>ref|XM_470010.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1794

 Score =  208 bits (105), Expect = 1e-50
 Identities = 207/240 (86%), Gaps = 1/240 (0%)
 Strand = Plus / Plus

                                                                        
Query: 22   ggcatgcacagcttgaccgatgttatcgctgggnatctcttttggcatcgtgatccttgc 81
            ||||||||||||||||  |||||||| |||||  |||| ||||||| | || ||||| ||
Sbjct: 886  ggcatgcacagcttgattgatgttattgctgg-catctgttttggcgttgtaatcctggc 944

                                                                        
Query: 82   attctggttggttgtccatgatcatgttgatgcctttgtcgtctctggccaaaacgttac 141
            ||||||||||| ||||||| ||||||| ||||| ||||| ||||| || ||||| |||||
Sbjct: 945  attctggttggctgtccataatcatgtcgatgcttttgttgtctccggtcaaaatgttac 1004

                                                                        
Query: 142  attcttctgggcaagccttgccctagtgctctgctttgcatatccaaagccagagttccc 201
            |  ||||||||| |||||| | ||  |||| ||||| ||||||||||| ||||| |||||
Sbjct: 1005 aaccttctgggcgagcctttctctgttgctgtgcttcgcatatccaaaaccagaattccc 1064

                                                                        
Query: 202  aactcctagctttgaattccacacagcattcaacggggtcgctttcggaattgtctatgg 261
            ||||||||||||||||| ||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 1065 aactcctagctttgaataccacacagcattcaatggggtggcttttggaattgtctatgg 1124



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 84/99 (84%)
 Strand = Plus / Plus

                                                                        
Query: 343  cgggagggtcctggtgggcatcccgaccatcctagccgtgaagtcctgcagcaaggcgct 402
            ||||||||| || ||||| ||||| ||||||||||  ||||| | |||||| || || ||
Sbjct: 1206 cgggagggttctcgtggggatcccaaccatcctagttgtgaaattctgcagtaaagctct 1265

                                                   
Query: 403  ctcgaaatggctcctgccggtcatgtgcagcaccctggg 441
            |||||||||||| || ||||| ||||||| |||||||||
Sbjct: 1266 ctcgaaatggcttctaccggtgatgtgcaacaccctggg 1304

>dbj|AK102189.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086P22, full
           insert sequence
          Length = 1698

 Score =  208 bits (105), Expect = 1e-50
 Identities = 207/240 (86%), Gaps = 1/240 (0%)
 Strand = Plus / Plus

                                                                       
Query: 22  ggcatgcacagcttgaccgatgttatcgctgggnatctcttttggcatcgtgatccttgc 81
           ||||||||||||||||  |||||||| |||||  |||| ||||||| | || ||||| ||
Sbjct: 746 ggcatgcacagcttgattgatgttattgctgg-catctgttttggcgttgtaatcctggc 804

                                                                       
Query: 82  attctggttggttgtccatgatcatgttgatgcctttgtcgtctctggccaaaacgttac 141
           ||||||||||| ||||||| ||||||| ||||| ||||| ||||| || ||||| |||||
Sbjct: 805 attctggttggctgtccataatcatgtcgatgcttttgttgtctccggtcaaaatgttac 864

                                                                       
Query: 142 attcttctgggcaagccttgccctagtgctctgctttgcatatccaaagccagagttccc 201
           |  ||||||||| |||||| | ||  |||| ||||| ||||||||||| ||||| |||||
Sbjct: 865 aaccttctgggcgagcctttctctgttgctgtgcttcgcatatccaaaaccagaattccc 924

                                                                       
Query: 202 aactcctagctttgaattccacacagcattcaacggggtcgctttcggaattgtctatgg 261
           ||||||||||||||||| ||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 925 aactcctagctttgaataccacacagcattcaatggggtggcttttggaattgtctatgg 984



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 84/99 (84%)
 Strand = Plus / Plus

                                                                        
Query: 343  cgggagggtcctggtgggcatcccgaccatcctagccgtgaagtcctgcagcaaggcgct 402
            ||||||||| || ||||| ||||| ||||||||||  ||||| | |||||| || || ||
Sbjct: 1066 cgggagggttctcgtggggatcccaaccatcctagttgtgaaattctgcagtaaagctct 1125

                                                   
Query: 403  ctcgaaatggctcctgccggtcatgtgcagcaccctggg 441
            |||||||||||| || ||||| ||||||| |||||||||
Sbjct: 1126 ctcgaaatggcttctaccggtgatgtgcaacaccctggg 1164

>dbj|AK071708.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023111M04, full
            insert sequence
          Length = 1796

 Score =  208 bits (105), Expect = 1e-50
 Identities = 207/240 (86%), Gaps = 1/240 (0%)
 Strand = Plus / Plus

                                                                        
Query: 22   ggcatgcacagcttgaccgatgttatcgctgggnatctcttttggcatcgtgatccttgc 81
            ||||||||||||||||  |||||||| |||||  |||| ||||||| | || ||||| ||
Sbjct: 888  ggcatgcacagcttgattgatgttattgctgg-catctgttttggcgttgtaatcctggc 946

                                                                        
Query: 82   attctggttggttgtccatgatcatgttgatgcctttgtcgtctctggccaaaacgttac 141
            ||||||||||| ||||||| ||||||| ||||| ||||| ||||| || ||||| |||||
Sbjct: 947  attctggttggctgtccataatcatgtcgatgcttttgttgtctccggtcaaaatgttac 1006

                                                                        
Query: 142  attcttctgggcaagccttgccctagtgctctgctttgcatatccaaagccagagttccc 201
            |  ||||||||| |||||| | ||  |||| ||||| ||||||||||| ||||| |||||
Sbjct: 1007 aaccttctgggcgagcctttctctgttgctgtgcttcgcatatccaaaaccagaattccc 1066

                                                                        
Query: 202  aactcctagctttgaattccacacagcattcaacggggtcgctttcggaattgtctatgg 261
            ||||||||||||||||| ||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 1067 aactcctagctttgaataccacacagcattcaatggggtggcttttggaattgtctatgg 1126



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 84/99 (84%)
 Strand = Plus / Plus

                                                                        
Query: 343  cgggagggtcctggtgggcatcccgaccatcctagccgtgaagtcctgcagcaaggcgct 402
            ||||||||| || ||||| ||||| ||||||||||  ||||| | |||||| || || ||
Sbjct: 1208 cgggagggttctcgtggggatcccaaccatcctagttgtgaaattctgcagtaaagctct 1267

                                                   
Query: 403  ctcgaaatggctcctgccggtcatgtgcagcaccctggg 441
            |||||||||||| || ||||| ||||||| |||||||||
Sbjct: 1268 ctcgaaatggcttctaccggtgatgtgcaacaccctggg 1306

>dbj|AK060174.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-H07, full
           insert sequence
          Length = 936

 Score =  208 bits (105), Expect = 1e-50
 Identities = 207/240 (86%), Gaps = 1/240 (0%)
 Strand = Plus / Plus

                                                                       
Query: 22  ggcatgcacagcttgaccgatgttatcgctgggnatctcttttggcatcgtgatccttgc 81
           ||||||||||||||||  |||||||| |||||  |||| ||||||| | || ||||| ||
Sbjct: 24  ggcatgcacagcttgattgatgttattgctgg-catctgttttggcgttgtaatcctggc 82

                                                                       
Query: 82  attctggttggttgtccatgatcatgttgatgcctttgtcgtctctggccaaaacgttac 141
           ||||||||||| ||||||| ||||||| ||||| ||||| ||||| || ||||| |||||
Sbjct: 83  attctggttggctgtccataatcatgtcgatgcttttgttgtctccggtcaaaatgttac 142

                                                                       
Query: 142 attcttctgggcaagccttgccctagtgctctgctttgcatatccaaagccagagttccc 201
           |  ||||||||| |||||| | ||  |||| ||||| ||||||||||| ||||| |||||
Sbjct: 143 aaccttctgggcgagcctttctctgttgctgtgcttcgcatatccaaaaccagaattccc 202

                                                                       
Query: 202 aactcctagctttgaattccacacagcattcaacggggtcgctttcggaattgtctatgg 261
           ||||||||||||||||| ||||||||||||||| ||||| ||||| ||||||||||||||
Sbjct: 203 aactcctagctttgaataccacacagcattcaatggggtggcttttggaattgtctatgg 262



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 84/99 (84%)
 Strand = Plus / Plus

                                                                       
Query: 343 cgggagggtcctggtgggcatcccgaccatcctagccgtgaagtcctgcagcaaggcgct 402
           ||||||||| || ||||| ||||| ||||||||||  ||||| | |||||| || || ||
Sbjct: 344 cgggagggttctcgtggggatcccaaccatcctagttgtgaaattctgcagtaaagctct 403

                                                  
Query: 403 ctcgaaatggctcctgccggtcatgtgcagcaccctggg 441
           |||||||||||| || ||||| ||||||| |||||||||
Sbjct: 404 ctcgaaatggcttctaccggtgatgtgcaacaccctggg 442

>gb|BT016586.1| Zea mays clone Contig419 mRNA sequence
          Length = 1548

 Score =  190 bits (96), Expect = 3e-45
 Identities = 252/303 (83%), Gaps = 1/303 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   ggcattgcgngggtatacctaggcatgcacagcttgaccgatgttatcgctgggnatctc 60
           ||||||||| || |||| || || ||||||||||||||||| ||| | |||||| ||   
Sbjct: 542 ggcattgcgaggatatatctgggtatgcacagcttgaccgacgttgttgctggg-attgg 600

                                                                       
Query: 61  ttttggcatcgtgatccttgcattctggttggttgtccatgatcatgttgatgcctttgt 120
           ||| |||| ||| ||||| ||||||||| ||| ||| ||||| ||||| || ||||||||
Sbjct: 601 tttcggcaccgtcatcctcgcattctggctggctgttcatgaccatgtcgacgcctttgt 660

                                                                       
Query: 121 cgtctctggccaaaacgttacattcttctgggcaagccttgccctagtgctctgctttgc 180
            ||||| || ||||||||| ||  |||||||||| ||||||| ||| || | ||||||||
Sbjct: 661 tgtctccgggcaaaacgttgcaaccttctgggcaggccttgcgctactgatgtgctttgc 720

                                                                       
Query: 181 atatccaaagccagagttcccaactcctagctttgaattccacacagcattcaacggggt 240
            ||||| |||||||| ||||| || || ||||||||||||||||||||||||||||||||
Sbjct: 721 gtatcccaagccagaattccctaccccgagctttgaattccacacagcattcaacggggt 780

                                                                       
Query: 241 cgctttcggaattgtctatggcgtccagcagacatacacccgtttccacggccccgacgc 300
           |||||||||||| || || ||| ||||||| || |||  ||  ||||||| ||| |||||
Sbjct: 781 cgctttcggaatcgtgtacggcatccagcaaacctacttccacttccacgccccggacgc 840

              
Query: 301 gcc 303
           |||
Sbjct: 841 gcc 843



 Score =  125 bits (63), Expect = 2e-25
 Identities = 120/139 (86%)
 Strand = Plus / Plus

                                                                        
Query: 330  tcctcgcgtacgccgggagggtcctggtgggcatcccgaccatcctagccgtgaagtcct 389
            ||||||||| ||| ||| | ||||| || || |||||||||||||| |||||||| || |
Sbjct: 870  tcctcgcgttcgcggggcgcgtcctcgtcgggatcccgaccatcctggccgtgaaatcgt 929

                                                                        
Query: 390  gcagcaaggcgctctcgaaatggctcctgccggtcatgtgcagcaccctggggatcccga 449
            |||||||||||||||| |  ||||| ||||| || ||||||||||||||||| ||||| |
Sbjct: 930  gcagcaaggcgctctccaggtggctgctgcccgtgatgtgcagcaccctgggcatcccca 989

                               
Query: 450  tcgtctcgtcctgctacgt 468
            |||| ||||||||||||||
Sbjct: 990  tcgtgtcgtcctgctacgt 1008

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  117 bits (59), Expect = 4e-23
 Identities = 98/111 (88%)
 Strand = Plus / Minus

                                                                            
Query: 145      cttctgggcaagccttgccctagtgctctgctttgcatatccaaagccagagttcccaac 204
                ||||||||| |||||| | ||  |||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 33324506 cttctgggcgagcctttctctgttgctgtgcttcgcatatccaaaaccagaattcccaac 33324447

                                                                   
Query: 205      tcctagctttgaattccacacagcattcaacggggtcgctttcggaattgt 255
                |||||||||||||| ||||||||||||||| ||||| ||||| ||||||||
Sbjct: 33324446 tcctagctttgaataccacacagcattcaatggggtggcttttggaattgt 33324396



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 97/114 (85%), Gaps = 1/114 (0%)
 Strand = Plus / Minus

                                                                            
Query: 22       ggcatgcacagcttgaccgatgttatcgctgggnatctcttttggcatcgtgatccttgc 81
                ||||||||||||||||  |||||||| |||||  |||| ||||||| | || ||||| ||
Sbjct: 33324711 ggcatgcacagcttgattgatgttattgctgg-catctgttttggcgttgtaatcctggc 33324653

                                                                      
Query: 82       attctggttggttgtccatgatcatgttgatgcctttgtcgtctctggccaaaa 135
                ||||||||||| ||||||| ||||||| ||||| ||||| ||||| || |||||
Sbjct: 33324652 attctggttggctgtccataatcatgtcgatgcttttgttgtctccggtcaaaa 33324599



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                            
Query: 343      cgggagggtcctggtgggcatcccgaccatcctagccgtgaagtcctgcagcaaggcgct 402
                ||||||||| || ||||| ||||| ||||||||||  ||||| | |||||| || || ||
Sbjct: 33324082 cgggagggttctcgtggggatcccaaccatcctagttgtgaaattctgcagtaaagctct 33324023

                                                       
Query: 403      ctcgaaatggctcctgccggtcatgtgcagcaccctggg 441
                |||||||||||| || ||||| ||||||| |||||||||
Sbjct: 33324022 ctcgaaatggcttctaccggtgatgtgcaacaccctggg 33323984

>gb|AC135563.5| Oryza sativa chromosome 3 BAC OSJNBb0015I02 genomic sequence, complete
             sequence
          Length = 122815

 Score =  117 bits (59), Expect = 4e-23
 Identities = 98/111 (88%)
 Strand = Plus / Minus

                                                                         
Query: 145   cttctgggcaagccttgccctagtgctctgctttgcatatccaaagccagagttcccaac 204
             ||||||||| |||||| | ||  |||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 81022 cttctgggcgagcctttctctgttgctgtgcttcgcatatccaaaaccagaattcccaac 80963

                                                                
Query: 205   tcctagctttgaattccacacagcattcaacggggtcgctttcggaattgt 255
             |||||||||||||| ||||||||||||||| ||||| ||||| ||||||||
Sbjct: 80962 tcctagctttgaataccacacagcattcaatggggtggcttttggaattgt 80912



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 97/114 (85%), Gaps = 1/114 (0%)
 Strand = Plus / Minus

                                                                         
Query: 22    ggcatgcacagcttgaccgatgttatcgctgggnatctcttttggcatcgtgatccttgc 81
             ||||||||||||||||  |||||||| |||||  |||| ||||||| | || ||||| ||
Sbjct: 81227 ggcatgcacagcttgattgatgttattgctgg-catctgttttggcgttgtaatcctggc 81169

                                                                   
Query: 82    attctggttggttgtccatgatcatgttgatgcctttgtcgtctctggccaaaa 135
             ||||||||||| ||||||| ||||||| ||||| ||||| ||||| || |||||
Sbjct: 81168 attctggttggctgtccataatcatgtcgatgcttttgttgtctccggtcaaaa 81115



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                         
Query: 343   cgggagggtcctggtgggcatcccgaccatcctagccgtgaagtcctgcagcaaggcgct 402
             ||||||||| || ||||| ||||| ||||||||||  ||||| | |||||| || || ||
Sbjct: 80598 cgggagggttctcgtggggatcccaaccatcctagttgtgaaattctgcagtaaagctct 80539

                                                    
Query: 403   ctcgaaatggctcctgccggtcatgtgcagcaccctggg 441
             |||||||||||| || ||||| ||||||| |||||||||
Sbjct: 80538 ctcgaaatggcttctaccggtgatgtgcaacaccctggg 80500

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  117 bits (59), Expect = 4e-23
 Identities = 98/111 (88%)
 Strand = Plus / Minus

                                                                            
Query: 145      cttctgggcaagccttgccctagtgctctgctttgcatatccaaagccagagttcccaac 204
                ||||||||| |||||| | ||  |||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 33415016 cttctgggcgagcctttctctgttgctgtgcttcgcatatccaaaaccagaattcccaac 33414957

                                                                   
Query: 205      tcctagctttgaattccacacagcattcaacggggtcgctttcggaattgt 255
                |||||||||||||| ||||||||||||||| ||||| ||||| ||||||||
Sbjct: 33414956 tcctagctttgaataccacacagcattcaatggggtggcttttggaattgt 33414906



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 97/114 (85%), Gaps = 1/114 (0%)
 Strand = Plus / Minus

                                                                            
Query: 22       ggcatgcacagcttgaccgatgttatcgctgggnatctcttttggcatcgtgatccttgc 81
                ||||||||||||||||  |||||||| |||||  |||| ||||||| | || ||||| ||
Sbjct: 33415221 ggcatgcacagcttgattgatgttattgctgg-catctgttttggcgttgtaatcctggc 33415163

                                                                      
Query: 82       attctggttggttgtccatgatcatgttgatgcctttgtcgtctctggccaaaa 135
                ||||||||||| ||||||| ||||||| ||||| ||||| ||||| || |||||
Sbjct: 33415162 attctggttggctgtccataatcatgtcgatgcttttgttgtctccggtcaaaa 33415109



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 84/99 (84%)
 Strand = Plus / Minus

                                                                            
Query: 343      cgggagggtcctggtgggcatcccgaccatcctagccgtgaagtcctgcagcaaggcgct 402
                ||||||||| || ||||| ||||| ||||||||||  ||||| | |||||| || || ||
Sbjct: 33414592 cgggagggttctcgtggggatcccaaccatcctagttgtgaaattctgcagtaaagctct 33414533

                                                       
Query: 403      ctcgaaatggctcctgccggtcatgtgcagcaccctggg 441
                |||||||||||| || ||||| ||||||| |||||||||
Sbjct: 33414532 ctcgaaatggcttctaccggtgatgtgcaacaccctggg 33414494

>ref|NM_115711.2| Arabidopsis thaliana phosphoric ester hydrolase AT3G58490 mRNA,
           complete cds
          Length = 1295

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 199 cccaactcctagctttgaattccacacagcattcaacggggt 240
           ||||||||||||||  || | ||||||||| |||||||||||
Sbjct: 783 cccaactcctagctacgagtaccacacagccttcaacggggt 824

>gb|AC142211.3| Mus musculus BAC clone RP24-501B23 from chromosome 8, complete sequence
          Length = 175636

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 426   tgtgcagcaccctggggatccc 447
             ||||||||||||||||||||||
Sbjct: 24906 tgtgcagcaccctggggatccc 24885

>emb|AL137082.1|ATF14P22 Arabidopsis thaliana DNA chromosome 3, BAC clone F14P22
          Length = 94239

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                       
Query: 199   cccaactcctagctttgaattccacacagcattcaacggggt 240
             ||||||||||||||  || | ||||||||| |||||||||||
Sbjct: 27997 cccaactcctagctacgagtaccacacagccttcaacggggt 28038

>dbj|AB239190.1| Arabidopsis thaliana AtSPP1 mRNA for sphingosine-1-phosphate
           phosphatase, complete cds
          Length = 1251

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 199 cccaactcctagctttgaattccacacagcattcaacggggt 240
           ||||||||||||||  || | ||||||||| |||||||||||
Sbjct: 783 cccaactcctagctacgagtaccacacagccttcaacggggt 824

>gb|AC163288.4| Mus musculus BAC clone RP23-279M5 from chromosome 8, complete sequence
          Length = 222867

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 426    tgtgcagcaccctggggatccc 447
              ||||||||||||||||||||||
Sbjct: 129837 tgtgcagcaccctggggatccc 129816

>ref|XM_960869.1| Encephalitozoon cuniculi GB-M1 hypothetical protein (ECU01_1240)
           partial mRNA
          Length = 1803

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 139 tacattcttctgggcaagcct 159
           |||||||||||||||||||||
Sbjct: 133 tacattcttctgggcaagcct 153

>emb|AL391737.2|CNS06C8G chromosome I of strain GB-M1 of Encephalitozoon cuniculi (Microspora)
          Length = 209982

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 139    tacattcttctgggcaagcct 159
              |||||||||||||||||||||
Sbjct: 149136 tacattcttctgggcaagcct 149156

>emb|AL596088.14| Mouse DNA sequence from clone RP23-157O10 on chromosome 11, complete
              sequence
          Length = 233204

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 344    gggagggtcctggtgggcatc 364
              |||||||||||||||||||||
Sbjct: 121094 gggagggtcctggtgggcatc 121074

>ref|XM_465002.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1441

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 289 cggccccgacgcgcccctcattctgagc 316
           |||||||||||||||| |||| ||||||
Sbjct: 377 cggccccgacgcgcccgtcatcctgagc 404

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 295    cgacgcgcccctcattctga 314
              ||||||||||||||||||||
Sbjct: 999769 cgacgcgcccctcattctga 999750

>ref|XM_505512.1| Yarrowia lipolytica CLIB122, YALI0F16896g predicted mRNA
          Length = 1497

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 478 gaagccgtcaaacagcagctcggg 501
           ||||||| ||||||||||||||||
Sbjct: 345 gaagccggcaaacagcagctcggg 322

>emb|AL732594.5| Mouse DNA sequence from clone RP24-189G18 on chromosome 4 Contains the
             Prpf4 gene for PRP4 pre-mRNA processing factor 4 homolog
             (yeast), three novel genes, the Bspry gene for B-box and
             SPRY domain containing protein, the Alad gene for delta
             aminolevulinate dehydratase, the Pole3 gene for polymerase
             (DNA directed) epsilon 3 (p17 subunit) and three CpG
             islands, complete sequence
          Length = 145776

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 110   gatgcctttgtcgtctctgg 129
             ||||||||||||||||||||
Sbjct: 85217 gatgcctttgtcgtctctgg 85236

>gb|AC183494.1| Brassica oleracea Contig C, complete sequence
          Length = 285752

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 500    ggcgacaagccggacgatgc 519
              ||||||||||||||||||||
Sbjct: 108159 ggcgacaagccggacgatgc 108178

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 289      cggccccgacgcgcccctcattctgagc 316
                |||||||||||||||| |||| ||||||
Sbjct: 10861584 cggccccgacgcgcccgtcatcctgagc 10861557

>gb|AC009490.10| Homo sapiens BAC clone RP11-355A23 from 2, complete sequence
          Length = 158692

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   ctttgaattccacacagcat 230
             ||||||||||||||||||||
Sbjct: 95736 ctttgaattccacacagcat 95717

>dbj|AP004168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1756_H07
          Length = 217205

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 289   cggccccgacgcgcccctcattctgagc 316
             |||||||||||||||| |||| ||||||
Sbjct: 67783 cggccccgacgcgcccgtcatcctgagc 67756

>dbj|AK109705.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-145-G04, full
           insert sequence
          Length = 1441

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 289 cggccccgacgcgcccctcattctgagc 316
           |||||||||||||||| |||| ||||||
Sbjct: 377 cggccccgacgcgcccgtcatcctgagc 404

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 478     gaagccgtcaaacagcagctcggg 501
               ||||||| ||||||||||||||||
Sbjct: 2261914 gaagccggcaaacagcagctcggg 2261937


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,168,605
Number of Sequences: 3902068
Number of extensions: 3168605
Number of successful extensions: 54503
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 54370
Number of HSP's gapped (non-prelim): 125
length of query: 541
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 518
effective length of database: 17,143,297,704
effective search space: 8880228210672
effective search space used: 8880228210672
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)