>gb|DQ083192.1| Oryza sativa (indica cultivar-group) clone 5S5H65 mRNA sequence
          Length = 741

 Score = 89.7 bits (45), Expect = 5e-16
 Identities = 48/49 (97%)
 Strand = Plus / Plus

                                                            
Query: 1   atggagcttgggaacaataccttggcttggagcatactgacacaacacc 49
           ||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 313 atggagcttgggaacaataccttggcttggaacatactgacacaacacc 361

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 89.7 bits (45), Expect = 5e-16
 Identities = 48/49 (97%)
 Strand = Plus / Plus

                                                                 
Query: 1        atggagcttgggaacaataccttggcttggagcatactgacacaacacc 49
                ||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 18388090 atggagcttgggaacaataccttggcttggaacatactgacacaacacc 18388138

>dbj|AK058717.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-E02,
          full insert sequence
          Length = 650

 Score = 89.7 bits (45), Expect = 5e-16
 Identities = 48/49 (97%)
 Strand = Plus / Plus

                                                           
Query: 1  atggagcttgggaacaataccttggcttggagcatactgacacaacacc 49
          ||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 17 atggagcttgggaacaataccttggcttggaacatactgacacaacacc 65

>gb|DQ119301.1| Oryza sativa (indica cultivar-group) putative ubiquitin protease
           mRNA, partial cds
          Length = 1593

 Score = 89.7 bits (45), Expect = 5e-16
 Identities = 48/49 (97%)
 Strand = Plus / Plus

                                                            
Query: 1   atggagcttgggaacaataccttggcttggagcatactgacacaacacc 49
           ||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 938 atggagcttgggaacaataccttggcttggaacatactgacacaacacc 986

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 89.7 bits (45), Expect = 5e-16
 Identities = 48/49 (97%)
 Strand = Plus / Plus

                                                                 
Query: 1        atggagcttgggaacaataccttggcttggagcatactgacacaacacc 49
                ||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 18314316 atggagcttgggaacaataccttggcttggaacatactgacacaacacc 18314364

>emb|AL845344.4|CNS08CB6 Oryza sativa chromosome 12, . BAC OSJNBb0108O14 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 138585

 Score = 89.7 bits (45), Expect = 5e-16
 Identities = 48/49 (97%)
 Strand = Plus / Plus

                                                              
Query: 1     atggagcttgggaacaataccttggcttggagcatactgacacaacacc 49
             ||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 39989 atggagcttgggaacaataccttggcttggaacatactgacacaacacc 40037

>gb|BT016292.1| Zea mays clone Contig125 mRNA sequence
          Length = 1106

 Score = 69.9 bits (35), Expect = 5e-10
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                          
Query: 1   atggagcttgggaacaataccttggcttggagcatactgacacaaca 47
           |||| ||||||||||||||||||||||||||||| ||||| ||||||
Sbjct: 512 atggtgcttgggaacaataccttggcttggagcacactgatacaaca 558

>gb|AY104559.1| Zea mays PCO133879 mRNA sequence
          Length = 962

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 1   atggagcttgggaacaataccttggcttggagcatactgacacaaca 47
           |||| ||||||||||||||||||||||||||||| || || ||||||
Sbjct: 340 atggtgcttgggaacaataccttggcttggagcacaccgatacaaca 386

>emb|CR936945.2| Medicago truncatula chromosome 5 clone mte1-67e6, COMPLETE SEQUENCE
          Length = 127675

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 1    atggagcttgggaacaataccttggcttggagcatactga 40
            |||| |||||||| || || ||||||||||||||||||||
Sbjct: 5215 atggtgcttgggagcagtatcttggcttggagcatactga 5254

>dbj|AP006535.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT02D13, TM0546,
             complete sequence
          Length = 107979

 Score = 44.1 bits (22), Expect = 0.028
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                       
Query: 1     atggagcttgggaacaataccttggcttggagcatactgaca 42
             |||| |||||||| || || ||||| ||||||||||||||||
Sbjct: 76963 atggtgcttgggagcagtatcttggtttggagcatactgaca 76922

>gb|AC156454.2| Volvox carteri clone JGIAOBO-9I12, complete sequence
          Length = 36564

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 31    agcatactgacacaacaccc 50
             ||||||||||||||||||||
Sbjct: 15682 agcatactgacacaacaccc 15663

>ref|NM_117595.3| Arabidopsis thaliana metal ion binding AT4G15080 mRNA, complete cds
          Length = 2876

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 18   taccttggcttggagcata 36
            |||||||||||||||||||
Sbjct: 1799 taccttggcttggagcata 1781

>ref|XM_476711.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3351

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 31/35 (88%)
 Strand = Plus / Plus

                                               
Query: 1    atggagcttgggaacaataccttggcttggagcat 35
            ||||||||||||| ||||| |||||  ||||||||
Sbjct: 3236 atggagcttgggagcaatatcttggactggagcat 3270

>gb|AC003092.1| Homo sapiens BAC clone CTA-335O22 from 7, complete sequence
          Length = 108878

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 6     gcttgggaacaataccttg 24
             |||||||||||||||||||
Sbjct: 36805 gcttgggaacaataccttg 36787

>gb|AC146121.3| Pan troglodytes BAC clone RP43-4M8 from 7, complete sequence
          Length = 153260

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 6      gcttgggaacaataccttg 24
              |||||||||||||||||||
Sbjct: 133658 gcttgggaacaataccttg 133676

>gb|BT008794.1| Arabidopsis thaliana At4g15680 gene, complete cds
          Length = 2157

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 18   taccttggcttggagcata 36
            |||||||||||||||||||
Sbjct: 1465 taccttggcttggagcata 1447

>emb|Z97337.2|ATFCA2 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 2
          Length = 202860

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 18     taccttggcttggagcata 36
              |||||||||||||||||||
Sbjct: 174844 taccttggcttggagcata 174862

>gb|AY099860.1| Arabidopsis thaliana unknown protein (At4g15080) mRNA, complete cds
          Length = 2872

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 18   taccttggcttggagcata 36
            |||||||||||||||||||
Sbjct: 1799 taccttggcttggagcata 1781

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 31/35 (88%)
 Strand = Plus / Plus

                                                  
Query: 1       atggagcttgggaacaataccttggcttggagcat 35
               ||||||||||||| ||||| |||||  ||||||||
Sbjct: 3455922 atggagcttgggagcaatatcttggactggagcat 3455956

>gb|AC147324.3| Pan troglodytes BAC clone RP43-41B9 from chromosome 7, complete sequence
          Length = 163009

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 6      gcttgggaacaataccttg 24
              |||||||||||||||||||
Sbjct: 129069 gcttgggaacaataccttg 129051

>dbj|AP004664.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0428D12
          Length = 141678

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 31/35 (88%)
 Strand = Plus / Plus

                                                
Query: 1     atggagcttgggaacaataccttggcttggagcat 35
             ||||||||||||| ||||| |||||  ||||||||
Sbjct: 95742 atggagcttgggagcaatatcttggactggagcat 95776

>emb|AL161540.2|ATCHRIV40 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 40
          Length = 197405

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 18     taccttggcttggagcata 36
              |||||||||||||||||||
Sbjct: 120298 taccttggcttggagcata 120316

>gb|AC183529.4| Pan troglodytes BAC clone CH251-669H19 from chromosome 3, complete
              sequence
          Length = 216860

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 23     tggcttggagcatactga 40
              ||||||||||||||||||
Sbjct: 212978 tggcttggagcatactga 212995

>gb|AC183103.2| Pan troglodytes BAC clone CH251-712L4 from chromosome 3, complete
             sequence
          Length = 191366

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 23    tggcttggagcatactga 40
             ||||||||||||||||||
Sbjct: 17205 tggcttggagcatactga 17188

>gb|AC147638.2| Mus musculus BAC clone RP23-181L5 from chromosome 7, complete sequence
          Length = 196114

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 2      tggagcttgggaacaata 19
              ||||||||||||||||||
Sbjct: 129482 tggagcttgggaacaata 129465

>gb|AC183269.3| Pan troglodytes BAC clone CH251-685E7 from chromosome 3, complete
              sequence
          Length = 220398

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 23     tggcttggagcatactga 40
              ||||||||||||||||||
Sbjct: 119457 tggcttggagcatactga 119474

>gb|AC119996.7| Mus musculus chromosome 19, clone RP24-120D1, complete sequence
          Length = 172160

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 25    gcttggagcatactgaca 42
             ||||||||||||||||||
Sbjct: 94878 gcttggagcatactgaca 94895

>gb|AC151830.3| Mus musculus BAC clone RP24-76I23 from chromosome 7, complete sequence
          Length = 212931

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 2     tggagcttgggaacaata 19
             ||||||||||||||||||
Sbjct: 82860 tggagcttgggaacaata 82843

>gb|AC034203.7| Homo sapiens chromosome 3 clone CTB-182H21, complete sequence
          Length = 105702

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 23   tggcttggagcatactga 40
            ||||||||||||||||||
Sbjct: 2868 tggcttggagcatactga 2885

>gb|AC146160.3| Pan troglodytes BAC clone RP43-1E22 from chromosome 7, complete sequence
          Length = 182457

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 23     tggcttggagcatactga 40
              ||||||||||||||||||
Sbjct: 116798 tggcttggagcatactga 116815

>gb|AC092903.11| Homo sapiens 3 BAC RP11-666A20 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 161141

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 23     tggcttggagcatactga 40
              ||||||||||||||||||
Sbjct: 158548 tggcttggagcatactga 158565

>gb|AC139453.10| Homo sapiens 3 BAC RP11-803B1 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 149461

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 23    tggcttggagcatactga 40
             ||||||||||||||||||
Sbjct: 55742 tggcttggagcatactga 55725

>emb|BX294441.9| Mouse DNA sequence from clone RP23-421H1 on chromosome 2, complete
             sequence
          Length = 96360

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 1     atggagcttgggaacaat 18
             ||||||||||||||||||
Sbjct: 81130 atggagcttgggaacaat 81147

>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome
          Length = 7215267

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 17      ataccttggcttggagca 34
               ||||||||||||||||||
Sbjct: 1701523 ataccttggcttggagca 1701540

>gb|AC171736.1| Lycopersicon esculentum chromosome 11 clone C11HBa0323E19, complete
             sequence
          Length = 141216

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 36/42 (85%)
 Strand = Plus / Plus

                                                       
Query: 1     atggagcttgggaacaataccttggcttggagcatactgaca 42
             |||| |||||||| || || ||||||||||| ||| ||||||
Sbjct: 45114 atggtgcttgggagcagtatcttggcttggaacattctgaca 45155

>emb|AL671185.8| Mouse DNA sequence from clone RP23-192N1 on chromosome X, complete
              sequence
          Length = 229574

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 16     aataccttggcttggagc 33
              ||||||||||||||||||
Sbjct: 204990 aataccttggcttggagc 204973


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 293,190
Number of Sequences: 3902068
Number of extensions: 293190
Number of successful extensions: 73735
Number of sequences better than 10.0: 36
Number of HSP's better than 10.0 without gapping: 36
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 73627
Number of HSP's gapped (non-prelim): 108
length of query: 51
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 31
effective length of database: 17,155,003,908
effective search space: 531805121148
effective search space used: 531805121148
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)