ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name basdi11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|D01000.1|RICSODB Oryza sativa mRNA for copper/zinc-superoxid... 238 1e-59
2gb|AY109448.1| Zea mays CL1415_1 mRNA sequence 236 4e-59
3gb|BT017337.1| Zea mays clone EL01N0321D04.c mRNA sequence 220 2e-54
4emb|X17565.1|ZMSOD4 Zea mays mRNA for superoxide dismutase-4AP (... 212 6e-52
5emb|X17564.1|ZMSOD4A Zea mays mRNA for superoxide dismutase-4A (... 196 3e-47
6ref|NM_186073.1| Oryza sativa (japonica cultivar-group), mRNA 176 3e-41
7gb|AY103754.1| Zea mays PCO107770 mRNA sequence 176 3e-41
8gb|M15175.1|MZESOD2A Maize superoxide dismutase 2 (SOD2) mRNA, c... 168 7e-39
9gb|M54936.1|MZESOD2 Maize superoxide dismutase-2 (Sod-2) mRNA, c... 168 7e-39
10dbj|AK120692.1| Oryza sativa (japonica cultivar-group) cDNA clon... 139 7e-30
11dbj|AK061662.1| Oryza sativa (japonica cultivar-group) cDNA clon... 139 7e-30
12dbj|D00999.1|RICSODA Oryza sativa mRNA for copper/zinc-superoxid... 139 7e-30
13gb|DQ058108.1| Oryza sativa (indica cultivar-group) cytoplasmic ... 131 2e-27
14gb|L36320.1|RICSOXDM Oryza sativa (clone cu101) superoxide dismu... 131 2e-27
15emb|AJ250667.1|ACO250667 Ananas comosus mRNA for copper/zinc-sup... 111 2e-21
16gb|AF479059.1| Sandersonia aurantiaca copper/zinc superoxide dis... 105 9e-20
17dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 105 9e-20
18dbj|AP003825.3| Oryza sativa (japonica cultivar-group) genomic D... 105 9e-20
19dbj|AP004274.5| Oryza sativa (japonica cultivar-group) genomic D... 105 9e-20
20gb|L19434.1|RICSODCC2A Oryza sativa cytosolic copper/zinc-supero... 105 9e-20
21gb|L32834.1|ASNCZSD Aspergillus japonicus (clone Assod4-g) coppe... 105 9e-20
22gb|AY646367.1| Malus xiaojinensis superoxide dismutase (Sod1) mR... 96 9e-17
23gb|AF037359.1|AF037359 Paulownia kawakamii superoxide dismutase ... 96 9e-17
24gb|AF009735.1| Raphanus sativus Cu/Zn superoxide dismutase (SOD)... 92 1e-15
25gb|AF328859.1| Avicennia marina Cu-Zn superoxide dismutase mRNA,... 90 6e-15
26gb|U34726.1|ZMU34726 Zea mays superoxide dismutase 4 (sod4) gene... 88 2e-14
27emb|AJ844003.1| Plantago major mRNA for copper-zinc superoxide d... 86 9e-14
28gb|U34727.1|ZMU34727 Zea mays superoxide dismutase 4A (sod4A) ge... 86 9e-14
29dbj|AB062752.1| Bruguiera gymnorhiza SodC mRNA for copper/zinc s... 86 9e-14
30gb|DQ078121.2| Rheum australe copper/zinc superoxide dismutase m... 84 3e-13
31gb|AF426829.1|AF426829 Olea europaea Cu/Zn-superoxide dismutase ... 82 1e-12
32emb|Y13610.1|CPCZSD Carica papaya mRNA for copper/zinc-superoxid... 80 5e-12
33gb|DQ088818.1| Gossypium hirsutum cytoplasmic Cu/ZnSOD mRNA, com... 78 2e-11
34emb|AJ428575.2|OEU428575 Olea europaea Cu/Zn super-oxide dismuta... 78 2e-11
35emb|AJ278669.1|PTR278669 Populus tremula x Populus tremuloides m... 78 2e-11
36dbj|AB190501.1| Populus alba x Populus tremula var. glandulosa C... 78 2e-11
37dbj|AB190500.1| Populus alba x Populus tremula var. glandulosa C... 78 2e-11
38dbj|AB091055.1| Barbula unguiculata mRNA for cytosolic copper/zi... 78 2e-11
39gb|AF016892.1|AF016892 Populus tremuloides cytoplasmic superoxid... 78 2e-11
40gb|U80069.1|MCU80069 Mesembryanthemum crystallinum cytosolic cop... 78 2e-11
41emb|X95728.1|BJMSOD1GE B.juncea mRNA for Cu/Zn-superoxide dismutase 76 8e-11
42gb|AF071112.1|AF071112 Brassica rapa ssp. pekinensis cytosolic C... 76 8e-11
43gb|AF054150.1|AF054150 Zantedeschia aethiopica cytosolic Cu/Zn-s... 74 3e-10
44ref|NM_100757.2| Arabidopsis thaliana CSD1; copper, zinc superox... 72 1e-09
45gb|DQ227345.1| Nelumbo nucifera isolate 0 copper-zinc superoxide... 72 1e-09
46gb|DQ481231.1| Populus suaveolens cytoplasmic Cu/Zn-superoxide d... 72 1e-09
47gb|AY091168.1| Arabidopsis thaliana putative superoxide dismutas... 72 1e-09
48gb|AY050932.1| Arabidopsis thaliana putative superoxidase dismut... 72 1e-09
49emb|X60935.1|ATCZSUDI A.thaliana mRNA for Cu,Zn superoxide dismu... 72 1e-09
50emb|X55974.1|NPSODM N.plumbaginifolia mRNA for superoxide dismutase 72 1e-09
51emb|BX818158.1|CNS0AE2K Arabidopsis thaliana Full-length cDNA Co... 72 1e-09
52gb|AY087273.1| Arabidopsis thaliana clone 33493 mRNA, complete s... 72 1e-09
53gb|AY881163.1| Nelumbo nucifera isolate 13 copper-zinc superoxid... 72 1e-09
54gb|AY881162.1| Nelumbo nucifera isolate 11 copper-zinc superoxid... 72 1e-09
55gb|AY881155.1| Nelumbo nucifera isolate 4 copper-zinc superoxide... 72 1e-09
56emb|AJ844861.1| Drosophila bipectinata partial Sod gene, exons 1... 70 5e-09
57emb|AJ844854.1| Drosophila malerkotliana pallens partial Sod gen... 70 5e-09
58emb|AJ844850.1| Drosophila bipectinata partial Sod gene, exons 1... 70 5e-09
59emb|AJ844844.1| Drosophila malerkotliana malerkotliana partial S... 70 5e-09
60gb|AY694187.1| Camellia sinensis Cu/Zn superoxide dismutase mRNA... 68 2e-08
61gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 68 2e-08
62gb|AC135257.1| Genomic sequence for Oryza sativa, Nipponbare str... 68 2e-08
63emb|X53872.1|SOSODCY Spinacia oleracea mRNA for cytosolic copper... 68 2e-08
64emb|AJ844862.1| Drosophila bipectinata partial Sod gene, exons 1... 68 2e-08
65dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 68 2e-08
66gb|L19435.1|RICSODCC Oryza sativa cytosolic copper/zinc-superoxi... 68 2e-08
67gb|AY642137.1| Manihot esculenta copper/zinc superoxide dismutas... 66 8e-08
68gb|DQ124227.1| Fagus sylvatica putative copper/zinc-superoxide d... 64 3e-07
69emb|AJ586519.1| Fagus sylvatica partial sod1 mRNA for superoxide... 64 3e-07
70emb|BX816203.1|CNS0AE91 Arabidopsis thaliana Full-length cDNA Co... 64 3e-07
71gb|AF016893.1|AF016893 Populus tremuloides copper/zinc-superoxid... 64 3e-07
72emb|AJ844865.1| Drosophila parabipectinata partial Sod gene, exo... 62 1e-06
73emb|AJ844860.1| Drosophila bipectinata partial Sod gene, exons 1... 62 1e-06
74emb|AJ844859.1| Drosophila bipectinata partial Sod gene, exons 1... 62 1e-06
75emb|AJ844855.1| Drosophila malerkotliana pallens partial Sod gen... 62 1e-06
76emb|AJ844839.1| Drosophila malerkotliana malerkotliana partial S... 62 1e-06
77gb|AF355460.1|AF355460 Solanum tuberosum Cu/Zn-superoxide dismut... 62 1e-06
78gb|AF354748.1|AF354748 Solanum tuberosum copper-zinc superoxide ... 62 1e-06
79gb|AF009734.1|AF009734 Capsicum annuum Cu/Zn superoxide dismutas... 62 1e-06
80gb|AC003981.2|AC003981 Genomic sequence for Arabidopsis thaliana... 60 5e-06
81gb|AF034630.1|AF034630 Panax ginseng Cu/Zn superoxide dismutase ... 60 5e-06
82gb|AF540558.1| Brassica juncea clone SOD 8A superoxide dismutase... 58 2e-05
83gb|AF170297.1|AF170297 Manihot esculenta copper/zinc-superoxide ... 58 2e-05
84gb|AY833718.1| Codonopsis lanceolata CuZn superoxide dismutase (... 56 8e-05
85gb|DQ178940.1| Cucumis sativus Cu/Zn superoxide dismutase 1 mRNA... 56 8e-05
86emb|X95726.1|BJMSOD2GE B.juncea mRNA for Cu/Zn-superoxide dismutase 56 8e-05
87gb|AF127156.1| Drosophila erecta Cu-Zn superoxide dismutase (Sod... 56 8e-05
88gb|AF021825.1|AF021825 Drosophila immigrans superoxide dismutase... 56 8e-05
89gb|U47868.1|DAU47868 Drosophila ambigua NDSSC 14011-0091.1 Cu,Zn... 56 8e-05
90emb|X14040.1|LECYTSOD Tomato mRNA for cytoplasmic Cu-Zn superoxi... 54 3e-04
91gb|AF191342.1| Olea europaea copper/zinc superoxide dismutase (S... 54 3e-04
92gb|AY257198.1| Lotus corniculatus var. japonicus cytosolic CuZn-... 54 3e-04
93gb|U37714.1|DHU37714 Drosophila hydei Cu,Zn superoxide dismutase... 54 3e-04
94gb|M37150.1|TOMSODA Tomato superoxide dismutase (SOD) mRNA, comp... 54 3e-04
95gb|DQ499511.1| Arachis hypogaea cultivar JL-24 Cu-Zn superoxide ... 52 0.001
96emb|X73139.1|IBSOD I.batatas mRNA for superoxide dismutase 52 0.001
97emb|AJ278671.1|PTR278671 Populus tremula x Populus tremuloides m... 52 0.001
98emb|AJ278670.1|PTR278670 Populus tremula x Populus tremuloides p... 52 0.001
99gb|DQ097721.1| Arachis hypogaea Cu-Zn superoxide dismutase mRNA,... 52 0.001
100gb|AF127157.1| Drosophila sechellia Cu-Zn superoxide dismutase (... 52 0.001
101gb|U47892.1|DOU47892 Drosophila obscura Cu,Zn superoxide dismuta... 52 0.001
102gb|AY804513.1| Drosophila yakuba strain Tai18 sod (sod) gene, pa... 50 0.005
103gb|AF127160.1| Drosophila teissieri Cu-Zn superoxide dismutase (... 50 0.005
104gb|AF127159.1| Drosophila yakuba Cu-Zn superoxide dismutase (Sod... 50 0.005
105gb|AF021828.1|AF021828 Drosophila teissieri superoxide dismutase... 50 0.005
106gb|AF021824.1|AF021824 Hirtodrosophila pictiventris superoxide d... 50 0.005
107emb|AL670114.17| Mouse DNA sequence from clone RP23-7C19 on chro... 50 0.005
108gb|AC156827.4| Medicago truncatula clone mth2-15c17, complete se... 48 0.019
109emb|Z19591.1|DMCZSUDMA D.melanogaster Cu-Zn superoxide dismutase... 48 0.019
110emb|Y00367.1|DMSOD Drosophila mRNA for Cu-Zn superoxide dismutase 48 0.019
111gb|DQ445093.1| Gossypium hirsutum putative cytosolic copper/zinc... 48 0.019
112emb|X17332.1|DMSODG2 Drosophila Cu-Zn superoxide dismutase gene ... 48 0.019
113emb|X13780.1|DMSODG Drosophila melanogaster sod gene for Cu-Zn s... 48 0.019
114gb|AC010023.6| Drosophila melanogaster 3L BAC RP98-19G23 (Roswel... 48 0.019
115gb|AC096692.5| Drosophila melanogaster 3L BAC RP98-48O3 (Roswell... 48 0.019
116ref|NM_057387.3| Drosophila melanogaster Superoxide dismutase CG... 48 0.019
117gb|AY071435.1| Drosophila melanogaster RE52090 full length cDNA 48 0.019
118gb|AY898945.1| Lilium hybrid cultivar superoxide dismutase (SOD)... 48 0.019
119gb|AC006562.8|AC006562 Drosophila melanogaster, chromosome 3L, r... 48 0.019
120gb|S72589.1|S72589 Drosophila melanogaster slow superoxide dismu... 48 0.019
121gb|AE003546.4| Drosophila melanogaster chromosome 3L, section 39... 48 0.019
122dbj|AB066500.1| Barbula unguiculata mRNA for chloroplastic coppe... 48 0.019
123gb|AF059879.1|AF059879 Drosophila immigrans Cu-Zn superoxide dis... 48 0.019
124gb|AF021822.1|AF021822 Scaptodrosophila lebanonensis superoxide ... 48 0.019
125gb|L08253.1|TOBCCZSODM Nicotiana plumbaginifolia Cu/Zn-superoxid... 48 0.019
126gb|M24421.1|DROSODCUZN Drosophila melanogaster Cu-Zn superoxide ... 48 0.019
127gb|DQ440061.1| Aedes aegypti clone AE-321 Cu2+/Zn2+ superoxide d... 46 0.074
128emb|AJ971950.1| Pinus pinea partial mRNA for chloroplast CuZn su... 46 0.074
129gb|AY434497.1| Trifolium pratense superoxide dismutase mRNA, com... 46 0.074
130gb|AC126007.16| Medicago truncatula clone mth2-11o4, complete se... 46 0.074
131emb|X58579.1|PSCUZNPST P.sylvestris mRNA for CuZn superoxide dis... 46 0.074
132emb|X56435.1|PSSODII Pea mRNA for Cu/Zn superoxide dismutase II ... 46 0.074
133emb|X15685.1|DSSOD Drosophila simulans DNA for Cu-Zn superoxide ... 46 0.074
134emb|AJ279694.1|BPE279694 Betula pendula partial mRNA for copper/... 46 0.074
135gb|AY867724.1| Pinus taeda isolate FBRC30 chloroplast Cu/Zn supe... 46 0.074
136gb|AY867723.1| Pinus taeda isolate FBRC29 chloroplast Cu/Zn supe... 46 0.074
137gb|AY867722.1| Pinus taeda isolate FBRC28 chloroplast Cu/Zn supe... 46 0.074
138gb|AY867719.1| Pinus taeda isolate FBRC25 chloroplast Cu/Zn supe... 46 0.074
139gb|AY867717.1| Pinus taeda isolate FBRC23 chloroplast Cu/Zn supe... 46 0.074
140gb|AY867714.1| Pinus taeda isolate FBRC20 chloroplast Cu/Zn supe... 46 0.074
141gb|AY867713.1| Pinus taeda isolate FBRC19 chloroplast Cu/Zn supe... 46 0.074
142gb|AY867712.1| Pinus taeda isolate FBRC18 chloroplast Cu/Zn supe... 46 0.074
143gb|AY867710.1| Pinus taeda isolate FBRC16 chloroplast Cu/Zn supe... 46 0.074
144gb|AY867708.1| Pinus taeda isolate FBRC14 chloroplast Cu/Zn supe... 46 0.074
145gb|AY867707.1| Pinus taeda isolate FBRC13 chloroplast Cu/Zn supe... 46 0.074
146gb|AY867706.1| Pinus taeda isolate FBRC12 chloroplast Cu/Zn supe... 46 0.074
147gb|AY867703.1| Pinus taeda isolate FBRC9 chloroplast Cu/Zn super... 46 0.074
148gb|AY867702.1| Pinus taeda isolate FBRC8 chloroplast Cu/Zn super... 46 0.074
149gb|AY867700.1| Pinus taeda isolate FBRC6 chloroplast Cu/Zn super... 46 0.074
150gb|AY867697.1| Pinus taeda isolate FBRC3 chloroplast Cu/Zn super... 46 0.074
151emb|AJ786258.1| Helianthus annuus mRNA for Cu/Zn superoxide dism... 46 0.074
152gb|AF434186.1|AF434186 Pinus pinaster Cu-Zn-superoxide dismutase... 46 0.074
153dbj|AB189165.1| Pisum sativum mRNA for copper zinc superoxide di... 46 0.074
154dbj|AB087845.1| Pisum sativum SOD mRNA for superoxide dismutase,... 46 0.074
155gb|AF056621.1|AF056621 Medicago sativa putative Cu/Zn superoxide... 46 0.074
156gb|U08097.1|PTU08097 Populus tremuloides Cu/Zn-superoxide dismut... 46 0.074
157gb|J04087.1|PEASOD Pea chloroplastic copper/zinc-superoxide dism... 46 0.074
158gb|M63003.1|PEACUZNSD Pea Cu-Zn superoxide dismutase mRNA, compl... 46 0.074
159emb|AJ971949.1| Pinus pinea partial mRNA for cytosolic CuZn supe... 44 0.29
160gb|AC130711.3| Mus musculus BAC clone RP23-22M24 from chromosome... 44 0.29
161emb|X87372.1|LESODCC L.esculentum SodCc;Le;2 gene 44 0.29
162emb|X58578.1|PSCUZNPS3 P.sylvestris mRNA for CuZn superoxide dis... 44 0.29
163gb|AC158975.9| Mus musculus chromosome 18, clone RP24-192J22, co... 44 0.29
164dbj|AK144519.1| Mus musculus 13 days embryo brain cDNA, RIKEN fu... 44 0.29
165gb|AF457209.1| Hevea brasiliensis Cu/Zn superoxide dismutase (Cu... 44 0.29
166gb|AF220294.1|AF220294 Mus musculus clone BAC126c8 Rsp29-like pr... 44 0.29
167gb|AY754566.1| Drosophila miranda strain MSH22 superoxide dismut... 44 0.29
168gb|AC119259.15| Mus musculus chromosome 18, clone RP24-285N19, c... 44 0.29
169gb|AC154229.1| Mus musculus BAC clone RP24-155I8 from 17, comple... 44 0.29
170gb|U47873.1|DPU47873 Drosophila persimilis NDSSC 14011-0111.2 Cu... 44 0.29
171gb|U47872.1|DPU47872 Drosophila pseudoobscura bogotana NDSSC 140... 44 0.29
172gb|U47871.1|DPU47871 Drosophila pseudoobscura pseudoobscura NDSS... 44 0.29
173gb|U47870.1|DMU47870 Drosophila miranda NDSSC 14011-0101.1 Cu,Zn... 44 0.29
174gb|U47869.1|DBU47869 Drosophila bifasciata NDSSC 14012-0181.0 Cu... 44 0.29
175gb|BT012694.1| Lycopersicon esculentum clone 113564F, mRNA sequence 42 1.2
176gb|AF385581.2| Dichanthelium lanuginosum copper/zinc superoxide ... 42 1.2
177gb|AC146631.27| Medicago truncatula clone mth2-7g1, complete seq... 42 1.2
178emb|X14041.1|LECHSOD Tomato mRNA for chloroplast Cu-Zn superoxid... 42 1.2
179emb|X13831.1|DVSOD Drosophila sod gene for Cu-Zn superoxide dism... 42 1.2
180gb|AY081436.1| Drosophila guttifera superoxide dismutase (Sod) g... 42 1.2
181gb|AY081435.1| Drosophila flexa superoxide dismutase (Sod) gene,... 42 1.2
182gb|AY081434.1| Drosophila ornatipennis superoxide dismutase (Sod... 42 1.2
183gb|AY081433.1| Drosophila nannoptera superoxide dismutase (Sod) ... 42 1.2
184gb|AY754565.1| Drosophila affinis superoxide dismutase (Sod) gen... 42 1.2
185gb|AF021826.1|AF021826 Drosophila guttifera superoxide dismutase... 42 1.2
186emb|X77175.1|LESOD1 L.esculentum (cherry tomato) SOD Cp;Le:1 gen... 42 1.2
187gb|AY881165.1| Nelumbo nucifera isolate 16 copper-zinc superoxid... 42 1.2
188gb|AY881164.1| Nelumbo nucifera isolate 14 copper-zinc superoxid... 42 1.2
189gb|U39445.1|DBU39445 Drosophila busckii Cu,Zn superoxide dismuta... 42 1.2
190gb|M37151.1|TOMSODB Tomato superoxide dismutase (SOD) mRNA, comp... 42 1.2
191gb|DQ497636.1| Thermoascus aurantiacus var. levisporus Cu,Zn-sup... 40 4.6
192gb|AY566699.1| Citrullus lanatus copper-zinc superoxide dismutas... 40 4.6
193ref|XM_748622.1| Aspergillus fumigatus Af293 Cu,Zn superoxide di... 40 4.6
194ref|XM_385171.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 40 4.6
195gb|AF264031.1| Callinectes sapidus extracellular Cu, Zn-superoxi... 40 4.6
196ref|XM_503850.1| Yarrowia lipolytica CLIB122, YALI0E12133g predi... 40 4.6
197emb|AJ305146.1|PAN305146 Podospora anserina sod1 gene for copper... 40 4.6
198emb|AJ278668.1|PTR278668 Populus tremula x Populus tremuloides c... 40 4.6
199gb|AF401280.1| Aspergillus flavus Cu,Zn-superoxide dismutase mRN... 40 4.6
200dbj|AB226266.1| Aspergillus oryzae cDNA, contig sequence: AoEST3125 40 4.6
201dbj|AB223448.1| Aspergillus oryzae cDNA, contig sequence: AoEST0280 40 4.6
202gb|AC140006.1| Oryza sativa (japonica cultivar-group) chromosome... 40 4.6
203gb|AF127158.1| Drosophila mauritiana Cu-Zn superoxide dismutase ... 40 4.6
204gb|AC104474.2| Oryza sativa (japonica cultivar-group) chromosome... 40 4.6
205gb|AF128886.1|AF128886 Aspergillus fumigatus Cu,Zn superoxide di... 40 4.6
206dbj|AK073785.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.6
207gb|AF021827.1|AF021827 Scaptomyza adusta superoxide dismutase (S... 40 4.6
208gb|AF059886.1|AF059886 Drosophila tanythrix Cu-Zn superoxide dis... 40 4.6
209emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 40 4.6

>dbj|D01000.1|RICSODB Oryza sativa mRNA for copper/zinc-superoxide dismutase, complete
           cds, clone:RSODB
          Length = 667

 Score =  238 bits (120), Expect = 1e-59
 Identities = 243/284 (85%)
 Strand = Plus / Plus

                                                                       
Query: 59  gagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaag 118
           |||| |||||| ||||||||||||||||| ||||||||| |  |||| ||||||||||||
Sbjct: 1   gagaacacatagacaatggtgaaggctgttgctgtgcttgctagcagtgagggtgtcaag 60

                                                                       
Query: 119 ggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgggaagtgtcacg 178
           ||||||||||| ||| |||| ||||||||||| |||||| ||||||||||||||||| | 
Sbjct: 61  ggcaccatctttttctcccaagagggagatggtccgacctctgtgacgggaagtgtctct 120

                                                                       
Query: 179 ggactcaaggaagggctccacggcttccatgtgcacgctcttggtgacaccaccaacggc 238
           || ||||||  ||||||||| || |||||||||||||| || ||||||||||| || |||
Sbjct: 121 gggctcaagccagggctccatggattccatgtgcacgcgctcggtgacaccactaatggc 180

                                                                       
Query: 239 tgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatggggcacccgaagat 298
           ||||||||||||||||| |||||||| ||  ||||  | |  |||||||||||  |||||
Sbjct: 181 tgcatgtcaactggaccacacttcaatcctactgggaaggaacatggggcaccacaagat 240

                                                       
Query: 299 gaaatccgccatgctggtgacctcggaaatgtgacagctggagc 342
           || | ||||||||| ||||| || |||||| | |||||||||||
Sbjct: 241 gagaaccgccatgccggtgatcttggaaatataacagctggagc 284



to top

>gb|AY109448.1| Zea mays CL1415_1 mRNA sequence
          Length = 1046

 Score =  236 bits (119), Expect = 4e-59
 Identities = 245/287 (85%)
 Strand = Plus / Plus

                                                                       
Query: 56  cctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtc 115
           |||||||||||||| ||||||||||||||||| |||||||||    ||||||| ||||||
Sbjct: 202 cctgagatcacataaacaatggtgaaggctgttgctgtgcttggtagcagcgatggtgtc 261

                                                                       
Query: 116 aagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgggaagtgtc 175
           ||||||||||||||||||||||| |||||||||||||| ||| |||| || |||||||||
Sbjct: 262 aagggcaccatcttcttcacccaagagggagatggccctaccgctgtcaccggaagtgtc 321

                                                                       
Query: 176 acgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgacaccaccaac 235
            | || ||||||   || ||||| || |||||||| || || ||||||||||||||||| 
Sbjct: 322 tctggcctcaagcctggcctccatgggttccatgtacatgcacttggtgacaccaccaat 381

                                                                       
Query: 236 ggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatggggcacccgaa 295
           || ||||||||||||||||| |||| ||| || ||  |  | | |||||||||||| |||
Sbjct: 382 ggatgcatgtcaactggaccacactacaatcctgcgagcaaggagcatggggcaccagaa 441

                                                          
Query: 296 gatgaaatccgccatgctggtgacctcggaaatgtgacagctggagc 342
           ||||| | ||||||||||||||| || ||||| ||||||||||||||
Sbjct: 442 gatgagaaccgccatgctggtgatcttggaaacgtgacagctggagc 488



to top

>gb|BT017337.1| Zea mays clone EL01N0321D04.c mRNA sequence
          Length = 756

 Score =  220 bits (111), Expect = 2e-54
 Identities = 249/295 (84%)
 Strand = Plus / Plus

                                                                       
Query: 48  gggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcg 107
           ||||||| | |||||||||||| ||||||||||||||||| |||||||||    |||| |
Sbjct: 37  gggggtcccttgagatcacataaacaatggtgaaggctgttgctgtgcttggtagcagtg 96

                                                                       
Query: 108 agggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgg 167
           | |||||||||||||||||||| |||||||| |||||||||||||| ||| |||| || |
Sbjct: 97  atggtgtcaagggcaccatctttttcacccaagagggagatggccctaccgctgtcaccg 156

                                                                       
Query: 168 gaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgaca 227
           |||||||| | || ||||||   || ||||| || |||||||| || || ||||||||||
Sbjct: 157 gaagtgtctctggcctcaagcctggcctccatgggttccatgtacatgcacttggtgaca 216

                                                                       
Query: 228 ccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatgggg 287
           ||||||| || ||||||||||||||||| |||| ||| || ||  |  | | ||||||||
Sbjct: 217 ccaccaatggatgcatgtcaactggaccacactacaatcctgcgagcaaggagcatgggg 276

                                                                  
Query: 288 cacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggagc 342
           |||| |||||||| | ||||||||| ||||| || ||||||||||||||||||||
Sbjct: 277 caccagaagatgagaaccgccatgccggtgatcttggaaatgtgacagctggagc 331



to top

>emb|X17565.1|ZMSOD4 Zea mays mRNA for superoxide dismutase-4AP (Sod4AP gene)
          Length = 722

 Score =  212 bits (107), Expect = 6e-52
 Identities = 249/295 (84%), Gaps = 1/295 (0%)
 Strand = Plus / Plus

                                                                       
Query: 48  gggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcg 107
           ||||||| |||||||||||||| ||| ||||||||||||| ||||||||     ||||||
Sbjct: 67  gggggtcgcctgagatcacataaaca-tggtgaaggctgttgctgtgctgggtagcagcg 125

                                                                       
Query: 108 agggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgg 167
           |||||||||||||||| |||||||||||||| || || |||||||| |||||||| || |
Sbjct: 126 agggtgtcaagggcacaatcttcttcacccaagaaggggatggccctaccactgtcactg 185

                                                                       
Query: 168 gaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgaca 227
           |||||||| | || ||||||   || ||||| || ||||||||||| || ||||||||||
Sbjct: 186 gaagtgtctctggcctcaagcctggcctccatgggttccatgtgcatgcacttggtgaca 245

                                                                       
Query: 228 ccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatgggg 287
           ||||||| |||||||||||||||||||| |||| ||| || ||  |  | |  ||||| |
Sbjct: 246 ccaccaatggctgcatgtcaactggaccacactacaatcctgcgagcaaggaacatggag 305

                                                                  
Query: 288 cacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggagc 342
           |||| |||||||| | ||||||||| ||||| || ||||||||||||||||||||
Sbjct: 306 caccagaagatgagaaccgccatgccggtgatcttggaaatgtgacagctggagc 360



to top

>emb|X17564.1|ZMSOD4A Zea mays mRNA for superoxide dismutase-4A (Sod4A gene)
          Length = 691

 Score =  196 bits (99), Expect = 3e-47
 Identities = 247/295 (83%), Gaps = 1/295 (0%)
 Strand = Plus / Plus

                                                                       
Query: 48  gggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcg 107
           ||||||| |||||||||||||| ||| ||||||||||||| ||||||||     ||||||
Sbjct: 24  gggggtcgcctgagatcacataaaca-tggtgaaggctgttgctgtgctgggtagcagcg 82

                                                                       
Query: 108 agggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgg 167
           | |||||||||||||||||||| |||||||| |||||||||||||| ||| |||| || |
Sbjct: 83  atggtgtcaagggcaccatctttttcacccaagagggagatggccctaccgctgtcactg 142

                                                                       
Query: 168 gaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgaca 227
           |||||||| | || ||||||   || ||||| || |||||||| || || ||||||||||
Sbjct: 143 gaagtgtctctggcctcaagcctggcctccatgggttccatgtacatgcacttggtgaca 202

                                                                       
Query: 228 ccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatgggg 287
           ||||||| || ||||||||||||||||   ||| ||| || ||  |  | | ||||||||
Sbjct: 203 ccaccaatggatgcatgtcaactggacacgactacaatcctgcgagcaaggagcatgggg 262

                                                                  
Query: 288 cacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggagc 342
           |||| |||||||| | ||||||||| ||||| || ||||||||||||||||||||
Sbjct: 263 caccagaagatgagaaccgccatgccggtgatcttggaaatgtgacagctggagc 317



to top

>ref|NM_186073.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 444

 Score =  176 bits (89), Expect = 3e-41
 Identities = 225/269 (83%), Gaps = 6/269 (2%)
 Strand = Plus / Plus

                                                                       
Query: 74  atggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttcttc 133
           |||||||||||||| ||||||||| |  |||| ||||||||||||||||||||||| |||
Sbjct: 1   atggtgaaggctgttgctgtgcttgctagcagtgagggtgtcaagggcaccatctttttc 60

                                                                       
Query: 134 acccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactcaaggaaggg 193
            |||| |||||||||   |||||| ||||||||||||||||| | || ||||||  ||||
Sbjct: 61  tcccaagagggagat---ccgacctctgtgacgggaagtgtctctgggctcaagccaggg 117

                                                                       
Query: 194 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 253
           ||||| || |||||||||||||| || ||||||||||| || |||||||||||||||   
Sbjct: 118 ctccatggattccatgtgcacgcgctcggtgacaccactaatggctgcatgtcaact--- 174

                                                                       
Query: 254 ccgcacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgct 313
           || |||||||| ||  ||||  | |  |||||||||||  ||||||| | ||||||||| 
Sbjct: 175 ccacacttcaatcctactgggaaggaacatggggcaccacaagatgagaaccgccatgcc 234

                                        
Query: 314 ggtgacctcggaaatgtgacagctggagc 342
           ||||| || |||||| | |||||||||||
Sbjct: 235 ggtgatcttggaaatataacagctggagc 263



to top

>gb|AY103754.1| Zea mays PCO107770 mRNA sequence
          Length = 910

 Score =  176 bits (89), Expect = 3e-41
 Identities = 244/295 (82%), Gaps = 3/295 (1%)
 Strand = Plus / Plus

                                                                       
Query: 47  ggggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagc 106
           |||||||| ||||||||||||   |||||||||||||| || ||||| ||  ||||||  
Sbjct: 172 ggggggtcgcctgagatcacagcgacaatggtgaaggcagttgctgtcctcgccggcact 231

                                                                       
Query: 107 gagggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacg 166
           ||   |||||||||||||||||||||  | |||||||| ||||| |||||||| ||||| 
Sbjct: 232 ga---tgtcaagggcaccatcttcttttcacaggagggggatggtccgaccaccgtgact 288

                                                                       
Query: 167 ggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgac 226
           |||||| || | || ||||||  ||||||||| || |||||||||||||| ||||| |||
Sbjct: 289 ggaagtatctctggcctcaagccagggctccatgggttccatgtgcacgcgcttggcgac 348

                                                                       
Query: 227 accaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatggg 286
           |||||||||||||||||||| ||||| || |||||||| || | |||  | | |||||| 
Sbjct: 349 accaccaacggctgcatgtcgactgggccacacttcaatcctgttggcaaggagcatggc 408

                                                                  
Query: 287 gcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggag 341
           ||||| ||||||||   ||||||||| ||||| || || ||||||||||| ||||
Sbjct: 409 gcaccggaagatgaggaccgccatgccggtgatcttgggaatgtgacagcgggag 463



to top

>gb|M15175.1|MZESOD2A Maize superoxide dismutase 2 (SOD2) mRNA, complete cds
          Length = 694

 Score =  168 bits (85), Expect = 7e-39
 Identities = 243/295 (82%), Gaps = 3/295 (1%)
 Strand = Plus / Plus

                                                                       
Query: 47  ggggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagc 106
           |||||||| |||||||||||| | |||||||||||||| || ||||| ||  ||||||  
Sbjct: 10  ggggggtcgcctgagatcacagagacaatggtgaaggcagttgctgtcctcgccggcact 69

                                                                       
Query: 107 gagggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacg 166
           ||   |||||||||||||||||||||  | ||||| || ||||| |||||||| ||||| 
Sbjct: 70  ga---tgtcaagggcaccatcttcttttcacaggaaggggatggtccgaccaccgtgact 126

                                                                       
Query: 167 ggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgac 226
           |||||| || | || ||||||  ||| ||||| || |||||||||||||| ||||| |||
Sbjct: 127 ggaagtatctctggcctcaagccaggcctccatgggttccatgtgcacgcgcttggcgac 186

                                                                       
Query: 227 accaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatggg 286
           |||||||||||||||||||| ||||| || |||||||| || | |||  | | |||||| 
Sbjct: 187 accaccaacggctgcatgtcgactgggccacacttcaatcctgttggcaaggagcatggt 246

                                                                  
Query: 287 gcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggag 341
           ||||| ||||||||   ||||||||| ||||| || || ||||||||||| ||||
Sbjct: 247 gcaccggaagatgaggaccgccatgccggtgatcttgggaatgtgacagcgggag 301



to top

>gb|M54936.1|MZESOD2 Maize superoxide dismutase-2 (Sod-2) mRNA, complete cds
          Length = 694

 Score =  168 bits (85), Expect = 7e-39
 Identities = 243/295 (82%), Gaps = 3/295 (1%)
 Strand = Plus / Plus

                                                                       
Query: 47  ggggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagc 106
           |||||||| |||||||||||| | |||||||||||||| || ||||| ||  ||||||  
Sbjct: 10  ggggggtcgcctgagatcacagagacaatggtgaaggcagttgctgtcctcgccggcact 69

                                                                       
Query: 107 gagggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacg 166
           ||   |||||||||||||||||||||  | ||||| || ||||| |||||||| ||||| 
Sbjct: 70  ga---tgtcaagggcaccatcttcttttcacaggaaggggatggtccgaccaccgtgact 126

                                                                       
Query: 167 ggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgac 226
           |||||| || | || ||||||  ||| ||||| || |||||||||||||| ||||| |||
Sbjct: 127 ggaagtatctctggcctcaagccaggcctccatgggttccatgtgcacgcgcttggcgac 186

                                                                       
Query: 227 accaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatggg 286
           |||||||||||||||||||| ||||| || |||||||| || | |||  | | |||||| 
Sbjct: 187 accaccaacggctgcatgtcgactgggccacacttcaatcctgttggcaaggagcatggt 246

                                                                  
Query: 287 gcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggag 341
           ||||| ||||||||   ||||||||| ||||| || || ||||||||||| ||||
Sbjct: 247 gcaccggaagatgaggaccgccatgccggtgatcttgggaatgtgacagcgggag 301



to top

>dbj|AK120692.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013169L20, full
           insert sequence
          Length = 829

 Score =  139 bits (70), Expect = 7e-30
 Identities = 238/294 (80%)
 Strand = Plus / Plus

                                                                       
Query: 48  gggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcg 107
           ||||||| |||||||||||||  ||||||||||||||||| | |||||||    |||| |
Sbjct: 70  gggggtcgcctgagatcacattaacaatggtgaaggctgttgttgtgcttggtagcagtg 129

                                                                       
Query: 108 agggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgg 167
           ||  ||| |||||||| |||  |||   ||| ||||||||||| || ||||||||||| |
Sbjct: 130 agattgttaagggcactatccactttgtccaagagggagatggtcccaccactgtgactg 189

                                                                       
Query: 168 gaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgaca 227
           |||||||| | || ||||||   || ||||| || |||||| | || || ||||||||||
Sbjct: 190 gaagtgtctctggcctcaagcctggtctccatgggttccatattcatgcacttggtgaca 249

                                                                       
Query: 228 ccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatgggg 287
           ||||||| || |||||||||||||| || |||| ||| || || ||  | | |||||| |
Sbjct: 250 ccaccaatggttgcatgtcaactgggccacactacaatcctgccggaaaggagcatggag 309

                                                                 
Query: 288 cacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggag 341
           |||| |||||||| | ||||||||||||||| || |||||||| || |||||||
Sbjct: 310 caccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctggag 363



to top

>dbj|AK061662.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-036-E04, full
           insert sequence
          Length = 786

 Score =  139 bits (70), Expect = 7e-30
 Identities = 238/294 (80%)
 Strand = Plus / Plus

                                                                       
Query: 48  gggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcg 107
           ||||||| |||||||||||||  ||||||||||||||||| | |||||||    |||| |
Sbjct: 78  gggggtcgcctgagatcacattaacaatggtgaaggctgttgttgtgcttggtagcagtg 137

                                                                       
Query: 108 agggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgg 167
           ||  ||| |||||||| |||  |||   ||| ||||||||||| || ||||||||||| |
Sbjct: 138 agattgttaagggcactatccactttgtccaagagggagatggtcccaccactgtgactg 197

                                                                       
Query: 168 gaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgaca 227
           |||||||| | || ||||||   || ||||| || |||||| | || || ||||||||||
Sbjct: 198 gaagtgtctctggcctcaagcctggtctccatgggttccatattcatgcacttggtgaca 257

                                                                       
Query: 228 ccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatgggg 287
           ||||||| || |||||||||||||| || |||| ||| || || ||  | | |||||| |
Sbjct: 258 ccaccaatggttgcatgtcaactgggccacactacaatcctgccggaaaggagcatggag 317

                                                                 
Query: 288 cacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggag 341
           |||| |||||||| | ||||||||||||||| || |||||||| || |||||||
Sbjct: 318 caccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctggag 371



to top

>dbj|D00999.1|RICSODA Oryza sativa mRNA for copper/zinc-superoxide dismutase, complete
           cds, clone:RSODA
          Length = 760

 Score =  139 bits (70), Expect = 7e-30
 Identities = 238/294 (80%)
 Strand = Plus / Plus

                                                                       
Query: 48  gggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcg 107
           ||||||| |||||||||||||  ||||||||||||||||| | |||||||    |||| |
Sbjct: 48  gggggtcgcctgagatcacattaacaatggtgaaggctgttgttgtgcttggtagcagtg 107

                                                                       
Query: 108 agggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgg 167
           ||  ||| |||||||| |||  |||   ||| ||||||||||| || ||||||||||| |
Sbjct: 108 agattgttaagggcactatccactttgtccaagagggagatggtcccaccactgtgactg 167

                                                                       
Query: 168 gaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgaca 227
           |||||||| | || ||||||   || ||||| || |||||| | || || ||||||||||
Sbjct: 168 gaagtgtctctggcctcaagcctggtctccatgggttccatattcatgcacttggtgaca 227

                                                                       
Query: 228 ccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatgggg 287
           ||||||| || |||||||||||||| || |||| ||| || || ||  | | |||||| |
Sbjct: 228 ccaccaatggttgcatgtcaactgggccacactacaatcctgccggaaaggagcatggag 287

                                                                 
Query: 288 cacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggag 341
           |||| |||||||| | ||||||||||||||| || |||||||| || |||||||
Sbjct: 288 caccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctggag 341



to top

>gb|DQ058108.1| Oryza sativa (indica cultivar-group) cytoplasmic
           copper/zinc-superoxide dismutase mRNA, complete cds
          Length = 698

 Score =  131 bits (66), Expect = 2e-27
 Identities = 237/294 (80%)
 Strand = Plus / Plus

                                                                       
Query: 48  gggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcg 107
           ||||||| |||||||||||||  ||||||||||||||||| | |||||||    |||| |
Sbjct: 31  gggggtcgcctgagatcacattaacaatggtgaaggctgttgttgtgcttggtagcagtg 90

                                                                       
Query: 108 agggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgg 167
           ||  ||| |||||||| |||  |||   ||| ||||||||||| || ||||||||||| |
Sbjct: 91  agattgttaagggcactatccactttgtccaagagggagatggtcccaccactgtgactg 150

                                                                       
Query: 168 gaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgaca 227
           |||||||| | || || |||   || ||||| || |||||| | || || ||||||||||
Sbjct: 151 gaagtgtctctggccttaagcctggtctccatgggttccatattcatgcacttggtgaca 210

                                                                       
Query: 228 ccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatgggg 287
           ||||||| || |||||||||||||| || |||| ||| || || ||  | | |||||| |
Sbjct: 211 ccaccaatggttgcatgtcaactgggccacactacaatcctgccggaaaggagcatggag 270

                                                                 
Query: 288 cacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggag 341
           |||| |||||||| | ||||||||||||||| || |||||||| || |||||||
Sbjct: 271 caccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctggag 324



to top

>gb|L36320.1|RICSOXDM Oryza sativa (clone cu101) superoxide dismutase (cuznsod1) mRNA,
           complete cds
          Length = 768

 Score =  131 bits (66), Expect = 2e-27
 Identities = 237/294 (80%)
 Strand = Plus / Plus

                                                                       
Query: 48  gggggtcacctgagatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcg 107
           ||||||| |||||||||||||  ||||||||||||||||| | |||||||    |||| |
Sbjct: 62  gggggtcgcctgagatcacattaacaatggtgaaggctgttgttgtgcttggtagcagtg 121

                                                                       
Query: 108 agggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgg 167
           ||  ||| |||||||| |||  |||   ||| ||||||||||| || ||||||||||| |
Sbjct: 122 agattgttaagggcactatccactttgtccaagagggagatggtcccaccactgtgactg 181

                                                                       
Query: 168 gaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgaca 227
           |||||||| | || ||||||   || ||||| || |||||| | || || ||||||||||
Sbjct: 182 gaagtgtctctggcctcaagcctggtctccatgggttccatattcatgcacttggtgaca 241

                                                                       
Query: 228 ccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatgggg 287
           ||||||| || ||||| |||||||| || |||| ||| || || ||  | | |||||| |
Sbjct: 242 ccaccaatggttgcatctcaactgggccacactacaatcctgccggaaaggagcatggag 301

                                                                 
Query: 288 cacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctggag 341
           |||| |||||||| | ||||||||||||||| || |||||||| || |||||||
Sbjct: 302 caccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctggag 355



to top

>emb|AJ250667.1|ACO250667 Ananas comosus mRNA for copper/zinc-superoxide dismutase (sod1
           gene)
          Length = 820

 Score =  111 bits (56), Expect = 2e-21
 Identities = 209/260 (80%)
 Strand = Plus / Plus

                                                                       
Query: 74  atggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttcttc 133
           |||||||||||||| ||||||||     |||| |||||||| || ||||| |||| ||||
Sbjct: 42  atggtgaaggctgttgctgtgctgggtagcagtgagggtgttaaaggcacaatctacttc 101

                                                                       
Query: 134 acccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactcaaggaaggg 193
           ||||| || || ||||| ||||| |||||||| |||||| || |||| ||||||   || 
Sbjct: 102 acccaagaaggggatggtccgacaactgtgactggaagtatctcgggcctcaagcccgga 161

                                                                       
Query: 194 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 253
           || || || || ||||| || || ||||| |||||||| || || |||||||||||||| 
Sbjct: 162 cttcatggatttcatgttcatgcacttggcgacaccacaaatggttgcatgtcaactggg 221

                                                                       
Query: 254 ccgcacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgct 313
           || || ||||| || || ||  |||  ||||| ||||| |||||||| | ||||||||||
Sbjct: 222 ccacatttcaatcctgccgggaatgaacatggcgcacctgaagatgagacccgccatgct 281

                               
Query: 314 ggtgacctcggaaatgtgac 333
           ||||| || |||||||||||
Sbjct: 282 ggtgatcttggaaatgtgac 301



to top

>gb|AF479059.1| Sandersonia aurantiaca copper/zinc superoxide dismutase mRNA,
           complete cds
          Length = 799

 Score =  105 bits (53), Expect = 9e-20
 Identities = 80/89 (89%)
 Strand = Plus / Plus

                                                                       
Query: 74  atggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttcttc 133
           |||||||||||||| ||||| || | ||| || |||||||||||||||||| | ||||||
Sbjct: 20  atggtgaaggctgttgctgttctgaacgggagtgagggtgtcaagggcaccgtgttcttc 79

                                        
Query: 134 acccaggagggagatggcccgaccactgt 162
           || ||||||||||||||||||||||||||
Sbjct: 80  acacaggagggagatggcccgaccactgt 108



 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           ||||| |||||||| || || || |||||||| || || ||||||||||| ||||| |||
Sbjct: 143 cacggattccatgttcatgcgctcggtgacactacaaatggctgcatgtctactgggccg 202

                                                                       
Query: 257 cacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggt 316
           || || || || |||||  | | |||||| ||||| ||||| |||| ||||||||| |||
Sbjct: 203 cattttaatcctgctgggaaggagcatggagcaccggaagacgaaaaccgccatgccggt 262

                                  
Query: 317 gacctcggaaatgtgacagctgg 339
           || || || ||||||||||||||
Sbjct: 263 gatcttgggaatgtgacagctgg 285



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  105 bits (53), Expect = 9e-20
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                            
Query: 152      ccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtg 211
                |||||| ||||||||||||||||| | || ||||||  ||||||||| || |||||||||
Sbjct: 28023204 ccgacctctgtgacgggaagtgtctctgggctcaagccagggctccatggattccatgtg 28023145

                                                         
Query: 212      cacgctcttggtgacaccaccaacggctgcatgtcaactgg 252
                ||||| || ||||||||||| || |||||||||||||||||
Sbjct: 28023144 cacgcgctcggtgacaccactaatggctgcatgtcaactgg 28023104



 Score =  101 bits (51), Expect = 1e-18
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                            
Query: 64       cacatacacaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcac 123
                |||||| ||||||||||||||||| ||||||||| |  |||| |||||||||||||||||
Sbjct: 28023376 cacatagacaatggtgaaggctgttgctgtgcttgctagcagtgagggtgtcaagggcac 28023317

                                           
Query: 124      catcttcttcacccaggagggagatgg 150
                |||||| ||| |||| |||||||||||
Sbjct: 28023316 catctttttctcccaagagggagatgg 28023290



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                            
Query: 281      catggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgga 340
                |||||||||||  ||||||| | ||||||||| ||||| || |||||| | |||||||||
Sbjct: 28022987 catggggcaccacaagatgagaaccgccatgccggtgatcttggaaatataacagctgga 28022928

                  
Query: 341      gc 342
                ||
Sbjct: 28022927 gc 28022926



to top

>dbj|AP003825.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1343_D04
          Length = 143407

 Score =  105 bits (53), Expect = 9e-20
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                          
Query: 152    ccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtg 211
              |||||| ||||||||||||||||| | || ||||||  ||||||||| || |||||||||
Sbjct: 112538 ccgacctctgtgacgggaagtgtctctgggctcaagccagggctccatggattccatgtg 112479

                                                       
Query: 212    cacgctcttggtgacaccaccaacggctgcatgtcaactgg 252
              ||||| || ||||||||||| || |||||||||||||||||
Sbjct: 112478 cacgcgctcggtgacaccactaatggctgcatgtcaactgg 112438



 Score =  101 bits (51), Expect = 1e-18
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                          
Query: 64     cacatacacaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcac 123
              |||||| ||||||||||||||||| ||||||||| |  |||| |||||||||||||||||
Sbjct: 112710 cacatagacaatggtgaaggctgttgctgtgcttgctagcagtgagggtgtcaagggcac 112651

                                         
Query: 124    catcttcttcacccaggagggagatgg 150
              |||||| ||| |||| |||||||||||
Sbjct: 112650 catctttttctcccaagagggagatgg 112624



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                          
Query: 281    catggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgga 340
              |||||||||||  ||||||| | ||||||||| ||||| || |||||| | |||||||||
Sbjct: 112321 catggggcaccacaagatgagaaccgccatgccggtgatcttggaaatataacagctgga 112262

                
Query: 341    gc 342
              ||
Sbjct: 112261 gc 112260



to top

>dbj|AP004274.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
            clone:P0450A04
          Length = 162545

 Score =  105 bits (53), Expect = 9e-20
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                        
Query: 152  ccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtg 211
            |||||| ||||||||||||||||| | || ||||||  ||||||||| || |||||||||
Sbjct: 6500 ccgacctctgtgacgggaagtgtctctgggctcaagccagggctccatggattccatgtg 6441

                                                     
Query: 212  cacgctcttggtgacaccaccaacggctgcatgtcaactgg 252
            ||||| || ||||||||||| || |||||||||||||||||
Sbjct: 6440 cacgcgctcggtgacaccactaatggctgcatgtcaactgg 6400



 Score =  101 bits (51), Expect = 1e-18
 Identities = 78/87 (89%)
 Strand = Plus / Minus

                                                                        
Query: 64   cacatacacaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcac 123
            |||||| ||||||||||||||||| ||||||||| |  |||| |||||||||||||||||
Sbjct: 6672 cacatagacaatggtgaaggctgttgctgtgcttgctagcagtgagggtgtcaagggcac 6613

                                       
Query: 124  catcttcttcacccaggagggagatgg 150
            |||||| ||| |||| |||||||||||
Sbjct: 6612 catctttttctcccaagagggagatgg 6586



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                        
Query: 281  catggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgga 340
            |||||||||||  ||||||| | ||||||||| ||||| || |||||| | |||||||||
Sbjct: 6283 catggggcaccacaagatgagaaccgccatgccggtgatcttggaaatataacagctgga 6224

              
Query: 341  gc 342
            ||
Sbjct: 6223 gc 6222



to top

>gb|L19434.1|RICSODCC2A Oryza sativa cytosolic copper/zinc-superoxide dismutase (SodCc2)
            gene, complete cds
          Length = 3522

 Score =  105 bits (53), Expect = 9e-20
 Identities = 89/101 (88%)
 Strand = Plus / Plus

                                                                        
Query: 152  ccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtg 211
            |||||| ||||||||||||||||| | || ||||||  ||||||||| || |||||||||
Sbjct: 2291 ccgacctctgtgacgggaagtgtctctgggctcaagccagggctccatggattccatgtg 2350

                                                     
Query: 212  cacgctcttggtgacaccaccaacggctgcatgtcaactgg 252
            ||||| || ||||||||||| || |||||||||||||||||
Sbjct: 2351 cacgcgctcggtgacaccactaatggctgcatgtcaactgg 2391



 Score =  101 bits (51), Expect = 1e-18
 Identities = 78/87 (89%)
 Strand = Plus / Plus

                                                                        
Query: 64   cacatacacaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcac 123
            |||||| ||||||||||||||||| ||||||||| |  |||| |||||||||||||||||
Sbjct: 2119 cacatagacaatggtgaaggctgttgctgtgcttgctagcagtgagggtgtcaagggcac 2178

                                       
Query: 124  catcttcttcacccaggagggagatgg 150
            |||||| ||| |||| |||||||||||
Sbjct: 2179 catctttttctcccaagagggagatgg 2205



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                        
Query: 281  catggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgga 340
            |||||||||||  ||||||| | ||||||||| ||||| || |||||| | |||||||||
Sbjct: 2508 catggggcaccacaagatgagaaccgccatgccggtgatcttggaaatataacagctgga 2567

              
Query: 341  gc 342
            ||
Sbjct: 2568 gc 2569



to top

>gb|L32834.1|ASNCZSD Aspergillus japonicus (clone Assod4-g) copper/zinc-superoxide
           dismutase gene, 3' end
          Length = 393

 Score =  105 bits (53), Expect = 9e-20
 Identities = 125/149 (83%)
 Strand = Plus / Plus

                                                                       
Query: 194 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 253
           ||||| || |||||||||||||| || ||||||||||| || ||||||||||||||||||
Sbjct: 20  ctccatggattccatgtgcacgcgctcggtgacaccactaatggctgcatgtcaactgga 79

                                                                       
Query: 254 ccgcacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgct 313
           || |||||||| ||  ||||  | |  |||||||||||  ||||||| | ||||||||| 
Sbjct: 80  ccacacttcaatcctactgggaaggaacatggggcaccacaagatgagaaccgccatgcc 139

                                        
Query: 314 ggtgacctcggaaatgtgacagctggagc 342
           ||||| || |||||| | |||||||||||
Sbjct: 140 ggtgatcttggaaatataacagctggagc 168



to top

>gb|AY646367.1| Malus xiaojinensis superoxide dismutase (Sod1) mRNA, complete cds
          Length = 805

 Score = 95.6 bits (48), Expect = 9e-17
 Identities = 147/180 (81%)
 Strand = Plus / Plus

                                                                       
Query: 136 ccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactcaaggaagggct 195
           |||||||||||||||||| || |||||||| ||||||||| | || ||||||   || ||
Sbjct: 175 ccaggagggagatggcccaactactgtgactggaagtgtctctggcctcaagcctggact 234

                                                                       
Query: 196 ccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggacc 255
            || || |||||||| || |||||||| ||||| || ||||| |||||||||||||| ||
Sbjct: 235 tcatggtttccatgtccatgctcttggagacacaacaaacggttgcatgtcaactgggcc 294

                                                                       
Query: 256 gcacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctgg 315
            |||||||| || |||||  | | |||||| || || ||||||||  | |||||||||||
Sbjct: 295 acacttcaatcctgctggaaaagagcatggtgcccctgaagatgagcttcgccatgctgg 354



to top

>gb|AF037359.1|AF037359 Paulownia kawakamii superoxide dismutase (SOD5) mRNA, complete cds
          Length = 794

 Score = 95.6 bits (48), Expect = 9e-17
 Identities = 213/268 (79%)
 Strand = Plus / Plus

                                                                       
Query: 74  atggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttcttc 133
           |||||||||| ||| || ||||| | | |||| |||||||| |  |||||||||| ||||
Sbjct: 88  atggtgaagggtgtcgcagtgctcagcagcagtgagggtgttagtggcaccatctacttc 147

                                                                       
Query: 134 acccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactcaaggaaggg 193
           |||||||| |||||||| || || ||||| || ||||  ||  | || || |||   || 
Sbjct: 148 acccaggaaggagatggtccaacaactgttactggaaacgtttctggccttaagcctgga 207

                                                                       
Query: 194 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 253
           | ||| ||||| |||||||| || ||||||||||||||||| || ||  |||||||||||
Sbjct: 208 ccccatggctttcatgtgcatgcccttggtgacaccaccaatggttgtttgtcaactgga 267

                                                                       
Query: 254 ccgcacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgct 313
           || |||||||| || |||||  | | |||||| || || || |||||  | |||||||||
Sbjct: 268 cctcacttcaatcctgctggcaaagagcatggagctcctgatgatgaggttcgccatgct 327

                                       
Query: 314 ggtgacctcggaaatgtgacagctggag 341
           |||||||| || ||||| |||| |||||
Sbjct: 328 ggtgaccttgggaatgtcacagttggag 355



to top

>gb|AF009735.1| Raphanus sativus Cu/Zn superoxide dismutase (SOD) mRNA, complete
           cds
          Length = 576

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 136/166 (81%)
 Strand = Plus / Plus

                                                                       
Query: 102 gcagcgagggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactg 161
           ||||||||||||| ||||| |||||||||||||||||||| ||| | ||  | |||||||
Sbjct: 106 gcagcgagggtgttaagggaaccatcttcttcacccaggaaggaaacggttccaccactg 165

                                                                       
Query: 162 tgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttg 221
           |||| |||| |||  | || || |||   || ||||| || |||||||| || |||||||
Sbjct: 166 tgactggaactgtttctggccttaagcctggtctccatggtttccatgtccatgctcttg 225

                                                         
Query: 222 gtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccc 267
           |||||||||| || || |||||||| || || ||||| ||||||||
Sbjct: 226 gtgacaccactaatggttgcatgtccaccggtccgcatttcaaccc 271



to top

>gb|AF328859.1| Avicennia marina Cu-Zn superoxide dismutase mRNA, complete cds
          Length = 768

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 105/125 (84%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 259
           ||||| |||||||| || ||||||||||||||||| ||||| ||||||||||| || |||
Sbjct: 173 ggctttcatgtgcatgcccttggtgacaccaccaatggctgtatgtcaactggtcctcac 232

                                                                       
Query: 260 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgac 319
           ||||| || |||||  | |  ||||| || || ||||||||  | |||||||||||||||
Sbjct: 233 ttcaatccggctggcaaagaccatggtgctccagaagatgaggttcgccatgctggtgac 292

                
Query: 320 ctcgg 324
           |||||
Sbjct: 293 ctcgg 297



to top

>gb|U34726.1|ZMU34726 Zea mays superoxide dismutase 4 (sod4) gene, partial cds
          Length = 3039

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 89/104 (85%)
 Strand = Plus / Plus

                                                                        
Query: 149  ggcccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccat 208
            ||||| |||||||| || ||||||||| | || ||||||   || ||||| || ||||||
Sbjct: 2375 ggccctaccactgtcactggaagtgtctctggcctcaagcctggcctccatgggttccat 2434

                                                        
Query: 209  gtgcacgctcttggtgacaccaccaacggctgcatgtcaactgg 252
            ||||| || ||||||||||||||||| |||||||||||||||||
Sbjct: 2435 gtgcatgcacttggtgacaccaccaatggctgcatgtcaactgg 2478



 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 70/79 (88%), Gaps = 1/79 (1%)
 Strand = Plus / Plus

                                                                        
Query: 60   agatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagg 119
            |||||||||| ||| ||||||||||||| ||||||||     ||||||||||||||||||
Sbjct: 2208 agatcacataaaca-tggtgaaggctgttgctgtgctgggtagcagcgagggtgtcaagg 2266

                               
Query: 120  gcaccatcttcttcaccca 138
            |||| ||||||||||||||
Sbjct: 2267 gcacaatcttcttcaccca 2285



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                        
Query: 281  catggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgga 340
            ||||| ||||| |||||||| | ||||||||| ||||| || ||||||||||||||||||
Sbjct: 2612 catggagcaccagaagatgagaaccgccatgccggtgatcttggaaatgtgacagctgga 2671

              
Query: 341  gc 342
            ||
Sbjct: 2672 gc 2673



to top

>emb|AJ844003.1| Plantago major mRNA for copper-zinc superoxide dismutase (csd1
           gene)
          Length = 779

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 115/139 (82%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           |||||||||||||| || |||||||||||||| |||||||| ||||||||||| ||||| 
Sbjct: 187 cacggcttccatgttcatgctcttggtgacactaccaacggttgcatgtcaacaggacca 246

                                                                       
Query: 257 cacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggt 316
           || ||||| || ||||   | | |||||| || || || |||||  | ||||||||||||
Sbjct: 247 catttcaatccggctgcaaaagagcatggtgctcctgatgatgaggttcgccatgctggt 306

                              
Query: 317 gacctcggaaatgtgacag 335
           ||||| || ||||| ||||
Sbjct: 307 gaccttggtaatgtcacag 325



to top

>gb|U34727.1|ZMU34727 Zea mays superoxide dismutase 4A (sod4A) gene, complete cds
          Length = 4326

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 80/91 (87%), Gaps = 1/91 (1%)
 Strand = Plus / Plus

                                                                        
Query: 60   agatcacatacacaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagg 119
            |||||||||| ||| ||||||||||||| ||||||||     ||||||| ||||||||||
Sbjct: 2128 agatcacataaaca-tggtgaaggctgttgctgtgctgggtagcagcgatggtgtcaagg 2186

                                           
Query: 120  gcaccatcttcttcacccaggagggagatgg 150
            |||||||||| |||||||| |||||||||||
Sbjct: 2187 gcaccatctttttcacccaagagggagatgg 2217



 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 57/63 (90%)
 Strand = Plus / Plus

                                                                        
Query: 280  gcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgg 339
            |||||||||||| |||||||| | ||||||||| ||||| || |||||||||||||||||
Sbjct: 2733 gcatggggcaccagaagatgagaaccgccatgccggtgatcttggaaatgtgacagctgg 2792

               
Query: 340  agc 342
            |||
Sbjct: 2793 agc 2795



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                        
Query: 149  ggcccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccat 208
            ||||| ||| |||| || ||||||||| | || ||||||   || ||||| || ||||||
Sbjct: 2505 ggccctaccgctgtcactggaagtgtctctggcctcaagcctggcctccatgggttccat 2564

                                                        
Query: 209  gtgcacgctcttggtgacaccaccaacggctgcatgtcaactgg 252
            || || || ||||||||||||||||| || ||||||||||||||
Sbjct: 2565 gtacatgcacttggtgacaccaccaatggatgcatgtcaactgg 2608



to top

>dbj|AB062752.1| Bruguiera gymnorhiza SodC mRNA for copper/zinc superoxide
           dismutase, complete cds
          Length = 874

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 115/139 (82%)
 Strand = Plus / Plus

                                                                       
Query: 126 tcttcttcacccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactca 185
           ||||||||| ||| |||||||||||||| || ||||| || |||| |||  | || || |
Sbjct: 192 tcttcttcaaccaagagggagatggcccaactactgtaactggaaatgtttctggcctta 251

                                                                       
Query: 186 aggaagggctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgt 245
           ||  |||||| || ||||||||||| || |||||||| ||||| || || || |||||||
Sbjct: 252 agtcagggcttcatggcttccatgttcatgctcttggggacactacaaatggttgcatgt 311

                              
Query: 246 caactggaccgcacttcaa 264
           ||||||| |||||||||||
Sbjct: 312 caactgggccgcacttcaa 330



to top

>gb|DQ078121.2| Rheum australe copper/zinc superoxide dismutase mRNA, complete cds
          Length = 586

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                       
Query: 203 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 262
           |||||||||||||||||||||||||| || || |||||||||||||||||||| || |||
Sbjct: 194 ttccatgtgcacgctcttggtgacacaacaaatggctgcatgtcaactggaccacatttc 253

             
Query: 263 aa 264
           ||
Sbjct: 254 aa 255



 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                         
Query: 57 ctgagatcacatacacaatggtgaaggctgt 87
          |||||||||||  ||||||||||||||||||
Sbjct: 48 ctgagatcacaatcacaatggtgaaggctgt 78



to top

>gb|AF426829.1|AF426829 Olea europaea Cu/Zn-superoxide dismutase mRNA, partial cds
          Length = 312

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 259
           ||||||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| || 
Sbjct: 13  ggcttccatgtccacgcccttggtgacaccaccaatggctgtatgtcaactggacctcat 72

                
Query: 260 ttcaa 264
           |||||
Sbjct: 73  ttcaa 77



to top

>emb|Y13610.1|CPCZSD Carica papaya mRNA for copper/zinc-superoxide dismutase
          Length = 768

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 89/104 (85%), Gaps = 1/104 (0%)
 Strand = Plus / Plus

                                                                       
Query: 57  ctgagatcacatacacaa-tggtgaaggctgtagctgtgcttaccggcagcgagggtgtc 115
           ||||||||||||||| || ||||||||||||||||||| |||| | |||| |||||||||
Sbjct: 37  ctgagatcacatacaaaaatggtgaaggctgtagctgtccttagcagcagtgagggtgtc 96

                                                       
Query: 116 aagggcaccatcttcttcacccaggagggagatggcccgaccac 159
           |  || || |||||||||||||| |  | ||||||||| |||||
Sbjct: 97  agtggaactatcttcttcacccaagcagcagatggcccaaccac 140



 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           |||||||||||||| || ||  | |||||||| || || ||||||||||| ||||| || 
Sbjct: 178 cacggcttccatgttcatgccttgggtgacacaacaaatggctgcatgtcgactggtcct 237

                                                                       
Query: 257 cacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggt 316
           || ||||| || |||||  | |  ||||| || || || ||||| ||||| |||||||||
Sbjct: 238 catttcaatcctgctggcaaagaacatggtgctccagaggatgacatccgtcatgctggt 297

                         
Query: 317 gacctcggaaatgt 330
           ||||| ||||||||
Sbjct: 298 gaccttggaaatgt 311



to top

>gb|DQ088818.1| Gossypium hirsutum cytoplasmic Cu/ZnSOD mRNA, complete cds
          Length = 459

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 112/137 (81%)
 Strand = Plus / Plus

                                                                       
Query: 194 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 253
           ||||| ||||||||||| || || ||||| ||||| || ||||| |||||||||||||||
Sbjct: 121 ctccatggcttccatgttcatgcccttggggacacaactaacgggtgcatgtcaactgga 180

                                                                       
Query: 254 ccgcacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgct 313
           || || || || || |||||  | | |||||| || || |||||||| | ||||||||||
Sbjct: 181 ccccattttaatcctgctggcaaagagcatggtgctccngaagatgagaaccgccatgct 240

                            
Query: 314 ggtgacctcggaaatgt 330
           ||||| || || |||||
Sbjct: 241 ggtgatctaggnaatgt 257



to top

>emb|AJ428575.2|OEU428575 Olea europaea Cu/Zn super-oxide dismutase (ole e 5 allergen)
          Length = 714

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 99/119 (83%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 259
           ||||| ||||| ||||| ||||||||||||||||| ||||| |||||||||||||| || 
Sbjct: 127 ggctttcatgtccacgcccttggtgacaccaccaatggctgtatgtcaactggacctcat 186

                                                                      
Query: 260 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 318
           ||||| || | |||  | | |||||| ||||| | |||||| | ||| |||||||||||
Sbjct: 187 ttcaatcctgttgggaaagagcatggtgcacctggagatgagaaccgtcatgctggtga 245



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 74  atggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttcttc 133
           ||||||||||| ||| | || || | | |||||||||||||||  |||||| ||| ||||
Sbjct: 1   atggtgaaggccgtaacagtcctcaacagcagcgagggtgtcactggcaccgtctacttc 60

                            
Query: 134 acccaggagggagatgg 150
           ||||| || ||||||||
Sbjct: 61  acccaagaaggagatgg 77



to top

>emb|AJ278669.1|PTR278669 Populus tremula x Populus tremuloides mRNA for putative cytosolic
           CuZn-superoxide dismutase (cyt-SOD1 gene)
          Length = 851

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 163/203 (80%), Gaps = 1/203 (0%)
 Strand = Plus / Plus

                                                                       
Query: 57  ctgagatcacataca-caatggtgaaggctgtagctgtgcttaccggcagcgagggtgtc 115
           ||||||||||||| | |||||||||||||||| ||||| || |   |||| || ||||||
Sbjct: 61  ctgagatcacatagaacaatggtgaaggctgttgctgttctgaatagcagtgaaggtgtc 120

                                                                       
Query: 116 aagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgggaagtgtc 175
           || |||||||||  ||| ||||| || |||||||| || || ||||| || |||||  ||
Sbjct: 121 aaaggcaccatcaactttacccaagaaggagatggtccaactactgtaactggaagcctc 180

                                                                       
Query: 176 acgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgacaccaccaac 235
              || || |||  ||| || || ||||||||||| || || ||||| |||||||| || 
Sbjct: 181 tgtggtcttaagccaggccttcatggcttccatgttcatgcccttggagacaccacaaat 240

                                  
Query: 236 ggctgcatgtcaactggaccgca 258
           ||||||||||||||||| |||||
Sbjct: 241 ggctgcatgtcaactggcccgca 263



to top

>dbj|AB190501.1| Populus alba x Populus tremula var. glandulosa CuZn-SOD mRNA for
           CuZn-superoxide dismutase, complete cds, clone:
           PO3024C12
          Length = 730

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 163/203 (80%), Gaps = 1/203 (0%)
 Strand = Plus / Plus

                                                                       
Query: 57  ctgagatcacataca-caatggtgaaggctgtagctgtgcttaccggcagcgagggtgtc 115
           ||||||||||||| | |||||||||||||||| ||||| || |   |||| || ||||||
Sbjct: 60  ctgagatcacatagaacaatggtgaaggctgttgctgttctgaatagcagtgaaggtgtc 119

                                                                       
Query: 116 aagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgggaagtgtc 175
           || |||||||||  ||| ||||| || |||||||| || || ||||| || |||||  ||
Sbjct: 120 aaaggcaccatcaactttacccaagaaggagatggtccaactactgtaactggaagcctc 179

                                                                       
Query: 176 acgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgacaccaccaac 235
              || || |||  ||| || || ||||||||||| || || ||||| |||||||| || 
Sbjct: 180 tgtggtcttaagccaggccttcatggcttccatgttcatgcccttggagacaccacaaat 239

                                  
Query: 236 ggctgcatgtcaactggaccgca 258
           ||||||||||||||||| |||||
Sbjct: 240 ggctgcatgtcaactggcccgca 262



to top

>dbj|AB190500.1| Populus alba x Populus tremula var. glandulosa CuZn-SOD mRNA for
           CuZn-superoxide dismutase, complete cds, clone:
           PO3023E02
          Length = 725

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 163/203 (80%), Gaps = 1/203 (0%)
 Strand = Plus / Plus

                                                                       
Query: 57  ctgagatcacataca-caatggtgaaggctgtagctgtgcttaccggcagcgagggtgtc 115
           ||||||||||||| | |||||||||||||||| ||||| || |   |||| || ||||||
Sbjct: 80  ctgagatcacatagaacaatggtgaaggctgttgctgttctgaatagcagtgaaggtgtc 139

                                                                       
Query: 116 aagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgggaagtgtc 175
           || |||||||||  ||| ||||| || |||||||| || || ||||| || |||||  ||
Sbjct: 140 aaaggcaccatcaactttacccaagaaggagatggtccaactactgtaactggaagcctc 199

                                                                       
Query: 176 acgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgacaccaccaac 235
              || || |||  ||| || || ||||||||||| || || ||||| |||||||| || 
Sbjct: 200 tgtggtcttaagccaggccttcatggcttccatgttcatgcccttggagacaccacaaat 259

                                  
Query: 236 ggctgcatgtcaactggaccgca 258
           ||||||||||||||||| |||||
Sbjct: 260 ggctgcatgtcaactggcccgca 282



to top

>dbj|AB091055.1| Barbula unguiculata mRNA for cytosolic copper/zinc superoxide
           dismutase, partial cds
          Length = 276

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                       
Query: 194 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 253
           |||||||| ||||| || ||||| || |||||||| ||||| ||||||||||||||||| 
Sbjct: 4   ctccacggattccacgttcacgccctgggtgacacaaccaatggctgcatgtcaactggt 63

                          
Query: 254 ccgcacttcaacccc 268
           || ||||||||||||
Sbjct: 64  ccccacttcaacccc 78



to top

>gb|AF016892.1|AF016892 Populus tremuloides cytoplasmic superoxide dismutase 1 (SODcyt1)
           mRNA, complete cds
          Length = 787

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 91/107 (85%), Gaps = 1/107 (0%)
 Strand = Plus / Plus

                                                                       
Query: 57  ctgagatcacataca-caatggtgaaggctgtagctgtgcttaccggcagcgagggtgtc 115
           ||||||||||||| | |||||||||||||||||||||| ||||   |||| || ||||| 
Sbjct: 61  ctgagatcacatagaacaatggtgaaggctgtagctgttcttaatagcagtgaaggtgtg 120

                                                          
Query: 116 aagggcaccatcttcttcacccaggagggagatggcccgaccactgt 162
           |  |||||||||||||| ||||| || ||||||||||| || |||||
Sbjct: 121 agtggcaccatcttctttacccaagaaggagatggcccaactactgt 167



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 200 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgca 258
           |||||||| || || || ||||| |||||||| || ||||||||||||||||| |||||
Sbjct: 205 ggcttccacgtccatgcccttggagacaccacaaatggctgcatgtcaactgggccgca 263



to top

>gb|U80069.1|MCU80069 Mesembryanthemum crystallinum cytosolic copper/zinc superoxide
           dismutase (SOD) mRNA, complete cds
          Length = 816

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 191 gggctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaact 250
           |||||||| || || ||||| ||||| |||||||||||||| || ||||||||||| |||
Sbjct: 248 gggctccatggatttcatgttcacgcccttggtgacaccacaaatggctgcatgtccact 307

                                  
Query: 251 ggaccgcacttcaaccccgctgg 273
           ||||| |||||||| || |||||
Sbjct: 308 ggaccacacttcaatcctgctgg 330



to top

>emb|X95728.1|BJMSOD1GE B.juncea mRNA for Cu/Zn-superoxide dismutase
          Length = 766

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 134/166 (80%)
 Strand = Plus / Plus

                                                                       
Query: 102 gcagcgagggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactg 161
           ||||||||||||| ||||| |||||||||||||| ||||| ||| | ||  | |||||||
Sbjct: 107 gcagcgagggtgttaaggggaccatcttcttcactcaggaaggaaacggtaccaccactg 166

                                                                       
Query: 162 tgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttg 221
           |||| ||||  ||  | || || |||   || ||||| || |||||||| || |||||||
Sbjct: 167 tgacaggaaccgtttctggccttaagcctggtctccatggtttccatgtccatgctcttg 226

                                                         
Query: 222 gtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccc 267
           |||||||||| ||||| |||||||| || || || || ||||||||
Sbjct: 227 gtgacaccactaacggttgcatgtctaccggtccacatttcaaccc 272



to top

>gb|AF071112.1|AF071112 Brassica rapa ssp. pekinensis cytosolic Cu/Zn superoxide dismutase
           mRNA, complete cds
          Length = 757

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 134/166 (80%)
 Strand = Plus / Plus

                                                                       
Query: 102 gcagcgagggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactg 161
           |||| |||||||| ||||| || ||||||||||||||||| ||||||||  | || ||||
Sbjct: 123 gcagtgagggtgttaaggggactatcttcttcacccaggaaggagatggtgccacaactg 182

                                                                       
Query: 162 tgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttg 221
           |||| |||| |||  | || || ||    || | ||| || |||||||| || |||||||
Sbjct: 183 tgactggaactgtttctggtcttaaacctggtccccatggtttccatgtccatgctcttg 242

                                                         
Query: 222 gtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccc 267
           |||||||||||||||| |||||||| || || || || ||||||||
Sbjct: 243 gtgacaccaccaacggttgcatgtctaccggtccacatttcaaccc 288



to top

>gb|AF054150.1|AF054150 Zantedeschia aethiopica cytosolic Cu/Zn-superoxide dismutase (sod3)
           mRNA, complete cds
          Length = 832

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 139/173 (80%)
 Strand = Plus / Plus

                                                                       
Query: 74  atggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttcttc 133
           |||||||||||||| || || ||||| ||    ||||||||| |||||||| | ||||| 
Sbjct: 145 atggtgaaggctgttgccgttcttactggatcggagggtgtccagggcaccgtgttcttt 204

                                                                       
Query: 134 acccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactcaaggaaggg 193
            |||||||||| || |||||||| ||  | ||||| ||| |  |||| || |||   |||
Sbjct: 205 gcccaggagggggaaggcccgactaccattacggggagtttgtcgggcctaaagcctggg 264

                                                                
Query: 194 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 246
           || |||||||| ||||||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 265 cttcacggctttcatgtgcacgcgcttggtgacactaccaatggctgtatgtc 317



to top

>ref|NM_100757.2| Arabidopsis thaliana CSD1; copper, zinc superoxide dismutase
           AT1G08830 (CSD1) mRNA, complete cds
          Length = 789

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 203 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 262
           |||||||| || ||||||||||||||||| ||||| |||||||| ||||| || || |||
Sbjct: 256 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactggtccacatttc 315

                       
Query: 263 aaccccgctggt 274
           ||||||| ||||
Sbjct: 316 aaccccgatggt 327



to top

>gb|DQ227345.1| Nelumbo nucifera isolate 0 copper-zinc superoxide dismutase
           (CuZn-SOD) mRNA, complete cds
          Length = 461

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 203 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 262
           |||||||| || |||||||||||||| || || || ||||||||||| ||||| || || 
Sbjct: 131 ttccatgtccatgctcttggtgacacaacaaatggttgcatgtcaacaggaccacatttt 190

                                                                       
Query: 263 aaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctc 322
           |||||   |||| | | |||||| || ||||| ||||||| ||| |||||||||||||| 
Sbjct: 191 aaccctcatggtaaagagcatggtgctcccgaggatgaaaaccgtcatgctggtgacctt 250

                   
Query: 323 ggaaatgt 330
           || |||||
Sbjct: 251 gggaatgt 258



to top

>gb|DQ481231.1| Populus suaveolens cytoplasmic Cu/Zn-superoxide dismutase (SODcyt1)
           mRNA, complete cds
          Length = 487

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 150/188 (79%)
 Strand = Plus / Plus

                                                                       
Query: 71  acaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttc 130
           ||||||||||||||||||||||| ||||   |||| || ||||| |  ||||||||||||
Sbjct: 17  acaatggtgaaggctgtagctgttcttaatagcagtgaaggtgtgagtggcaccatcttc 76

                                                                       
Query: 131 ttcacccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactcaaggaa 190
           || ||||| || ||||||||||| || ||||| || ||||   |  | || || |||  |
Sbjct: 77  tttacccaagaaggagatggcccaactactgtaactggaaacctttctggtcttaagcca 136

                                                                       
Query: 191 gggctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaact 250
           || || || |||||||| || || || ||| | |||||||| || |||||||||||||||
Sbjct: 137 ggccttcatggcttccacgtccatgcccttagagacaccacaaatggctgcatgtcaact 196

                   
Query: 251 ggaccgca 258
           || |||||
Sbjct: 197 gggccgca 204



to top

>gb|AY091168.1| Arabidopsis thaliana putative superoxide dismutase (At1g08830)
           mRNA, complete cds
          Length = 490

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 203 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 262
           |||||||| || ||||||||||||||||| ||||| |||||||| ||||| || || |||
Sbjct: 130 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactggtccacatttc 189

                       
Query: 263 aaccccgctggt 274
           ||||||| ||||
Sbjct: 190 aaccccgatggt 201



to top

>gb|AY050932.1| Arabidopsis thaliana putative superoxidase dismutase (At1g08830)
           mRNA, complete cds
          Length = 769

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 203 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 262
           |||||||| || ||||||||||||||||| ||||| |||||||| ||||| || || |||
Sbjct: 225 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactggtccacatttc 284

                       
Query: 263 aaccccgctggt 274
           ||||||| ||||
Sbjct: 285 aaccccgatggt 296



to top

>emb|X60935.1|ATCZSUDI A.thaliana mRNA for Cu,Zn superoxide dismutase
          Length = 788

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 203 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 262
           |||||||| || ||||||||||||||||| ||||| |||||||| ||||| || || |||
Sbjct: 242 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactggtccacatttc 301

                       
Query: 263 aaccccgctggt 274
           ||||||| ||||
Sbjct: 302 aaccccgatggt 313



to top

>emb|X55974.1|NPSODM N.plumbaginifolia mRNA for superoxide dismutase
          Length = 837

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 208/264 (78%), Gaps = 1/264 (0%)
 Strand = Plus / Plus

                                                                       
Query: 56  cctgagatcacatac-acaatggtgaaggctgtagctgtgcttaccggcagcgagggtgt 114
           ||||||||||||||| | |||||||||||| || || || |||| | |||| || |||||
Sbjct: 70  cctgagatcacataccaaaatggtgaaggccgttgccgtccttagcagcagtgaaggtgt 129

                                                                       
Query: 115 caagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgggaagtgt 174
            |  ||||||||||||||||| || || |||||||  || ||||| || || |||| |||
Sbjct: 130 tagcggcaccatcttcttcactcaagatggagatgcaccaaccacagttactggaaatgt 189

                                                                       
Query: 175 cacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgacaccaccaa 234
           | | || || ||    || || || ||||||||||| || || |||||||| ||||| ||
Sbjct: 190 ctctggcctaaaacccggacttcatggcttccatgtccatgcccttggtgataccacaaa 249

                                                                       
Query: 235 cggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatggggcacccga 294
            |||||||||||||| ||||| || | ||| || |||||| | | |||||| || || ||
Sbjct: 250 tggctgcatgtcaacgggaccacattacaatcctgctggtaaggagcatggtgctcctga 309

                                   
Query: 295 agatgaaatccgccatgctggtga 318
           ||||||  | || |||||||||||
Sbjct: 310 agatgaggtgcgtcatgctggtga 333



to top

>emb|BX818158.1|CNS0AE2K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL64ZA05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 737

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 203 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 262
           |||||||| || ||||||||||||||||| ||||| |||||||| ||||| || || |||
Sbjct: 204 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactggtccacatttc 263

                       
Query: 263 aaccccgctggt 274
           ||||||| ||||
Sbjct: 264 aaccccgatggt 275



to top

>gb|AY087273.1| Arabidopsis thaliana clone 33493 mRNA, complete sequence
          Length = 788

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 203 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 262
           |||||||| || ||||||||||||||||| ||||| |||||||| ||||| || || |||
Sbjct: 256 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactggtccacatttc 315

                       
Query: 263 aaccccgctggt 274
           ||||||| ||||
Sbjct: 316 aaccccgatggt 327



to top

>gb|AY881163.1| Nelumbo nucifera isolate 13 copper-zinc superoxide dismutase mRNA,
           partial cds
          Length = 457

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 203 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 262
           |||||||| || |||||||||||||| || || || ||||||||||| ||||| || || 
Sbjct: 131 ttccatgtccatgctcttggtgacacaacaaatggttgcatgtcaacaggaccacatttt 190

                                                                       
Query: 263 aaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctc 322
           |||||   |||| | | |||||| || ||||| ||||||| ||| |||||||||||||| 
Sbjct: 191 aaccctcatggtaaagagcatggtgctcccgaggatgaaaaccgtcatgctggtgacctt 250

                   
Query: 323 ggaaatgt 330
           || |||||
Sbjct: 251 gggaatgt 258



to top

>gb|AY881162.1| Nelumbo nucifera isolate 11 copper-zinc superoxide dismutase mRNA,
           partial cds
          Length = 457

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 203 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 262
           |||||||| || |||||||||||||| || || || ||||||||||| ||||| || || 
Sbjct: 131 ttccatgtccatgctcttggtgacacaacaaatggttgcatgtcaacaggaccacatttt 190

                                                                       
Query: 263 aaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctc 322
           |||||   |||| | | |||||| || ||||| ||||||| ||| |||||||||||||| 
Sbjct: 191 aaccctcatggtaaagagcatggtgctcccgaggatgaaaaccgtcatgctggtgacctt 250

                   
Query: 323 ggaaatgt 330
           || |||||
Sbjct: 251 gggaatgt 258



to top

>gb|AY881155.1| Nelumbo nucifera isolate 4 copper-zinc superoxide dismutase mRNA,
           partial cds
          Length = 457

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 203 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 262
           |||||||| || |||||||||||||| || || || ||||||||||| ||||| || || 
Sbjct: 131 ttccatgtccatgctcttggtgacacaacaaatggttgcatgtcaacaggaccacatttt 190

                                                                       
Query: 263 aaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctc 322
           |||||   |||| | | |||||| || ||||| ||||||| ||| |||||||||||||| 
Sbjct: 191 aaccctcatggtaaagagcatggtgctcccgaggatgaaaaccgtcatgctggtgacctt 250

                   
Query: 323 ggaaatgt 330
           || |||||
Sbjct: 251 gggaatgt 258



to top

>emb|AJ844861.1| Drosophila bipectinata partial Sod gene, exons 1-2, strain Pune
          Length = 996

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           |||||||||||||||||||   ||||||||| ||||||||||||||||||  |||| || 
Sbjct: 714 cacggcttccatgtgcacgagtttggtgacaacaccaacggctgcatgtcctctggtcct 773

                      
Query: 257 cacttcaaccc 267
           || ||||||||
Sbjct: 774 catttcaaccc 784



to top

>emb|AJ844854.1| Drosophila malerkotliana pallens partial Sod gene, exons 1-2,
           strain KB270
          Length = 1000

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           |||||||||||||||||||   ||||||||| ||||||||||||||||||  |||| || 
Sbjct: 718 cacggcttccatgtgcacgagtttggtgacaacaccaacggctgcatgtcctctggtcct 777

                      
Query: 257 cacttcaaccc 267
           || ||||||||
Sbjct: 778 catttcaaccc 788



to top

>emb|AJ844850.1| Drosophila bipectinata partial Sod gene, exons 1-2, strain 381.3
          Length = 994

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           |||||||||||||||||||   ||||||||| ||||||||||||||||||  |||| || 
Sbjct: 712 cacggcttccatgtgcacgagtttggtgacaacaccaacggctgcatgtcctctggtcct 771

                      
Query: 257 cacttcaaccc 267
           || ||||||||
Sbjct: 772 catttcaaccc 782



to top

>emb|AJ844844.1| Drosophila malerkotliana malerkotliana partial Sod gene, exons 1-2,
           strain 391.0
          Length = 994

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           |||||||||||||||||||   ||||||||| ||||||||||||||||||  |||| || 
Sbjct: 712 cacggcttccatgtgcacgagtttggtgacaacaccaacggctgcatgtcctctggtccc 771

                      
Query: 257 cacttcaaccc 267
           || ||||||||
Sbjct: 772 catttcaaccc 782



to top

>gb|AY694187.1| Camellia sinensis Cu/Zn superoxide dismutase mRNA, partial cds
          Length = 403

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 103/126 (81%)
 Strand = Plus / Plus

                                                                       
Query: 203 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 262
           |||||||| || |||||||| ||||| ||||| || ||||||||||||||||| || |||
Sbjct: 73  ttccatgttcatgctcttggggacacaaccaatggttgcatgtcaactggaccacatttc 132

                                                                       
Query: 263 aaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctc 322
           || || |||||  | | ||||||| | || |||||||| |  || ||||||||||| || 
Sbjct: 133 aatcctgctggcaaagagcatgggtctcctgaagatgagactcgtcatgctggtgatctt 192

                 
Query: 323 ggaaat 328
           ||||||
Sbjct: 193 ggaaat 198



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                            
Query: 155      accactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcac 214
                ||||||||||| ||||||||| | || ||||||   || ||||| || |||||| | || 
Sbjct: 13157201 accactgtgactggaagtgtctctggcctcaagcctggtctccatgggttccatattcat 13157260

                                                      
Query: 215      gctcttggtgacaccaccaacggctgcatgtcaactgg 252
                || ||||||||||||||||| || ||||||||||||||
Sbjct: 13157261 gcacttggtgacaccaccaatggttgcatgtcaactgg 13157298



 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                            
Query: 280      gcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgg 339
                |||||| ||||| |||||||| | ||||||||||||||| || |||||||| || |||||
Sbjct: 13157450 gcatggagcaccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctgg 13157509

                  
Query: 340      ag 341
                ||
Sbjct: 13157510 ag 13157511



 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                      
Query: 60       agatcacatacacaatggtgaaggctgtagctgtgctt 97
                |||||||||  ||||||||||||||||| | |||||||
Sbjct: 13157014 agatcacattaacaatggtgaaggctgttgttgtgctt 13157051



 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 219     ttggtgacaccaccaacggctgca 242
               |||| |||||||||||||||||||
Sbjct: 6243317 ttggcgacaccaccaacggctgca 6243294



to top

>gb|AC135257.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1113A07,
             from chromosome 3, complete sequence
          Length = 151173

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                         
Query: 155   accactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcac 214
             ||||||||||| ||||||||| | || ||||||   || ||||| || |||||| | || 
Sbjct: 69437 accactgtgactggaagtgtctctggcctcaagcctggtctccatgggttccatattcat 69378

                                                   
Query: 215   gctcttggtgacaccaccaacggctgcatgtcaactgg 252
             || ||||||||||||||||| || ||||||||||||||
Sbjct: 69377 gcacttggtgacaccaccaatggttgcatgtcaactgg 69340



 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                         
Query: 280   gcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgg 339
             |||||| ||||| |||||||| | ||||||||||||||| || |||||||| || |||||
Sbjct: 69188 gcatggagcaccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctgg 69129

               
Query: 340   ag 341
             ||
Sbjct: 69128 ag 69127



 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 60    agatcacatacacaatggtgaaggctgtagctgtgctt 97
             |||||||||  ||||||||||||||||| | |||||||
Sbjct: 69624 agatcacattaacaatggtgaaggctgttgttgtgctt 69587



to top

>emb|X53872.1|SOSODCY Spinacia oleracea mRNA for cytosolic copper/zinc-superoxide
           dismutase (EC 1.15.1.1)
          Length = 795

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 103/126 (81%)
 Strand = Plus / Plus

                                                                       
Query: 135 cccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactcaaggaagggc 194
           ||||||| |||||||| || || ||||| || |||| |||| | || ||||||   ||||
Sbjct: 132 cccaggaaggagatggtccaacaactgttactggaaatgtctccggtctcaagcctgggc 191

                                                                       
Query: 195 tccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggac 254
           |||| || || ||||| || || ||||||||||| || || ||||||||||||||||| |
Sbjct: 192 tccatggatttcatgttcatgcccttggtgacacaacaaatggctgcatgtcaactgggc 251

                 
Query: 255 cgcact 260
           ||||||
Sbjct: 252 cgcact 257



to top

>emb|AJ844862.1| Drosophila bipectinata partial Sod gene, exons 1-2, strain KB51
          Length = 1001

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 246
           |||||||||||||||||||   ||||||||| ||||||||||||||||||
Sbjct: 719 cacggcttccatgtgcacgagtttggtgacaacaccaacggctgcatgtc 768



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                            
Query: 155      accactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcac 214
                ||||||||||| ||||||||| | || ||||||   || ||||| || |||||| | || 
Sbjct: 13153976 accactgtgactggaagtgtctctggcctcaagcctggtctccatgggttccatattcat 13154035

                                                      
Query: 215      gctcttggtgacaccaccaacggctgcatgtcaactgg 252
                || ||||||||||||||||| || ||||||||||||||
Sbjct: 13154036 gcacttggtgacaccaccaatggttgcatgtcaactgg 13154073



 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                            
Query: 280      gcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgg 339
                |||||| ||||| |||||||| | ||||||||||||||| || |||||||| || |||||
Sbjct: 13154225 gcatggagcaccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctgg 13154284

                  
Query: 340      ag 341
                ||
Sbjct: 13154285 ag 13154286



 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                      
Query: 60       agatcacatacacaatggtgaaggctgtagctgtgctt 97
                |||||||||  ||||||||||||||||| | |||||||
Sbjct: 13153789 agatcacattaacaatggtgaaggctgttgttgtgctt 13153826



 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 219     ttggtgacaccaccaacggctgca 242
               |||| |||||||||||||||||||
Sbjct: 6242530 ttggcgacaccaccaacggctgca 6242507



to top

>gb|L19435.1|RICSODCC Oryza sativa cytosolic copper/zinc-superoxide dismutase (SodCc1)
            gene, complete cds
          Length = 4253

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                        
Query: 155  accactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcac 214
            ||||||||||| ||||||||| | || ||||||   || ||||| || |||||| | || 
Sbjct: 2429 accactgtgactggaagtgtctctggcctcaagcctggtctccatgggttccatattcat 2488

                                                  
Query: 215  gctcttggtgacaccaccaacggctgcatgtcaactgg 252
            || ||||||||||||||||| || ||||||||||||||
Sbjct: 2489 gcacttggtgacaccaccaatggttgcatgtcaactgg 2526



 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                        
Query: 280  gcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgg 339
            |||||| ||||| |||||||| | ||||||||||||||| || |||||||| || |||||
Sbjct: 2678 gcatggagcaccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctgg 2737

              
Query: 340  ag 341
            ||
Sbjct: 2738 ag 2739



 Score = 44.1 bits (22), Expect = 0.29
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 60   agatcacatacacaatggtgaaggctgtagctgtgctt 97
            |||||||||  ||||||||||||||||| | |||||||
Sbjct: 2242 agatcacattaacaatggtgaaggctgttgttgtgctt 2279



to top

>gb|AY642137.1| Manihot esculenta copper/zinc superoxide dismutase mRNA, complete
           cds
          Length = 774

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 156/197 (79%)
 Strand = Plus / Plus

                                                                       
Query: 71  acaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttc 130
           |||||||||||||| || ||||| |||| | | || ||||||||    || || ||||||
Sbjct: 11  acaatggtgaaggccgttgctgttcttaacagtagtgagggtgttgctgggacaatcttc 70

                                                                       
Query: 131 ttcacccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactcaaggaa 190
           |||||||| || |||||||| || ||||| || || ||||||||  | || || |||  |
Sbjct: 71  ttcacccaagaaggagatggtccaaccaccgtcactggaagtgtttctggccttaagcca 130

                                                                       
Query: 191 gggctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaact 250
           ||||| || || |||||||| || || ||||| ||||| || || || ||||||||||||
Sbjct: 131 gggcttcatggattccatgttcatgcccttggagacacaacaaatggttgcatgtcaact 190

                            
Query: 251 ggaccgcacttcaaccc 267
           || || || ||||||||
Sbjct: 191 gggccacatttcaaccc 207



to top

>gb|DQ124227.1| Fagus sylvatica putative copper/zinc-superoxide dismutase mRNA,
           partial cds
          Length = 388

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                       
Query: 194 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 253
           ||||| |||||||| ||||| |||||||| ||||| || || || |||||||||||||||
Sbjct: 122 ctccatggcttccacgtgcatgctcttggggacacaacaaatggttgcatgtcaactgga 181

                               
Query: 254 ccgcacttcaaccccgctgg 273
           || || ||||| || |||||
Sbjct: 182 ccacatttcaatcctgctgg 201



to top

>emb|AJ586519.1| Fagus sylvatica partial sod1 mRNA for superoxide dismutase
          Length = 710

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                       
Query: 194 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 253
           ||||| |||||||| ||||| |||||||| ||||| || || || |||||||||||||||
Sbjct: 163 ctccatggcttccacgtgcatgctcttggggacacaacaaatggttgcatgtcaactgga 222

                               
Query: 254 ccgcacttcaaccccgctgg 273
           || || ||||| || |||||
Sbjct: 223 ccacatttcaatcctgctgg 242



to top

>emb|BX816203.1|CNS0AE91 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH34ZB02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 748

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 203 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 262
           ||||||||||| |||||||||||||||||  |||| ||||| || ||||| || || |||
Sbjct: 225 ttccatgtgcatgctcttggtgacaccactgacggttgcatctctactggtccacatttc 284

                       
Query: 263 aaccccgctggt 274
           ||||||| ||||
Sbjct: 285 aaccccgatggt 296



to top

>gb|AF016893.1|AF016893 Populus tremuloides copper/zinc-superoxide dismutase (SodCc1) gene,
            complete cds
          Length = 4390

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                        
Query: 71   acaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttc 130
            ||||||||||||||||||||||| ||||   |||| || ||||| |  ||||||||||||
Sbjct: 2408 acaatggtgaaggctgtagctgttcttaatagcagtgaaggtgtgagtggcaccatcttc 2467

                                
Query: 131  ttcacccaggagggagatgg 150
            || ||||| || ||||||||
Sbjct: 2468 tttacccaagaaggagatgg 2487



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                 
Query: 200  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgg 252
            |||||||| || || || ||||| |||||||| || |||||||||||||||||
Sbjct: 2626 ggcttccacgtccatgcccttggagacaccacaaatggctgcatgtcaactgg 2678



to top

>emb|AJ844865.1| Drosophila parabipectinata partial Sod gene, exons 1-2, strain
           Yunnan 7
          Length = 977

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           |||||||||||||||||||   |||| |||| ||||||||||||||||||  |||| || 
Sbjct: 695 cacggcttccatgtgcacgagtttggcgacaacaccaacggctgcatgtcctctggtcct 754

                      
Query: 257 cacttcaaccc 267
           || ||||||||
Sbjct: 755 catttcaaccc 765



to top

>emb|AJ844860.1| Drosophila bipectinata partial Sod gene, exons 1-2, strain 211.5
          Length = 933

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           |||||||||||||||||||   |||| |||| ||||||||||||||||||  |||| || 
Sbjct: 651 cacggcttccatgtgcacgagtttggcgacaacaccaacggctgcatgtcctctggtcct 710

                      
Query: 257 cacttcaaccc 267
           || ||||||||
Sbjct: 711 catttcaaccc 721



to top

>emb|AJ844859.1| Drosophila bipectinata partial Sod gene, exons 1-2, strain 381.4
          Length = 995

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           |||||||||||||||||||   |||| |||| ||||||||||||||||||  |||| || 
Sbjct: 713 cacggcttccatgtgcacgagtttggcgacaacaccaacggctgcatgtcctctggtcct 772

                      
Query: 257 cacttcaaccc 267
           || ||||||||
Sbjct: 773 catttcaaccc 783



to top

>emb|AJ844855.1| Drosophila malerkotliana pallens partial Sod gene, exons 1-2,
           strain KB447
          Length = 1025

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           |||||||| ||||||||||   ||||||||| ||||||||||||||||||  |||| || 
Sbjct: 743 cacggctttcatgtgcacgagtttggtgacaacaccaacggctgcatgtcctctggtcct 802

                      
Query: 257 cacttcaaccc 267
           || ||||||||
Sbjct: 803 catttcaaccc 813



to top

>emb|AJ844839.1| Drosophila malerkotliana malerkotliana partial Sod gene, exons 1-2,
           strain Raichuri
          Length = 1000

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           |||||||||||||||||||   |||| |||| ||||||||||||||||||  |||| || 
Sbjct: 718 cacggcttccatgtgcacgaatttggcgacaacaccaacggctgcatgtcctctggtcct 777

                      
Query: 257 cacttcaaccc 267
           || ||||||||
Sbjct: 778 catttcaaccc 788



to top

>gb|AF355460.1|AF355460 Solanum tuberosum Cu/Zn-superoxide dismutase mRNA, partial cds
          Length = 617

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 259
           ||||||||||| || || |||||||| ||||| || |||||||||||||| ||||| || 
Sbjct: 105 ggcttccatgtccatgcccttggtgataccacaaatggctgcatgtcaacaggaccacat 164

                                                                      
Query: 260 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 318
           | ||| || |||||| | | |||||| || || ||||||||  | || |||||||||||
Sbjct: 165 tacaatcctgctggtaaggagcatggtgctcctgaagatgaggtgcgtcatgctggtga 223



to top

>gb|AF354748.1|AF354748 Solanum tuberosum copper-zinc superoxide dismutase mRNA, partial
           cds
          Length = 443

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 259
           ||||||||||| || || |||||||| ||||| || |||||||||||||| ||||| || 
Sbjct: 115 ggcttccatgtccatgcccttggtgataccacaaatggctgcatgtcaacaggaccacat 174

                                                                      
Query: 260 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 318
           | ||| || |||||| | | |||||| || || ||||||||  | || |||||||||||
Sbjct: 175 tacaatcctgctggtaaggagcatggtgctcctgaagatgaggtgcgtcatgctggtga 233



to top

>gb|AF009734.1|AF009734 Capsicum annuum Cu/Zn superoxide dismutase (SOD) mRNA, complete cds
          Length = 730

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 259
           ||||||||||| || || |||||||| ||||| || |||||||||||||| ||||| || 
Sbjct: 173 ggcttccatgtacatgcccttggtgataccacaaatggctgcatgtcaacaggaccacat 232

                                                                      
Query: 260 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 318
           | ||| || |||||| | |  ||||| || || |||||||| | ||| |||||||||||
Sbjct: 233 tacaatcctgctggtaaggaacatggtgctcctgaagatgagaaccgtcatgctggtga 291



to top

>gb|AC003981.2|AC003981 Genomic sequence for Arabidopsis thaliana BAC F22O13 from chromosome I,
              complete sequence
          Length = 133843

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 203    ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgg 252
              |||||||| || ||||||||||||||||| ||||| |||||||| |||||
Sbjct: 125851 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactgg 125900



to top

>gb|AF034630.1|AF034630 Panax ginseng Cu/Zn superoxide dismutase (SOD) mRNA, complete cds
          Length = 624

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 96/118 (81%)
 Strand = Plus / Plus

                                                                       
Query: 218 cttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcat 277
           |||||||| || || ||||| ||| ||||||||||||| || |  ||||| |||  | | 
Sbjct: 163 cttggtgatacaacaaacggttgcctgtcaactggaccccattataaccctgctaataaa 222

                                                                     
Query: 278 gtgcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacag 335
           | |||||| || || |||||||| | ||||||||||||||| ||||| ||||||||||
Sbjct: 223 gagcatggtgctccggaagatgagacccgccatgctggtgatctcgggaatgtgacag 280



 Score = 40.1 bits (20), Expect = 4.6
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Plus

                                          
Query: 57 ctgagatcacataca-caatggtgaaggctgt 87
          ||||||||||||| | ||||||||||||||||
Sbjct: 1  ctgagatcacatataacaatggtgaaggctgt 32



to top

>gb|AF540558.1| Brassica juncea clone SOD 8A superoxide dismutase mRNA, complete
           cds
          Length = 755

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 128/161 (79%)
 Strand = Plus / Plus

                                                                       
Query: 107 gagggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacg 166
           |||||||| ||||| || ||||| ||||||||||| ||||| ||   |||||||||||| 
Sbjct: 107 gagggtgttaaggggactatctttttcacccaggaaggagacggtgtgaccactgtgact 166

                                                                       
Query: 167 ggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgac 226
           ||||  ||  | ||||| ||    || || || || |||||||| || ||||||||||||
Sbjct: 167 ggaacagtttctggacttaaacctggtctacatggtttccatgtccatgctcttggtgac 226

                                                    
Query: 227 accaccaacggctgcatgtcaactggaccgcacttcaaccc 267
           ||||| ||||| |||||||| || || || || ||||||||
Sbjct: 227 accactaacggttgcatgtccaccggtccacatttcaaccc 267



to top

>gb|AF170297.1|AF170297 Manihot esculenta copper/zinc-superoxide dismutase mRNA, complete
           cds
          Length = 801

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 155/197 (78%)
 Strand = Plus / Plus

                                                                       
Query: 71  acaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaagggcaccatcttc 130
           |||||||||||||||| |||||| |||||| | || ||||| || |  || || ||||||
Sbjct: 52  acaatggtgaaggctgaagctgttcttaccagtagtgagggggttagcggaacaatcttc 111

                                                                       
Query: 131 ttcacccaggagggagatggcccgaccactgtgacgggaagtgtcacgggactcaaggaa 190
           || ||||| || |||||||| || |||||||| || ||||   |  | || || |||  |
Sbjct: 112 tttacccaagaaggagatggtcctaccactgtaactggaaacatttccggccttaagcca 171

                                                                       
Query: 191 gggctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaact 250
           ||||| || || ||||| || || || ||||| ||||| || ||||| ||||||||||||
Sbjct: 172 gggcttcatgggttccacgtccatgcccttggagacacaacaaacggttgcatgtcaact 231

                            
Query: 251 ggaccgcacttcaaccc 267
           || || ||||| |||||
Sbjct: 232 gggccacactttaaccc 248



to top

>gb|AY833718.1| Codonopsis lanceolata CuZn superoxide dismutase (SODCc) mRNA,
           complete cds
          Length = 799

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgg 252
           ||||| |||||||| || || ||||||||||| ||||| || ||||||||||||||
Sbjct: 278 cacggtttccatgttcatgcccttggtgacacaaccaatggttgcatgtcaactgg 333



to top

>gb|DQ178940.1| Cucumis sativus Cu/Zn superoxide dismutase 1 mRNA, partial cds
          Length = 283

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 103/128 (80%)
 Strand = Plus / Plus

                                                                       
Query: 146 gatggcccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttc 205
           |||||||| |||||||| ||||| | |||  | || ||||||   ||||| || || |||
Sbjct: 12  gatggcccaaccactgttacgggtaatgtttctggtctcaagcccgggcttcatggattc 71

                                                                       
Query: 206 catgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaac 265
           ||||| |||||  | |||||||| ||||| ||||||||||| ||||| || || ||||||
Sbjct: 72  catgttcacgccttaggtgacacaaccaatggctgcatgtcgactgggccacatttcaac 131

                   
Query: 266 cccgctgg 273
           || |||||
Sbjct: 132 cctgctgg 139



to top

>emb|X95726.1|BJMSOD2GE B.juncea mRNA for Cu/Zn-superoxide dismutase
          Length = 722

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 109/136 (80%)
 Strand = Plus / Plus

                                                                       
Query: 104 agcgagggtgtcaagggcaccatcttcttcacccaggagggagatggcccgaccactgtg 163
           ||||||||||| ||||| || ||||||||| ||||||| ||||| |||   |||||||||
Sbjct: 143 agcgagggtgttaaggggactatcttcttcgcccaggaaggagaaggcaaaaccactgtg 202

                                                                       
Query: 164 acgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcacgctcttggt 223
           || ||||  ||  | ||||| ||    || || || || |||||||| || |||||||||
Sbjct: 203 actggaacagtttctggacttaaacctggtctacatggtttccatgtccatgctcttggt 262

                           
Query: 224 gacaccaccaacggct 239
           |||||||| |||||||
Sbjct: 263 gacaccactaacggct 278



to top

>gb|AF127156.1| Drosophila erecta Cu-Zn superoxide dismutase (Sod) gene, exons 1 and
            2 and complete cds
          Length = 1509

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                        
Query: 197  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
            ||||| ||||| |||||||   |||| |||| ||||||||||||||||||  | ||||||
Sbjct: 1157 cacggattccacgtgcacgagtttggagacaacaccaacggctgcatgtcgtccggaccg 1216

                    
Query: 257  cacttcaa 264
            ||||||||
Sbjct: 1217 cacttcaa 1224



to top

>gb|AF021825.1|AF021825 Drosophila immigrans superoxide dismutase (Sod) gene, partial cds
          Length = 1350

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           ||||| |||||||||||||   |||| || | ||||||||||||||||||| ||||||| 
Sbjct: 500 cacggattccatgtgcacgagtttggcgataacaccaacggctgcatgtcatctggaccc 559

                   
Query: 257 cacttcaa 264
           || |||||
Sbjct: 560 catttcaa 567



to top

>gb|U47868.1|DAU47868 Drosophila ambigua NDSSC 14011-0091.1 Cu,Zn superoxide dismutase
           (Sod) gene, partial cds
          Length = 720

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           ||||| |||||||||||||   | ||||||| ||||||||||||||||||  | || |||
Sbjct: 478 cacggattccatgtgcacgagttcggtgacaacaccaacggctgcatgtcgtccggcccg 537

                   
Query: 257 cacttcaa 264
           ||||||||
Sbjct: 538 cacttcaa 545



to top

>emb|X14040.1|LECYTSOD Tomato mRNA for cytoplasmic Cu-Zn superoxide dismutase (EC
           1.15.1.1)
          Length = 777

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 96/119 (80%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 259
           ||||||||||| || || |||||||| ||||| || ||||| |||||||| ||||| || 
Sbjct: 132 ggcttccatgtccatgcccttggtgataccacaaatggctgtatgtcaacaggaccacat 191

                                                                      
Query: 260 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 318
           | ||| || |||||| | | |||||| || || ||||||||  | || |||||||||||
Sbjct: 192 tacaatcctgctggtaaggagcatggtgctcctgaagatgaggtgcgtcatgctggtga 250



to top

>gb|AF191342.1| Olea europaea copper/zinc superoxide dismutase (SOD1) mRNA, partial
           cds
          Length = 276

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatggggcacccgaa 295
           |||||||||||||||||||| || ||||| || | |||  | | |||||| ||||| | |
Sbjct: 7   ggctgcatgtcaactggacctcatttcaatcctgttgggaaagagcatggtgcacctgga 66

                                  
Query: 296 gatgaaatccgccatgctggtga 318
           ||||| | |||||||||||||||
Sbjct: 67  gatgagaaccgccatgctggtga 89



to top

>gb|AY257198.1| Lotus corniculatus var. japonicus cytosolic CuZn-superoxide
           dismutase (sodCc) gene, complete cds
          Length = 3172

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 194 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgg 252
           ||||| ||||||||||| || ||  | |||||||||||||| |||||| ||||||||||
Sbjct: 593 ctccatggcttccatgtccatgccttgggtgacaccaccaatggctgcttgtcaactgg 651



to top

>gb|U37714.1|DHU37714 Drosophila hydei Cu,Zn superoxide dismutase mRNA, partial cds
          Length = 439

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 200 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgca 258
           |||||||||||||| |   |||| |||| ||||||||||||||||||  ||||||||||
Sbjct: 104 ggcttccatgtgcatgagtttggcgacaacaccaacggctgcatgtcctctggaccgca 162



to top

>gb|M37150.1|TOMSODA Tomato superoxide dismutase (SOD) mRNA, complete cds
          Length = 776

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 96/119 (80%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 259
           ||||||||||| || || |||||||| ||||| || ||||| |||||||| ||||| || 
Sbjct: 132 ggcttccatgtccatgcccttggtgataccacaaatggctgtatgtcaacaggaccacat 191

                                                                      
Query: 260 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 318
           | ||| || |||||| | | |||||| || || ||||||||  | || |||||||||||
Sbjct: 192 tacaatcctgctggtaaggagcatggtgctcctgaagatgaggtgcgtcatgctggtga 250



to top

>gb|DQ499511.1| Arachis hypogaea cultivar JL-24 Cu-Zn superoxide dismutase mRNA,
           complete cds
          Length = 562

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 203 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 262
           |||||||| || || ||||| |||||||| || || ||| |||||||||||||||| |||
Sbjct: 136 ttccatgtccatgcccttggagacaccacaaatggttgcctgtcaactggaccgcatttc 195

             
Query: 263 aa 264
           ||
Sbjct: 196 aa 197



to top

>emb|X73139.1|IBSOD I.batatas mRNA for superoxide dismutase
          Length = 702

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 171/218 (78%), Gaps = 1/218 (0%)
 Strand = Plus / Plus

                                                                       
Query: 57  ctgagatcacatacacaa-tggtgaaggctgtagctgtgcttaccggcagcgagggtgtc 115
           ||||||||||| ||| || ||||||||||||| || || |||| | | || || ||||||
Sbjct: 9   ctgagatcacaaacaaaaatggtgaaggctgtcgcagttcttagcagtagtgaaggtgtc 68

                                                                       
Query: 116 aagggcaccatcttcttcacccaggagggagatggcccgaccactgtgacgggaagtgtc 175
           |  |||||||| ||||||| ||| || |||||||| || ||||| || || ||||  || 
Sbjct: 69  agcggcaccattttcttcagccaagaaggagatggtccaaccacagtcactggaaacgtt 128

                                                                       
Query: 176 acgggactcaaggaagggctccacggcttccatgtgcacgctcttggtgacaccaccaac 235
            |||| |||||    || || || ||||||||||| || || || |||||||| || || 
Sbjct: 129 tcgggcctcaaacctggtcttcatggcttccatgtccatgccctaggtgacacaacaaat 188

                                                 
Query: 236 ggctgcatgtcaactggaccgcacttcaaccccgctgg 273
           || |||||||| |||||||| || ||||| || |||||
Sbjct: 189 ggatgcatgtctactggaccacatttcaatcctgctgg 226



to top

>emb|AJ278671.1|PTR278671 Populus tremula x Populus tremuloides mRNA for putative
           CuZn-superoxide dismutase (hipI-SOD1 gene)
          Length = 780

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 215 gctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
           |||||||||||||||||||| |||||||  || |||||||| || |||||
Sbjct: 214 gctcttggtgacaccaccaatggctgcaattccactggacctcatttcaa 263



to top

>emb|AJ278670.1|PTR278670 Populus tremula x Populus tremuloides partial mRNA for putative
           CuZn-superoxide dismutase (hipI-SOD 2 gene)
          Length = 691

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 215 gctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
           |||||||||||||||||||| |||||||  || |||||||| || |||||
Sbjct: 158 gctcttggtgacaccaccaatggctgcaattccactggacctcatttcaa 207



to top

>gb|DQ097721.1| Arachis hypogaea Cu-Zn superoxide dismutase mRNA, complete cds
          Length = 617

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 203 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 262
           |||||||| || || ||||| |||||||| || || ||| |||||||||||||||| |||
Sbjct: 180 ttccatgtccatgcccttggagacaccacaaatggttgcctgtcaactggaccgcatttc 239

             
Query: 263 aa 264
           ||
Sbjct: 240 aa 241



to top

>gb|AF127157.1| Drosophila sechellia Cu-Zn superoxide dismutase (Sod) gene, exons 1
            and 2 and complete cds
          Length = 1532

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 219  ttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
            |||| |||| ||||||||||||||||||| | ||||| ||||||||
Sbjct: 1202 ttggagacaacaccaacggctgcatgtcatccggaccccacttcaa 1247



to top

>gb|U47892.1|DOU47892 Drosophila obscura Cu,Zn superoxide dismutase (Sod) gene, partial
           cds
          Length = 718

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 246
           ||||| |||||||||||||   | ||||||| ||||||||||||||||||
Sbjct: 476 cacggattccatgtgcacgagttcggtgacaacaccaacggctgcatgtc 525



to top

>gb|AY804513.1| Drosophila yakuba strain Tai18 sod (sod) gene, partial cds
          Length = 663

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 224 gacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
           |||| ||||||||||||||||||  | ||||||||||||||
Sbjct: 388 gacaacaccaacggctgcatgtcgtccggaccgcacttcaa 428



to top

>gb|AF127160.1| Drosophila teissieri Cu-Zn superoxide dismutase (Sod) gene, exons 1
            and 2 and complete cds
          Length = 1617

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 224  gacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
            |||| ||||||||||||||||||  | ||||||||||||||
Sbjct: 1292 gacaacaccaacggctgcatgtcgtccggaccgcacttcaa 1332



to top

>gb|AF127159.1| Drosophila yakuba Cu-Zn superoxide dismutase (Sod) gene, exons 1 and
            2 and complete cds
          Length = 1563

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 224  gacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
            |||| ||||||||||||||||||  | ||||||||||||||
Sbjct: 1238 gacaacaccaacggctgcatgtcgtccggaccgcacttcaa 1278



to top

>gb|AF021828.1|AF021828 Drosophila teissieri superoxide dismutase (Sod) gene, partial cds
          Length = 1856

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 224 gacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
           |||| ||||||||||||||||||  | ||||||||||||||
Sbjct: 911 gacaacaccaacggctgcatgtcgtccggaccgcacttcaa 951



to top

>gb|AF021824.1|AF021824 Hirtodrosophila pictiventris superoxide dismutase (Sod) gene,
           partial cds
          Length = 890

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           |||||||||||||||||||   |||| |||| |||||| || ||||||||| |||| || 
Sbjct: 648 cacggcttccatgtgcacgaatttggggacaacaccaatggttgcatgtcatctgggcca 707

                
Query: 257 cactt 261
           |||||
Sbjct: 708 cactt 712



to top

>emb|AL670114.17| Mouse DNA sequence from clone RP23-7C19 on chromosome X, complete
             sequence
          Length = 128978

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 124   catcttcttcacccaggagggagat 148
             |||||||||||||||||||||||||
Sbjct: 44816 catcttcttcacccaggagggagat 44792



to top

>gb|AC156827.4| Medicago truncatula clone mth2-15c17, complete sequence
          Length = 110578

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 215    gctcttggtgacaccaccaacggctgca 242
              |||||||||||||||||||| |||||||
Sbjct: 100894 gctcttggtgacaccaccaatggctgca 100867



to top

>emb|Z19591.1|DMCZSUDMA D.melanogaster Cu-Zn superoxide dismutase gene
          Length = 1844

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 221  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
            ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 1286 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 1329



to top

>emb|Y00367.1|DMSOD Drosophila mRNA for Cu-Zn superoxide dismutase
          Length = 724

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 221 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
           ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 216 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 259



to top

>gb|DQ445093.1| Gossypium hirsutum putative cytosolic copper/zinc superoxide
           dismutase mRNA, complete cds
          Length = 682

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 75/92 (81%)
 Strand = Plus / Plus

                                                                       
Query: 239 tgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatggggcacccgaagat 298
           ||||||||||| ||||| |||||||| || |||||  | | |||||| || || ||||||
Sbjct: 285 tgcatgtcaacaggacctcacttcaatcctgctggaaaagggcatggtgctcctgaagat 344

                                           
Query: 299 gaaatccgccatgctggtgacctcggaaatgt 330
           |  |  |||||||||||||| || ||||||||
Sbjct: 345 gtgaatcgccatgctggtgatctaggaaatgt 376



to top

>emb|X17332.1|DMSODG2 Drosophila Cu-Zn superoxide dismutase gene (EC 1.15.1.1)
          Length = 2458

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 221  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
            ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 1900 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 1943



to top

>emb|X13780.1|DMSODG Drosophila melanogaster sod gene for Cu-Zn superoxide dismutase (EC
            1.15.1.1)
          Length = 1844

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 221  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
            ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 1286 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 1329



to top

>gb|AC010023.6| Drosophila melanogaster 3L BAC RP98-19G23 (Roswell Park Cancer
           Institute Drosophila BAC Library) complete sequence
          Length = 161175

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 221 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
           ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 559 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 516



to top

>gb|AC096692.5| Drosophila melanogaster 3L BAC RP98-48O3 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 173782

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 221   ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
             ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 28360 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 28403



to top

>ref|NM_057387.3| Drosophila melanogaster Superoxide dismutase CG11793-RA (Sod), mRNA
          Length = 741

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 221 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
           ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 247 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 290



to top

>gb|AY071435.1| Drosophila melanogaster RE52090 full length cDNA
          Length = 747

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 221 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
           ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 245 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 288



to top

>gb|AY898945.1| Lilium hybrid cultivar superoxide dismutase (SOD) mRNA, complete
           cds
          Length = 872

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 284 ggggcacccgaagatgaaatccgccatgctggtgacctcggaaa 327
           ||||| || |||||||||||||| ||||| |||||||| |||||
Sbjct: 438 ggggctcctgaagatgaaatccgtcatgcgggtgacctgggaaa 481



to top

>gb|AC006562.8|AC006562 Drosophila melanogaster, chromosome 3L, region 68A1-68B2, BAC clone
              BACR48O03, complete sequence
          Length = 173781

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 221    ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
              ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 145422 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 145379



to top

>gb|S72589.1|S72589 Drosophila melanogaster slow superoxide dismutase (Sod) gene,
           partial cds
          Length = 1410

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 221 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
           ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 852 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 895



to top

>gb|AE003546.4| Drosophila melanogaster chromosome 3L, section 39 of 83 of the complete
              sequence
          Length = 281589

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 221    ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
              ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 224627 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 224584



to top

>dbj|AB066500.1| Barbula unguiculata mRNA for chloroplastic copper/zinc superoxide
           dismutase, complete cds
          Length = 946

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 221 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
           |||||||| ||||| ||||||||||| ||||| || ||||||||
Sbjct: 426 ggtgacacaaccaatggctgcatgtcgactggtcctcacttcaa 469



to top

>gb|AF059879.1|AF059879 Drosophila immigrans Cu-Zn superoxide dismutase (Sod) gene, exon 2
           and partial cds
          Length = 282

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           ||||| |||||||||||||   |||| || | |||||||||||||||||||  |||||| 
Sbjct: 46  cacggattccatgtgcacgagtttggcgataacaccaacggctgcatgtcatatggaccc 105

                   
Query: 257 cacttcaa 264
           || |||||
Sbjct: 106 catttcaa 113



to top

>gb|AF021822.1|AF021822 Scaptodrosophila lebanonensis superoxide dismutase (Sod) mRNA,
           partial cds
          Length = 439

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           |||||||||||||||||||   |||| || |  |||||||||||||||||  ||||||| 
Sbjct: 101 cacggcttccatgtgcacgagtttggagataataccaacggctgcatgtccgctggacct 160

                   
Query: 257 cacttcaa 264
           || |||||
Sbjct: 161 catttcaa 168



to top

>gb|L08253.1|TOBCCZSODM Nicotiana plumbaginifolia Cu/Zn-superoxide dismutase gene, 5' end
          Length = 2742

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 76/92 (82%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                        
Query: 60   agatcacatac-acaatggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaag 118
            ||||||||||| | |||||||||||| || || || |||| | |||| || ||||| |  
Sbjct: 2479 agatcacataccaaaatggtgaaggccgttgccgtccttagcagcagtgaaggtgttagc 2538

                                            
Query: 119  ggcaccatcttcttcacccaggagggagatgg 150
            ||||||||||||||||| || || ||||||||
Sbjct: 2539 ggcaccatcttcttcactcaagatggagatgg 2570



 Score = 46.1 bits (23), Expect = 0.074
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 200  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 246
            ||||||||||| || || |||||||| ||||| || |||||||||||
Sbjct: 2693 ggcttccatgtccatgcccttggtgataccacaaatggctgcatgtc 2739



to top

>gb|M24421.1|DROSODCUZN Drosophila melanogaster Cu-Zn superoxide dismutase (SOD) gene,
           complete cds
          Length = 462

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 221 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 264
           ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 148 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 191



to top

>gb|DQ440061.1| Aedes aegypti clone AE-321 Cu2+/Zn2+ superoxide dismutase mRNA,
           complete cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 221 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccc 267
           ||||||| ||||||||| ||||  ||  |||||||||||||||||||
Sbjct: 148 ggtgacaacaccaacggatgcacctcggctggaccgcacttcaaccc 194



to top

>emb|AJ971950.1| Pinus pinea partial mRNA for chloroplast CuZn superoxide dismutase
           (cuZnsodchl gene)
          Length = 233

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 39  ttggtgacacaaccaatggctgcatgtcaac 69



to top

>gb|AY434497.1| Trifolium pratense superoxide dismutase mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1016

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 293 gaagatgaaatccgccatgctggtgacctcggaaa 327
           |||||||||||||| ||||| |||||||| |||||
Sbjct: 447 gaagatgaaatccgtcatgcgggtgacctgggaaa 481



to top

>gb|AC126007.16| Medicago truncatula clone mth2-11o4, complete sequence
          Length = 106747

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 293   gaagatgaaatccgccatgctggtgacctcggaaa 327
             |||||||||||||| ||||| |||||||| |||||
Sbjct: 51081 gaagatgaaatccgtcatgcgggtgacctgggaaa 51047



to top

>emb|X58579.1|PSCUZNPST P.sylvestris mRNA for CuZn superoxide dismutase, clone PST13
          Length = 676

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 111 ttggtgacacaaccaatggctgcatgtcaac 141



to top

>emb|X56435.1|PSSODII Pea mRNA for Cu/Zn superoxide dismutase II (SOD9)
          Length = 901

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 293 gaagatgaaatccgccatgctggtgacctcggaaa 327
           |||||||||||||| ||||| |||||||| |||||
Sbjct: 400 gaagatgaaatccgtcatgcgggtgacctgggaaa 434



to top

>emb|X15685.1|DSSOD Drosophila simulans DNA for Cu-Zn superoxide dismutase (EC 1.15.1.1)
          Length = 1793

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                        
Query: 194  ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 253
            |||||||| ||||| |||||||   |||| |||| |||||| |||||||||||  | |||
Sbjct: 1242 ctccacggattccacgtgcacgagtttggagacaacaccaatggctgcatgtcgtccgga 1301

                       
Query: 254  ccgcacttcaa 264
            || ||||||||
Sbjct: 1302 ccccacttcaa 1312



to top

>emb|AJ279694.1|BPE279694 Betula pendula partial mRNA for copper/zinc-superoxide dismutase
           (cu/Zn sod gene)
          Length = 355

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 68/83 (81%)
 Strand = Plus / Plus

                                                                       
Query: 191 gggctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaact 250
           |||||||| || |||||||| || || ||||| ||||| || || || ||||||||||||
Sbjct: 94  gggctccatgggttccatgtccatgcacttggggacacaacaaatggttgcatgtcaact 153

                                  
Query: 251 ggaccgcacttcaaccccgctgg 273
           || || || ||||| || |||||
Sbjct: 154 gggccacatttcaatcctgctgg 176



to top

>gb|AY867724.1| Pinus taeda isolate FBRC30 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867723.1| Pinus taeda isolate FBRC29 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867722.1| Pinus taeda isolate FBRC28 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867719.1| Pinus taeda isolate FBRC25 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867717.1| Pinus taeda isolate FBRC23 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867714.1| Pinus taeda isolate FBRC20 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867713.1| Pinus taeda isolate FBRC19 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867712.1| Pinus taeda isolate FBRC18 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867710.1| Pinus taeda isolate FBRC16 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867708.1| Pinus taeda isolate FBRC14 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867707.1| Pinus taeda isolate FBRC13 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867706.1| Pinus taeda isolate FBRC12 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867703.1| Pinus taeda isolate FBRC9 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867702.1| Pinus taeda isolate FBRC8 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867700.1| Pinus taeda isolate FBRC6 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867697.1| Pinus taeda isolate FBRC3 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>emb|AJ786258.1| Helianthus annuus mRNA for Cu/Zn superoxide dismutase, (sod2 gene)
          Length = 729

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 203 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaac 249
           |||||||| || || ||||||||||| ||||| || |||||||||||
Sbjct: 219 ttccatgttcatgcgcttggtgacacaaccaatggatgcatgtcaac 265



to top

>gb|AF434186.1|AF434186 Pinus pinaster Cu-Zn-superoxide dismutase precursor, mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 961

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 ttggtgacaccaccaacggctgcatgtcaac 249
           |||||||||| ||||| ||||||||||||||
Sbjct: 332 ttggtgacacaaccaatggctgcatgtcaac 362



to top

>dbj|AB189165.1| Pisum sativum mRNA for copper zinc superoxide dismutase, complete
           cds
          Length = 857

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 194 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 253
           ||||||||||||||| | || ||  | || |||||||| ||||| ||||| |||||||||
Sbjct: 186 ctccacggcttccatatccatgccttgggagacaccacaaacggttgcatttcaactgga 245

                      
Query: 254 ccgcacttcaa 264
           || || |||||
Sbjct: 246 ccacatttcaa 256



to top

>dbj|AB087845.1| Pisum sativum SOD mRNA for superoxide dismutase, complete cds
          Length = 850

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 194 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 253
           ||||||||||||||| | || ||  | || |||||||| ||||| ||||| |||||||||
Sbjct: 182 ctccacggcttccatatccatgccttgggagacaccacaaacggttgcatttcaactgga 241

                      
Query: 254 ccgcacttcaa 264
           || || |||||
Sbjct: 242 ccacatttcaa 252



to top

>gb|AF056621.1|AF056621 Medicago sativa putative Cu/Zn superoxide dismutase precursor,
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 900

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 293 gaagatgaaatccgccatgctggtgacctcggaaa 327
           |||||||||||||| ||||| |||||||| |||||
Sbjct: 420 gaagatgaaatccgtcatgcgggtgacctgggaaa 454



to top

>gb|U08097.1|PTU08097 Populus tremuloides Cu/Zn-superoxide dismutase preprotein
           (Cu/Zn-SOD) mRNA, complete cds
          Length = 685

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 293 gaagatgaaatccgccatgctggtgacctcggaaa 327
           |||||||||||||| ||||| |||||||| |||||
Sbjct: 372 gaagatgaaatccgtcatgcgggtgacctgggaaa 406



to top

>gb|J04087.1|PEASOD Pea chloroplastic copper/zinc-superoxide dismutase mRNA, complete
           cds
          Length = 825

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 293 gaagatgaaatccgccatgctggtgacctcggaaa 327
           |||||||||||||| ||||| |||||||| |||||
Sbjct: 377 gaagatgaaatccgtcatgcgggtgacctgggaaa 411



to top

>gb|M63003.1|PEACUZNSD Pea Cu-Zn superoxide dismutase mRNA, complete cds
          Length = 738

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 194 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 253
           ||||||||||||||| | || ||  | || |||||||| ||||| ||||| |||||||||
Sbjct: 136 ctccacggcttccatatccatgccttgggagacaccacaaacggttgcatttcaactgga 195

                      
Query: 254 ccgcacttcaa 264
           || || |||||
Sbjct: 196 ccacatttcaa 206



to top

>emb|AJ971949.1| Pinus pinea partial mRNA for cytosolic CuZn superoxide dismutase
           (cuZnsodcyt gene)
          Length = 250

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 194 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 253
           ||||| || |||||||| || || || |||||||| || || || |||||||||||||||
Sbjct: 11  ctccatggtttccatgttcatgcactaggtgacacaacaaatgggtgcatgtcaactgga 70

             
Query: 254 cc 255
           ||
Sbjct: 71  cc 72



to top

>gb|AC130711.3| Mus musculus BAC clone RP23-22M24 from chromosome 17, complete
            sequence
          Length = 226651

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 135  cccaggagggagatggcccgac 156
            ||||||||||||||||||||||
Sbjct: 1583 cccaggagggagatggcccgac 1604



to top

>emb|X87372.1|LESODCC L.esculentum  SodCc;Le;2 gene
          Length = 11053

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 200  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaac 249
            ||||||||||| || || |||||||| ||||| || ||||| ||||||||
Sbjct: 6599 ggcttccatgtccatgcccttggtgataccacaaatggctgtatgtcaac 6648



 Score = 40.1 bits (20), Expect = 4.6
 Identities = 75/92 (81%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                        
Query: 60   agatcacatacacaa-tggtgaaggctgtagctgtgcttaccggcagcgagggtgtcaag 118
            |||||||||||| || |||||||||| || || || |||| | |||| || ||||| |  
Sbjct: 6375 agatcacatacaaaaatggtgaaggccgtcgccgtccttaacagcagtgaaggtgttagt 6434

                                            
Query: 119  ggcaccatcttcttcacccaggagggagatgg 150
            ||||||||| ||||||| || || ||||||||
Sbjct: 6435 ggcaccatcctcttcactcaagatggagatgg 6466



to top

>emb|X58578.1|PSCUZNPS3 P.sylvestris mRNA for CuZn superoxide dismutase, clone PS3
          Length = 821

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 194 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 253
           ||||| || |||||||| || || || |||||||| || || || |||||||||||||||
Sbjct: 239 ctccatggtttccatgttcatgcactaggtgacacaacaaatgggtgcatgtcaactgga 298

             
Query: 254 cc 255
           ||
Sbjct: 299 cc 300



to top

>gb|AC158975.9| Mus musculus chromosome 18, clone RP24-192J22, complete sequence
          Length = 178651

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 312    ctggtgacctcggaaatgtgacagct 337
              ||||||||||| ||||||||||||||
Sbjct: 113393 ctggtgacctcagaaatgtgacagct 113368



to top

>dbj|AK144519.1| Mus musculus 13 days embryo brain cDNA, RIKEN full-length enriched
           library, clone:G630087L22 product:unclassifiable, full
           insert sequence
          Length = 1102

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 135 cccaggagggagatggcccgac 156
           ||||||||||||||||||||||
Sbjct: 841 cccaggagggagatggcccgac 862



to top

>gb|AF457209.1| Hevea brasiliensis Cu/Zn superoxide dismutase (Cu/Zn-SOD) mRNA,
           complete cds
          Length = 738

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 125 atcttcttcacccaggagggagatggcccgaccactgtgacgggaagtgt 174
           |||||||||||||| || |||||||| || ||||| || || ||||||||
Sbjct: 103 atcttcttcacccaagaaggagatggtccaaccaccgtaactggaagtgt 152



to top

>gb|AF220294.1|AF220294 Mus musculus clone BAC126c8 Rsp29-like protein (Rsp29) and Als splice
              variant 2 (Als) genes, partial cds; Als splice variant 1
              (Als), TCE2 (Tce2), NDK3-like protein (Ndk3), and TCE4
              (Tce4) genes, complete cds; and TCE5 (Tce5) gene, partial
              cds
          Length = 175759

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 135    cccaggagggagatggcccgac 156
              ||||||||||||||||||||||
Sbjct: 151842 cccaggagggagatggcccgac 151863



to top

>gb|AY754566.1| Drosophila miranda strain MSH22 superoxide dismutase (Sod) gene,
           exons 1, 2 and partial cds
          Length = 721

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 246
           ||||| |||||||||||||   | || |||| ||||||||||||||||||
Sbjct: 479 cacggattccatgtgcacgagttcggggacaacaccaacggctgcatgtc 528



to top

>gb|AC119259.15| Mus musculus chromosome 18, clone RP24-285N19, complete sequence
          Length = 169310

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 312   ctggtgacctcggaaatgtgacagct 337
             ||||||||||| ||||||||||||||
Sbjct: 10079 ctggtgacctcagaaatgtgacagct 10054



to top

>gb|AC154229.1| Mus musculus BAC clone RP24-155I8 from 17, complete sequence
          Length = 159982

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 135    cccaggagggagatggcccgac 156
              ||||||||||||||||||||||
Sbjct: 121106 cccaggagggagatggcccgac 121127



to top

>gb|U47873.1|DPU47873 Drosophila persimilis NDSSC 14011-0111.2 Cu,Zn superoxide dismutase
           (Sod) gene, partial cds
          Length = 721

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 246
           ||||| |||||||||||||   | || |||| ||||||||||||||||||
Sbjct: 479 cacggattccatgtgcacgagttcggggacaacaccaacggctgcatgtc 528



to top

>gb|U47872.1|DPU47872 Drosophila pseudoobscura bogotana NDSSC 14011-0121.69 Cu,Zn
           superoxide dismutase (Sod) gene, partial cds
          Length = 720

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 246
           ||||| |||||||||||||   | || |||| ||||||||||||||||||
Sbjct: 478 cacggattccatgtgcacgagttcggggacaacaccaacggctgcatgtc 527



to top

>gb|U47871.1|DPU47871 Drosophila pseudoobscura pseudoobscura NDSSC 14011-0121.43 Cu,Zn
           superoxide dismutase (Sod) gene, partial cds
          Length = 721

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 246
           ||||| |||||||||||||   | || |||| ||||||||||||||||||
Sbjct: 479 cacggattccatgtgcacgagttcggggacaacaccaacggctgcatgtc 528



to top

>gb|U47870.1|DMU47870 Drosophila miranda NDSSC 14011-0101.1 Cu,Zn superoxide dismutase
           (Sod) gene, partial cds
          Length = 721

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 246
           ||||| |||||||||||||   | || |||| ||||||||||||||||||
Sbjct: 479 cacggattccatgtgcacgagttcggggacaacaccaacggctgcatgtc 528



to top

>gb|U47869.1|DBU47869 Drosophila bifasciata NDSSC 14012-0181.0 Cu,Zn superoxide dismutase
           (Sod) gene, partial cds
          Length = 739

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 246
           ||||| |||||||||||||   | || |||| ||||||||||||||||||
Sbjct: 497 cacggattccatgtgcacgagttcggggacaacaccaacggctgcatgtc 546



to top

>gb|BT012694.1| Lycopersicon esculentum clone 113564F, mRNA sequence
          Length = 1048

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 295 agatgaaatccgccatgctggtgacctcggaaa 327
           |||||||||||| ||||| |||||||| |||||
Sbjct: 461 agatgaaatccgtcatgcgggtgacctgggaaa 493



to top

>gb|AF385581.2| Dichanthelium lanuginosum copper/zinc superoxide dismutase
           precursor (SOD1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 643

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 219 ttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccc 267
           |||||||||||||||| || ||||| || || ||||| || ||||||||
Sbjct: 327 ttggtgacaccaccaatggatgcatatcgacaggaccacatttcaaccc 375



to top

>gb|AC146631.27| Medicago truncatula clone mth2-7g1, complete sequence
          Length = 132372

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 9      ctccccaaccactccgctctt 29
              |||||||||||||||||||||
Sbjct: 101543 ctccccaaccactccgctctt 101523



to top

>emb|X14041.1|LECHSOD Tomato mRNA for chloroplast Cu-Zn superoxide dismutase (SOD)
          Length = 1033

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 295 agatgaaatccgccatgctggtgacctcggaaa 327
           |||||||||||| ||||| |||||||| |||||
Sbjct: 445 agatgaaatccgtcatgcgggtgacctgggaaa 477



to top

>emb|X13831.1|DVSOD Drosophila sod gene for Cu-Zn superoxide dismutase (EC 1.15.1.1)
          Length = 2103

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 259
           |||||||||||||| |   | || |||| |||||| |||||||||||  | |||||||||
Sbjct: 830 ggcttccatgtgcatgagttcggcgacaacaccaatggctgcatgtcgtcgggaccgcac 889

                
Query: 260 ttcaa 264
           |||||
Sbjct: 890 ttcaa 894



to top

>gb|AY081436.1| Drosophila guttifera superoxide dismutase (Sod) gene, partial cds
          Length = 282

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 259
           ||||||||||||||||   |||| |||| ||| || |||||||||||  ||||||| || 
Sbjct: 49  ggcttccatgtgcacgagtttggcgacaacacaaatggctgcatgtcgtctggaccacat 108

                
Query: 260 ttcaa 264
           |||||
Sbjct: 109 ttcaa 113



to top

>gb|AY081435.1| Drosophila flexa superoxide dismutase (Sod) gene, partial cds
          Length = 253

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           ||||||||||||||||| |   |||| ||||  || || |||||||||||  ||||||||
Sbjct: 46  cacggcttccatgtgcatgagtttggggacaatacgaatggctgcatgtcgtctggaccg 105

                
Query: 257 cactt 261
           |||||
Sbjct: 106 cactt 110



to top

>gb|AY081434.1| Drosophila ornatipennis superoxide dismutase (Sod) gene, partial
           cds
          Length = 282

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 194 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 246
           ||||| ||||||||||||||||   |||| |||| ||| || |||||||||||
Sbjct: 43  ctccatggcttccatgtgcacgagtttggcgacaacacaaatggctgcatgtc 95



to top

>gb|AY081433.1| Drosophila nannoptera superoxide dismutase (Sod) gene, partial cds
          Length = 282

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 259
           ||||||||||||||||   ||||||| | ||| || ||||| |||||  |||||||||| 
Sbjct: 49  ggcttccatgtgcacgagtttggtgataacacgaatggctgtatgtccgctggaccgcat 108

                
Query: 260 ttcaa 264
           |||||
Sbjct: 109 ttcaa 113



to top

>gb|AY754565.1| Drosophila affinis superoxide dismutase (Sod) gene, exons 1, 2 and
           partial cds
          Length = 698

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 60/73 (82%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           ||||| |||||||||||||   | || |||| ||||||||| ||||||||  | || || 
Sbjct: 477 cacggattccatgtgcacgagttcggggacaacaccaacggatgcatgtcgtcaggcccc 536

                        
Query: 257 cacttcaaccccg 269
           |||||||||||||
Sbjct: 537 cacttcaaccccg 549



to top

>gb|AF021826.1|AF021826 Drosophila guttifera superoxide dismutase (Sod) gene, partial cds
          Length = 960

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 259
           ||||||||||||||||   |||| |||| ||| || |||||||||||  ||||||| || 
Sbjct: 624 ggcttccatgtgcacgagtttggcgacaacacaaatggctgcatgtcgtctggaccacat 683

                
Query: 260 ttcaa 264
           |||||
Sbjct: 684 ttcaa 688



to top

>emb|X77175.1|LESOD1 L.esculentum (cherry tomato) SOD Cp;Le:1 gene (part 1)
          Length = 3676

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 295  agatgaaatccgccatgctggtgacctcggaaa 327
            |||||||||||| ||||| |||||||| |||||
Sbjct: 2238 agatgaaatccgtcatgcgggtgacctgggaaa 2270



to top

>gb|AY881165.1| Nelumbo nucifera isolate 16 copper-zinc superoxide dismutase mRNA,
           partial cds
          Length = 457

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 203 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggacc 255
           |||||||| || || |||||||||||||| || || || |||||||| |||||
Sbjct: 131 ttccatgtccatgcccttggtgacaccacaaatggttgtatgtcaacaggacc 183



to top

>gb|AY881164.1| Nelumbo nucifera isolate 14 copper-zinc superoxide dismutase mRNA,
           partial cds
          Length = 457

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 203 ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggacc 255
           |||||||| || || |||||||||||||| || || || |||||||| |||||
Sbjct: 131 ttccatgtccatgcccttggtgacaccacaaatggttgtatgtcaacaggacc 183



to top

>gb|U39445.1|DBU39445 Drosophila busckii Cu,Zn superoxide dismutase (Sod) and unknown
           protein genes, partial cds
          Length = 1177

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 259
           ||||||||||||||||   |||| |||| ||| || |||||||||||  |||| || |||
Sbjct: 459 ggcttccatgtgcacgaatttggcgacaacacaaatggctgcatgtcgtctggcccccac 518

                
Query: 260 ttcaa 264
           |||||
Sbjct: 519 ttcaa 523



to top

>gb|M37151.1|TOMSODB Tomato superoxide dismutase (SOD) mRNA, complete cds
          Length = 1034

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 295 agatgaaatccgccatgctggtgacctcggaaa 327
           |||||||||||| ||||| |||||||| |||||
Sbjct: 445 agatgaaatccgtcatgcgggtgacctgggaaa 477



to top

>gb|DQ497636.1| Thermoascus aurantiacus var. levisporus Cu,Zn-superoxide dismutase
           (CZSOD-1) mRNA, complete cds
          Length = 705

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 221 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 268
           ||||||| ||||||||||||||  ||  | || |||||||||||||||
Sbjct: 154 ggtgacaacaccaacggctgcacctccgccggcccgcacttcaacccc 201



to top

>gb|AY566699.1| Citrullus lanatus copper-zinc superoxide dismutase (CuZn-SOD II)
           mRNA, partial cds
          Length = 444

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 296 gatgaaatccgccatgctggtgacctcggaaa 327
           ||||||||||| ||||| |||||||| |||||
Sbjct: 227 gatgaaatccgtcatgcgggtgacctgggaaa 258



to top

>ref|XM_748622.1| Aspergillus fumigatus Af293 Cu,Zn superoxide dismutase SOD1
           (Afu5g09240) partial mRNA
          Length = 477

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 221 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 268
           ||||||| ||||||||||||||  ||  |||| || ||||||||||||
Sbjct: 166 ggtgacaacaccaacggctgcacctccgctggtcctcacttcaacccc 213



to top

>ref|XM_385171.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG04995.1)
            partial mRNA
          Length = 3447

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 219  ttggtgacaccaccaacggc 238
            ||||||||||||||||||||
Sbjct: 1547 ttggtgacaccaccaacggc 1528



to top

>gb|AF264031.1| Callinectes sapidus extracellular Cu, Zn-superoxide dismutase mRNA,
           complete cds
          Length = 756

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 ctccacggcttccatgtgca 213
           ||||||||||||||||||||
Sbjct: 350 ctccacggcttccatgtgca 369



to top

>ref|XM_503850.1| Yarrowia lipolytica CLIB122, YALI0E12133g predicted mRNA
          Length = 465

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 219 ttggtgacaccaccaacggctgca 242
           ||||||||| ||||||||||||||
Sbjct: 152 ttggtgacaacaccaacggctgca 175



to top

>emb|AJ305146.1|PAN305146 Podospora anserina sod1 gene for copper/zinc superoxide dismutase,
           exons 1-4
          Length = 1586

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 219 ttggtgacaccaccaacggctgca 242
           ||||||||| ||||||||||||||
Sbjct: 604 ttggtgacaacaccaacggctgca 627



to top

>emb|AJ278668.1|PTR278668 Populus tremula x Populus tremuloides chloroplast mRNA for putative
           CuZn-superoxide dismutase (cp-SOD 1 gene)
          Length = 1029

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 296 gatgaaatccgccatgctggtgacctcggaaa 327
           ||||||||||| ||||| |||||||| |||||
Sbjct: 411 gatgaaatccgtcatgcgggtgacctgggaaa 442



to top

>gb|AF401280.1| Aspergillus flavus Cu,Zn-superoxide dismutase mRNA, partial cds
          Length = 463

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 221 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 268
           ||||||| ||||||||||||||  ||  |||| || ||||||||||||
Sbjct: 152 ggtgacaacaccaacggctgcacctccgctggccctcacttcaacccc 199



to top

>dbj|AB226266.1| Aspergillus oryzae cDNA, contig sequence: AoEST3125
          Length = 761

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 221 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 268
           ||||||| ||||||||||||||  ||  |||| || ||||||||||||
Sbjct: 217 ggtgacaacaccaacggctgcacctccgctggccctcacttcaacccc 264



to top

>dbj|AB223448.1| Aspergillus oryzae cDNA, contig sequence: AoEST0280
          Length = 779

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 221 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 268
           ||||||| ||||||||||||||  ||  |||| || ||||||||||||
Sbjct: 195 ggtgacaacaccaacggctgcacctccgctggccctcacttcaacccc 242



to top

>gb|AC140006.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNAa0090D11, complete sequence
          Length = 115403

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 219   ttggtgacaccaccaacggctgca 242
             |||| |||||||||||||||||||
Sbjct: 81928 ttggcgacaccaccaacggctgca 81905



to top

>gb|AF127158.1| Drosophila mauritiana Cu-Zn superoxide dismutase (Sod) gene, exons 1
            and 2 and complete cds
          Length = 1539

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 56/68 (82%)
 Strand = Plus / Plus

                                                                        
Query: 197  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
            ||||| ||||| |||||||   |||| |||| |||||| |||||||||||  | || |||
Sbjct: 1187 cacggattccacgtgcacgagtttggagacaacaccaatggctgcatgtcgtccgggccg 1246

                    
Query: 257  cacttcaa 264
            ||||||||
Sbjct: 1247 cacttcaa 1254



to top

>gb|AC104474.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0024O21, complete sequence
          Length = 155651

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 219   ttggtgacaccaccaacggctgca 242
             |||| |||||||||||||||||||
Sbjct: 56525 ttggcgacaccaccaacggctgca 56502



to top

>gb|AF128886.1|AF128886 Aspergillus fumigatus Cu,Zn superoxide dismutase mRNA, complete cds
          Length = 465

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 221 ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 268
           ||||||| ||||||||||||||  ||  |||| || ||||||||||||
Sbjct: 154 ggtgacaacaccaacggctgcacctccgctggtcctcacttcaacccc 201



to top

>dbj|AK073785.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033068D19, full
           insert sequence
          Length = 801

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 219 ttggtgacaccaccaacggctgca 242
           |||| |||||||||||||||||||
Sbjct: 172 ttggcgacaccaccaacggctgca 195



to top

>gb|AF021827.1|AF021827 Scaptomyza adusta superoxide dismutase (Sod) mRNA, partial cds
          Length = 343

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 56/68 (82%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           |||||||||||||||||||   ||||||| |  ||||| || ||||||||  | ||||| 
Sbjct: 101 cacggcttccatgtgcacgaatttggtgataataccaatggatgcatgtcctcgggacca 160

                   
Query: 257 cacttcaa 264
           ||||||||
Sbjct: 161 cacttcaa 168



to top

>gb|AF059886.1|AF059886 Drosophila tanythrix Cu-Zn superoxide dismutase (Sod) gene, exon 2
           and partial cds
          Length = 282

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 56/68 (82%)
 Strand = Plus / Plus

                                                                       
Query: 197 cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 256
           ||||||||||||||||| |   |||||||||  || ||||| ||||||||  | ||||||
Sbjct: 46  cacggcttccatgtgcatgaatttggtgacaatacaaacggatgcatgtcgtcaggaccg 105

                   
Query: 257 cacttcaa 264
           || |||||
Sbjct: 106 catttcaa 113



to top

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica
          Length = 4224103

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 219     ttggtgacaccaccaacggctgca 242
               ||||||||| ||||||||||||||
Sbjct: 1474355 ttggtgacaacaccaacggctgca 1474332


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,195,598
Number of Sequences: 3902068
Number of extensions: 3195598
Number of successful extensions: 61380
Number of sequences better than 10.0: 209
Number of HSP's better than 10.0 without gapping: 199
Number of HSP's successfully gapped in prelim test: 12
Number of HSP's that attempted gapping in prelim test: 60853
Number of HSP's gapped (non-prelim): 485
length of query: 346
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 324
effective length of database: 17,147,199,772
effective search space: 5555692726128
effective search space used: 5555692726128
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top