ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags9d01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 379 e-102
2dbj|AP001539.1| Oryza sativa (japonica cultivar-group) genomic D... 379 e-102
3dbj|AK061701.1| Oryza sativa (japonica cultivar-group) cDNA clon... 379 e-102
4ref|NM_188677.1| Oryza sativa (japonica cultivar-group), Ozsa828... 375 e-100
5dbj|AK067319.1| Oryza sativa (japonica cultivar-group) cDNA clon... 371 2e-99
6gb|AY108185.1| Zea mays PCO082879 mRNA sequence 283 3e-73
7gb|AY111765.1| Zea mays CL18194_1 mRNA sequence 226 7e-56
8gb|DQ011286.1| Zea mays Mu killer (Muk) insertion site, genomic ... 190 4e-45
9ref|NM_118534.3| Arabidopsis thaliana transcription factor AT4G2... 46 0.13
10emb|AL109619.1|ATT19F6 Arabidopsis thaliana DNA chromosome 4, BA... 46 0.13
11emb|AL161560.2|ATCHRIV60 Arabidopsis thaliana DNA chromosome 4, ... 46 0.13
12gb|BT005776.1| Arabidopsis thaliana clone RAFL15-03-P13 (R20174)... 46 0.13
13gb|AC002343.1|ATAC002343 Arabidopsis thaliana chromosome IV BAC ... 46 0.13
14ref|XM_554349.1| Anopheles gambiae str. PEST ENSANGP00000026966 ... 44 0.52
15gb|AC130551.4| Mus musculus BAC clone RP24-538J2 from chromosome... 42 2.1
16emb|CR352209.10| Zebrafish DNA sequence from clone DKEY-150O13 i... 42 2.1
17gb|AC162180.2| Mus musculus BAC clone RP23-126K16 from chromosom... 42 2.1
18gb|AC161589.2| Mus musculus BAC clone RP24-383M20 from chromosom... 42 2.1
19gb|AC137584.4| Mus musculus BAC clone RP23-351O20 from 9, comple... 42 2.1
20gb|AC102396.28| Mus musculus chromosome 3, clone RP24-169F23, co... 40 8.1
21ref|XM_380420.1| Gibberella zeae PH-1 chromosome 1 hypothetical ... 40 8.1
22emb|BX088568.4| Human DNA sequence from clone XX-751M15 on chrom... 40 8.1
23emb|AL646005.7| Human DNA sequence from clone XXyac-Y20H11 on ch... 40 8.1
24emb|CR380956.1| Candida glabrata strain CBS138 chromosome J comp... 40 8.1
25gb|AC092807.2| Homo sapiens chromosome 1 clone RP11-290M5, compl... 40 8.1
26dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
27dbj|AP005474.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
28emb|CT573040.5| Wallaby DNA sequence from clone MEKBa-454A14, co... 40 8.1

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score =  379 bits (191), Expect = e-102
 Identities = 370/431 (85%), Gaps = 9/431 (2%)
 Strand = Plus / Plus

                                                                           
Query: 135     caagaaccagagctaccactttccaggatgctcattgaggattctggtagttccaaggat 194
               ||||||||||  ||||| ||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 7575109 caagaaccagcactaccgctttccaggatgctcattgaggattctggaagttccaaagat 7575168

                                                                           
Query: 195     ttgaagaatctcttcggttcagcaattggccaaccaatgttagcgcctcccagcaatttt 254
               |||||||||||||||  ||||||| |||  |||||| | ||||| | | | |||||||| 
Sbjct: 7575169 ttgaagaatctcttcacttcagcagttgatcaaccatttttagcacgttcaagcaatttg 7575228

                                                                           
Query: 255     gggccaatgcgaaattcaggtactgtgacgataaaggcgagctttaaggaagacattgta 314
               | ||  |||| ||||||||| || ||||| |||||||| |||||||||||||||||||| 
Sbjct: 7575229 gcgctgatgcaaaattcagggacggtgaccataaaggctagctttaaggaagacattgtc 7575288

                                                                           
Query: 315     aggttccgcttcccgtgttctagcagcgttatggcattgaaagatgaggttgccaaaagg 374
               |||||||||||||| |||||  | |||||||  |||||||||||||| || |||||||||
Sbjct: 7575289 aggttccgcttcccatgttccggtagcgttactgcattgaaagatgaagtagccaaaagg 7575348

                                                                           
Query: 375     ctgaggatggatgctggcatgtttgatatcaagtaccttgacgatgatcacgagtgggtg 434
               || |||||||||| ||||||||||||||||||||| || ||||||||||| |||||||||
Sbjct: 7575349 ctaaggatggatgttggcatgtttgatatcaagtatctcgacgatgatcatgagtgggtg 7575408

                                                                           
Query: 435     aagttggcttgcaatgcggacttggaagaatgcatagaaatctcccggcattctggtacc 494
               ||||| || ||||| |||||||||||||||||||| || |||         ||||||| |
Sbjct: 7575409 aagttagcatgcaacgcggacttggaagaatgcatggagatc---------tctggtagc 7575459

                                                                           
Query: 495     catgttatcaggctattggttagcgatgtcgcggcccacattggtagttcttgtggaagc 554
               ||||| |||||||| |||||||||||||| ||||| ||| |||||||||| |||||||||
Sbjct: 7575460 catgtcatcaggctgttggttagcgatgttgcggcacaccttggtagttcctgtggaagc 7575519

                          
Query: 555     tccggttgata 565
               || ||||||||
Sbjct: 7575520 tcaggttgata 7575530



to top

>dbj|AP001539.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
              clone:P0708G02
          Length = 168976

 Score =  379 bits (191), Expect = e-102
 Identities = 370/431 (85%), Gaps = 9/431 (2%)
 Strand = Plus / Plus

                                                                          
Query: 135    caagaaccagagctaccactttccaggatgctcattgaggattctggtagttccaaggat 194
              ||||||||||  ||||| ||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 123901 caagaaccagcactaccgctttccaggatgctcattgaggattctggaagttccaaagat 123960

                                                                          
Query: 195    ttgaagaatctcttcggttcagcaattggccaaccaatgttagcgcctcccagcaatttt 254
              |||||||||||||||  ||||||| |||  |||||| | ||||| | | | |||||||| 
Sbjct: 123961 ttgaagaatctcttcacttcagcagttgatcaaccatttttagcacgttcaagcaatttg 124020

                                                                          
Query: 255    gggccaatgcgaaattcaggtactgtgacgataaaggcgagctttaaggaagacattgta 314
              | ||  |||| ||||||||| || ||||| |||||||| |||||||||||||||||||| 
Sbjct: 124021 gcgctgatgcaaaattcagggacggtgaccataaaggctagctttaaggaagacattgtc 124080

                                                                          
Query: 315    aggttccgcttcccgtgttctagcagcgttatggcattgaaagatgaggttgccaaaagg 374
              |||||||||||||| |||||  | |||||||  |||||||||||||| || |||||||||
Sbjct: 124081 aggttccgcttcccatgttccggtagcgttactgcattgaaagatgaagtagccaaaagg 124140

                                                                          
Query: 375    ctgaggatggatgctggcatgtttgatatcaagtaccttgacgatgatcacgagtgggtg 434
              || |||||||||| ||||||||||||||||||||| || ||||||||||| |||||||||
Sbjct: 124141 ctaaggatggatgttggcatgtttgatatcaagtatctcgacgatgatcatgagtgggtg 124200

                                                                          
Query: 435    aagttggcttgcaatgcggacttggaagaatgcatagaaatctcccggcattctggtacc 494
              ||||| || ||||| |||||||||||||||||||| || |||         ||||||| |
Sbjct: 124201 aagttagcatgcaacgcggacttggaagaatgcatggagatc---------tctggtagc 124251

                                                                          
Query: 495    catgttatcaggctattggttagcgatgtcgcggcccacattggtagttcttgtggaagc 554
              ||||| |||||||| |||||||||||||| ||||| ||| |||||||||| |||||||||
Sbjct: 124252 catgtcatcaggctgttggttagcgatgttgcggcacaccttggtagttcctgtggaagc 124311

                         
Query: 555    tccggttgata 565
              || ||||||||
Sbjct: 124312 tcaggttgata 124322



to top

>dbj|AK061701.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-E01, full
           insert sequence
          Length = 759

 Score =  379 bits (191), Expect = e-102
 Identities = 370/431 (85%), Gaps = 9/431 (2%)
 Strand = Plus / Plus

                                                                       
Query: 135 caagaaccagagctaccactttccaggatgctcattgaggattctggtagttccaaggat 194
           ||||||||||  ||||| ||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 136 caagaaccagcactaccgctttccaggatgctcattgaggattctggaagttccaaagat 195

                                                                       
Query: 195 ttgaagaatctcttcggttcagcaattggccaaccaatgttagcgcctcccagcaatttt 254
           |||||||||||||||  ||||||| |||  |||||| | ||||| | | | |||||||| 
Sbjct: 196 ttgaagaatctcttcacttcagcagttgatcaaccatttttagcacgttcaagcaatttg 255

                                                                       
Query: 255 gggccaatgcgaaattcaggtactgtgacgataaaggcgagctttaaggaagacattgta 314
           | ||  |||| ||||||||| || ||||| |||||||| |||||||||||||||||||| 
Sbjct: 256 gcgctgatgcaaaattcagggacggtgaccataaaggctagctttaaggaagacattgtc 315

                                                                       
Query: 315 aggttccgcttcccgtgttctagcagcgttatggcattgaaagatgaggttgccaaaagg 374
           |||||||||||||| |||||  | |||||||  |||||||||||||| || |||||||||
Sbjct: 316 aggttccgcttcccatgttccggtagcgttactgcattgaaagatgaagtagccaaaagg 375

                                                                       
Query: 375 ctgaggatggatgctggcatgtttgatatcaagtaccttgacgatgatcacgagtgggtg 434
           || |||||||||| ||||||||||||||||||||| || ||||||||||| |||||||||
Sbjct: 376 ctaaggatggatgttggcatgtttgatatcaagtatctcgacgatgatcatgagtgggtg 435

                                                                       
Query: 435 aagttggcttgcaatgcggacttggaagaatgcatagaaatctcccggcattctggtacc 494
           ||||| || ||||| |||||||||||||||||||| || |||         ||||||| |
Sbjct: 436 aagttagcatgcaacgcggacttggaagaatgcatggagatc---------tctggtagc 486

                                                                       
Query: 495 catgttatcaggctattggttagcgatgtcgcggcccacattggtagttcttgtggaagc 554
           ||||| |||||||| |||||||||||||| ||||| ||| |||||||||| |||||||||
Sbjct: 487 catgtcatcaggctgttggttagcgatgttgcggcacaccttggtagttcctgtggaagc 546

                      
Query: 555 tccggttgata 565
           || ||||||||
Sbjct: 547 tcaggttgata 557



to top

>ref|NM_188677.1| Oryza sativa (japonica cultivar-group), Ozsa8280 predicted mRNA
          Length = 2559

 Score =  375 bits (189), Expect = e-100
 Identities = 368/429 (85%), Gaps = 9/429 (2%)
 Strand = Plus / Plus

                                                                        
Query: 135  caagaaccagagctaccactttccaggatgctcattgaggattctggtagttccaaggat 194
            ||||||||||  ||||| ||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 2140 caagaaccagcactaccgctttccaggatgctcattgaggattctggaagttccaaagat 2199

                                                                        
Query: 195  ttgaagaatctcttcggttcagcaattggccaaccaatgttagcgcctcccagcaatttt 254
            |||||||||||||||  ||||||| |||  |||||| | ||||| | | | |||||||| 
Sbjct: 2200 ttgaagaatctcttcacttcagcagttgatcaaccatttttagcacgttcaagcaatttg 2259

                                                                        
Query: 255  gggccaatgcgaaattcaggtactgtgacgataaaggcgagctttaaggaagacattgta 314
            | ||  |||| ||||||||| || ||||| |||||||| |||||||||||||||||||| 
Sbjct: 2260 gcgctgatgcaaaattcagggacggtgaccataaaggctagctttaaggaagacattgtc 2319

                                                                        
Query: 315  aggttccgcttcccgtgttctagcagcgttatggcattgaaagatgaggttgccaaaagg 374
            |||||||||||||| |||||  | |||||||  |||||||||||||| || |||||||||
Sbjct: 2320 aggttccgcttcccatgttccggtagcgttactgcattgaaagatgaagtagccaaaagg 2379

                                                                        
Query: 375  ctgaggatggatgctggcatgtttgatatcaagtaccttgacgatgatcacgagtgggtg 434
            || |||||||||| ||||||||||||||||||||| || ||||||||||| |||||||||
Sbjct: 2380 ctaaggatggatgttggcatgtttgatatcaagtatctcgacgatgatcatgagtgggtg 2439

                                                                        
Query: 435  aagttggcttgcaatgcggacttggaagaatgcatagaaatctcccggcattctggtacc 494
            ||||| || ||||| |||||||||||||||||||| || |||         ||||||| |
Sbjct: 2440 aagttagcatgcaacgcggacttggaagaatgcatggagatc---------tctggtagc 2490

                                                                        
Query: 495  catgttatcaggctattggttagcgatgtcgcggcccacattggtagttcttgtggaagc 554
            ||||| |||||||| |||||||||||||| ||||| ||| |||||||||| |||||||||
Sbjct: 2491 catgtcatcaggctgttggttagcgatgttgcggcacaccttggtagttcctgtggaagc 2550

                     
Query: 555  tccggttga 563
            || ||||||
Sbjct: 2551 tcaggttga 2559



to top

>dbj|AK067319.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013106K21, full
            insert sequence
          Length = 3334

 Score =  371 bits (187), Expect = 2e-99
 Identities = 369/431 (85%), Gaps = 9/431 (2%)
 Strand = Plus / Plus

                                                                        
Query: 135  caagaaccagagctaccactttccaggatgctcattgaggattctggtagttccaaggat 194
            ||||||||||  ||||| ||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 2651 caagaaccagcactaccgctttccaggatgctcattgaggattctggaagttccaaagat 2710

                                                                        
Query: 195  ttgaagaatctcttcggttcagcaattggccaaccaatgttagcgcctcccagcaatttt 254
            |||||||||||||||  ||||||| |||  |||||| | ||||| | | | |||||||| 
Sbjct: 2711 ttgaagaatctcttcacttcagcagttgatcaaccatttttagcacgttcaagcaatttg 2770

                                                                        
Query: 255  gggccaatgcgaaattcaggtactgtgacgataaaggcgagctttaaggaagacattgta 314
            | ||  |||| ||||||||| || ||||| |||||||| |||||||||||||||||||| 
Sbjct: 2771 gcgctgatgcaaaattcagggacggtgaccataaaggctagctttaaggaagacattgtc 2830

                                                                        
Query: 315  aggttccgcttcccgtgttctagcagcgttatggcattgaaagatgaggttgccaaaagg 374
            ||||||| |||||| |||||  | |||||||  |||||||||||||| || |||||||||
Sbjct: 2831 aggttccacttcccatgttccggtagcgttactgcattgaaagatgaagtagccaaaagg 2890

                                                                        
Query: 375  ctgaggatggatgctggcatgtttgatatcaagtaccttgacgatgatcacgagtgggtg 434
            || |||||||||| ||||||||||||||||||||| || ||||||||||| |||||||||
Sbjct: 2891 ctaaggatggatgttggcatgtttgatatcaagtatctcgacgatgatcatgagtgggtg 2950

                                                                        
Query: 435  aagttggcttgcaatgcggacttggaagaatgcatagaaatctcccggcattctggtacc 494
            ||||| || ||||| |||||||||||||||||||| || |||         ||||||| |
Sbjct: 2951 aagttagcatgcaacgcggacttggaagaatgcatggagatc---------tctggtagc 3001

                                                                        
Query: 495  catgttatcaggctattggttagcgatgtcgcggcccacattggtagttcttgtggaagc 554
            ||||| |||||||| |||||||||||||| ||||| ||| |||||||||| |||||||||
Sbjct: 3002 catgtcatcaggctgttggttagcgatgttgcggcacaccttggtagttcctgtggaagc 3061

                       
Query: 555  tccggttgata 565
            || ||||||||
Sbjct: 3062 tcaggttgata 3072



to top

>gb|AY108185.1| Zea mays PCO082879 mRNA sequence
          Length = 668

 Score =  283 bits (143), Expect = 3e-73
 Identities = 368/443 (83%)
 Strand = Plus / Plus

                                                                       
Query: 123 aaagaacctttccaagaaccagagctaccactttccaggatgctcattgaggattctggt 182
           ||||| ||||||||||||||| | |||||||||||||||||||||||||| |||||||||
Sbjct: 194 aaagagcctttccaagaaccacaactaccactttccaggatgctcattgaagattctggt 253

                                                                       
Query: 183 agttccaaggatttgaagaatctcttcggttcagcaattggccaaccaatgttagcgcct 242
           || ||||| ||||||||||||||||||  |||| ||  || ||||||| | || || |||
Sbjct: 254 agctccaaagatttgaagaatctcttcacttcaacatctgaccaaccatttttggcccct 313

                                                                       
Query: 243 cccagcaattttgggccaatgcgaaattcaggtactgtgacgataaaggcgagctttaag 302
           ||||  ||||| | |||||||    |||||||  |||| |||||||||||||| ||||| 
Sbjct: 314 cccaataatttggtgccaatgaagcattcagggtctgtaacgataaaggcgagttttaaa 373

                                                                       
Query: 303 gaagacattgtaaggttccgcttcccgtgttctagcagcgttatggcattgaaagatgag 362
           ||||| ||||| |||||||| ||| | || ||  |||| ||||| | ||||||||| |||
Sbjct: 374 gaagatattgtgaggttccgtttctcatgctcaggcagtgttattgtattgaaagaggag 433

                                                                       
Query: 363 gttgccaaaaggctgaggatggatgctggcatgtttgatatcaagtaccttgacgatgat 422
           || || |||||||| |||||||||| ||||| ||||||||||||||| || || ||||| 
Sbjct: 434 gtagcgaaaaggctaaggatggatgttggcacgtttgatatcaagtatctagatgatgac 493

                                                                       
Query: 423 cacgagtgggtgaagttggcttgcaatgcggacttggaagaatgcatagaaatctcccgg 482
           || || ||||| |||||| | || ||| | ||||||||||||||||| || ||||| |||
Sbjct: 494 catgaatgggtaaagttgacgtgtaattcagacttggaagaatgcatggagatctcacgg 553

                                                                       
Query: 483 cattctggtacccatgttatcaggctattggttagcgatgtcgcggcccacattggtagt 542
           | ||| |||| |||||| |||||| |||  ||||||||| | ||| | ||| |||| |||
Sbjct: 554 ctttcgggtagccatgtcatcaggttatctgttagcgatattgcgacacactttggcagt 613

                                  
Query: 543 tcttgtggaagctccggttgata 565
           ||||| |||||||||||||||||
Sbjct: 614 tcttggggaagctccggttgata 636



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 63/74 (85%), Gaps = 2/74 (2%)
 Strand = Plus / Plus

                                                                       
Query: 1   cacgcacttcggnnggctcatgtcagggnaagccccgcaaaccagnacatttgtttgcca 60
           ||||||||||||  |||||||| ||| | ||| || || |||||| |||||||||||| |
Sbjct: 84  cacgcacttcggaaggctcatgccagag-aagtccagcgaaccag-acatttgtttgcaa 141

                         
Query: 61  gcctattgcttcaa 74
           ||| ||||||||||
Sbjct: 142 gccaattgcttcaa 155



to top

>gb|AY111765.1| Zea mays CL18194_1 mRNA sequence
          Length = 769

 Score =  226 bits (114), Expect = 7e-56
 Identities = 252/298 (84%)
 Strand = Plus / Minus

                                                                       
Query: 268 attcaggtactgtgacgataaaggcgagctttaaggaagacattgtaaggttccgcttcc 327
           ||||||| ||||| |||||||||||||| ||||||||||| ||||| |||||||| ||||
Sbjct: 436 attcagggactgtaacgataaaggcgagttttaaggaagatattgtgaggttccgtttcc 377

                                                                       
Query: 328 cgtgttctagcagcgttatggcattgaaagatgaggttgccaaaaggctgaggatggatg 387
           | || ||  |  | ||||| | ||||||||| ||||| || || ||||| ||||||||||
Sbjct: 376 catgctcaggtggtgttattgtattgaaagaggaggtagcgaagaggctaaggatggatg 317

                                                                       
Query: 388 ctggcatgtttgatatcaagtaccttgacgatgatcacgagtgggtgaagttggcttgca 447
            ||||| ||| ||||||||||| || || ||||| || |||||||| |||||||| ||||
Sbjct: 316 ttggcacgttcgatatcaagtatctcgatgatgaccatgagtgggtaaagttggcgtgca 257

                                                                       
Query: 448 atgcggacttggaagaatgcatagaaatctcccggcattctggtacccatgttatcaggc 507
           |||| ||||||||||||||||| || ||||| |||| |||||| | |||||| || ||||
Sbjct: 256 atgcagacttggaagaatgcatggagatctcgcggctttctggcagccatgtcattaggc 197

                                                                     
Query: 508 tattggttagcgatgtcgcggcccacattggtagttcttgtggaagctccggttgata 565
           || ||||||||||| | || |||||| |||| ||||||||||||||||| ||||||||
Sbjct: 196 tactggttagcgatattgcagcccactttggcagttcttgtggaagctctggttgata 139



 Score =  117 bits (59), Expect = 4e-23
 Identities = 80/87 (91%)
 Strand = Plus / Minus

                                                                       
Query: 123 aaagaacctttccaagaaccagagctaccactttccaggatgctcattgaggattctggt 182
           ||||||||||||||||||||| | ||||||||||| |||||||| ||||| |||||||||
Sbjct: 581 aaagaacctttccaagaaccacaactaccactttcaaggatgctgattgaagattctggt 522

                                      
Query: 183 agttccaaggatttgaagaatctcttc 209
           || ||||| ||||||||||||||||||
Sbjct: 521 agctccaaagatttgaagaatctcttc 495



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 66/79 (83%), Gaps = 2/79 (2%)
 Strand = Plus / Minus

                                                                       
Query: 1   cacgcacttcggnnggctcatgtcagggnaagccccgcaaaccagnacatttgtttgcca 60
           ||||||||||||  |||||||| ||||| ||| || || |||||  |||||||||||  |
Sbjct: 691 cacgcacttcggaaggctcatgccaggg-aagtccagcgaacca-aacatttgtttgtaa 634

                              
Query: 61  gcctattgcttcaatgttc 79
           ||| || ||||||||||||
Sbjct: 633 gccaatcgcttcaatgttc 615



to top

>gb|DQ011286.1| Zea mays Mu killer (Muk) insertion site, genomic sequence
          Length = 13941

 Score =  190 bits (96), Expect = 4e-45
 Identities = 247/298 (82%)
 Strand = Plus / Minus

                                                                        
Query: 268  attcaggtactgtgacgataaaggcgagctttaaggaagacattgtaaggttccgcttcc 327
            |||||||  |||| |||||||||||||| ||||| ||||| ||||| |||||||| ||| 
Sbjct: 5816 attcagggtctgtaacgataaaggcgagttttaaagaagatattgtgaggttccgtttct 5757

                                                                        
Query: 328  cgtgttctagcagcgttatggcattgaaagatgaggttgccaaaaggctgaggatggatg 387
            | || ||  |||| ||||| | ||||||||| ||||| || |||||||| ||||||||||
Sbjct: 5756 catgctcaggcagtgttattgtattgaaagaggaggtagcgaaaaggctaaggatggatg 5697

                                                                        
Query: 388  ctggcatgtttgatatcaagtaccttgacgatgatcacgagtgggtgaagttggcttgca 447
             ||||| ||||||||||||||| || || ||||| || || ||||| |||||| | || |
Sbjct: 5696 ttggcacgtttgatatcaagtatctagatgatgaccatgaatgggtaaagttgacgtgta 5637

                                                                        
Query: 448  atgcggacttggaagaatgcatagaaatctcccggcattctggtacccatgttatcaggc 507
            || | ||||||||||||||||| || ||||| |||| ||| |||| |||||| |||||| 
Sbjct: 5636 attcagacttggaagaatgcatggagatctcacggctttcgggtagccatgtcatcaggt 5577

                                                                      
Query: 508  tattggttagcgatgtcgcggcccacattggtagttcttgtggaagctccggttgata 565
            |||  |||| |||| | ||| | ||| |||| ||||||||||||||||||||||||||
Sbjct: 5576 tatctgttarcgatattgcgacacactttggcagttcttgtggaagctccggttgata 5519



 Score =  117 bits (59), Expect = 4e-23
 Identities = 77/83 (92%)
 Strand = Plus / Minus

                                                                        
Query: 123  aaagaacctttccaagaaccagagctaccactttccaggatgctcattgaggattctggt 182
            ||||| ||||||||||||||| | |||||||||||||||||||||||||| |||||||||
Sbjct: 5964 aaagagcctttccaagaaccacaactaccactttccaggatgctcattgaagattctggt 5905

                                   
Query: 183  agttccaaggatttgaagaatct 205
            || ||||| ||||||||||||||
Sbjct: 5904 agctccaaagatttgaagaatct 5882



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 63/74 (85%), Gaps = 2/74 (2%)
 Strand = Plus / Minus

                                                                        
Query: 1    cacgcacttcggnnggctcatgtcagggnaagccccgcaaaccagnacatttgtttgcca 60
            ||||||||||||  |||||||| ||| | ||| || || |||||| |||||||||||| |
Sbjct: 6074 cacgcacttcggaaggctcatgccagag-aagtccagcgaaccag-acatttgtttgcaa 6017

                          
Query: 61   gcctattgcttcaa 74
            ||| ||||||||||
Sbjct: 6016 gccaattgcttcaa 6003



to top

>ref|NM_118534.3| Arabidopsis thaliana transcription factor AT4G24020 mRNA, complete
            cds
          Length = 3168

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 399  gatatcaagtaccttgacgatgatcacgagtgggt 433
            ||||||||||| |||||||||||| |||| |||||
Sbjct: 2828 gatatcaagtatcttgacgatgataacgaatgggt 2862



to top

>emb|AL109619.1|ATT19F6 Arabidopsis thaliana DNA chromosome 4, BAC clone T19F6, partial
            sequence (ESSA project)
          Length = 77567

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 399  gatatcaagtaccttgacgatgatcacgagtgggt 433
            ||||||||||| |||||||||||| |||| |||||
Sbjct: 8065 gatatcaagtatcttgacgatgataacgaatgggt 8099



to top

>emb|AL161560.2|ATCHRIV60 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 60
          Length = 196677

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 399    gatatcaagtaccttgacgatgatcacgagtgggt 433
              ||||||||||| |||||||||||| |||| |||||
Sbjct: 143037 gatatcaagtatcttgacgatgataacgaatgggt 143071



to top

>gb|BT005776.1| Arabidopsis thaliana clone RAFL15-03-P13 (R20174) unknown protein
            (At4g24020) mRNA, complete cds
          Length = 3193

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 399  gatatcaagtaccttgacgatgatcacgagtgggt 433
            ||||||||||| |||||||||||| |||| |||||
Sbjct: 2828 gatatcaagtatcttgacgatgataacgaatgggt 2862



to top

>gb|AC002343.1|ATAC002343 Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete
             sequence
          Length = 116156

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 399   gatatcaagtaccttgacgatgatcacgagtgggt 433
             ||||||||||| |||||||||||| |||| |||||
Sbjct: 69575 gatatcaagtatcttgacgatgataacgaatgggt 69541



to top

>ref|XM_554349.1| Anopheles gambiae str. PEST ENSANGP00000026966
           (ENSANGG00000023345), partial mRNA
          Length = 849

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 138 gaaccagagctaccactttcca 159
           ||||||||||||||||||||||
Sbjct: 554 gaaccagagctaccactttcca 533



to top

>gb|AC130551.4| Mus musculus BAC clone RP24-538J2 from chromosome 9, complete sequence
          Length = 189707

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 370   aaaggctgaggatggatgctg 390
             |||||||||||||||||||||
Sbjct: 33166 aaaggctgaggatggatgctg 33146



to top

>emb|CR352209.10| Zebrafish DNA sequence from clone DKEY-150O13 in linkage group 24,
             complete sequence
          Length = 143425

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   ctgaggatggatgctggcatgtttg 399
             |||||||||||||||| ||||||||
Sbjct: 44500 ctgaggatggatgctgacatgtttg 44524



to top

>gb|AC162180.2| Mus musculus BAC clone RP23-126K16 from chromosome 9, complete
            sequence
          Length = 226160

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 365  tgccaaaaggctgaggatggatgct 389
            ||||||||||||||||| |||||||
Sbjct: 4752 tgccaaaaggctgaggacggatgct 4776



to top

>gb|AC161589.2| Mus musculus BAC clone RP24-383M20 from chromosome 9, complete sequence
          Length = 226186

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 365    tgccaaaaggctgaggatggatgct 389
              ||||||||||||||||| |||||||
Sbjct: 148032 tgccaaaaggctgaggacggatgct 148008



to top

>gb|AC137584.4| Mus musculus BAC clone RP23-351O20 from 9, complete sequence
          Length = 197108

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 370    aaaggctgaggatggatgctg 390
              |||||||||||||||||||||
Sbjct: 190128 aaaggctgaggatggatgctg 190108



to top

>gb|AC102396.28| Mus musculus chromosome 3, clone RP24-169F23, complete sequence
          Length = 137155

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 300   aaggaagacattgtaaggtt 319
             ||||||||||||||||||||
Sbjct: 39090 aaggaagacattgtaaggtt 39109



to top

>ref|XM_380420.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG00244.1)
            partial mRNA
          Length = 1713

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 129  cctttccaagaaccagagct 148
            ||||||||||||||||||||
Sbjct: 1624 cctttccaagaaccagagct 1605



to top

>emb|BX088568.4| Human DNA sequence from clone XX-751M15 on chromosome 13 Contains a
             DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 6 (RNA
             helicase, 54kDa) (DDX6) pseudogene, complete sequence
          Length = 34808

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 69    cttcaatgttcttggaacca 88
             ||||||||||||||||||||
Sbjct: 34024 cttcaatgttcttggaacca 34005



to top

>emb|AL646005.7| Human DNA sequence from clone XXyac-Y20H11 on chromosome 13, complete
            sequence
          Length = 38306

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 69   cttcaatgttcttggaacca 88
            ||||||||||||||||||||
Sbjct: 1216 cttcaatgttcttggaacca 1197



to top

>emb|CR380956.1| Candida glabrata strain CBS138 chromosome J complete sequence
          Length = 1192501

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 357    gatgaggttgccaaaaggct 376
              ||||||||||||||||||||
Sbjct: 361023 gatgaggttgccaaaaggct 361004



to top

>gb|AC092807.2| Homo sapiens chromosome 1 clone RP11-290M5, complete sequence
          Length = 180574

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 122   aaaagaacctttccaagaaccaga 145
             |||||||||||| |||||||||||
Sbjct: 93556 aaaagaacctttacaagaaccaga 93579



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 403     tcaagtaccttgacgatgatcacgagtgggtg 434
               |||||||||| ||||| || ||||||||||||
Sbjct: 1913627 tcaagtacctggacgacgaccacgagtgggtg 1913596



to top

>dbj|AP005474.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0081C13
          Length = 144624

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 403   tcaagtaccttgacgatgatcacgagtgggtg 434
             |||||||||| ||||| || ||||||||||||
Sbjct: 53188 tcaagtacctggacgacgaccacgagtgggtg 53157



to top

>emb|CT573040.5| Wallaby DNA sequence from clone MEKBa-454A14, complete sequence
          Length = 164317

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 430   gggtgaagttggcttgcaat 449
             ||||||||||||||||||||
Sbjct: 10027 gggtgaagttggcttgcaat 10008


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,981,960
Number of Sequences: 3902068
Number of extensions: 3981960
Number of successful extensions: 68725
Number of sequences better than 10.0: 28
Number of HSP's better than 10.0 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68611
Number of HSP's gapped (non-prelim): 109
length of query: 596
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 573
effective length of database: 17,143,297,704
effective search space: 9823109584392
effective search space used: 9823109584392
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top