ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags8o11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 40 3.9
2gb|AC126608.20| Mus musculus chromosome 19, clone RP24-166L20, c... 40 3.9
3gb|AC117253.3| Mus musculus BAC clone RP24-405A12 from chromosom... 40 3.9
4dbj|AK095116.1| Homo sapiens cDNA FLJ37797 fis, clone BRSSN1000153 40 3.9
5dbj|AK091534.1| Homo sapiens cDNA FLJ34215 fis, clone FCBBF3021985 40 3.9
6dbj|AK022119.1| Homo sapiens cDNA FLJ12057 fis, clone HEMBB1002068 40 3.9
7gb|AC008696.6|AC008696 Homo sapiens chromosome 5 clone CTB-70D19... 40 3.9
8gb|AC079767.7| Homo sapiens BAC clone RP11-196E10 from 2, comple... 40 3.9
9gb|AC108673.11| Homo sapiens 3 BAC RP11-434H6 (Roswell Park Canc... 40 3.9
10dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete g... 40 3.9
11emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 40 3.9
12ref|NM_024768.1| Homo sapiens coiled-coil domain containing 48 (... 40 3.9

>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 148     agcgacggctggctactccc 167
               ||||||||||||||||||||
Sbjct: 1625448 agcgacggctggctactccc 1625467



to top

>gb|AC126608.20| Mus musculus chromosome 19, clone RP24-166L20, complete sequence
          Length = 139126

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 175   ttgtccctcccatctttggatcta 198
             ||||||||||||||||| ||||||
Sbjct: 30848 ttgtccctcccatctttagatcta 30825



to top

>gb|AC117253.3| Mus musculus BAC clone RP24-405A12 from chromosome 19, complete
            sequence
          Length = 142903

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 175  ttgtccctcccatctttggatcta 198
            ||||||||||||||||| ||||||
Sbjct: 7171 ttgtccctcccatctttagatcta 7194



to top

>dbj|AK095116.1| Homo sapiens cDNA FLJ37797 fis, clone BRSSN1000153
          Length = 2121

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 163  ctcccaccgcccttgtccct 182
            ||||||||||||||||||||
Sbjct: 1307 ctcccaccgcccttgtccct 1326



to top

>dbj|AK091534.1| Homo sapiens cDNA FLJ34215 fis, clone FCBBF3021985
          Length = 2937

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 163  ctcccaccgcccttgtccct 182
            ||||||||||||||||||||
Sbjct: 2123 ctcccaccgcccttgtccct 2142



to top

>dbj|AK022119.1| Homo sapiens cDNA FLJ12057 fis, clone HEMBB1002068
          Length = 1963

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 208  cactggtttcacccccatgg 227
            ||||||||||||||||||||
Sbjct: 1929 cactggtttcacccccatgg 1910



to top

>gb|AC008696.6|AC008696 Homo sapiens chromosome 5 clone CTB-70D19, complete sequence
          Length = 155666

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   tgtccctcccatctttggat 195
             ||||||||||||||||||||
Sbjct: 64490 tgtccctcccatctttggat 64471



to top

>gb|AC079767.7| Homo sapiens BAC clone RP11-196E10 from 2, complete sequence
          Length = 90906

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 163   ctcccaccgcccttgtccct 182
             ||||||||||||||||||||
Sbjct: 14698 ctcccaccgcccttgtccct 14717



to top

>gb|AC108673.11| Homo sapiens 3 BAC RP11-434H6 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 137864

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 208  cactggtttcacccccatgg 227
            ||||||||||||||||||||
Sbjct: 2446 cactggtttcacccccatgg 2427



to top

>dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete genome
          Length = 3147090

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 279     ggtgaccacggcgatctccg 298
               ||||||||||||||||||||
Sbjct: 2171922 ggtgaccacggcgatctccg 2171941



to top

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 115     gccgaccaccgtcaggccgc 134
               ||||||||||||||||||||
Sbjct: 1614788 gccgaccaccgtcaggccgc 1614769



to top

>ref|NM_024768.1| Homo sapiens coiled-coil domain containing 48 (CCDC48), mRNA
          Length = 1963

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 208  cactggtttcacccccatgg 227
            ||||||||||||||||||||
Sbjct: 1929 cactggtttcacccccatgg 1910


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,428,208
Number of Sequences: 3902068
Number of extensions: 1428208
Number of successful extensions: 26572
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 26482
Number of HSP's gapped (non-prelim): 90
length of query: 299
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 277
effective length of database: 17,147,199,772
effective search space: 4749774336844
effective search space used: 4749774336844
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top