>emb|AL390774.10| Human DNA sequence from clone RP11-417B4 on chromosome 9 Contains part of
              the gene for a novel protein (KIAA1608), a novel gene, a
              LSM5 homolog, U6 small nuclear RNA associated (S.
              cerevisiae) (LSM5) pseudogene and a phosphatidylinositol
              glycan, class F (PIGF) pseudogene, complete sequence
          Length = 197055

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 48     tccttctggagcactttctg 67
              ||||||||||||||||||||
Sbjct: 101291 tccttctggagcactttctg 101272

>gb|AC151355.2| Xenopus tropicalis clone ISB-52K19, complete sequence
          Length = 55519

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    ccttctggagcactttctgt 68
             ||||||||||||||||||||
Sbjct: 48189 ccttctggagcactttctgt 48170

>emb|BX842684.4| Zebrafish DNA sequence from clone DKEY-33I22 in linkage group 20,
             complete sequence
          Length = 140982

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 113   aaaatacatgttttttacaagaca 136
             ||||||||||||||||| ||||||
Sbjct: 51542 aaaatacatgttttttataagaca 51565

>ref|XM_715419.1| Candida albicans SC5314 putative alkyl hydroperoxide reductase
           (CaO19_2762), mRNA
          Length = 531

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 103 acattgaaccaaaatacat 121
           |||||||||||||||||||
Sbjct: 26  acattgaaccaaaatacat 44

>ref|XM_715189.1| Candida albicans SC5314 putative alkyl hydroperoxide reductase
           (CaO19_10278), mRNA
          Length = 531

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 103 acattgaaccaaaatacat 121
           |||||||||||||||||||
Sbjct: 26  acattgaaccaaaatacat 44

>ref|XM_765899.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_29_69925_54083)
            partial mRNA
          Length = 15843

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 50   cttctggagcactttctgt 68
            |||||||||||||||||||
Sbjct: 6744 cttctggagcactttctgt 6726

>gb|DQ009112.1| Uncultured marine bacterium clone SPOTSDEC01_5m27 16S ribosomal
          RNA gene, partial sequence; 16S-23S ribosomal RNA
          intergenic spacer, complete sequence; and 23S ribosomal
          RNA gene, partial sequence
          Length = 2060

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 56 gagcactttctgttacccc 74
          |||||||||||||||||||
Sbjct: 57 gagcactttctgttacccc 39

>emb|AL445430.15| Human DNA sequence from clone RP11-716O23 on chromosome 6 Contains one
             or two novel genes, a repressor of protein-kinase
             (interferon-inducible double stranded RNA dependent
             inhibitor) (P58 repressor) (PRKRIR) pseudogene and a CpG
             island, complete sequence
          Length = 127862

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 111   ccaaaatacatgtttttta 129
             |||||||||||||||||||
Sbjct: 99263 ccaaaatacatgtttttta 99245

>emb|AL139318.9| Human DNA sequence from clone RP11-124B17 on chromosome 13 Contains the
              DCT gene for dopachrome tautomerase (dopachrome
              delta-isomerase, tyrosine-related protein 2) (TYRP2), the
              3' end of the gene for dTDP-D-glucose 4,6-dehydratase
              (TDPGD) and a CpG island, complete sequence
          Length = 160004

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 114    aaatacatgttttttacaagaca 136
              ||||||||||| |||||||||||
Sbjct: 159586 aaatacatgttgtttacaagaca 159608

>emb|CR450749.7| Zebrafish DNA sequence from clone DKEY-2J6 in linkage group 5, complete
             sequence
          Length = 142889

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 113   aaaatacatgttttttaca 131
             |||||||||||||||||||
Sbjct: 96482 aaaatacatgttttttaca 96464

>emb|AL732511.6| Zebrafish DNA sequence from clone CH211-140G4 in linkage group 19
             Contains two CpG islands, complete sequence
          Length = 175786

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 105   attgaaccaaaatacatgttttt 127
             ||||||||||||||||| |||||
Sbjct: 16796 attgaaccaaaatacatcttttt 16818

>emb|BX666060.8| Zebrafish DNA sequence from clone CH211-133N22 in linkage group 5,
             complete sequence
          Length = 180348

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 103   acattgaaccaaaatacatgttt 125
             ||||||||| |||||||||||||
Sbjct: 71558 acattgaacaaaaatacatgttt 71580

>emb|BX510352.17| Zebrafish DNA sequence from clone DKEY-96J11 in linkage group 18,
             complete sequence
          Length = 152387

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 110   accaaaatacatgtttttt 128
             |||||||||||||||||||
Sbjct: 90516 accaaaatacatgtttttt 90498

>dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, complete genome
          Length = 2685015

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                      
Query: 48      tccttctggagcactttctgtta 70
               |||||||||||||||| ||||||
Sbjct: 1484730 tccttctggagcacttgctgtta 1484708

>gb|AC122937.4| Mus musculus BAC clone RP23-24P3 from chromosome 15, complete sequence
          Length = 196863

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 39    gaataaagatccttctgga 57
             |||||||||||||||||||
Sbjct: 98253 gaataaagatccttctgga 98271

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 18      tgcgcatcagggtcgtctt 36
               |||||||||||||||||||
Sbjct: 2160847 tgcgcatcagggtcgtctt 2160865

>dbj|AK173847.1| Ciona intestinalis cDNA, clone:cicl005c07, full insert sequence
          Length = 2488

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 100  agcacattgaaccaaaata 118
            |||||||||||||||||||
Sbjct: 2243 agcacattgaaccaaaata 2225

>dbj|AK117063.1| Ciona intestinalis cDNA, clone:cits023m17, full insert sequence
          Length = 2419

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 100  agcacattgaaccaaaata 118
            |||||||||||||||||||
Sbjct: 2341 agcacattgaaccaaaata 2323

>emb|AL935064.7| Zebrafish DNA sequence from clone CH211-153K23, complete sequence
          Length = 157256

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 103    acattgaaccaaaatacatgttt 125
              ||||||||| |||||||||||||
Sbjct: 128891 acattgaacaaaaatacatgttt 128913

>emb|CT009486.7| Mouse DNA sequence from clone RP23-44G15 on chromosome 13, complete
             sequence
          Length = 180092

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 33    tcttatgaataaagatcct 51
             |||||||||||||||||||
Sbjct: 38211 tcttatgaataaagatcct 38229

>emb|AL121612.5|CNS01DS1 Human chromosome 14 DNA sequence BAC R-179A9 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 180914

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 73     cccactgctcctaatggctctga 95
              ||||||||||| |||||||||||
Sbjct: 161304 cccactgctccaaatggctctga 161282


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,256,886
Number of Sequences: 3902068
Number of extensions: 1256886
Number of successful extensions: 87450
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 87400
Number of HSP's gapped (non-prelim): 50
length of query: 155
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 133
effective length of database: 17,147,199,772
effective search space: 2280577569676
effective search space used: 2280577569676
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)