcattgccgtggacatcaatcctgaa 736



to top

>emb|CR641168.2|CNS0ETP2 Tetraodon nigroviridis full-length cDNA
          Length = 983

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 238 ggatcatcggcgtggacatcaatcctgaa 266
           ||||||| | |||||||||||||||||||
Sbjct: 709 ggatcattgccgtggacatcaatcctgaa 737



to top

>emb|CR639644.2|CNS0ESIQ Tetraodon nigroviridis full-length cDNA
          Length = 1235

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 239 gatcatcggcgtggacatcaatcctgaaaagtt 271
           |||||| | |||||||||||||||||| |||||
Sbjct: 702 gatcattgccgtggacatcaatcctgacaagtt 734



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 239     gatcatcggcgtggacatcaa 259
               |||||||||||||||||||||
Sbjct: 3304718 gatcatcggcgtggacatcaa 3304738



to top

>gb|AC123515.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0033E08, complete sequence
          Length = 149241

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 97    tcctcagctgtggcatctcaaccgg 121
             ||||||||||||||||||| |||||
Sbjct: 16105 tcctcagctgtggcatctccaccgg 16081



to top

>gb|AY699123.1| Gossypium lobatum voucher DRD 157 (ISC) alcohol dehydrogenase
           (AdhC) gene, partial cds
          Length = 760

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 219 tttggacttggtgctgtaggtcttgcggt 247



to top

>gb|AY699122.1| Gossypium laxum voucher IA 40-4 (ISC) alcohol dehydrogenase (AdhC)
           pseudogene, partial sequence
          Length = 759

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 219 tttggacttggtgctgtaggtcttgcggt 247



to top

>gb|AY699121.1| Gossypium laxum voucher IA 25-2 (ISC) alcohol dehydrogenase (AdhC)
           pseudogene, partial sequence
          Length = 759

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 219 tttggacttggtgctgtaggtcttgcggt 247



to top

>gb|AY699119.1| Gossypium laxum voucher L. Phillips (ISC) alcohol dehydrogenase
           (AdhC) pseudogene, partial sequence
          Length = 759

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 219 tttggacttggtgctgtaggtcttgcggt 247



to top

>gb|AY699116.1| Gossypium schwendimanii voucher DRD 56-3 (ISC) alcohol
           dehydrogenase C (AdhC) gene, partial cds
          Length = 759

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 219 tttggacttggtgctgtaggtcttgcggt 247



to top

>gb|AY699115.1| Gossypium lobatum voucher DRD 161 (ISC) alcohol dehydrogenase C
           (AdhC) pseudogene, partial sequence
          Length = 759

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 219 tttggacttggtgctgtaggtcttgcggt 247



to top

>gb|AY699110.1| Gossypium armourianum voucher D2-1-7 (ISC) alcohol dehydrogenase C
           (AdhC) gene, partial cds
          Length = 759

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 219 tttggacttggtgctgtaggtcttgcggt 247



to top

>gb|AY699109.1| Gossypium aridum voucher IA 36-1 (ISC) alcohol dehydrogenase C
           (AdhC) gene, partial cds
          Length = 759

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 219 tttggacttggtgctgtaggtcttgcggt 247



to top

>gb|AY699108.1| Gossypium sp. IA 64-1 alcohol dehydrogenase C (AdhC) gene, partial
           cds
          Length = 759

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 219 tttggacttggtgctgtaggtcttgcggt 247



to top

>gb|AY699106.1| Gossypium aridum voucher IA 1-4 (ISC) alcohol dehydrogenase C
           (AdhC) gene, partial cds
          Length = 757

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 219 tttggacttggtgctgtaggtcttgcggt 247



to top

>gb|AY699105.1| Gossypium aridum voucher DRD 168 (ISC) alcohol dehydrogenase C
           (AdhC) gene, partial cds
          Length = 757

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 219 tttggacttggtgctgtaggtcttgcggt 247



to top

>gb|AY699104.1| Gossypium aridum voucher DRD 185 (ISC) alcohol dehydrogenase C
           (AdhC) gene, partial cds
          Length = 759

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 219 tttggacttggtgctgtaggtcttgcggt 247



to top

>gb|AF419968.1| Gossypium bickii alcohol dehydrogenase C (AdhC) gene, partial cds
          Length = 920

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 255 tttggacttggtgctgtaggtcttgcggt 283



to top

>gb|AF419966.1| Gossypium anomalum alcohol dehydrogenase C (AdhC) gene, partial cds
          Length = 918

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 257 tttggacttggtgctgtaggtcttgcggt 285



to top

>gb|AF403367.1| Gossypium hirsutum D-subgenome BR115 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403366.1| Gossypium hirsutum D-subgenome BR115 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403365.1| Gossypium hirsutum D-subgenome Deltapine alcohol dehydrogenase
           (AdhC) gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403364.1| Gossypium hirsutum D-subgenome Deltapine alcohol dehydrogenase
           (AdhC) gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403363.1| Gossypium hirsutum D-subgenome Paymaster alcohol dehydrogenase
           (AdhC) gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403362.1| Gossypium hirsutum D-subgenome Paymaster alcohol dehydrogenase
           (AdhC) gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403361.1| Gossypium hirsutum D-subgenome TX766 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403360.1| Gossypium hirsutum D-subgenome TX766 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403359.1| Gossypium hirsutum D-subgenome TX706 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403358.1| Gossypium hirsutum D-subgenome TX706 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403357.1| Gossypium hirsutum D-subgenome TX481 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403356.1| Gossypium hirsutum D-subgenome TX367 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403355.1| Gossypium hirsutum D-subgenome TX367 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403354.1| Gossypium hirsutum D-subgenome TX192 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403353.1| Gossypium hirsutum D-subgenome TX192 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403352.1| Gossypium hirsutum D-subgenome TX188 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403351.1| Gossypium hirsutum D-subgenome TX188 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403350.1| Gossypium hirsutum D-subgenome TX166 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403349.1| Gossypium hirsutum D-subgenome TX166 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403347.1| Gossypium hirsutum D-subgenome TX119 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403346.1| Gossypium hirsutum D-subgenome TX116 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403344.1| Gossypium hirsutum D-subgenome TX111 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403342.1| Gossypium hirsutum D-subgenome TX98 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403340.1| Gossypium hirsutum D-subgenome TX94 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403339.1| Gossypium hirsutum D-subgenome TX93 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403338.1| Gossypium hirsutum D-subgenome TX93 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403332.1| Gossypium hirsutum D-subgenome TX6 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 821 tttggacttggtgctgtaggtcttgcggt 849



to top

>gb|AF403329.1| Gossypium hirsutum A-subgenome BR115 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1313

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 817 tttggacttggtgctgtaggtcttgcggt 845



to top

>gb|AF403328.1| Gossypium hirsutum A-subgenome Deltapine alcohol dehydrogenase
           (AdhC) gene, partial cds
          Length = 1313

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 817 tttggacttggtgctgtaggtcttgcggt 845



to top

>gb|AF403327.1| Gossypium hirsutum A-subgenome Paymaster alcohol dehydrogenase
           (AdhC) gene, partial cds
          Length = 1313

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 817 tttggacttggtgctgtaggtcttgcggt 845



to top

>gb|AF403326.1| Gossypium hirsutum A-subgenome TX766 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 818 tttggacttggtgctgtaggtcttgcggt 846



to top

>gb|AF403325.1| Gossypium hirsutum A-subgenome TX706 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 818 tttggacttggtgctgtaggtcttgcggt 846



to top

>gb|AF403324.1| Gossypium hirsutum A-subgenome TX481 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 818 tttggacttggtgctgtaggtcttgcggt 846



to top

>gb|AF403323.1| Gossypium hirsutum A-subgenome TX367 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1313

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 817 tttggacttggtgctgtaggtcttgcggt 845



to top

>gb|AF403322.1| Gossypium hirsutum A-subgenome TX192 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 818 tttggacttggtgctgtaggtcttgcggt 846



to top

>gb|AF403321.1| Gossypium hirsutum A-subgenome TX188 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 818 tttggacttggtgctgtaggtcttgcggt 846



to top

>gb|AF403320.1| Gossypium hirsutum A-subgenome TX166 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 818 tttggacttggtgctgtaggtcttgcggt 846



to top

>gb|AF403319.1| Gossypium hirsutum A-subgenome TX119 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 818 tttggacttggtgctgtaggtcttgcggt 846



to top

>gb|AF403318.1| Gossypium hirsutum A-subgenome TX116 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 818 tttggacttggtgctgtaggtcttgcggt 846



to top

>gb|AF403317.1| Gossypium hirsutum A-subgenome TX111 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 818 tttggacttggtgctgtaggtcttgcggt 846



to top

>gb|AF403316.1| Gossypium hirsutum A-subgenome TX98 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 818 tttggacttggtgctgtaggtcttgcggt 846



to top

>gb|AF403315.1| Gossypium hirsutum A-subgenome TX94 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 818 tttggacttggtgctgtaggtcttgcggt 846



to top

>gb|AF403314.1| Gossypium hirsutum A-subgenome TX93 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 818 tttggacttggtgctgtaggtcttgcggt 846



to top

>gb|AF403313.1| Gossypium hirsutum A-subgenome TX51 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 818 tttggacttggtgctgtaggtcttgcggt 846



to top

>gb|AF403312.1| Gossypium hirsutum A-subgenome TX44 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 818 tttggacttggtgctgtaggtcttgcggt 846



to top

>gb|AF403311.1| Gossypium hirsutum A-subgenome TX21 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 818 tttggacttggtgctgtaggtcttgcggt 846



to top

>gb|AF403310.1| Gossypium hirsutum A-subgenome TX6 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 818 tttggacttggtgctgtaggtcttgcggt 846



to top

>gb|AF403309.1| Gossypium hirsutum A-subgenome TX1 alcohol dehydrogenase (AdhC)
           gene, partial cds
          Length = 1314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 818 tttggacttggtgctgtaggtcttgcggt 846



to top

>gb|AF403303.1| Gossypium barbadense A-subgenome B559 alcohol dehydrogenase (AdhC)
           pseudogene, partial sequence
          Length = 1247

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 751 tttggacttggtgctgtaggtcttgcggt 779



to top

>gb|AF403302.1| Gossypium barbadense A-subgenome B444 alcohol dehydrogenase (AdhC)
           pseudogene, partial sequence
          Length = 1247

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 751 tttggacttggtgctgtaggtcttgcggt 779



to top

>gb|AF403301.1| Gossypium barbadense A-subgenome B250 alcohol dehydrogenase (AdhC)
           pseudogene, partial sequence
          Length = 1247

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 751 tttggacttggtgctgtaggtcttgcggt 779



to top

>gb|AF403300.1| Gossypium barbadense A-subgenome B106 alcohol dehydrogenase (AdhC)
           pseudogene, partial sequence
          Length = 1247

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 751 tttggacttggtgctgtaggtcttgcggt 779



to top

>gb|AF403299.1| Gossypium barbadense A-subgenome Pima_S5 alcohol dehydrogenase
           (AdhC) pseudogene, partial sequence
          Length = 1247

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 751 tttggacttggtgctgtaggtcttgcggt 779



to top

>gb|AF326715.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 alcohol
           dehydrogenase (adh3) gene, partial cds
          Length = 1865

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 93  tgcctcctcagctgtggcatctcaaccgg 121
           |||||||| |||||||| |||||||||||
Sbjct: 913 tgcctccttagctgtggtatctcaaccgg 941



to top

>gb|AF326714.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 alcohol
           dehydrogenase (adh3) gene, partial cds
          Length = 1865

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 93  tgcctcctcagctgtggcatctcaaccgg 121
           |||||||| |||||||| |||||||||||
Sbjct: 913 tgcctccttagctgtggtatctcaaccgg 941



to top

>gb|AF326713.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 alcohol
           dehydrogenase (adh3) gene, partial cds
          Length = 1865

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 93  tgcctcctcagctgtggcatctcaaccgg 121
           |||||||| |||||||| |||||||||||
Sbjct: 913 tgcctccttagctgtggtatctcaaccgg 941



to top

>gb|AF326712.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 alcohol
           dehydrogenase (adh3) gene, partial cds
          Length = 1865

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 93  tgcctcctcagctgtggcatctcaaccgg 121
           |||||||| |||||||| |||||||||||
Sbjct: 913 tgcctccttagctgtggtatctcaaccgg 941



to top

>gb|AF326711.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 alcohol
           dehydrogenase (adh3) gene, partial cds
          Length = 1865

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 93  tgcctcctcagctgtggcatctcaaccgg 121
           |||||||| |||||||| |||||||||||
Sbjct: 913 tgcctccttagctgtggtatctcaaccgg 941



to top

>gb|AF326710.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 alcohol
           dehydrogenase (adh3) gene, partial cds
          Length = 1865

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 93  tgcctcctcagctgtggcatctcaaccgg 121
           |||||||| |||||||| |||||||||||
Sbjct: 913 tgcctccttagctgtggtatctcaaccgg 941



to top

>gb|AF326709.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 alcohol
           dehydrogenase (adh3) gene, partial cds
          Length = 1865

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 93  tgcctcctcagctgtggcatctcaaccgg 121
           |||||||| |||||||| |||||||||||
Sbjct: 913 tgcctccttagctgtggtatctcaaccgg 941



to top

>gb|AF326708.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 alcohol
           dehydrogenase (adh3) gene, partial cds
          Length = 1865

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 93  tgcctcctcagctgtggcatctcaaccgg 121
           |||||||| |||||||| |||||||||||
Sbjct: 913 tgcctccttagctgtggtatctcaaccgg 941



to top

>gb|AF326707.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 alcohol
           dehydrogenase (adh3) gene, partial cds
          Length = 1865

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 93  tgcctcctcagctgtggcatctcaaccgg 121
           |||||||| |||||||| |||||||||||
Sbjct: 913 tgcctccttagctgtggtatctcaaccgg 941



to top

>gb|AF326706.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 alcohol
           dehydrogenase (adh3) gene, partial cds
          Length = 1864

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 93  tgcctcctcagctgtggcatctcaaccgg 121
           |||||||| |||||||| |||||||||||
Sbjct: 913 tgcctccttagctgtggtatctcaaccgg 941



to top

>gb|AF326705.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 alcohol
           dehydrogenase (adh3) gene, partial cds
          Length = 1864

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 93  tgcctcctcagctgtggcatctcaaccgg 121
           |||||||| |||||||| |||||||||||
Sbjct: 913 tgcctccttagctgtggtatctcaaccgg 941



to top

>gb|AF326704.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 alcohol
           dehydrogenase (adh3) gene, partial cds
          Length = 1865

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 93  tgcctcctcagctgtggcatctcaaccgg 121
           |||||||| |||||||| |||||||||||
Sbjct: 913 tgcctccttagctgtggtatctcaaccgg 941



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 97      tcctcagctgtggcatctcaaccgg 121
               ||||||||||||||||||| |||||
Sbjct: 5680548 tcctcagctgtggcatctccaccgg 5680524



to top

>dbj|AK214149.1| Mus musculus cDNA, clone:Y2G0130N04, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000005964, based on BLAT search
          Length = 361

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 355 tgacagatgggggcgtcgactacagcttcgagtgcagtggcaacg 399
           |||||||||||||||| || |||  ||| ||||||| ||||||||
Sbjct: 317 tgacagatgggggcgtggattactcctttgagtgcattggcaacg 361



to top

>gb|AY104598.1| Zea mays PCO147721 mRNA sequence
          Length = 1683

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 366 ggcgtcgactacagcttcgagtgca 390
           ||||| |||||||||||||||||||
Sbjct: 866 ggcgtggactacagcttcgagtgca 890



to top

>gb|AF036579.1|AF036579 Gossypium darwinii A-subgenome alcohol dehydrogenase (AdhC) gene,
           partial cds
          Length = 1578

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 884 tttggacttggtgctgtaggtcttgcggt 912



to top

>gb|AF036578.1|AF036578 Gossypium barbadense A-subgenome alcohol dehydrogenase (AdhC) gene,
           partial cds
          Length = 1578

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 884 tttggacttggtgctgtaggtcttgcggt 912



to top

>gb|AF036577.1|AF036577 Gossypium mustelinum A-subgenome alcohol dehydrogenase (AdhC) gene,
           partial cds
          Length = 1617

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 923 tttggacttggtgctgtaggtcttgcggt 951



to top

>gb|AF036576.1|AF036576 Gossypium tomentosum A-subgenome alcohol dehydrogenase (AdhC) gene,
           partial cds
          Length = 1643

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 949 tttggacttggtgctgtaggtcttgcggt 977



to top

>gb|AF036575.1|AF036575 Gossypium hirsutum A-subgenome alcohol dehydrogenase (AdhC) gene,
           partial cds
          Length = 1645

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 951 tttggacttggtgctgtaggtcttgcggt 979



to top

>gb|AF036574.1|AF036574 Gossypium arboreum alcohol dehydrogenase (AdhC) pseudogene, partial
           sequence
          Length = 1344

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 950 tttggacttggtgctgtaggtcttgcggt 978



to top

>gb|AF036572.1|AF036572 Gossypium mustelinum D-subgenome alcohol dehydrogenase (AdhC) gene,
           partial cds
          Length = 1634

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 943 tttggacttggtgctgtaggtcttgcggt 971



to top

>gb|AF036571.1|AF036571 Gossypium tomentosum D-subgenome alcohol dehydrogenase (AdhC) gene,
           partial cds
          Length = 1654

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 963 tttggacttggtgctgtaggtcttgcggt 991



to top

>gb|AF036569.1|AF036569 Gossypium hirsutum D-subgenome alcohol dehydrogenase (AdhC) gene,
           partial cds
          Length = 1651

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 963 tttggacttggtgctgtaggtcttgcggt 991



to top

>gb|AF036568.1|AF036568 Gossypium raimondii alcohol dehydrogenase (AdhC) gene, partial cds
          Length = 1653

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 954 tttggacttggtgctgtaggtcttgcggt 982



to top

>gb|AF036567.1|AF036567 Gossypium robinsonii alcohol dehydrogenase (AdhC) gene, partial cds
          Length = 1616

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 177 tttggacttggtgcagttggtcttgcggt 205
           |||||||||||||| || |||||||||||
Sbjct: 927 tttggacttggtgctgtaggtcttgcggt 955



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 97      tcctcagctgtggcatctcaaccgg 121
               ||||||||||||||||||| |||||
Sbjct: 5747025 tcctcagctgtggcatctccaccgg 5747001



to top

>gb|BC038239.1| Homo sapiens tyrosine kinase with immunoglobulin-like and EGF-like
            domains 1, mRNA (cDNA clone MGC:46155 IMAGE:5767075),
            complete cds
          Length = 3960

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 94   gcctcctcagctgtggcatc 113
            ||||||||||||||||||||
Sbjct: 3492 gcctcctcagctgtggcatc 3473


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,414,738
Number of Sequences: 3902068
Number of extensions: 4414738
Number of successful extensions: 87440
Number of sequences better than 10.0: 316
Number of HSP's better than 10.0 without gapping: 316
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 86143
Number of HSP's gapped (non-prelim): 1288
length of query: 595
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 572
effective length of database: 17,143,297,704
effective search space: 9805966286688
effective search space used: 9805966286688
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top