Clone Name | basdj24 |
---|---|
Clone Library Name | barley_pub |
>gb|AC146424.3| Pan troglodytes BAC clone RP43-26H22 from 7, complete sequence Length = 195194 Score = 44.1 bits (22), Expect = 0.100 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 ttgcccttctgtctactcctgt 90 |||||||||||||||||||||| Sbjct: 75114 ttgcccttctgtctactcctgt 75093
>gb|AC145771.1| Pan troglodytes BAC clone RP43-14A5 from 7, complete sequence Length = 155040 Score = 44.1 bits (22), Expect = 0.100 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 ttgcccttctgtctactcctgt 90 |||||||||||||||||||||| Sbjct: 154842 ttgcccttctgtctactcctgt 154821
>gb|AC131725.2| Mus musculus BAC clone RP23-129H16 from chromosome 5, complete sequence Length = 203437 Score = 40.1 bits (20), Expect = 1.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 69 ttgcccttctgtctactcctgttg 92 ||||||||||||||||| |||||| Sbjct: 199946 ttgcccttctgtctactgctgttg 199923
>gb|AC166347.2| Mus musculus BAC clone RP24-87G12 from chromosome 6, complete sequence Length = 193181 Score = 40.1 bits (20), Expect = 1.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 82 tactcctgttgctgctcgtcagcc 105 ||||||||||||||||| |||||| Sbjct: 112854 tactcctgttgctgctcctcagcc 112877
>gb|AC161570.6| Mus musculus chromosome 5, clone RP23-36O9, complete sequence Length = 228402 Score = 40.1 bits (20), Expect = 1.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 69 ttgcccttctgtctactcctgttg 92 ||||||||||||||||| |||||| Sbjct: 144376 ttgcccttctgtctactgctgttg 144353
>gb|AC141891.3| Mus musculus BAC clone RP23-378A8 from 6, complete sequence Length = 152261 Score = 40.1 bits (20), Expect = 1.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 82 tactcctgttgctgctcgtcagcc 105 ||||||||||||||||| |||||| Sbjct: 47820 tactcctgttgctgctcctcagcc 47797
>gb|U37008.1|MXU37008 Myxococcus xanthus socD (socD500 allele) and kefC genes, complete cds Length = 3780 Score = 40.1 bits (20), Expect = 1.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 85 tcctgttgctgctcgtcagcctgg 108 ||||||||||| |||||||||||| Sbjct: 2090 tcctgttgctgttcgtcagcctgg 2113
>ref|XM_979488.1| PREDICTED: Mus musculus similar to alpha 3 type VI collagen isoform 1 precursor (LOC675101), mRNA Length = 2130 Score = 38.2 bits (19), Expect = 6.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 91 tgctgctcgtcagcctggg 109 ||||||||||||||||||| Sbjct: 1532 tgctgctcgtcagcctggg 1550
>gb|AC121826.3| Mus musculus BAC clone RP23-470O13 from chromosome 3, complete sequence Length = 187184 Score = 38.2 bits (19), Expect = 6.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 52 tgggcttaggactgagatt 70 ||||||||||||||||||| Sbjct: 46270 tgggcttaggactgagatt 46288
>ref|XM_696282.1| PREDICTED: Danio rerio similar to cryopyrin isoform b (LOC572555), partial mRNA Length = 2768 Score = 38.2 bits (19), Expect = 6.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 62 actgagattgcccttctgt 80 ||||||||||||||||||| Sbjct: 2415 actgagattgcccttctgt 2433
>dbj|AP003067.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-397P10, complete sequence Length = 190381 Score = 38.2 bits (19), Expect = 6.2 Identities = 19/19 (100%) Strand = Plus / Minus Query: 63 ctgagattgcccttctgtc 81 ||||||||||||||||||| Sbjct: 83049 ctgagattgcccttctgtc 83031
>gb|AC171642.3| Rhesus Macaque BAC CH250-405K12 (Children's Hospital Oakland Research Institute Rhesus macaque Adult Male BAC Library) complete sequence Length = 138125 Score = 38.2 bits (19), Expect = 6.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 64 tgagattgcccttctgtct 82 ||||||||||||||||||| Sbjct: 136212 tgagattgcccttctgtct 136230 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 680,281 Number of Sequences: 3902068 Number of extensions: 680281 Number of successful extensions: 42134 Number of sequences better than 10.0: 12 Number of HSP's better than 10.0 without gapping: 12 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 42118 Number of HSP's gapped (non-prelim): 16 length of query: 131 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 110 effective length of database: 17,151,101,840 effective search space: 1886621202400 effective search space used: 1886621202400 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)