>gb|AF195221.1|AF195221 Pyrus pyrifolia strain Whangkeumbae chlorophyll a/b-binding protein
           (ChBP) mRNA, complete cds
          Length = 411

 Score = 44.1 bits (22), Expect = 0.024
 Identities = 40/47 (85%)
 Strand = Plus / Plus

                                                          
Query: 1   ggatgggacactgcggggctctntgncgaccccganacctttgccaa 47
           |||||||||||||| ||||| |  |  |||||||| |||||||||||
Sbjct: 63  ggatgggacactgctgggctatcagcagaccccgaaacctttgccaa 109

>emb|X16536.1|GMCAB5 G.max DNA for Cab5
          Length = 1467

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 37/44 (84%)
 Strand = Plus / Plus

                                                       
Query: 4   tgggacactgcggggctctntgncgaccccganacctttgccaa 47
           ||||||||||| ||||| | ||  ||||| || |||||||||||
Sbjct: 559 tgggacactgctgggctttctgctgacccagagacctttgccaa 602

>emb|X16535.1|GMCAB4 G.max DNA for Cab4
          Length = 1470

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 37/44 (84%)
 Strand = Plus / Plus

                                                       
Query: 4   tgggacactgcggggctctntgncgaccccganacctttgccaa 47
           ||||||||||| ||||| | ||  ||||| || |||||||||||
Sbjct: 562 tgggacactgctgggctttctgctgacccagagacctttgccaa 605

>gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting chlorophyll a/b
           binding protein (Lhcb-Pp1) gene, complete cds
          Length = 1912

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 37/44 (84%)
 Strand = Plus / Plus

                                                       
Query: 4   tgggacactgcggggctctntgncgaccccganacctttgccaa 47
           ||||||||||| |||||||  |  ||||| || |||||||||||
Sbjct: 576 tgggacactgctgggctctcagctgacccagagacctttgccaa 619

>gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-binding protein (LHCPII)
           mRNA, 3' end
          Length = 911

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 37/44 (84%)
 Strand = Plus / Plus

                                                       
Query: 4   tgggacactgcggggctctntgncgaccccganacctttgccaa 47
           ||||||||||| ||||| | ||  ||||| || |||||||||||
Sbjct: 177 tgggacactgctgggctttctgctgacccagagacctttgccaa 220

>gb|AC123029.3| Mus musculus BAC clone RP24-571B18 from chromosome 8, complete sequence
          Length = 154235

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 5      gggacactgcggggctct 22
              ||||||||||||||||||
Sbjct: 130021 gggacactgcggggctct 130004

>dbj|AK141475.1| Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length
          enriched library, clone:C530031H15 product:small
          nuclear RNA activating complex, polypeptide 2, full
          insert sequence
          Length = 1517

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                            
Query: 5  gggacactgcggggctct 22
          ||||||||||||||||||
Sbjct: 19 gggacactgcggggctct 2

>gb|AC001228.1|HSAC001228 244Kb Contig from Human Chromosome 11p15.5 spanning D11S1 through D11S25,
              complete sequence
          Length = 244254

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 4      tgggacactgcggggctc 21
              ||||||||||||||||||
Sbjct: 171436 tgggacactgcggggctc 171419

>dbj|AK155012.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
          full-length enriched library, clone:F630115N11
          product:small nuclear RNA activating complex,
          polypeptide 2, full insert sequence
          Length = 1193

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                            
Query: 5  gggacactgcggggctct 22
          ||||||||||||||||||
Sbjct: 29 gggacactgcggggctct 12

>dbj|AK035340.1| Mus musculus adult male urinary bladder cDNA, RIKEN full-length
          enriched library, clone:9530020C04 product:weakly
          similar to proximal sequence element-binding
          transcription factor delta chain [Homo sapiens], full
          insert sequence
          Length = 1525

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                            
Query: 5  gggacactgcggggctct 22
          ||||||||||||||||||
Sbjct: 29 gggacactgcggggctct 12

>dbj|AK075569.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
          library, clone:0610007H10 product:weakly similar to
          proximal sequence element-binding transcription factor
          delta chain [Homo sapiens], full insert sequence
          Length = 1536

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                            
Query: 5  gggacactgcggggctct 22
          ||||||||||||||||||
Sbjct: 40 gggacactgcggggctct 23

>dbj|AK004379.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
          enriched library, clone:1110065O23 product:weakly
          similar to proximal sequence element-binding
          transcription factor delta chain [Homo sapiens], full
          insert sequence
          Length = 1513

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                            
Query: 5  gggacactgcggggctct 22
          ||||||||||||||||||
Sbjct: 23 gggacactgcggggctct 6

>gb|AC131971.9| Homo sapiens chromosome 11, clone CTC-343N3, complete sequence
          Length = 176226

 Score = 36.2 bits (18), Expect = 6.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 4      tgggacactgcggggctc 21
              ||||||||||||||||||
Sbjct: 104248 tgggacactgcggggctc 104265


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 61,093
Number of Sequences: 3902068
Number of extensions: 61093
Number of successful extensions: 11476
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 11462
Number of HSP's gapped (non-prelim): 14
length of query: 47
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 27
effective length of database: 17,155,003,908
effective search space: 463185105516
effective search space used: 463185105516
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)