ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags8p04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|BT016262.1| Zea mays clone Contig95 mRNA sequence 379 e-102
2gb|AY103818.1| Zea mays PCO124949 mRNA sequence 379 e-102
3ref|XM_477795.1| Oryza sativa (japonica cultivar-group), mRNA 323 4e-85
4dbj|AK061408.1| Oryza sativa (japonica cultivar-group) cDNA clon... 323 4e-85
5dbj|AK061383.1| Oryza sativa (japonica cultivar-group) cDNA clon... 323 4e-85
6dbj|AB037153.1| Oryza sativa (japonica cultivar-group) OsRPN12 m... 323 4e-85
7dbj|AK101316.1| Oryza sativa (japonica cultivar-group) cDNA clon... 315 9e-83
8dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 151 3e-33
9dbj|AP005200.4| Oryza sativa (japonica cultivar-group) genomic D... 151 3e-33
10ref|NM_123569.1| Arabidopsis thaliana peptidase AT5G42040 mRNA, ... 98 4e-17
11gb|AY258413.1| Arabidopsis thaliana 26S proteasome subunit RPN12... 98 4e-17
12dbj|AB017067.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 90 1e-14
13ref|NM_105127.2| Arabidopsis thaliana peptidase AT1G64520 mRNA, ... 66 1e-07
14gb|AY230847.1| Arabidopsis thaliana 26S proteasome subunit RPN12... 66 1e-07
15gb|AY230846.1| Arabidopsis thaliana 26S proteasome subunit RPN12... 66 1e-07
16gb|AY143888.1| Arabidopsis thaliana At1g64520/F1N19_10 mRNA, com... 66 1e-07
17gb|AF410265.1|AF410265 Arabidopsis thaliana At1g64520/F1N19_10 m... 66 1e-07
18gb|AY039857.1| Arabidopsis thaliana At1g64520/F1N19_10 mRNA, com... 66 1e-07
19emb|BX816010.1|CNS0ABWV Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
20emb|BX815245.1|CNS0AAGS Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
21gb|AC009519.4|AC009519 Genomic sequence for Arabidopsis thaliana... 66 1e-07
22dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone... 52 0.002
23gb|AC113514.9| Mus musculus chromosome 19, clone RP23-475D11, co... 44 0.52
24gb|AC116128.15| Mus musculus chromosome 19, clone RP23-95H3, com... 44 0.52
25dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 44 0.52
26gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 44 0.52
27gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 42 2.1
28emb|AL356234.18| Human DNA sequence from clone RP11-95M15 on chr... 42 2.1
29emb|BX044529.1|CNS096IT Single read from an extremity of a full-... 42 2.1
30emb|BX044528.1|CNS096IS Single read from an extremity of a full-... 42 2.1
31emb|BX043538.1|CNS095RA Single read from an extremity of a full-... 42 2.1
32emb|BX043537.1|CNS095R9 Single read from an extremity of a full-... 42 2.1
33emb|BX040987.1|CNS093SF Single read from an extremity of a full-... 42 2.1
34emb|BX031771.1|CNS08WOF Single read from an extremity of a full-... 42 2.1
35emb|BX031770.1|CNS08WOE Single read from an extremity of a full-... 42 2.1
36emb|BX028549.1|CNS08U6X Single read from an extremity of a full-... 42 2.1
37emb|BX028548.1|CNS08U6W Single read from an extremity of a full-... 42 2.1
38emb|BX027525.1|CNS08TEH Single read from an extremity of a full-... 42 2.1
39emb|BX027524.1|CNS08TEG Single read from an extremity of a full-... 42 2.1
40emb|BX021496.1|CNS08OR0 Single read from an extremity of a full-... 42 2.1
41emb|BX006225.1|CNS08CYT Single read from an extremity of a full-... 42 2.1
42emb|BX006224.1|CNS08CYS Single read from an extremity of a full-... 42 2.1
43gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 42 2.1
44gb|AC104122.2| Homo sapiens chromosome 5 clone RP11-410P18, comp... 42 2.1
45gb|AC027323.5| Homo sapiens chromosome 5 clone CTD-2034A10, comp... 42 2.1
46gb|AC154014.4| Mus musculus 6 BAC RP24-409C18 (Roswell Park Canc... 42 2.1
47gb|AC087349.17| Homo sapiens chromosome 8, clone RP11-339A23, co... 42 2.1
48emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 42 2.1
49emb|AL732474.8| Mouse DNA sequence from clone RP23-180I2 on chro... 42 2.1
50emb|AL606917.12| Mouse DNA sequence from clone RP23-25K8 on chro... 42 2.1
51emb|CT010576.9| Mouse DNA sequence from clone RP23-193B21 on chr... 40 8.2
52ref|XM_742921.1| Aspergillus fumigatus Af293 hypothetical protei... 40 8.2
53ref|XM_816106.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 8.2
54ref|XM_809419.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 8.2
55emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete ... 40 8.2
56emb|BX640430.1| Bordetella parapertussis strain 12822, complete ... 40 8.2
57emb|BX640419.1| Bordetella pertussis strain Tohama I, complete g... 40 8.2
58emb|BX572598.1| Rhodopseudomonas palustris CGA009 complete genom... 40 8.2
59gb|CP000282.1| Saccharophagus degradans 2-40, complete genome 40 8.2
60gb|AC010186.6| Homo sapiens 12p12-21.3-21.8 BAC RP11-705C15 (Ros... 40 8.2
61ref|XM_321580.2| Anopheles gambiae str. PEST ENSANGP00000011799 ... 40 8.2 
>gb|BT016262.1| Zea mays clone Contig95 mRNA sequence
          Length = 1020

 Score =  379 bits (191), Expect = e-102
 Identities = 476/571 (83%)
 Strand = Plus / Plus

                                                                       
Query: 7   gaggtgacgcagctgttcgaacgcttcaaggcggcctgcaagcgcagcgatctcgacgcc 66
           |||||||| ||| ||||||  |||||||||||||||| |   |||| ||| ||| || ||
Sbjct: 21  gaggtgacccagatgttcgcccgcttcaaggcggcctacgcccgcaacgacctcaacacc 80

                                                                       
Query: 67  tccgcgaccctcctctcgcagctcaaggtgctcctcaccaagttccccagcctccctccg 126
           | ||  ||||||||||||||||||||||| |  |||||| | ||||||||||| || || 
Sbjct: 81  tgcgtcaccctcctctcgcagctcaaggtccatctcacccaattccccagccttccgccc 140

                                                                       
Query: 127 ctcttccagcagacgcccaacgccgtggaggagctcaagctcgcgagggaaatttatgag 186
            | || |||||||| || |||   |||||||||||||| || || ||||| |||||||||
Sbjct: 141 ttgtttcagcagacaccgaacattgtggaggagctcaaacttgcaagggacatttatgag 200

                                                                       
Query: 187 catgcagttcttttgagtgtgaaaatggaagatcaagatgcatttgaaagggacttctgc 246
           ||||| ||| |||||||||||||| | || || |||||||| |||||| | || ||||||
Sbjct: 201 catgctgttgttttgagtgtgaaacttgaggaccaagatgcgtttgaacgcgatttctgc 260

                                                                       
Query: 247 cagctcaagccttattacatggacacatgtggcatacttcctccatcttcaatggagtac 306
           ||||| ||||||||||||||||| |||||||||||| ||||  | ||  ||  |||||||
Sbjct: 261 cagctgaagccttattacatggatacatgtggcataattcccgcctcgccagaggagtac 320

                                                                       
Query: 307 ccaatcatggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccac 366
           |||||  |||| || || ||||||||||||||||| |||||||||||||| || ||||||
Sbjct: 321 ccaattttgggactcaatcttctgaggctgttggttcagaatagaattgccgaattccac 380

                                                                       
Query: 367 actgagctggagcttctgcccgccaaagcgctggagaatgcttgcatcaagcacggggtt 426
           ||||||||||||||| | || ||||| || || ||| || ||||||||||||| |  || 
Sbjct: 381 actgagctggagcttttacctgccaaggcactcgagcatccttgcatcaagcatgctgta 440

                                                                       
Query: 427 gagctcgagcagtcctttatggagggcgcctacaaccgtgtgctgagcgctcggcaaacc 486
           ||||| ||||| ||||| |||||||| ||||||||||| ||| | |||||||||||  | 
Sbjct: 441 gagcttgagcaatccttcatggagggtgcctacaaccgagtgttaagcgctcggcaggct 500

                                                                       
Query: 487 gcaccgcatgagacctacgtatacttcatggaccttctcgccaaaacggttagagacgag 546
           |  || |||||||||||||| |||||||| ||||||||||||||||| |||||||| |||
Sbjct: 501 gtgccacatgagacctacgtttacttcatcgaccttctcgccaaaacagttagagatgag 560

                                          
Query: 547 atagctgggtgcagcgagaagggatatgatt 577
           || |||||||||||||| ||||| |||||||
Sbjct: 561 atcgctgggtgcagcgaaaaggggtatgatt 591
to top
>gb|AY103818.1| Zea mays PCO124949 mRNA sequence
          Length = 1251

 Score =  379 bits (191), Expect = e-102
 Identities = 476/571 (83%)
 Strand = Plus / Plus

                                                                       
Query: 7   gaggtgacgcagctgttcgaacgcttcaaggcggcctgcaagcgcagcgatctcgacgcc 66
           |||||||| ||| ||||||  |||||||||||||||| |   |||| ||| ||| || ||
Sbjct: 227 gaggtgacccagatgttcgcccgcttcaaggcggcctacgcccgcaacgacctcaacacc 286

                                                                       
Query: 67  tccgcgaccctcctctcgcagctcaaggtgctcctcaccaagttccccagcctccctccg 126
           | ||  ||||||||||||||||||||||| |  |||||| | ||||||||||| || || 
Sbjct: 287 tgcgtcaccctcctctcgcagctcaaggtccatctcacccaattccccagccttccgccc 346

                                                                       
Query: 127 ctcttccagcagacgcccaacgccgtggaggagctcaagctcgcgagggaaatttatgag 186
            | || |||||||| || |||   |||||||||||||| || || ||||| |||||||||
Sbjct: 347 ttgtttcagcagacaccgaacattgtggaggagctcaaacttgcaagggacatttatgag 406

                                                                       
Query: 187 catgcagttcttttgagtgtgaaaatggaagatcaagatgcatttgaaagggacttctgc 246
           ||||| ||| |||||||||||||| | || || |||||||| |||||| | || ||||||
Sbjct: 407 catgctgttgttttgagtgtgaaacttgaggaccaagatgcgtttgaacgcgatttctgc 466

                                                                       
Query: 247 cagctcaagccttattacatggacacatgtggcatacttcctccatcttcaatggagtac 306
           ||||| ||||||||||||||||| |||||||||||| ||||  | ||  ||  |||||||
Sbjct: 467 cagctgaagccttattacatggatacatgtggcataattcccgcctcgccagaggagtac 526

                                                                       
Query: 307 ccaatcatggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccac 366
           |||||  |||| || || ||||||||||||||||| |||||||||||||| |||||||||
Sbjct: 527 ccaattttgggactcaatcttctgaggctgttggttcagaatagaattgccgagttccac 586

                                                                       
Query: 367 actgagctggagcttctgcccgccaaagcgctggagaatgcttgcatcaagcacggggtt 426
           ||||||||||||||| | || | ||| || || ||| || ||||||||||||| |  || 
Sbjct: 587 actgagctggagcttttacctgtcaaggcactcgagcatccttgcatcaagcatgctgta 646

                                                                       
Query: 427 gagctcgagcagtcctttatggagggcgcctacaaccgtgtgctgagcgctcggcaaacc 486
           ||||| ||||| ||||| |||||||| ||||||||||| ||| | |||||||||||  | 
Sbjct: 647 gagcttgagcaatccttcatggagggtgcctacaaccgagtgttaagcgctcggcaggct 706

                                                                       
Query: 487 gcaccgcatgagacctacgtatacttcatggaccttctcgccaaaacggttagagacgag 546
           |  || |||||||||||||| |||||||| ||||||||||||||||| |||||||| |||
Sbjct: 707 gtgccacatgagacctacgtttacttcatcgaccttctcgccaaaacagttagagatgag 766

                                          
Query: 547 atagctgggtgcagcgagaagggatatgatt 577
           || |||||||||||||| ||||| |||||||
Sbjct: 767 atcgctgggtgcagcgaaaaggggtatgatt 797
to top
>ref|XM_477795.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 804

 Score =  323 bits (163), Expect = 4e-85
 Identities = 421/507 (83%)
 Strand = Plus / Plus

                                                                       
Query: 82  tcgcagctcaaggtgctcctcaccaagttccccagcctccctccgctcttccagcagacg 141
           |||||||||||||| | ||||||||||||||||||||| |||||    || |||||||| 
Sbjct: 94  tcgcagctcaaggtccgcctcaccaagttccccagccttcctccatcatttcagcagaca 153

                                                                       
Query: 142 cccaacgccgtggaggagctcaagctcgcgagggaaatttatgagcatgcagttcttttg 201
           || || || ||||| ||||| ||  | |||||||| || ||||||||||||||| || ||
Sbjct: 154 ccgaatgcagtggaagagctgaaaattgcgagggacatctatgagcatgcagttgttctg 213

                                                                       
Query: 202 agtgtgaaaatggaagatcaagatgcatttgaaagggacttctgccagctcaagccttat 261
           ||||||||||| ||||| ||||||||||||||||||||||| || || ||||| ||||||
Sbjct: 214 agtgtgaaaattgaagaccaagatgcatttgaaagggacttttgtcaactcaaaccttat 273

                                                                       
Query: 262 tacatggacacatgtggcatacttcctccatcttcaatggagtacccaatcatggggctt 321
           |||||||| ||||| |||||| |||| |||||  ||  |||||| |||||| |||| |||
Sbjct: 274 tacatggatacatgcggcataattccaccatcaccacaggagtatccaatcttgggtctt 333

                                                                       
Query: 322 aaccttctgaggctgttggtccagaatagaattgcggagttccacactgagctggagctt 381
           || ||||| |||||||| || ||||| |||||||| |||||||||||||||||||| |||
Sbjct: 334 aatcttctaaggctgttagttcagaacagaattgcagagttccacactgagctggaactt 393

                                                                       
Query: 382 ctgcccgccaaagcgctggagaatgcttgcatcaagcacggggttgagctcgagcagtcc 441
           ||||| | || ||| || || ||| ||||||||||||| | ||| ||||| |||||||| 
Sbjct: 394 ctgccggtcacagcacttgaaaatccttgcatcaagcatgcggtggagcttgagcagtca 453

                                                                       
Query: 442 tttatggagggcgcctacaaccgtgtgctgagcgctcggcaaaccgcaccgcatgagacc 501
           ||||||||||| || |||||||| ||| |||||||||| ||  | |  || || || || 
Sbjct: 454 tttatggagggtgcttacaaccgagtgttgagcgctcgccaggctgtgccccacgaaaca 513

                                                                       
Query: 502 tacgtatacttcatggaccttctcgccaaaacggttagagacgagatagctgggtgcagc 561
           || || ||||||||||| ||||| |||||||| || ||||| ||  | ||||| ||||| 
Sbjct: 514 tatgtgtacttcatggatcttcttgccaaaacagtcagagatgaactggctggttgcagt 573

                                      
Query: 562 gagaagggatatgattacctgtcaata 588
           |||||||| ||||||||  ||||||||
Sbjct: 574 gagaagggttatgattatatgtcaata 600



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                    
Query: 2  tggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 43
          ||||||||||||||||||| |||   ||||||||||| ||||
Sbjct: 14 tggtggaggtgacgcagctcttctcccgcttcaaggcagcct 55
to top
>dbj|AK061408.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-A10, full
           insert sequence
          Length = 1053

 Score =  323 bits (163), Expect = 4e-85
 Identities = 421/507 (83%)
 Strand = Plus / Plus

                                                                       
Query: 82  tcgcagctcaaggtgctcctcaccaagttccccagcctccctccgctcttccagcagacg 141
           |||||||||||||| | ||||||||||||||||||||| |||||    || |||||||| 
Sbjct: 173 tcgcagctcaaggtccgcctcaccaagttccccagccttcctccatcatttcagcagaca 232

                                                                       
Query: 142 cccaacgccgtggaggagctcaagctcgcgagggaaatttatgagcatgcagttcttttg 201
           || || || ||||| ||||| ||  | |||||||| || ||||||||||||||| || ||
Sbjct: 233 ccgaatgcagtggaagagctgaaaattgcgagggacatctatgagcatgcagttgttctg 292

                                                                       
Query: 202 agtgtgaaaatggaagatcaagatgcatttgaaagggacttctgccagctcaagccttat 261
           ||||||||||| ||||| ||||||||||||||||||||||| || || ||||| ||||||
Sbjct: 293 agtgtgaaaattgaagaccaagatgcatttgaaagggacttttgtcaactcaaaccttat 352

                                                                       
Query: 262 tacatggacacatgtggcatacttcctccatcttcaatggagtacccaatcatggggctt 321
           |||||||| ||||| |||||| |||| |||||  ||  |||||| |||||| |||| |||
Sbjct: 353 tacatggatacatgcggcataattccaccatcaccacaggagtatccaatcttgggtctt 412

                                                                       
Query: 322 aaccttctgaggctgttggtccagaatagaattgcggagttccacactgagctggagctt 381
           || ||||| |||||||| || ||||| |||||||| |||||||||||||||||||| |||
Sbjct: 413 aatcttctaaggctgttagttcagaacagaattgcagagttccacactgagctggaactt 472

                                                                       
Query: 382 ctgcccgccaaagcgctggagaatgcttgcatcaagcacggggttgagctcgagcagtcc 441
           ||||| | || ||| || || ||| ||||||||||||| | ||| ||||| |||||||| 
Sbjct: 473 ctgccggtcacagcacttgaaaatccttgcatcaagcatgcggtggagcttgagcagtca 532

                                                                       
Query: 442 tttatggagggcgcctacaaccgtgtgctgagcgctcggcaaaccgcaccgcatgagacc 501
           ||||||||||| || |||||||| ||| |||||||||| ||  | |  || || || || 
Sbjct: 533 tttatggagggtgcttacaaccgagtgttgagcgctcgccaggctgtgccccacgaaaca 592

                                                                       
Query: 502 tacgtatacttcatggaccttctcgccaaaacggttagagacgagatagctgggtgcagc 561
           || || ||||||||||| ||||| |||||||| || ||||| ||  | ||||| ||||| 
Sbjct: 593 tatgtgtacttcatggatcttcttgccaaaacagtcagagatgaactggctggttgcagt 652

                                      
Query: 562 gagaagggatatgattacctgtcaata 588
           |||||||| ||||||||  ||||||||
Sbjct: 653 gagaagggttatgattatatgtcaata 679



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 2   tggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 43
           ||||||||||||||||||| |||   ||||||||||| ||||
Sbjct: 93  tggtggaggtgacgcagctcttctcccgcttcaaggcagcct 134
to top
>dbj|AK061383.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-H08, full
           insert sequence
          Length = 1230

 Score =  323 bits (163), Expect = 4e-85
 Identities = 421/507 (83%)
 Strand = Plus / Plus

                                                                       
Query: 82  tcgcagctcaaggtgctcctcaccaagttccccagcctccctccgctcttccagcagacg 141
           |||||||||||||| | ||||||||||||||||||||| |||||    || |||||||| 
Sbjct: 185 tcgcagctcaaggtccgcctcaccaagttccccagccttcctccatcatttcagcagaca 244

                                                                       
Query: 142 cccaacgccgtggaggagctcaagctcgcgagggaaatttatgagcatgcagttcttttg 201
           || || || ||||| ||||| ||  | |||||||| || ||||||||||||||| || ||
Sbjct: 245 ccgaatgcagtggaagagctgaaaattgcgagggacatctatgagcatgcagttgttctg 304

                                                                       
Query: 202 agtgtgaaaatggaagatcaagatgcatttgaaagggacttctgccagctcaagccttat 261
           ||||||||||| ||||| ||||||||||||||||||||||| || || ||||| ||||||
Sbjct: 305 agtgtgaaaattgaagaccaagatgcatttgaaagggacttttgtcaactcaaaccttat 364

                                                                       
Query: 262 tacatggacacatgtggcatacttcctccatcttcaatggagtacccaatcatggggctt 321
           |||||||| ||||| |||||| |||| |||||  ||  |||||| |||||| |||| |||
Sbjct: 365 tacatggatacatgcggcataattccaccatcaccacaggagtatccaatcttgggtctt 424

                                                                       
Query: 322 aaccttctgaggctgttggtccagaatagaattgcggagttccacactgagctggagctt 381
           || ||||| |||||||| || ||||| |||||||| |||||||||||||||||||| |||
Sbjct: 425 aatcttctaaggctgttagttcagaacagaattgcagagttccacactgagctggaactt 484

                                                                       
Query: 382 ctgcccgccaaagcgctggagaatgcttgcatcaagcacggggttgagctcgagcagtcc 441
           ||||| | || ||| || || ||| ||||||||||||| | ||| ||||| |||||||| 
Sbjct: 485 ctgccggtcacagcacttgaaaatccttgcatcaagcatgcggtggagcttgagcagtca 544

                                                                       
Query: 442 tttatggagggcgcctacaaccgtgtgctgagcgctcggcaaaccgcaccgcatgagacc 501
           ||||||||||| || |||||||| ||| |||||||||| ||  | |  || || || || 
Sbjct: 545 tttatggagggtgcttacaaccgagtgttgagcgctcgccaggctgtgccccacgaaaca 604

                                                                       
Query: 502 tacgtatacttcatggaccttctcgccaaaacggttagagacgagatagctgggtgcagc 561
           || || ||||||||||| ||||| |||||||| || ||||| ||  | ||||| ||||| 
Sbjct: 605 tatgtgtacttcatggatcttcttgccaaaacagtcagagatgaactggctggttgcagt 664

                                      
Query: 562 gagaagggatatgattacctgtcaata 588
           |||||||| ||||||||  ||||||||
Sbjct: 665 gagaagggttatgattatatgtcaata 691



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 2   tggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 43
           ||||||||||||||||||| |||   ||||||||||| ||||
Sbjct: 105 tggtggaggtgacgcagctcttctcccgcttcaaggcagcct 146
to top
>dbj|AB037153.1| Oryza sativa (japonica cultivar-group) OsRPN12 mRNA for 26S
           proteasome regulatory particle non-ATPase subunit12,
           complete cds
          Length = 1063

 Score =  323 bits (163), Expect = 4e-85
 Identities = 421/507 (83%)
 Strand = Plus / Plus

                                                                       
Query: 82  tcgcagctcaaggtgctcctcaccaagttccccagcctccctccgctcttccagcagacg 141
           |||||||||||||| | ||||||||||||||||||||| |||||    || |||||||| 
Sbjct: 169 tcgcagctcaaggtccgcctcaccaagttccccagccttcctccatcatttcagcagaca 228

                                                                       
Query: 142 cccaacgccgtggaggagctcaagctcgcgagggaaatttatgagcatgcagttcttttg 201
           || || || ||||| ||||| ||  | |||||||| || ||||||||||||||| || ||
Sbjct: 229 ccgaatgcagtggaagagctgaaaattgcgagggacatctatgagcatgcagttgttctg 288

                                                                       
Query: 202 agtgtgaaaatggaagatcaagatgcatttgaaagggacttctgccagctcaagccttat 261
           ||||||||||| ||||| ||||||||||||||||||||||| || || ||||| ||||||
Sbjct: 289 agtgtgaaaattgaagaccaagatgcatttgaaagggacttttgtcaactcaaaccttat 348

                                                                       
Query: 262 tacatggacacatgtggcatacttcctccatcttcaatggagtacccaatcatggggctt 321
           |||||||| ||||| |||||| |||| |||||  ||  |||||| |||||| |||| |||
Sbjct: 349 tacatggatacatgcggcataattccaccatcaccacaggagtatccaatcttgggtctt 408

                                                                       
Query: 322 aaccttctgaggctgttggtccagaatagaattgcggagttccacactgagctggagctt 381
           || ||||| |||||||| || ||||| |||||||| |||||||||||||||||||| |||
Sbjct: 409 aatcttctaaggctgttagttcagaacagaattgcagagttccacactgagctggaactt 468

                                                                       
Query: 382 ctgcccgccaaagcgctggagaatgcttgcatcaagcacggggttgagctcgagcagtcc 441
           ||||| | || ||| || || ||| ||||||||||||| | ||| ||||| |||||||| 
Sbjct: 469 ctgccggtcacagcacttgaaaatccttgcatcaagcatgcggtggagcttgagcagtca 528

                                                                       
Query: 442 tttatggagggcgcctacaaccgtgtgctgagcgctcggcaaaccgcaccgcatgagacc 501
           ||||||||||| || |||||||| ||| |||||||||| ||  | |  || || || || 
Sbjct: 529 tttatggagggtgcttacaaccgagtgttgagcgctcgccaggctgtgccccacgaaaca 588

                                                                       
Query: 502 tacgtatacttcatggaccttctcgccaaaacggttagagacgagatagctgggtgcagc 561
           || || ||||||||||| ||||| |||||||| || ||||| ||  | ||||| ||||| 
Sbjct: 589 tatgtgtacttcatggatcttcttgccaaaacagtcagagatgaactggctggttgcagt 648

                                      
Query: 562 gagaagggatatgattacctgtcaata 588
           |||||||| ||||||||  ||||||||
Sbjct: 649 gagaagggttatgattatatgtcaata 675



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 2   tggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 43
           ||||||||||||||||||| |||   ||||||||||| ||||
Sbjct: 89  tggtggaggtgacgcagctcttctcccgcttcaaggcagcct 130
to top
>dbj|AK101316.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034D03, full
           insert sequence
          Length = 1218

 Score =  315 bits (159), Expect = 9e-83
 Identities = 420/507 (82%)
 Strand = Plus / Plus

                                                                       
Query: 82  tcgcagctcaaggtgctcctcaccaagttccccagcctccctccgctcttccagcagacg 141
           |||||||||||||| | ||||||||||||||| ||||| |||||    || |||||||| 
Sbjct: 174 tcgcagctcaaggtccgcctcaccaagttcccaagccttcctccatcatttcagcagaca 233

                                                                       
Query: 142 cccaacgccgtggaggagctcaagctcgcgagggaaatttatgagcatgcagttcttttg 201
           || || || ||||| ||||| ||  | |||||||| || ||||||||||||||| || ||
Sbjct: 234 ccgaatgcagtggaagagctgaaaattgcgagggacatctatgagcatgcagttgttctg 293

                                                                       
Query: 202 agtgtgaaaatggaagatcaagatgcatttgaaagggacttctgccagctcaagccttat 261
           ||||||||||| ||||| ||||||||||||||||||||||| || || ||||| ||||||
Sbjct: 294 agtgtgaaaattgaagaccaagatgcatttgaaagggacttttgtcaactcaaaccttat 353

                                                                       
Query: 262 tacatggacacatgtggcatacttcctccatcttcaatggagtacccaatcatggggctt 321
           |||||||| ||||| |||||| |||| |||||  ||  |||||| |||||| |||| |||
Sbjct: 354 tacatggatacatgcggcataattccaccatcaccacaggagtatccaatcttgggtctt 413

                                                                       
Query: 322 aaccttctgaggctgttggtccagaatagaattgcggagttccacactgagctggagctt 381
           || ||||| |||||||| || ||||| |||||||| |||||||||||||||||||| |||
Sbjct: 414 aatcttctaaggctgttagttcagaacagaattgcagagttccacactgagctggaactt 473

                                                                       
Query: 382 ctgcccgccaaagcgctggagaatgcttgcatcaagcacggggttgagctcgagcagtcc 441
           ||||| | || ||| || || ||| ||||||||||||| | ||| ||||| |||||||| 
Sbjct: 474 ctgccggtcacagcacttgaaaatccttgcatcaagcatgcggtggagcttgagcagtca 533

                                                                       
Query: 442 tttatggagggcgcctacaaccgtgtgctgagcgctcggcaaaccgcaccgcatgagacc 501
           ||||||||||| || |||||||| ||| |||||||||| ||  | |  || || || || 
Sbjct: 534 tttatggagggtgcttacaaccgagtgttgagcgctcgccaggctgtgccccacgaaaca 593

                                                                       
Query: 502 tacgtatacttcatggaccttctcgccaaaacggttagagacgagatagctgggtgcagc 561
           || || ||||||||||| ||||| |||||||| || ||||| ||  | ||||| ||||| 
Sbjct: 594 tatgtgtacttcatggatcttcttgccaaaacagtcagagatgaactggctggttgcagt 653

                                      
Query: 562 gagaagggatatgattacctgtcaata 588
           |||||||| ||||||||  ||||||||
Sbjct: 654 gagaagggttatgattatatgtcaata 680



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 2   tggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 43
           ||||||||||||||||||| |||   ||||||||||| ||||
Sbjct: 94  tggtggaggtgacgcagctcttctcccgcttcaaggcagcct 135
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  151 bits (76), Expect = 3e-33
 Identities = 154/180 (85%)
 Strand = Plus / Minus

                                                                            
Query: 300      ggagtacccaatcatggggcttaaccttctgaggctgttggtccagaatagaattgcgga 359
                |||||| |||||| |||| ||||| ||||| |||||||| || ||||| |||||||| ||
Sbjct: 14474888 ggagtatccaatcttgggtcttaatcttctaaggctgttagttcagaacagaattgcaga 14474829

                                                                            
Query: 360      gttccacactgagctggagcttctgcccgccaaagcgctggagaatgcttgcatcaagca 419
                |||||||||||||||||| |||||||| | || ||| || || ||| |||||||||||||
Sbjct: 14474828 gttccacactgagctggaacttctgccggtcacagcacttgaaaatccttgcatcaagca 14474769

                                                                            
Query: 420      cggggttgagctcgagcagtcctttatggagggcgcctacaaccgtgtgctgagcgctcg 479
                 | ||| ||||| |||||||| ||||||||||| || |||||||| ||| ||||||||||
Sbjct: 14474768 tgcggtggagcttgagcagtcatttatggagggtgcttacaaccgagtgttgagcgctcg 14474709



 Score =  117 bits (59), Expect = 4e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                            
Query: 181      tatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcatttgaaagggac 240
                ||||||||||||||| || ||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 14475455 tatgagcatgcagttgttctgagtgtgaaaattgaagaccaagatgcatttgaaagggac 14475396

                                                   
Query: 241      ttctgccagctcaagccttattacatggacacatg 275
                || || || ||||| |||||||||||||| |||||
Sbjct: 14475395 ttttgtcaactcaaaccttattacatggatacatg 14475361



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 99       cctcaccaagttccccagcctccctcc 125
                ||||||||||||||||||||| |||||
Sbjct: 14476273 cctcaccaagttccccagccttcctcc 14476247



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                          
Query: 2        tggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 43
                ||||||||||||||||||| |||   ||||||||||| ||||
Sbjct: 14476839 tggtggaggtgacgcagctcttctcccgcttcaaggcagcct 14476798
to top
>dbj|AP005200.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0673E01
          Length = 125909

 Score =  151 bits (76), Expect = 3e-33
 Identities = 154/180 (85%)
 Strand = Plus / Minus

                                                                         
Query: 300   ggagtacccaatcatggggcttaaccttctgaggctgttggtccagaatagaattgcgga 359
             |||||| |||||| |||| ||||| ||||| |||||||| || ||||| |||||||| ||
Sbjct: 95219 ggagtatccaatcttgggtcttaatcttctaaggctgttagttcagaacagaattgcaga 95160

                                                                         
Query: 360   gttccacactgagctggagcttctgcccgccaaagcgctggagaatgcttgcatcaagca 419
             |||||||||||||||||| |||||||| | || ||| || || ||| |||||||||||||
Sbjct: 95159 gttccacactgagctggaacttctgccggtcacagcacttgaaaatccttgcatcaagca 95100

                                                                         
Query: 420   cggggttgagctcgagcagtcctttatggagggcgcctacaaccgtgtgctgagcgctcg 479
              | ||| ||||| |||||||| ||||||||||| || |||||||| ||| ||||||||||
Sbjct: 95099 tgcggtggagcttgagcagtcatttatggagggtgcttacaaccgagtgttgagcgctcg 95040



 Score =  117 bits (59), Expect = 4e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                         
Query: 181   tatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcatttgaaagggac 240
             ||||||||||||||| || ||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 95786 tatgagcatgcagttgttctgagtgtgaaaattgaagaccaagatgcatttgaaagggac 95727

                                                
Query: 241   ttctgccagctcaagccttattacatggacacatg 275
             || || || ||||| |||||||||||||| |||||
Sbjct: 95726 ttttgtcaactcaaaccttattacatggatacatg 95692



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 99    cctcaccaagttccccagcctccctcc 125
             ||||||||||||||||||||| |||||
Sbjct: 96604 cctcaccaagttccccagccttcctcc 96578



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                       
Query: 2     tggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 43
             ||||||||||||||||||| |||   ||||||||||| ||||
Sbjct: 97170 tggtggaggtgacgcagctcttctcccgcttcaaggcagcct 97129
to top
>ref|NM_123569.1| Arabidopsis thaliana peptidase AT5G42040 mRNA, complete cds
          Length = 480

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 139/169 (82%)
 Strand = Plus / Plus

                                                                       
Query: 398 tggagaatgcttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcct 457
           |||||||| ||||||||||||| | ||| ||||||||||| ||||| ||||| || || |
Sbjct: 86  tggagaatccttgcatcaagcatgcggtggagctcgagcaatccttcatggaaggtgctt 145

                                                                       
Query: 458 acaaccgtgtgctgagcgctcggcaaaccgcaccgcatgagacctacgtatacttcatgg 517
           | ||||||||| |||| ||| | |||||||||||  ||||||| ||||| || |||||||
Sbjct: 146 ataaccgtgtgttgagtgctagacaaaccgcacctgatgagacttacgtctatttcatgg 205

                                                            
Query: 518 accttctcgccaaaacggttagagacgagatagctgggtgcagcgagaa 566
           | ||  | || |||||  ||||||| || |||||||| ||||| |||||
Sbjct: 206 atctcttggcaaaaaccattagagatgaaatagctggatgcagtgagaa 254
to top
>gb|AY258413.1| Arabidopsis thaliana 26S proteasome subunit RPN12b (RPN12b) mRNA,
           complete cds
          Length = 480

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 139/169 (82%)
 Strand = Plus / Plus

                                                                       
Query: 398 tggagaatgcttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcct 457
           |||||||| ||||||||||||| | ||| ||||||||||| ||||| ||||| || || |
Sbjct: 86  tggagaatccttgcatcaagcatgcggtggagctcgagcaatccttcatggaaggtgctt 145

                                                                       
Query: 458 acaaccgtgtgctgagcgctcggcaaaccgcaccgcatgagacctacgtatacttcatgg 517
           | ||||||||| |||| ||| | |||||||||||  ||||||| ||||| || |||||||
Sbjct: 146 ataaccgtgtgttgagtgctagacaaaccgcacctgatgagacttacgtctatttcatgg 205

                                                            
Query: 518 accttctcgccaaaacggttagagacgagatagctgggtgcagcgagaa 566
           | ||  | || |||||  ||||||| || |||||||| ||||| |||||
Sbjct: 206 atctcttggcaaaaaccattagagatgaaatagctggatgcagtgagaa 254
to top
>dbj|AB017067.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJC20
          Length = 83689

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 102/121 (84%)
 Strand = Plus / Minus

                                                                         
Query: 398   tggagaatgcttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcct 457
             |||||||| ||||||||||||| | ||| ||||||||||| ||||| ||||| || || |
Sbjct: 36544 tggagaatccttgcatcaagcatgcggtggagctcgagcaatccttcatggaaggtgctt 36485

                                                                         
Query: 458   acaaccgtgtgctgagcgctcggcaaaccgcaccgcatgagacctacgtatacttcatgg 517
             | ||||||||| |||| ||| | |||||||||||  ||||||| ||||| || |||||||
Sbjct: 36484 ataaccgtgtgttgagtgctagacaaaccgcacctgatgagacttacgtctatttcatgg 36425

              
Query: 518   a 518
             |
Sbjct: 36424 a 36424
to top
>ref|NM_105127.2| Arabidopsis thaliana peptidase AT1G64520 mRNA, complete cds
          Length = 1063

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 314 tggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccacactgagc 373
           |||| |||||||||||||||||| |||| || ||||||||||| || |||||||| ||||
Sbjct: 387 tgggtcttaaccttctgaggctgctggtacaaaatagaattgctgaattccacaccgagc 446

            
Query: 374 t 374
           |
Sbjct: 447 t 447



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 407 cttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcctacaaccgtg 466
           ||||||||||||| |  || ||||| ||||| ||||| |||||||| ||||| |||||||
Sbjct: 480 cttgcatcaagcatgcagtagagcttgagcaatccttcatggagggtgcctataaccgtg 539

                  
Query: 467 tgctgag 473
           || ||||
Sbjct: 540 tgttgag 546



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 172 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 231
           ||||| |||||||||||||| ||| || | || || ||||  || ||||||||||| |||
Sbjct: 245 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 304

                                        
Query: 232 gaaagggacttctgccagctcaagcctta 260
           || || || |||| |||||| || |||||
Sbjct: 305 gagagagatttcttccagctgaaacctta 333
to top
>gb|AY230847.1| Arabidopsis thaliana 26S proteasome subunit RPN12 (RPN12) mRNA,
           RPN12-2 allele, complete cds
          Length = 1054

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 314 tggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccacactgagc 373
           |||| |||||||||||||||||| |||| || ||||||||||| || |||||||| ||||
Sbjct: 359 tgggtcttaaccttctgaggctgctggtacaaaatagaattgctgaattccacaccgagc 418

            
Query: 374 t 374
           |
Sbjct: 419 t 419



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 407 cttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcctacaaccgtg 466
           ||||||||||||| |  || ||||| ||||| ||||| |||||||| ||||| |||||||
Sbjct: 452 cttgcatcaagcatgcagtagagcttgagcaatccttcatggagggtgcctataaccgtg 511

                  
Query: 467 tgctgag 473
           || ||||
Sbjct: 512 tgttgag 518



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 172 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 231
           ||||| |||||||||||||| ||| || | || || ||||  || ||||||||||| |||
Sbjct: 217 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 276

                                        
Query: 232 gaaagggacttctgccagctcaagcctta 260
           || || || |||| |||||| || |||||
Sbjct: 277 gagagagatttcttccagctgaaacctta 305
to top
>gb|AY230846.1| Arabidopsis thaliana 26S proteasome subunit RPN12 (RPN12) mRNA,
           RPN12-1 allele, complete cds
          Length = 1038

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 314 tggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccacactgagc 373
           |||| |||||||||||||||||| |||| || ||||||||||| || |||||||| ||||
Sbjct: 349 tgggtcttaaccttctgaggctgctggtacaaaatagaattgctgaattccacaccgagc 408

            
Query: 374 t 374
           |
Sbjct: 409 t 409



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 407 cttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcctacaaccgtg 466
           ||||||||||||| |  || ||||| ||||| ||||| |||||||| ||||| |||||||
Sbjct: 442 cttgcatcaagcatgcagtagagcttgagcaatccttcatggagggtgcctataaccgtg 501

                  
Query: 467 tgctgag 473
           || ||||
Sbjct: 502 tgttgag 508



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 172 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 231
           ||||| |||||||||||||| ||| || | || || ||||  || ||||||||||| |||
Sbjct: 207 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 266

                                        
Query: 232 gaaagggacttctgccagctcaagcctta 260
           || || || |||| |||||| || |||||
Sbjct: 267 gagagagatttcttccagctgaaacctta 295
to top
>gb|AY143888.1| Arabidopsis thaliana At1g64520/F1N19_10 mRNA, complete cds
          Length = 804

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 314 tggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccacactgagc 373
           |||| |||||||||||||||||| |||| || ||||||||||| || |||||||| ||||
Sbjct: 326 tgggtcttaaccttctgaggctgctggtacaaaatagaattgctgaattccacaccgagc 385

            
Query: 374 t 374
           |
Sbjct: 386 t 386



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 407 cttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcctacaaccgtg 466
           ||||||||||||| |  || ||||| ||||| ||||| |||||||| ||||| |||||||
Sbjct: 419 cttgcatcaagcatgcagtagagcttgagcaatccttcatggagggtgcctataaccgtg 478

                  
Query: 467 tgctgag 473
           || ||||
Sbjct: 479 tgttgag 485



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 172 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 231
           ||||| |||||||||||||| ||| || | || || ||||  || ||||||||||| |||
Sbjct: 184 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 243

                                        
Query: 232 gaaagggacttctgccagctcaagcctta 260
           || || || |||| |||||| || |||||
Sbjct: 244 gagagagatttcttccagctgaaacctta 272
to top
>gb|AF410265.1|AF410265 Arabidopsis thaliana At1g64520/F1N19_10 mRNA, complete cds
          Length = 1008

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 314 tggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccacactgagc 373
           |||| |||||||||||||||||| |||| || ||||||||||| || |||||||| ||||
Sbjct: 372 tgggtcttaaccttctgaggctgctggtacaaaatagaattgctgaattccacaccgagc 431

            
Query: 374 t 374
           |
Sbjct: 432 t 432



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 407 cttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcctacaaccgtg 466
           ||||||||||||| |  || ||||| ||||| ||||| |||||||| ||||| |||||||
Sbjct: 465 cttgcatcaagcatgcagtagagcttgagcaatccttcatggagggtgcctataaccgtg 524

                  
Query: 467 tgctgag 473
           || ||||
Sbjct: 525 tgttgag 531



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 172 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 231
           ||||| |||||||||||||| ||| || | || || ||||  || ||||||||||| |||
Sbjct: 230 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 289

                                        
Query: 232 gaaagggacttctgccagctcaagcctta 260
           || || || |||| |||||| || |||||
Sbjct: 290 gagagagatttcttccagctgaaacctta 318
to top
>gb|AY039857.1| Arabidopsis thaliana At1g64520/F1N19_10 mRNA, complete cds
          Length = 953

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 314 tggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccacactgagc 373
           |||| |||||||||||||||||| |||| || ||||||||||| || |||||||| ||||
Sbjct: 335 tgggtcttaaccttctgaggctgctggtacaaaatagaattgctgaattccacaccgagc 394

            
Query: 374 t 374
           |
Sbjct: 395 t 395



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 407 cttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcctacaaccgtg 466
           ||||||||||||| |  || ||||| ||||| ||||| |||||||| ||||| |||||||
Sbjct: 428 cttgcatcaagcatgcagtagagcttgagcaatccttcatggagggtgcctataaccgtg 487

                  
Query: 467 tgctgag 473
           || ||||
Sbjct: 488 tgttgag 494



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 172 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 231
           ||||| |||||||||||||| ||| || | || || ||||  || ||||||||||| |||
Sbjct: 193 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 252

                                        
Query: 232 gaaagggacttctgccagctcaagcctta 260
           || || || |||| |||||| || |||||
Sbjct: 253 gagagagatttcttccagctgaaacctta 281
to top
>emb|BX816010.1|CNS0ABWV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH22ZE10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 960

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 314 tggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccacactgagc 373
           |||| |||||||||||||||||| |||| || ||||||||||| || |||||||| ||||
Sbjct: 379 tgggtcttaaccttctgaggctgctggtacaaaatagaattgctgaattccacaccgagc 438

            
Query: 374 t 374
           |
Sbjct: 439 t 439



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                       
Query: 407 cttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcctacaaccgtg 466
           ||||||||||||| |  || ||||| ||| | ||||| |||||||| ||||| |||||||
Sbjct: 472 cttgcatcaagcatgcagtagagcttgagaaatccttcatggagggtgcctataaccgtg 531

                  
Query: 467 tgctgag 473
           || ||||
Sbjct: 532 tgttgag 538



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 172 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 231
           ||||| |||||||||||||| ||| || | || || ||||  || ||||||||||| |||
Sbjct: 237 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 296

                                        
Query: 232 gaaagggacttctgccagctcaagcctta 260
           || || || |||| |||||| || |||||
Sbjct: 297 gagagagatttcttccagctgaaacctta 325
to top
>emb|BX815245.1|CNS0AAGS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS46ZA05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1025

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 314 tggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccacactgagc 373
           |||| |||||||||||||||||| |||| || ||||||||||| || |||||||| ||||
Sbjct: 368 tgggtcttaaccttctgaggctgctggtacaaaatagaattgctgaattccacaccgagc 427

            
Query: 374 t 374
           |
Sbjct: 428 t 428



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 407 cttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcctacaaccgtg 466
           ||||||||||||| |  || ||||| ||||| ||||| |||||||| ||||| |||||||
Sbjct: 461 cttgcatcaagcatgcagtagagcttgagcaatccttcatggagggtgcctataaccgtg 520

                  
Query: 467 tgctgag 473
           || ||||
Sbjct: 521 tgttgag 527



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 172 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 231
           ||||| |||||||||||||| ||| || | || || ||||  || ||||||||||| |||
Sbjct: 226 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 285

                                        
Query: 232 gaaagggacttctgccagctcaagcctta 260
           || || || |||| |||||| || |||||
Sbjct: 286 gagagagatttcttccagctgaaacctta 314
to top
>gb|AC009519.4|AC009519 Genomic sequence for Arabidopsis thaliana BAC F1N19 from chromosome I,
             complete sequence
          Length = 113172

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                         
Query: 314   tggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccacactgagc 373
             |||| |||||||||||||||||| |||| || ||||||||||| || |||||||| ||||
Sbjct: 25746 tgggtcttaaccttctgaggctgctggtacaaaatagaattgctgaattccacaccgagc 25805

              
Query: 374   t 374
             |
Sbjct: 25806 t 25806



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                         
Query: 407   cttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcctacaaccgtg 466
             ||||||||||||| |  || ||||| ||||| ||||| |||||||| ||||| |||||||
Sbjct: 25839 cttgcatcaagcatgcagtagagcttgagcaatccttcatggagggtgcctataaccgtg 25898

                    
Query: 467   tgctgag 473
             || ||||
Sbjct: 25899 tgttgag 25905



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 71/88 (80%)
 Strand = Plus / Plus

                                                                         
Query: 173   gggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcatttg 232
             |||| |||||||||||||| ||| || | || || ||||  || ||||||||||| ||||
Sbjct: 25525 gggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgcttttg 25584

                                         
Query: 233   aaagggacttctgccagctcaagcctta 260
             | || || |||| |||||| || |||||
Sbjct: 25585 agagagatttcttccagctgaaacctta 25612
to top
>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007,
             complete sequence
          Length = 92741

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                         
Query: 202   agtgtgaaaatggaagatcaagatgcatttgaaagggacttctgccagctcaagccttat 261
             ||||||||||  || ||||||||||| ||||| ||||| |||| |||||| || ||||||
Sbjct: 83685 agtgtgaaaactgaggatcaagatgcctttgagagggatttcttccagctgaaaccttat 83626

               
Query: 262   ta 263
             ||
Sbjct: 83625 ta 83624
to top
>gb|AC113514.9| Mus musculus chromosome 19, clone RP23-475D11, complete sequence
          Length = 170366

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 104    ccaagttccccagcctccctcc 125
              ||||||||||||||||||||||
Sbjct: 125636 ccaagttccccagcctccctcc 125657
to top
>gb|AC116128.15| Mus musculus chromosome 19, clone RP23-95H3, complete sequence
          Length = 228363

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 104   ccaagttccccagcctccctcc 125
             ||||||||||||||||||||||
Sbjct: 13756 ccaagttccccagcctccctcc 13777
to top
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 21      gttcgaacgcttcaaggcggcc 42
               ||||||||||||||||||||||
Sbjct: 4901285 gttcgaacgcttcaaggcggcc 4901264
to top
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 21      gttcgaacgcttcaaggcggcc 42
               ||||||||||||||||||||||
Sbjct: 4904302 gttcgaacgcttcaaggcggcc 4904281
to top
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 23     tcgaacgcttcaaggcggcctgcaagcgc 51
              ||||||||||| ||||||| |||||||||
Sbjct: 411439 tcgaacgcttcgaggcggcgtgcaagcgc 411411
to top
>emb|AL356234.18| Human DNA sequence from clone RP11-95M15 on chromosome 6 Contains a
             novel gene and a protein tyrosine phosphatase non-receptor
             type 11 (Nooan syndrome) (PTPN11) pseudogene, complete
             sequence
          Length = 115224

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 219   tcaagatgcatttgaaaggga 239
             |||||||||||||||||||||
Sbjct: 56493 tcaagatgcatttgaaaggga 56473
to top
>emb|BX044529.1|CNS096IT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC18BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 608

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 358 gagttccacactgagctggagcttctgcccgcc 390
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 569 gagtttcacaccgagctggagctgctgcccgcc 537
to top
>emb|BX044528.1|CNS096IS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 701

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 358 gagttccacactgagctggagcttctgcccgcc 390
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 479 gagtttcacaccgagctggagctgctgcccgcc 511
to top
>emb|BX043538.1|CNS095RA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 936

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 358 gagttccacactgagctggagcttctgcccgcc 390
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 577 gagtttcacaccgagctggagctgctgcccgcc 545
to top
>emb|BX043537.1|CNS095R9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 358 gagttccacactgagctggagcttctgcccgcc 390
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 477 gagtttcacaccgagctggagctgctgcccgcc 509
to top
>emb|BX040987.1|CNS093SF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 358 gagttccacactgagctggagcttctgcccgcc 390
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 449 gagtttcacaccgagctggagctgctgcccgcc 481
to top
>emb|BX031771.1|CNS08WOF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 358 gagttccacactgagctggagcttctgcccgcc 390
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 537 gagtttcacaccgagctggagctgctgcccgcc 505
to top
>emb|BX031770.1|CNS08WOE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 358 gagttccacactgagctggagcttctgcccgcc 390
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 449 gagtttcacaccgagctggagctgctgcccgcc 481
to top
>emb|BX028549.1|CNS08U6X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 769

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 358 gagttccacactgagctggagcttctgcccgcc 390
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 543 gagtttcacaccgagctggagctgctgcccgcc 511
to top
>emb|BX028548.1|CNS08U6W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 358 gagttccacactgagctggagcttctgcccgcc 390
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 470 gagtttcacaccgagctggagctgctgcccgcc 502
to top
>emb|BX027525.1|CNS08TEH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 358 gagttccacactgagctggagcttctgcccgcc 390
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 551 gagtttcacaccgagctggagctgctgcccgcc 519
to top
>emb|BX027524.1|CNS08TEG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1062

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 358 gagttccacactgagctggagcttctgcccgcc 390
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 486 gagtttcacaccgagctggagctgctgcccgcc 518
to top
>emb|BX021496.1|CNS08OR0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1081

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 358 gagttccacactgagctggagcttctgcccgcc 390
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 500 gagtttcacaccgagctggagctgctgcccgcc 532
to top
>emb|BX006225.1|CNS08CYT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 358 gagttccacactgagctggagcttctgcccgcc 390
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 477 gagtttcacaccgagctggagctgctgcccgcc 445
to top
>emb|BX006224.1|CNS08CYS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 800

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 358 gagttccacactgagctggagcttctgcccgcc 390
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 406 gagtttcacaccgagctggagctgctgcccgcc 438
to top
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 146     acgccgtggaggagctcaagctcgc 170
               |||||||||| ||||||||||||||
Sbjct: 2316349 acgccgtggatgagctcaagctcgc 2316373
to top
>gb|AC104122.2| Homo sapiens chromosome 5 clone RP11-410P18, complete sequence
          Length = 142636

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 215   aagatcaagatgcatttgaaa 235
             |||||||||||||||||||||
Sbjct: 45212 aagatcaagatgcatttgaaa 45192
to top
>gb|AC027323.5| Homo sapiens chromosome 5 clone CTD-2034A10, complete sequence
          Length = 140016

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 215    aagatcaagatgcatttgaaa 235
              |||||||||||||||||||||
Sbjct: 103937 aagatcaagatgcatttgaaa 103917
to top
>gb|AC154014.4| Mus musculus 6 BAC RP24-409C18 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 161963

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 194   ttcttttgagtgtgaaaatgg 214
             |||||||||||||||||||||
Sbjct: 65231 ttcttttgagtgtgaaaatgg 65251
to top
>gb|AC087349.17| Homo sapiens chromosome 8, clone RP11-339A23, complete sequence
          Length = 96337

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 509   acttcatggaccttctcgcca 529
             |||||||||||||||||||||
Sbjct: 48710 acttcatggaccttctcgcca 48730
to top
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 9       ggtgacgcagctgttcgaacgcttc 33
               |||||||||| ||||||||||||||
Sbjct: 2624545 ggtgacgcagttgttcgaacgcttc 2624521
to top
>emb|AL732474.8| Mouse DNA sequence from clone RP23-180I2 on chromosome 4, complete
             sequence
          Length = 151555

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 203   gtgtgaaaatggaagatcaag 223
             |||||||||||||||||||||
Sbjct: 65908 gtgtgaaaatggaagatcaag 65888
to top
>emb|AL606917.12| Mouse DNA sequence from clone RP23-25K8 on chromosome 4, complete
             sequence
          Length = 52163

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 99    cctcaccaagttccccagcct 119
             |||||||||||||||||||||
Sbjct: 48847 cctcaccaagttccccagcct 48867
to top
>emb|CT010576.9| Mouse DNA sequence from clone RP23-193B21 on chromosome 16, complete
             sequence
          Length = 208110

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 220   caagatgcatttgaaaggga 239
             ||||||||||||||||||||
Sbjct: 45956 caagatgcatttgaaaggga 45975
to top
>ref|XM_742921.1| Aspergillus fumigatus Af293 hypothetical protein (Afu5g03290) partial
            mRNA
          Length = 1701

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 152  tggaggagctcaagctcgcg 171
            ||||||||||||||||||||
Sbjct: 1111 tggaggagctcaagctcgcg 1130
to top
>ref|XM_816106.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053510329.220) partial mRNA
          Length = 2064

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 474  cgctcggcaaaccgcaccgc 493
            ||||||||||||||||||||
Sbjct: 1010 cgctcggcaaaccgcaccgc 991
to top
>ref|XM_809419.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053507257.10) partial mRNA
          Length = 1210

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 474 cgctcggcaaaccgcaccgc 493
           ||||||||||||||||||||
Sbjct: 153 cgctcggcaaaccgcaccgc 134
to top
>emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete genome; segment 6/16
          Length = 349876

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 33     caaggcggcctgcaagcgca 52
              ||||||||||||||||||||
Sbjct: 326685 caaggcggcctgcaagcgca 326666
to top
>emb|BX640430.1| Bordetella parapertussis strain 12822, complete genome; segment 8/14
          Length = 348014

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 33     caaggcggcctgcaagcgca 52
              ||||||||||||||||||||
Sbjct: 239408 caaggcggcctgcaagcgca 239389
to top
>emb|BX640419.1| Bordetella pertussis strain Tohama I, complete genome; segment 9/12
          Length = 349672

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 33     caaggcggcctgcaagcgca 52
              ||||||||||||||||||||
Sbjct: 310663 caaggcggcctgcaagcgca 310682
to top
>emb|BX572598.1| Rhodopseudomonas palustris CGA009 complete genome; segment 6/16
          Length = 346879

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 80     tctcgcagctcaaggtgctcctcaccaa 107
              |||||| |||||||||||| ||||||||
Sbjct: 275383 tctcgctgctcaaggtgctgctcaccaa 275356
to top
>gb|CP000282.1| Saccharophagus degradans 2-40, complete genome
          Length = 5057531

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 472    agcgctcggcaaaccgcacc 491
              ||||||||||||||||||||
Sbjct: 591622 agcgctcggcaaaccgcacc 591603
to top
>gb|AC010186.6| Homo sapiens 12p12-21.3-21.8 BAC RP11-705C15 (Roswell Park Cancer
             Institute Human BAC Library) complete sequence
          Length = 74801

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   tcaagatgcatttgaaaggg 238
             ||||||||||||||||||||
Sbjct: 27171 tcaagatgcatttgaaaggg 27190
to top
>ref|XM_321580.2| Anopheles gambiae str. PEST ENSANGP00000011799 (ENSANGG00000009310),
            partial mRNA
          Length = 1314

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 413  tcaagcacggggttgagctcgagc 436
            ||||||||||| ||||||||||||
Sbjct: 1147 tcaagcacgggcttgagctcgagc 1170


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,462,217
Number of Sequences: 3902068
Number of extensions: 4462217
Number of successful extensions: 84516
Number of sequences better than 10.0: 61
Number of HSP's better than 10.0 without gapping: 61
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 84101
Number of HSP's gapped (non-prelim): 404
length of query: 601
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 578
effective length of database: 17,143,297,704
effective search space: 9908826072912
effective search space used: 9908826072912
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top