| Clone Name | basdp12 |
|---|---|
| Clone Library Name | barley_pub |
>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome Length = 2467205 Score = 40.1 bits (20), Expect = 1.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 99 gccgaggtgcaggtcggggc 118 |||||||||||||||||||| Sbjct: 7363 gccgaggtgcaggtcggggc 7382
>gb|CP000092.1| Ralstonia eutropha JMP134 megaplasmid, complete sequence Length = 634917 Score = 40.1 bits (20), Expect = 1.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 gggagcgagcagtgagggag 36 |||||||||||||||||||| Sbjct: 412243 gggagcgagcagtgagggag 412262
>gb|AE006470.1| Chlorobium tepidum TLS, complete genome Length = 2154946 Score = 40.1 bits (20), Expect = 1.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 99 gccgaggtgcaggtcggggc 118 |||||||||||||||||||| Sbjct: 571537 gccgaggtgcaggtcggggc 571556
>emb|AL939130.1|SCO939130 Streptomyces coelicolor A3(2) complete genome; segment 27/29 Length = 303450 Score = 40.1 bits (20), Expect = 1.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 108 caggtcggggctcaccatgggagc 131 |||||||| ||||||||||||||| Sbjct: 132365 caggtcggcgctcaccatgggagc 132388
>ref|XM_368066.1| Magnaporthe grisea 70-15 chromosome III predicted protein (MG07970.4) partial mRNA Length = 1470 Score = 38.2 bits (19), Expect = 7.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 108 caggtcggggctcaccatg 126 ||||||||||||||||||| Sbjct: 693 caggtcggggctcaccatg 675
>gb|AC154647.2| Mus musculus BAC clone RP23-283P8 from chromosome 17, complete sequence Length = 208252 Score = 38.2 bits (19), Expect = 7.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tggggagcgagcagtgagggagg 37 ||||||| ||||||||||||||| Sbjct: 128334 tggggagtgagcagtgagggagg 128356 Score = 38.2 bits (19), Expect = 7.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tggggagcgagcagtgagggagg 37 |||||||| |||||||||||||| Sbjct: 4945 tggggagcaagcagtgagggagg 4967
>emb|AL672114.1|MLO672114 Mesorhizobium loti R7A symbiosis island; segment 3/4 Length = 149050 Score = 38.2 bits (19), Expect = 7.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 101 cgaggtgcaggtcggggct 119 ||||||||||||||||||| Sbjct: 140018 cgaggtgcaggtcggggct 140000
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 38.2 bits (19), Expect = 7.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 89 ccacgcccatgccgaggtg 107 ||||||||||||||||||| Sbjct: 4439964 ccacgcccatgccgaggtg 4439982
>gb|AF311738.1|AF311738 Mesorhizobium loti NifA (nifA) gene, complete cds; nicotinic acid mononucleotide biosynthetic operon and biotin biosynthetic operon; complete sequence; PanD (panD) gene, complete cds; and unknown genes Length = 13200 Score = 38.2 bits (19), Expect = 7.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 101 cgaggtgcaggtcggggct 119 ||||||||||||||||||| Sbjct: 4817 cgaggtgcaggtcggggct 4799
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 38.2 bits (19), Expect = 7.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 101 cgaggtgcaggtcggggct 119 ||||||||||||||||||| Sbjct: 4707566 cgaggtgcaggtcggggct 4707584
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence Length = 2648638 Score = 38.2 bits (19), Expect = 7.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 100 ccgaggtgcaggtcggggc 118 ||||||||||||||||||| Sbjct: 2644436 ccgaggtgcaggtcggggc 2644418 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 788,187 Number of Sequences: 3902068 Number of extensions: 788187 Number of successful extensions: 53309 Number of sequences better than 10.0: 11 Number of HSP's better than 10.0 without gapping: 11 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 52996 Number of HSP's gapped (non-prelim): 313 length of query: 148 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 127 effective length of database: 17,151,101,840 effective search space: 2178189933680 effective search space used: 2178189933680 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)