ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags9c07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY826150.1| Aedes albopictus clone AL_337 60S ribosomal prote... 40 0.17
2dbj|AK070605.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 0.17
3dbj|AK062150.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 0.17
4gb|AF022736.1|AF022736 Oryza sativa ribosomal protein mRNA, comp... 40 0.17
5gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 38 0.67
6gb|DQ196189.1| Triticum aestivum cultivar WH 542 cystatin gene, ... 38 0.67
7ref|NM_209888.1| Eremothecium gossypii AEL325Wp (AEL325W), mRNA 38 0.67
8gb|DQ279931.1| Triticum aestivum genotype WH-542 cystatin WC-4 m... 38 0.67
9gb|DQ279930.1| Triticum aestivum genotype HD-29 cystatin WC-4 mR... 38 0.67
10dbj|AB038393.1| Triticum aestivum WC4 mRNA for cysteine proteina... 38 0.67
11ref|NM_180806.1| Arabidopsis thaliana structural constituent of ... 36 2.7
12ref|NM_123945.2| Arabidopsis thaliana structural constituent of ... 36 2.7
13gb|AC115786.8| Mus musculus chromosome 5, clone RP23-170E15, com... 36 2.7
14ref|NM_000975.2| Homo sapiens ribosomal protein L11 (RPL11), mRNA 36 2.7
15ref|XM_513195.1| PREDICTED: Pan troglodytes similar to ribosomal... 36 2.7
16gb|AC104280.2| Oryza sativa (japonica cultivar-group) chromosome... 36 2.7
17gb|BC025077.1| Mus musculus ribosomal protein L11, mRNA (cDNA cl... 36 2.7
18ref|NM_025919.1| Mus musculus ribosomal protein L11 (Rpl11), mRNA 36 2.7
19gb|BC021402.1| Mus musculus ribosomal protein L11, mRNA (cDNA cl... 36 2.7
20ref|XM_001002764.1| PREDICTED: Mus musculus similar to 60S ribos... 36 2.7
21ref|XM_911700.2| PREDICTED: Mus musculus similar to 60S ribosoma... 36 2.7
22ref|XM_286185.6| PREDICTED: Mus musculus similar to 60S ribosoma... 36 2.7
23ref|XM_976864.1| PREDICTED: Mus musculus similar to 60S ribosoma... 36 2.7
24ref|XM_976158.1| PREDICTED: Mus musculus similar to 60S ribosoma... 36 2.7
25ref|XR_003409.1| PREDICTED: Mus musculus similar to 60S ribosoma... 36 2.7
26ref|XR_003560.1| PREDICTED: Mus musculus similar to 60S ribosoma... 36 2.7
27gb|BC021918.1| Mus musculus cDNA clone IMAGE:4485748, **** WARNI... 36 2.7
28ref|XM_798156.1| Trypanosoma cruzi strain CL Brener 60S ribosoma... 36 2.7
29gb|AC151275.3| Mus musculus BAC clone RP24-201F8 from chromosome... 36 2.7
30emb|X62146.1|RRRPL11 R.rattus mRNA for ribosomal protein L11 36 2.7
31emb|AL451000.16| Human DNA sequence from clone RP11-223J15 on ch... 36 2.7
32emb|AL356128.27| Human DNA sequence from clone RP11-366I13 on ch... 36 2.7
33gb|AC165445.1| Mus musculus BAC clone RP23-10J16 from chromosome... 36 2.7
34emb|CR858471.1| Pongo pygmaeus mRNA; cDNA DKFZp468I2311 (from cl... 36 2.7
35gb|AC115889.13| Mus musculus chromosome 3, clone RP24-409N2, com... 36 2.7
36emb|CR626653.1| full-length cDNA clone CS0DL001YE16 of B cells (... 36 2.7
37emb|CR625076.1| full-length cDNA clone CS0DL002YI20 of B cells (... 36 2.7
38emb|CR601780.1| full-length cDNA clone CS0CAP008YF02 of Thymus o... 36 2.7
39emb|CR597812.1| full-length cDNA clone CS0DI084YG07 of Placenta ... 36 2.7
40emb|CR597577.1| full-length cDNA clone CS0DI024YH20 of Placenta ... 36 2.7
41gb|AF432212.1| Homo sapiens CLL-associated antigen KW-12 mRNA, p... 36 2.7
42gb|AY078021.1| Arabidopsis thaliana AT4g18730/F28A21_140 mRNA, c... 36 2.7
43dbj|AK153486.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 36 2.7
44dbj|AK164445.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN ... 36 2.7
45dbj|AK169053.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu... 36 2.7
46dbj|AK013923.1| Mus musculus 13 days embryo head cDNA, RIKEN ful... 36 2.7
47emb|X79234.1|HSRPL11 Homo sapiens mRNA for ribosomal protein L11 36 2.7
48dbj|AK088967.1| Mus musculus 2 days neonate thymus thymic cells ... 36 2.7
49dbj|AK002998.1| Mus musculus adult male brain cDNA, RIKEN full-l... 36 2.7
50gb|AF101385.3|HOMORPL2 Homo sapiens ribosomal protein L11 gene, ... 36 2.7
51dbj|AK008422.1| Mus musculus adult male small intestine cDNA, RI... 36 2.7
52gb|AF385722.1|AF385722 Arabidopsis thaliana AT4g18730/F28A21_140... 36 2.7
53dbj|AK011800.1| Mus musculus 10 days embryo whole body cDNA, RIK... 36 2.7
54dbj|AK014593.1| Mus musculus 0 day neonate skin cDNA, RIKEN full... 36 2.7
55dbj|AK011211.1| Mus musculus 10 days embryo whole body cDNA, RIK... 36 2.7
56dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 36 2.7
57gb|AC153849.8| Mus musculus BAC RP23-97L11 (Roswell Park Cancer... 36 2.7
58gb|AY086211.1| Arabidopsis thaliana clone 22470 mRNA, complete s... 36 2.7
59ref|XM_578503.1| PREDICTED: Rattus norvegicus similar to 60S rib... 36 2.7
60gb|AY892917.1| Synthetic construct Homo sapiens clone FLH135007.... 36 2.7
61gb|AY890457.1| Synthetic construct Homo sapiens clone FLH135011.... 36 2.7
62emb|BX530725.11| Mouse DNA sequence from clone RP23-49E16 on chr... 36 2.7
63emb|AL672186.7| Mouse DNA sequence from clone RP23-42G2 on chrom... 36 2.7
64gb|BC069896.1| Mus musculus ribosomal protein L11, mRNA (cDNA cl... 36 2.7
65gb|BC018970.2| Homo sapiens ribosomal protein L11, mRNA (cDNA cl... 36 2.7
66gb|AC102377.14| Mus musculus chromosome 18, clone RP23-416I22, c... 36 2.7
67gb|DQ206471.1| Platynereis dumerilii isolate TOA19 ribosomal pro... 36 2.7
68gb|BC097372.1| Rattus norvegicus ribosomal protein L11, mRNA (cD... 36 2.7
69ref|NM_001025739.1| Rattus norvegicus ribosomal protein L11 (Rpl... 36 2.7
70gb|L05092.1|HUMRIBPROC Homo sapiens ribosomal protein L11 mRNA, ... 36 2.7
71dbj|AP004956.1| Lotus japonicus genomic DNA, chromosome 1, clone... 36 2.7
72gb|M88489.1|MUSNBP Mus musculus nonamer binding protein mRNA, co... 36 2.7
73emb|AL606934.12| Mouse DNA sequence from clone RP23-138L21 on ch... 36 2.7
74dbj|D16671.1|EGRMTC3SI Euglena gracilis mitochondrial mRNA for c... 36 2.7
75dbj|AB007171.1| Homo sapiens gene for ribosomal protein L11, par... 36 2.7

>gb|AY826150.1| Aedes albopictus clone AL_337 60S ribosomal protein L11 mRNA,
           complete cds
          Length = 552

 Score = 40.1 bits (20), Expect = 0.17
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 11  caaggtgttggagcagctga 30
           ||||||||||||||||||||
Sbjct: 120 caaggtgttggagcagctga 139



to top

>dbj|AK070605.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055B20, full
           insert sequence
          Length = 916

 Score = 40.1 bits (20), Expect = 0.17
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 11  caaggtgttggagcagctga 30
           ||||||||||||||||||||
Sbjct: 180 caaggtgttggagcagctga 199



to top

>dbj|AK062150.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-H04, full
           insert sequence
          Length = 1584

 Score = 40.1 bits (20), Expect = 0.17
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 11  caaggtgttggagcagctga 30
           ||||||||||||||||||||
Sbjct: 954 caaggtgttggagcagctga 973



to top

>gb|AF022736.1|AF022736 Oryza sativa ribosomal protein mRNA, complete cds
          Length = 905

 Score = 40.1 bits (20), Expect = 0.17
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 11  caaggtgttggagcagctga 30
           ||||||||||||||||||||
Sbjct: 162 caaggtgttggagcagctga 181



to top

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
             complete sequence
          Length = 1519138

 Score = 38.2 bits (19), Expect = 0.67
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 11    caaggtgttggagcagctg 29
             |||||||||||||||||||
Sbjct: 38720 caaggtgttggagcagctg 38738



to top

>gb|DQ196189.1| Triticum aestivum cultivar WH 542 cystatin gene, partial sequence
          Length = 1006

 Score = 38.2 bits (19), Expect = 0.67
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 11  caaggtgttggagcagctg 29
           |||||||||||||||||||
Sbjct: 483 caaggtgttggagcagctg 501



to top

>ref|NM_209888.1| Eremothecium gossypii AEL325Wp (AEL325W), mRNA
          Length = 525

 Score = 38.2 bits (19), Expect = 0.67
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 11  caaggtgttggagcagctg 29
           |||||||||||||||||||
Sbjct: 102 caaggtgttggagcagctg 120



to top

>gb|DQ279931.1| Triticum aestivum genotype WH-542 cystatin WC-4 mRNA, complete cds
          Length = 538

 Score = 38.2 bits (19), Expect = 0.67
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 11  caaggtgttggagcagctg 29
           |||||||||||||||||||
Sbjct: 446 caaggtgttggagcagctg 464



to top

>gb|DQ279930.1| Triticum aestivum genotype HD-29 cystatin WC-4 mRNA, complete cds
          Length = 538

 Score = 38.2 bits (19), Expect = 0.67
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 11  caaggtgttggagcagctg 29
           |||||||||||||||||||
Sbjct: 446 caaggtgttggagcagctg 464



to top

>dbj|AB038393.1| Triticum aestivum WC4 mRNA for cysteine proteinase inhibitor,
           complete cds
          Length = 720

 Score = 38.2 bits (19), Expect = 0.67
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 11  caaggtgttggagcagctg 29
           |||||||||||||||||||
Sbjct: 457 caaggtgttggagcagctg 475



to top

>ref|NM_180806.1| Arabidopsis thaliana structural constituent of ribosome AT5G45775
           transcript variant AT5G45775.1 mRNA, complete cds
          Length = 828

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 171 caaggtgttggagcagct 188



to top

>ref|NM_123945.2| Arabidopsis thaliana structural constituent of ribosome AT5G45775
           transcript variant AT5G45775.2 mRNA, complete cds
          Length = 827

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 170 caaggtgttggagcagct 187



to top

>gb|AC115786.8| Mus musculus chromosome 5, clone RP23-170E15, complete sequence
          Length = 193480

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 11     caaggtgttggagcagct 28
              ||||||||||||||||||
Sbjct: 119080 caaggtgttggagcagct 119063



to top

>ref|NM_000975.2| Homo sapiens ribosomal protein L11 (RPL11), mRNA
          Length = 609

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 131 caaggtgttggagcagct 148



to top

>ref|XM_513195.1| PREDICTED: Pan troglodytes similar to ribosomal protein L11
            (LOC456619), mRNA
          Length = 2308

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 11   caaggtgttggagcagct 28
            ||||||||||||||||||
Sbjct: 1317 caaggtgttggagcagct 1334



to top

>gb|AC104280.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1430_B02,
            complete sequence
          Length = 75456

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 13   aggtgttggagcagctga 30
            ||||||||||||||||||
Sbjct: 3205 aggtgttggagcagctga 3222



to top

>gb|BC025077.1| Mus musculus ribosomal protein L11, mRNA (cDNA clone MGC:35693
           IMAGE:2647882), complete cds
          Length = 598

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 118 caaggtgttggagcagct 135



to top

>ref|NM_025919.1| Mus musculus ribosomal protein L11 (Rpl11), mRNA
          Length = 596

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 131 caaggtgttggagcagct 148



to top

>gb|BC021402.1| Mus musculus ribosomal protein L11, mRNA (cDNA clone MGC:29111
           IMAGE:4039711), complete cds
          Length = 599

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 119 caaggtgttggagcagct 136



to top

>ref|XM_001002764.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L11
           (LOC328825), mRNA
          Length = 617

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 119 caaggtgttggagcagct 136



to top

>ref|XM_911700.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L11
           (LOC328825), mRNA
          Length = 617

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 119 caaggtgttggagcagct 136



to top

>ref|XM_286185.6| PREDICTED: Mus musculus similar to 60S ribosomal protein L11
           (LOC328825), mRNA
          Length = 617

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 119 caaggtgttggagcagct 136



to top

>ref|XM_976864.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L11
           (LOC235424), mRNA
          Length = 619

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 127 caaggtgttggagcagct 144



to top

>ref|XM_976158.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L11
           (LOC665330), mRNA
          Length = 619

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 127 caaggtgttggagcagct 144



to top

>ref|XR_003409.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L11
           (LOC631553), mRNA
          Length = 813

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 134 caaggtgttggagcagct 151



to top

>ref|XR_003560.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L11
           (LOC194197), mRNA
          Length = 529

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 111 caaggtgttggagcagct 128



to top

>gb|BC021918.1| Mus musculus cDNA clone IMAGE:4485748, **** WARNING: chimeric clone
            ****
          Length = 2069

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 11   caaggtgttggagcagct 28
            ||||||||||||||||||
Sbjct: 1588 caaggtgttggagcagct 1605



to top

>ref|XM_798156.1| Trypanosoma cruzi strain CL Brener 60S ribosomal protein L11
           (Tc00.1047053508197.10) partial mRNA
          Length = 579

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 12  aaggtgttggagcagctg 29
           ||||||||||||||||||
Sbjct: 121 aaggtgttggagcagctg 138



to top

>gb|AC151275.3| Mus musculus BAC clone RP24-201F8 from chromosome 17, complete sequence
          Length = 190772

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 11    caaggtgttggagcagct 28
             ||||||||||||||||||
Sbjct: 70905 caaggtgttggagcagct 70922



to top

>emb|X62146.1|RRRPL11 R.rattus mRNA for ribosomal protein L11
          Length = 585

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 128 caaggtgttggagcagct 145



to top

>emb|AL451000.16| Human DNA sequence from clone RP11-223J15 on chromosome 1 Contains a
              novel gene (MDS2), a eukaryotic translation elongation
              factor 1 alpha 2 (EEF1A2) pseudogene and the RPL11 gene for
              ribosomal protein L11, complete sequence
          Length = 115566

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 11     caaggtgttggagcagct 28
              ||||||||||||||||||
Sbjct: 105417 caaggtgttggagcagct 105434



to top

>emb|AL356128.27| Human DNA sequence from clone RP11-366I13 on chromosome 10 Contains the
              IDE gene for insulin-degrading enzyme, the 5' end of the
              KIF11 gene for kinesin family member 11, a ribosomal
              protein L11 (RPL11) pseudogene and two CpG islands,
              complete sequence
          Length = 191935

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 11     caaggtgttggagcagct 28
              ||||||||||||||||||
Sbjct: 147723 caaggtgttggagcagct 147706



to top

>gb|AC165445.1| Mus musculus BAC clone RP23-10J16 from chromosome 17, complete sequence
          Length = 209118

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 11     caaggtgttggagcagct 28
              ||||||||||||||||||
Sbjct: 207135 caaggtgttggagcagct 207152



to top

>emb|CR858471.1| Pongo pygmaeus mRNA; cDNA DKFZp468I2311 (from clone DKFZp468I2311)
          Length = 689

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 130 caaggtgttggagcagct 147



to top

>gb|AC115889.13| Mus musculus chromosome 3, clone RP24-409N2, complete sequence
          Length = 166218

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 11    caaggtgttggagcagct 28
             ||||||||||||||||||
Sbjct: 85282 caaggtgttggagcagct 85265



to top

>emb|CR626653.1| full-length cDNA clone CS0DL001YE16 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 589

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 118 caaggtgttggagcagct 135



to top

>emb|CR625076.1| full-length cDNA clone CS0DL002YI20 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 572

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 94  caaggtgttggagcagct 111



to top

>emb|CR601780.1| full-length cDNA clone CS0CAP008YF02 of Thymus of Homo sapiens
          (human)
          Length = 488

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                            
Query: 11 caaggtgttggagcagct 28
          ||||||||||||||||||
Sbjct: 17 caaggtgttggagcagct 34



to top

>emb|CR597812.1| full-length cDNA clone CS0DI084YG07 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1974

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 101 caaggtgttggagcagct 118



to top

>emb|CR597577.1| full-length cDNA clone CS0DI024YH20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 585

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 114 caaggtgttggagcagct 131



to top

>gb|AF432212.1| Homo sapiens CLL-associated antigen KW-12 mRNA, partial cds
          Length = 579

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 107 caaggtgttggagcagct 124



to top

>gb|AY078021.1| Arabidopsis thaliana AT4g18730/F28A21_140 mRNA, complete cds
          Length = 549

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 108 caaggtgttggagcagct 125



to top

>dbj|AK153486.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830166I12 product:ribosomal
           protein L11, full insert sequence
          Length = 595

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 130 caaggtgttggagcagct 147



to top

>dbj|AK164445.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN full-length
           enriched library, clone:D230034M23 product:ribosomal
           protein L11, full insert sequence
          Length = 594

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 130 caaggtgttggagcagct 147



to top

>dbj|AK169053.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920077F13 product:ribosomal protein L11,
           full insert sequence
          Length = 595

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 130 caaggtgttggagcagct 147



to top

>dbj|AK013923.1| Mus musculus 13 days embryo head cDNA, RIKEN full-length enriched
           library, clone:3100002N06 product:hypothetical Ribosomal
           protein L5 containing protein, full insert sequence
          Length = 595

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 130 caaggtgttggagcagct 147



to top

>emb|X79234.1|HSRPL11 Homo sapiens mRNA for ribosomal protein L11
          Length = 591

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 111 caaggtgttggagcagct 128



to top

>dbj|AK088967.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430034A18
           product:ribosomal protein L11, cytosolic  homolog
           [Rattus norvegicus], full insert sequence
          Length = 591

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 134 caaggtgttggagcagct 151



to top

>dbj|AK002998.1| Mus musculus adult male brain cDNA, RIKEN full-length enriched
           library, clone:0710005K21 product:hypothetical Ribosomal
           protein L5 structure containing protein, full insert
           sequence
          Length = 589

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 132 caaggtgttggagcagct 149



to top

>gb|AF101385.3|HOMORPL2 Homo sapiens ribosomal protein L11 gene, complete cds
          Length = 5373

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 11   caaggtgttggagcagct 28
            ||||||||||||||||||
Sbjct: 1660 caaggtgttggagcagct 1677



to top

>dbj|AK008422.1| Mus musculus adult male small intestine cDNA, RIKEN full-length
           enriched library, clone:2010203J19 product:hypothetical
           Ribosomal protein L5 containing protein, full insert
           sequence
          Length = 596

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 131 caaggtgttggagcagct 148



to top

>gb|AF385722.1|AF385722 Arabidopsis thaliana AT4g18730/F28A21_140 mRNA, complete cds
          Length = 749

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 170 caaggtgttggagcagct 187



to top

>dbj|AK011800.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610102K11 product:60S RIBOSOMAL
           PROTEIN L11 homolog [Homo sapiens], full insert sequence
          Length = 594

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 129 caaggtgttggagcagct 146



to top

>dbj|AK014593.1| Mus musculus 0 day neonate skin cDNA, RIKEN full-length enriched
           library, clone:4632426C10 product:unclassifiable, full
           insert sequence
          Length = 2795

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 130 caaggtgttggagcagct 147



to top

>dbj|AK011211.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2600014G17 product:ribosomal
           protein L11, cytosolic  homolog [Rattus norvegicus],
           full insert sequence
          Length = 582

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 125 caaggtgttggagcagct 142



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 13      aggtgttggagcagctga 30
               ||||||||||||||||||
Sbjct: 6565151 aggtgttggagcagctga 6565168



to top

>gb|AC153849.8| Mus musculus  BAC RP23-97L11 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 205220

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 11    caaggtgttggagcagct 28
             ||||||||||||||||||
Sbjct: 82651 caaggtgttggagcagct 82668



to top

>gb|AY086211.1| Arabidopsis thaliana clone 22470 mRNA, complete sequence
          Length = 741

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 171 caaggtgttggagcagct 188



to top

>ref|XM_578503.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L11
           (LOC366494), mRNA
          Length = 534

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 111 caaggtgttggagcagct 128



to top

>gb|AY892917.1| Synthetic construct Homo sapiens clone FLH135007.01L ribosomal
           protein L11 (RPL11) mRNA, partial cds
          Length = 534

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 108 caaggtgttggagcagct 125



to top

>gb|AY890457.1| Synthetic construct Homo sapiens clone FLH135011.01X ribosomal
           protein L11 (RPL11) mRNA, complete cds
          Length = 534

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 108 caaggtgttggagcagct 125



to top

>emb|BX530725.11| Mouse DNA sequence from clone RP23-49E16 on chromosome 4, complete
             sequence
          Length = 80674

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 11    caaggtgttggagcagct 28
             ||||||||||||||||||
Sbjct: 25328 caaggtgttggagcagct 25311



to top

>emb|AL672186.7| Mouse DNA sequence from clone RP23-42G2 on chromosome X, complete
              sequence
          Length = 205757

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 11     caaggtgttggagcagct 28
              ||||||||||||||||||
Sbjct: 150694 caaggtgttggagcagct 150711



to top

>gb|BC069896.1| Mus musculus ribosomal protein L11, mRNA (cDNA clone MGC:78121
           IMAGE:6475559), complete cds
          Length = 613

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 112 caaggtgttggagcagct 129



to top

>gb|BC018970.2| Homo sapiens ribosomal protein L11, mRNA (cDNA clone MGC:19586
           IMAGE:4337066), complete cds
          Length = 611

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 115 caaggtgttggagcagct 132



to top

>gb|AC102377.14| Mus musculus chromosome 18, clone RP23-416I22, complete sequence
          Length = 188005

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 11    caaggtgttggagcagct 28
             ||||||||||||||||||
Sbjct: 39325 caaggtgttggagcagct 39342



to top

>gb|DQ206471.1| Platynereis dumerilii isolate TOA19 ribosomal protein 11 large
          subunit mRNA, partial cds
          Length = 220

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                            
Query: 11 caaggtgttggagcagct 28
          ||||||||||||||||||
Sbjct: 27 caaggtgttggagcagct 44



to top

>gb|BC097372.1| Rattus norvegicus ribosomal protein L11, mRNA (cDNA clone
           MGC:114407 IMAGE:7444187), complete cds
          Length = 935

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 447 caaggtgttggagcagct 464



to top

>ref|NM_001025739.1| Rattus norvegicus ribosomal protein L11 (Rpl11), mRNA
          Length = 935

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 447 caaggtgttggagcagct 464



to top

>gb|L05092.1|HUMRIBPROC Homo sapiens ribosomal protein L11 mRNA, complete cds
          Length = 582

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 114 caaggtgttggagcagct 131



to top

>dbj|AP004956.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT34I04, TM0133,
             complete sequence
          Length = 106411

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 11    caaggtgttggagcagct 28
             ||||||||||||||||||
Sbjct: 94207 caaggtgttggagcagct 94224



to top

>gb|M88489.1|MUSNBP Mus musculus nonamer binding protein mRNA, complete cds
          Length = 1674

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 11  caaggtgttggagcagct 28
           ||||||||||||||||||
Sbjct: 211 caaggtgttggagcagct 194



to top

>emb|AL606934.12| Mouse DNA sequence from clone RP23-138L21 on chromosome 4, complete
              sequence
          Length = 211580

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 11     caaggtgttggagcagct 28
              ||||||||||||||||||
Sbjct: 179471 caaggtgttggagcagct 179488



to top

>dbj|D16671.1|EGRMTC3SI Euglena gracilis mitochondrial mRNA for complex III subunit I,
           complete cds
          Length = 1572

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 12  aaggtgttggagcagctg 29
           ||||||||||||||||||
Sbjct: 861 aaggtgttggagcagctg 878



to top

>dbj|AB007171.1| Homo sapiens gene for ribosomal protein L11, partial cds
          Length = 187

 Score = 36.2 bits (18), Expect = 2.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                            
Query: 11 caaggtgttggagcagct 28
          ||||||||||||||||||
Sbjct: 63 caaggtgttggagcagct 80


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 137,934
Number of Sequences: 3902068
Number of extensions: 137934
Number of successful extensions: 31475
Number of sequences better than 10.0: 75
Number of HSP's better than 10.0 without gapping: 75
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 31379
Number of HSP's gapped (non-prelim): 96
length of query: 32
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 12
effective length of database: 17,155,003,908
effective search space: 205860046896
effective search space used: 205860046896
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top