>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome
          Length = 2467205

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 99   gccgaggtgcaggtcggggc 118
            ||||||||||||||||||||
Sbjct: 7363 gccgaggtgcaggtcggggc 7382

>gb|CP000092.1| Ralstonia eutropha JMP134 megaplasmid, complete sequence
          Length = 634917

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 17     gggagcgagcagtgagggag 36
              ||||||||||||||||||||
Sbjct: 412243 gggagcgagcagtgagggag 412262

>gb|AE006470.1| Chlorobium tepidum TLS, complete genome
          Length = 2154946

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 99     gccgaggtgcaggtcggggc 118
              ||||||||||||||||||||
Sbjct: 571537 gccgaggtgcaggtcggggc 571556

>emb|AL939130.1|SCO939130 Streptomyces coelicolor A3(2) complete genome; segment 27/29
          Length = 303450

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 108    caggtcggggctcaccatgggagc 131
              |||||||| |||||||||||||||
Sbjct: 132365 caggtcggcgctcaccatgggagc 132388

>ref|XM_368066.1| Magnaporthe grisea 70-15 chromosome III predicted protein
           (MG07970.4) partial mRNA
          Length = 1470

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 108 caggtcggggctcaccatg 126
           |||||||||||||||||||
Sbjct: 693 caggtcggggctcaccatg 675

>gb|AC154647.2| Mus musculus BAC clone RP23-283P8 from chromosome 17, complete sequence
          Length = 208252

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 15     tggggagcgagcagtgagggagg 37
              ||||||| |||||||||||||||
Sbjct: 128334 tggggagtgagcagtgagggagg 128356



 Score = 38.2 bits (19), Expect = 7.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 15   tggggagcgagcagtgagggagg 37
            |||||||| ||||||||||||||
Sbjct: 4945 tggggagcaagcagtgagggagg 4967

>emb|AL672114.1|MLO672114 Mesorhizobium loti R7A symbiosis island; segment 3/4
          Length = 149050

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 101    cgaggtgcaggtcggggct 119
              |||||||||||||||||||
Sbjct: 140018 cgaggtgcaggtcggggct 140000

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 89      ccacgcccatgccgaggtg 107
               |||||||||||||||||||
Sbjct: 4439964 ccacgcccatgccgaggtg 4439982

>gb|AF311738.1|AF311738 Mesorhizobium loti NifA (nifA) gene, complete cds; nicotinic acid
            mononucleotide biosynthetic operon and biotin
            biosynthetic operon; complete sequence; PanD (panD) gene,
            complete cds; and unknown genes
          Length = 13200

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 101  cgaggtgcaggtcggggct 119
            |||||||||||||||||||
Sbjct: 4817 cgaggtgcaggtcggggct 4799

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 101     cgaggtgcaggtcggggct 119
               |||||||||||||||||||
Sbjct: 4707566 cgaggtgcaggtcggggct 4707584

>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 100     ccgaggtgcaggtcggggc 118
               |||||||||||||||||||
Sbjct: 2644436 ccgaggtgcaggtcggggc 2644418


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 788,187
Number of Sequences: 3902068
Number of extensions: 788187
Number of successful extensions: 53309
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 52996
Number of HSP's gapped (non-prelim): 313
length of query: 148
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 127
effective length of database: 17,151,101,840
effective search space: 2178189933680
effective search space used: 2178189933680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)