ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags8n20
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_472371.1| Oryza sativa (japonica cultivar-group), predic... 96 2e-17
2emb|AL606610.3|OSJN00045 Oryza sativa genomic DNA, chromosome 4,... 96 2e-17
3dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 96 2e-17
4dbj|AK069118.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 2e-17
5emb|X77569.1|ZMCNXRNA Z.mays CNX mRNA 94 6e-17
6gb|AY112482.1| Zea mays CL2224_1 mRNA sequence 94 6e-17
7gb|AC125180.6| Mus musculus BAC clone RP23-322K1 from chromosome... 38 3.2
8gb|AC123253.4| Rattus norvegicus 12 BAC CH230-230N7 (Children's ... 38 3.2
9gb|AC107720.16| Mus musculus chromosome 5, clone RP23-188F20, co... 38 3.2
10gb|BC049173.1| Mus musculus procollagen, type XXVII, alpha 1, mR... 38 3.2
11gb|AC132229.3| Mus musculus BAC clone RP24-484C7 from chromosome... 38 3.2
12gb|BC039222.1| Mus musculus procollagen, type XXVII, alpha 1, mR... 38 3.2
13gb|BC038041.1| Mus musculus procollagen, type XXVII, alpha 1, mR... 38 3.2
14gb|AC148526.24| Medicago truncatula clone mth2-53k6, complete se... 38 3.2
15emb|AL122008.28|HSJ799P18 Human DNA sequence from clone RP4-799P... 38 3.2
16emb|AL049749.2|HS293L6 Human DNA sequence from clone RP1-293L6 o... 38 3.2
17emb|AL683828.8| Mouse DNA sequence from clone RP23-340H1 on chro... 38 3.2
18gb|AC148482.10| Medicago truncatula clone mth2-36j11, complete s... 38 3.2
19dbj|AK053733.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 38 3.2
20dbj|AK030038.1| Mus musculus adult male testis cDNA, RIKEN full-... 38 3.2
21gb|AY167568.2| Mus musculus collagen type XXVII proalpha 1 chain... 38 3.2
22gb|AC007508.2|AC007508 Genomic sequence for Arabidopsis thaliana... 38 3.2
23dbj|AK173283.1| Mus musculus mRNA for mKIAA1870 protein 38 3.2
24ref|NM_025685.2| Mus musculus procollagen, type XXVII, alpha 1 (... 38 3.2
25emb|BX284660.1| Human DNA sequence from clone RP1-293L6 on chrom... 38 3.2
26emb|AL772365.3| Mouse DNA sequence from clone RP23-403H9 on chro... 38 3.2

>ref|XM_472371.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1614

 Score = 95.6 bits (48), Expect = 2e-17
 Identities = 69/76 (90%)
 Strand = Plus / Plus

                                                                       
Query: 4   cttaagtacattcgccctcaggaggctggatgggatgccaaggaatttgacaatgacact 63
           |||||||||||||| |||||||| |||| ||||||||||||||| ||||| ||||| |||
Sbjct: 325 cttaagtacattcgtcctcaggatgctgcatgggatgccaaggagtttgataatgagact 384

                           
Query: 64  ccttacacaattatgt 79
           |||||||| |||||||
Sbjct: 385 ccttacactattatgt 400



to top

>emb|AL606610.3|OSJN00045 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0012E08,
             complete sequence
          Length = 106975

 Score = 95.6 bits (48), Expect = 2e-17
 Identities = 69/76 (90%)
 Strand = Plus / Minus

                                                                         
Query: 4     cttaagtacattcgccctcaggaggctggatgggatgccaaggaatttgacaatgacact 63
             |||||||||||||| |||||||| |||| ||||||||||||||| ||||| ||||| |||
Sbjct: 78622 cttaagtacattcgtcctcaggatgctgcatgggatgccaaggagtttgataatgagact 78563

                             
Query: 64    ccttacacaattatgt 79
             |||||||| |||||||
Sbjct: 78562 ccttacactattatgt 78547



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 95.6 bits (48), Expect = 2e-17
 Identities = 69/76 (90%)
 Strand = Plus / Minus

                                                                            
Query: 4        cttaagtacattcgccctcaggaggctggatgggatgccaaggaatttgacaatgacact 63
                |||||||||||||| |||||||| |||| ||||||||||||||| ||||| ||||| |||
Sbjct: 19923814 cttaagtacattcgtcctcaggatgctgcatgggatgccaaggagtttgataatgagact 19923755

                                
Query: 64       ccttacacaattatgt 79
                |||||||| |||||||
Sbjct: 19923754 ccttacactattatgt 19923739



to top

>dbj|AK069118.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023008D14, full
           insert sequence
          Length = 2059

 Score = 95.6 bits (48), Expect = 2e-17
 Identities = 69/76 (90%)
 Strand = Plus / Plus

                                                                       
Query: 4   cttaagtacattcgccctcaggaggctggatgggatgccaaggaatttgacaatgacact 63
           |||||||||||||| |||||||| |||| ||||||||||||||| ||||| ||||| |||
Sbjct: 431 cttaagtacattcgtcctcaggatgctgcatgggatgccaaggagtttgataatgagact 490

                           
Query: 64  ccttacacaattatgt 79
           |||||||| |||||||
Sbjct: 491 ccttacactattatgt 506



to top

>emb|X77569.1|ZMCNXRNA Z.mays CNX mRNA
          Length = 1559

 Score = 93.7 bits (47), Expect = 6e-17
 Identities = 68/75 (90%)
 Strand = Plus / Plus

                                                                      
Query: 5  ttaagtacattcgccctcaggaggctggatgggatgccaaggaatttgacaatgacactc 64
          |||||||||| ||||||||||| |||||||||||||||||||| ||||| ||||| ||||
Sbjct: 6  ttaagtacatccgccctcaggatgctggatgggatgccaaggagtttgataatgagactc 65

                         
Query: 65 cttacacaattatgt 79
          | ||||| |||||||
Sbjct: 66 catacactattatgt 80



to top

>gb|AY112482.1| Zea mays CL2224_1 mRNA sequence
          Length = 1661

 Score = 93.7 bits (47), Expect = 6e-17
 Identities = 68/75 (90%)
 Strand = Plus / Plus

                                                                      
Query: 5  ttaagtacattcgccctcaggaggctggatgggatgccaaggaatttgacaatgacactc 64
          |||||||||| ||||||||||| |||||||||||||||||||| ||||| ||||| ||||
Sbjct: 6  ttaagtacatccgccctcaggatgctggatgggatgccaaggagtttgataatgagactc 65

                         
Query: 65 cttacacaattatgt 79
          | ||||| |||||||
Sbjct: 66 catacactattatgt 80



to top

>gb|AC125180.6| Mus musculus BAC clone RP23-322K1 from chromosome 14, complete sequence
          Length = 200560

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 57     tgacactccttacacaatt 75
              |||||||||||||||||||
Sbjct: 153126 tgacactccttacacaatt 153144



to top

>gb|AC123253.4| Rattus norvegicus 12 BAC CH230-230N7 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 231202

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 44     aggaatttgacaatgacac 62
              |||||||||||||||||||
Sbjct: 167579 aggaatttgacaatgacac 167561



to top

>gb|AC107720.16| Mus musculus chromosome 5, clone RP23-188F20, complete sequence
          Length = 206182

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 44     aggaatttgacaatgacac 62
              |||||||||||||||||||
Sbjct: 189697 aggaatttgacaatgacac 189715



to top

>gb|BC049173.1| Mus musculus procollagen, type XXVII, alpha 1, mRNA (cDNA clone
            IMAGE:4239652), partial cds
          Length = 4276

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 29   ctggatgggatgccaagga 47
            |||||||||||||||||||
Sbjct: 3151 ctggatgggatgccaagga 3133



to top

>gb|AC132229.3| Mus musculus BAC clone RP24-484C7 from chromosome 5, complete sequence
          Length = 170292

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 44    aggaatttgacaatgacac 62
             |||||||||||||||||||
Sbjct: 68512 aggaatttgacaatgacac 68530



to top

>gb|BC039222.1| Mus musculus procollagen, type XXVII, alpha 1, mRNA (cDNA clone
            IMAGE:4239652), containing frame-shift errors
          Length = 4288

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 29   ctggatgggatgccaagga 47
            |||||||||||||||||||
Sbjct: 3163 ctggatgggatgccaagga 3145



to top

>gb|BC038041.1| Mus musculus procollagen, type XXVII, alpha 1, mRNA (cDNA clone
           IMAGE:4194659), partial cds
          Length = 1597

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 29  ctggatgggatgccaagga 47
           |||||||||||||||||||
Sbjct: 472 ctggatgggatgccaagga 454



to top

>gb|AC148526.24| Medicago truncatula clone mth2-53k6, complete sequence
          Length = 89055

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 41    ccaaggaatttgacaatga 59
             |||||||||||||||||||
Sbjct: 61779 ccaaggaatttgacaatga 61797



to top

>emb|AL122008.28|HSJ799P18 Human DNA sequence from clone RP4-799P18 on chromosome 1q42.2-43 Contains
              the 3' end of the SLC35F3 gene for solute carrier family 35
              member F3, two novel genes and three CpG islands, complete
              sequence
          Length = 144407

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 20     ctcaggaggctggatggga 38
              |||||||||||||||||||
Sbjct: 136778 ctcaggaggctggatggga 136796



to top

>emb|AL049749.2|HS293L6 Human DNA sequence from clone RP1-293L6 on chromosome 22 Contains the
             first exon of the CACNG2 gene for voltage-dependent
             calcium channel gamma subunit 2, ESTs, STSs, GSSs and a
             putative CpG island, complete sequence
          Length = 99497

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 19    cctcaggaggctggatggg 37
             |||||||||||||||||||
Sbjct: 67391 cctcaggaggctggatggg 67409



to top

>emb|AL683828.8| Mouse DNA sequence from clone RP23-340H1 on chromosome 4 Contains the
             3' end of the Col27a1 gene for procollagen type XXVII
             alpha 1, the Orm1, Orm2 and Orm3 genes for orosomucoid 1,
             2 and 3, an orosomucoid pseudogene, the gene for a novel
             protein similar to human AT-hook protein AKNA, gene
             4933437N03Rik, the Whrn gene for whirlin and two CpG
             islands, complete sequence
          Length = 214370

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 29    ctggatgggatgccaagga 47
             |||||||||||||||||||
Sbjct: 39765 ctggatgggatgccaagga 39747



to top

>gb|AC148482.10| Medicago truncatula clone mth2-36j11, complete sequence
          Length = 115873

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 41    ccaaggaatttgacaatga 59
             |||||||||||||||||||
Sbjct: 89952 ccaaggaatttgacaatga 89934



to top

>dbj|AK053733.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
            library, clone:E130303P03 product:hypothetical Collagen
            triple helix repeat containing protein, full insert
            sequence
          Length = 3216

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 29   ctggatgggatgccaagga 47
            |||||||||||||||||||
Sbjct: 2087 ctggatgggatgccaagga 2069



to top

>dbj|AK030038.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
            library, clone:4932416J22 product:weakly similar to
            PROCOLLAGEN TYPE V ALPHA-2 CHAIN (FRAGMENT) [Homo
            sapiens], full insert sequence
          Length = 4280

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 29   ctggatgggatgccaagga 47
            |||||||||||||||||||
Sbjct: 3122 ctggatgggatgccaagga 3104



to top

>gb|AY167568.2| Mus musculus collagen type XXVII proalpha 1 chain (Col27a1) mRNA,
            complete cds
          Length = 5538

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 29   ctggatgggatgccaagga 47
            |||||||||||||||||||
Sbjct: 4824 ctggatgggatgccaagga 4806



to top

>gb|AC007508.2|AC007508 Genomic sequence for Arabidopsis thaliana BAC F1K23 from chromosome I,
             complete sequence
          Length = 101305

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 51    tgacaatgacactccttac 69
             |||||||||||||||||||
Sbjct: 26798 tgacaatgacactccttac 26816



to top

>dbj|AK173283.1| Mus musculus mRNA for mKIAA1870 protein
          Length = 3427

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 29   ctggatgggatgccaagga 47
            |||||||||||||||||||
Sbjct: 1862 ctggatgggatgccaagga 1844



to top

>ref|NM_025685.2| Mus musculus procollagen, type XXVII, alpha 1 (Col27a1), mRNA
          Length = 5538

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 29   ctggatgggatgccaagga 47
            |||||||||||||||||||
Sbjct: 4824 ctggatgggatgccaagga 4806



to top

>emb|BX284660.1| Human DNA sequence from clone RP1-293L6 on chromosome 22, complete
             sequence
          Length = 70881

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 19    cctcaggaggctggatggg 37
             |||||||||||||||||||
Sbjct: 30642 cctcaggaggctggatggg 30624



to top

>emb|AL772365.3| Mouse DNA sequence from clone RP23-403H9 on chromosome 4, complete
             sequence
          Length = 55296

 Score = 38.2 bits (19), Expect = 3.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 19    cctcaggaggctggatggg 37
             |||||||||||||||||||
Sbjct: 24722 cctcaggaggctggatggg 24740


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 899,415
Number of Sequences: 3902068
Number of extensions: 899415
Number of successful extensions: 49314
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49266
Number of HSP's gapped (non-prelim): 48
length of query: 79
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 58
effective length of database: 17,151,101,840
effective search space: 994763906720
effective search space used: 994763906720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top