ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name basdg23
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AL034351.1|HS879K22 Human DNA sequence from clone RP5-879K22... 46 0.11
2emb|BX067361.1|CNS09O51 Single read from an extremity of a full-... 44 0.44
3emb|BX065039.1|CNS09MCJ Single read from an extremity of a full-... 44 0.44
4emb|BX056667.1|CNS09FVZ Single read from an extremity of a full-... 44 0.44
5emb|BX056666.1|CNS09FVY Single read from an extremity of a full-... 44 0.44
6emb|BX056897.1|CNS09G2D Single read from an extremity of a full-... 44 0.44
7emb|BX053071.1|CNS09D43 Single read from an extremity of a full-... 44 0.44
8emb|BX042815.1|CNS09577 Single read from an extremity of a full-... 44 0.44
9emb|BX039805.1|CNS092VL Single read from an extremity of a full-... 44 0.44
10emb|BX034094.1|CNS08YGY Single read from an extremity of a full-... 44 0.44
11emb|BX020010.1|CNS08NLQ Single read from an extremity of a full-... 44 0.44
12emb|BX011839.1|CNS08HAR Single read from an extremity of a full-... 44 0.44
13emb|BX011624.1|CNS08H4S Single read from an extremity of a full-... 44 0.44
14emb|BX009000.1|CNS08F3W Single read from an extremity of a full-... 44 0.44
15emb|BX006361.1|CNS08D2L Single read from an extremity of a full-... 44 0.44
16ref|XM_316470.2| Anopheles gambiae str. PEST ENSANGP00000021035 ... 44 0.44
17gb|AC002288.1|HUAC002288 Homo sapiens Chromosome 16 BAC clone CI... 42 1.7
18gb|AC130451.2| Homo sapiens chromosome 16 clone CTA-249B10, comp... 42 1.7
19emb|BX071926.1|CNS09RNU Single read from an extremity of a full-... 42 1.7
20emb|BX071892.1|CNS09RMW Single read from an extremity of a full-... 42 1.7
21emb|BX068916.1|CNS09PC8 Single read from an extremity of a full-... 42 1.7
22emb|BX067978.1|CNS09OM6 Single read from an extremity of a full-... 42 1.7
23emb|BX067274.1|CNS09O2M Single read from an extremity of a full-... 42 1.7
24emb|BX067273.1|CNS09O2L Single read from an extremity of a full-... 42 1.7
25emb|BX065623.1|CNS09MSR Single read from an extremity of a full-... 42 1.7
26emb|BX065469.1|CNS09MOH Single read from an extremity of a full-... 42 1.7
27emb|BX065401.1|CNS09MML Single read from an extremity of a full-... 42 1.7
28emb|BX058037.1|CNS09GY1 Single read from an extremity of a full-... 42 1.7
29emb|BX053305.1|CNS09DAL Single read from an extremity of a full-... 42 1.7
30emb|BX053304.1|CNS09DAK Single read from an extremity of a full-... 42 1.7
31emb|BX054975.1|CNS09EKZ Single read from an extremity of a full-... 42 1.7
32emb|BX054726.1|CNS09EE2 Single read from an extremity of a full-... 42 1.7
33emb|BX054725.1|CNS09EE1 Single read from an extremity of a full-... 42 1.7
34emb|BX046548.1|CNS0982W Single read from an extremity of a full-... 42 1.7
35emb|BX045680.1|CNS097ES Single read from an extremity of a full-... 42 1.7
36emb|BX042580.1|CNS0950O Single read from an extremity of a full-... 42 1.7
37emb|BX042579.1|CNS0950N Single read from an extremity of a full-... 42 1.7
38emb|BX041880.1|CNS094H8 Single read from an extremity of a full-... 42 1.7
39emb|BX041463.1|CNS0945N Single read from an extremity of a full-... 42 1.7
40emb|BX041349.1|CNS0942H Single read from an extremity of a full-... 42 1.7
41emb|BX040977.1|CNS093S5 Single read from an extremity of a full-... 42 1.7
42emb|BX033733.1|CNS08Y6X Single read from an extremity of a full-... 42 1.7
43emb|BX031543.1|CNS08WI3 Single read from an extremity of a full-... 42 1.7
44emb|BX027561.1|CNS08TFH Single read from an extremity of a full-... 42 1.7
45emb|BX025600.1|CNS08RX0 Single read from an extremity of a full-... 42 1.7
46emb|BX021322.1|CNS08OM6 Single read from an extremity of a full-... 42 1.7
47emb|BX020409.1|CNS08NWT Single read from an extremity of a full-... 42 1.7
48emb|BX017672.1|CNS08LSS Single read from an extremity of a full-... 42 1.7
49emb|BX015014.1|CNS08JQY Single read from an extremity of a full-... 42 1.7
50emb|BX012160.1|CNS08HJO Single read from an extremity of a full-... 42 1.7
51emb|BX012159.1|CNS08HJN Single read from an extremity of a full-... 42 1.7
52emb|BX011957.1|CNS08HE1 Single read from an extremity of a full-... 42 1.7
53emb|BX011093.1|CNS08GQ1 Single read from an extremity of a full-... 42 1.7
54emb|BX010949.1|CNS08GM1 Single read from an extremity of a full-... 42 1.7
55emb|BX010605.1|CNS08GCH Single read from an extremity of a full-... 42 1.7
56emb|BX010604.1|CNS08GCG Single read from an extremity of a full-... 42 1.7
57emb|BX010581.1|CNS08GBT Single read from an extremity of a full-... 42 1.7
58emb|BX010191.1|CNS08G0Z Single read from an extremity of a full-... 42 1.7
59emb|BX008394.1|CNS08EN2 Single read from an extremity of a full-... 42 1.7
60emb|BX005487.1|CNS08CEB Single read from an extremity of a full-... 42 1.7
61dbj|AP006697.1| Lotus japonicus genomic DNA, chromosome 4, clone... 42 1.7
62dbj|AP004519.1| Lotus japonicus genomic DNA, chromosome 4, clone... 42 1.7
63gb|AC150540.2| Bos taurus BAC CH240-385H19 (Children's Hospital... 40 6.8
64gb|AC124322.7| Mus musculus chromosome 7, clone RP24-330M21, com... 40 6.8
65gb|AC110175.14| Mus musculus chromosome 12, clone RP23-124B21, c... 40 6.8
66gb|DQ160197.1| Homo sapiens RAD51-like 1 (S. cerevisiae) (RAD51L... 40 6.8
67emb|CT010432.7| Mouse DNA sequence from clone RP23-337G13 on chr... 40 6.8
68ref|XM_762816.1| Giardia lamblia ATCC 50803 hypothetical protein... 40 6.8
69emb|AL008721.1|HS390C10 Human DNA sequence from clone CTA-390C10... 40 6.8
70gb|AC164000.2| Mus musculus chromosome 7, clone RP23-157G7, comp... 40 6.8
71gb|AC068292.8| Homo sapiens BAC clone RP11-738L3 from 2, complet... 40 6.8
72dbj|AK199351.1| Mus musculus cDNA, clone:Y1G0130O18, strand:plus... 40 6.8
73emb|AL122013.5|CNS01DSU Human chromosome 14 DNA sequence BAC R-2... 40 6.8
74gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 40 6.8
75gb|AF007101.1|AF007101 Streptomyces hygroscopicus putative pteri... 40 6.8
76emb|AL607142.16| Mouse DNA sequence from clone RP23-98J9 on chro... 40 6.8 
>emb|AL034351.1|HS879K22 Human DNA sequence from clone RP5-879K22 on chromosome 1q32.1-41
             Contains part of the gene for melanoma antigen recognized
             by T cells 2 protein (MART2), complete sequence
          Length = 137678

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 126   gtcgctgctgacaagtgatgttc 148
             |||||||||||||||||||||||
Sbjct: 47274 gtcgctgctgacaagtgatgttc 47252
to top
>emb|BX067361.1|CNS09O51 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 215 tgtggatgacggtgcacaacag 236
           ||||||||||||||||||||||
Sbjct: 487 tgtggatgacggtgcacaacag 508
to top
>emb|BX065039.1|CNS09MCJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 798

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 215 tgtggatgacggtgcacaacag 236
           ||||||||||||||||||||||
Sbjct: 344 tgtggatgacggtgcacaacag 365
to top
>emb|BX056667.1|CNS09FVZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 857

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 215 tgtggatgacggtgcacaacag 236
           ||||||||||||||||||||||
Sbjct: 344 tgtggatgacggtgcacaacag 365
to top
>emb|BX056666.1|CNS09FVY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1015

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 215 tgtggatgacggtgcacaacag 236
           ||||||||||||||||||||||
Sbjct: 690 tgtggatgacggtgcacaacag 669
to top
>emb|BX056897.1|CNS09G2D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 644

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 215 tgtggatgacggtgcacaacag 236
           ||||||||||||||||||||||
Sbjct: 491 tgtggatgacggtgcacaacag 512
to top
>emb|BX053071.1|CNS09D43 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 406

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 215 tgtggatgacggtgcacaacag 236
           ||||||||||||||||||||||
Sbjct: 228 tgtggatgacggtgcacaacag 249
to top
>emb|BX042815.1|CNS09577 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 215 tgtggatgacggtgcacaacag 236
           ||||||||||||||||||||||
Sbjct: 519 tgtggatgacggtgcacaacag 540
to top
>emb|BX039805.1|CNS092VL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 215 tgtggatgacggtgcacaacag 236
           ||||||||||||||||||||||
Sbjct: 500 tgtggatgacggtgcacaacag 521
to top
>emb|BX034094.1|CNS08YGY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 784

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 215 tgtggatgacggtgcacaacag 236
           ||||||||||||||||||||||
Sbjct: 344 tgtggatgacggtgcacaacag 365
to top
>emb|BX020010.1|CNS08NLQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 512

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 215 tgtggatgacggtgcacaacag 236
           ||||||||||||||||||||||
Sbjct: 345 tgtggatgacggtgcacaacag 366
to top
>emb|BX011839.1|CNS08HAR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA18DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 875

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 215 tgtggatgacggtgcacaacag 236
           ||||||||||||||||||||||
Sbjct: 344 tgtggatgacggtgcacaacag 365
to top
>emb|BX011624.1|CNS08H4S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA18CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 215 tgtggatgacggtgcacaacag 236
           ||||||||||||||||||||||
Sbjct: 479 tgtggatgacggtgcacaacag 500
to top
>emb|BX009000.1|CNS08F3W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA14CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 841

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 215 tgtggatgacggtgcacaacag 236
           ||||||||||||||||||||||
Sbjct: 344 tgtggatgacggtgcacaacag 365
to top
>emb|BX006361.1|CNS08D2L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 215 tgtggatgacggtgcacaacag 236
           ||||||||||||||||||||||
Sbjct: 438 tgtggatgacggtgcacaacag 459
to top
>ref|XM_316470.2| Anopheles gambiae str. PEST ENSANGP00000021035
           (ENSANGG00000018546), partial mRNA
          Length = 1077

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 215 tgtggatgacggtgcacaacag 236
           ||||||||||||||||||||||
Sbjct: 902 tgtggatgacggtgcacaacag 881
to top
>gb|AC002288.1|HUAC002288 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-249B10, complete
             sequence
          Length = 213633

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 5     attagcactaccatcaaatga 25
             |||||||||||||||||||||
Sbjct: 87482 attagcactaccatcaaatga 87502
to top
>gb|AC130451.2| Homo sapiens chromosome 16 clone CTA-249B10, complete sequence
          Length = 215866

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 5      attagcactaccatcaaatga 25
              |||||||||||||||||||||
Sbjct: 128379 attagcactaccatcaaatga 128359
to top
>emb|BX071926.1|CNS09RNU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 486 tgtggatgacggtgcacaaca 506
to top
>emb|BX071892.1|CNS09RMW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1058

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 494 tgtggatgacggtgcacaaca 514
to top
>emb|BX068916.1|CNS09PC8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 640

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 496 tgtggatgacggtgcacaaca 516
to top
>emb|BX067978.1|CNS09OM6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 876

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 506 tgtggatgacggtgcacaaca 526
to top
>emb|BX067274.1|CNS09O2M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 477 tgtggatgacggtgcacaaca 497
to top
>emb|BX067273.1|CNS09O2L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 753 tgtggatgacggtgcacaaca 733
to top
>emb|BX065623.1|CNS09MSR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 696

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 482 tgtggatgacggtgcacaaca 502
to top
>emb|BX065469.1|CNS09MOH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1045

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 479 tgtggatgacggtgcacaaca 499
to top
>emb|BX065401.1|CNS09MML Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 478 tgtggatgacggtgcacaaca 498
to top
>emb|BX058037.1|CNS09GY1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 549

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 463 tgtggatgacggtgcacaaca 483
to top
>emb|BX053305.1|CNS09DAL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 487 tgtggatgacggtgcacaaca 507
to top
>emb|BX053304.1|CNS09DAK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 712 tgtggatgacggtgcacaaca 692
to top
>emb|BX054975.1|CNS09EKZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 773

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 466 tgtggatgacggtgcacaaca 486
to top
>emb|BX054726.1|CNS09EE2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 486 tgtggatgacggtgcacaaca 506
to top
>emb|BX054725.1|CNS09EE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 363 tgtggatgacggtgcacaaca 343
to top
>emb|BX046548.1|CNS0982W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20BA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 454 tgtggatgacggtgcacaaca 474
to top
>emb|BX045680.1|CNS097ES Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC19DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 489 tgtggatgacggtgcacaaca 509
to top
>emb|BX042580.1|CNS0950O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 561

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 504 tgtggatgacggtgcacaaca 524
to top
>emb|BX042579.1|CNS0950N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 743 tgtggatgacggtgcacaaca 723
to top
>emb|BX041880.1|CNS094H8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 361 tgtggatgacggtgcacaaca 341
to top
>emb|BX041463.1|CNS0945N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 503 tgtggatgacggtgcacaaca 523
to top
>emb|BX041349.1|CNS0942H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 842

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 397 tgtggatgacggtgcacaaca 417
to top
>emb|BX040977.1|CNS093S5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12AD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 511 tgtggatgacggtgcacaaca 531
to top
>emb|BX033733.1|CNS08Y6X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 481 tgtggatgacggtgcacaaca 501
to top
>emb|BX031543.1|CNS08WI3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 480 tgtggatgacggtgcacaaca 500
to top
>emb|BX027561.1|CNS08TFH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 500 tgtggatgacggtgcacaaca 520
to top
>emb|BX025600.1|CNS08RX0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 490 tgtggatgacggtgcacaaca 510
to top
>emb|BX021322.1|CNS08OM6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 512 tgtggatgacggtgcacaaca 532
to top
>emb|BX020409.1|CNS08NWT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 490 tgtggatgacggtgcacaaca 510
to top
>emb|BX017672.1|CNS08LSS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26CH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 500 tgtggatgacggtgcacaaca 520
to top
>emb|BX015014.1|CNS08JQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 493 tgtggatgacggtgcacaaca 513
to top
>emb|BX012160.1|CNS08HJO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 484 tgtggatgacggtgcacaaca 504
to top
>emb|BX012159.1|CNS08HJN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 654 tgtggatgacggtgcacaaca 634
to top
>emb|BX011957.1|CNS08HE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19AC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 541 tgtggatgacggtgcacaaca 521
to top
>emb|BX011093.1|CNS08GQ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 482 tgtggatgacggtgcacaaca 502
to top
>emb|BX010949.1|CNS08GM1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 497 tgtggatgacggtgcacaaca 517
to top
>emb|BX010605.1|CNS08GCH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 485 tgtggatgacggtgcacaaca 505
to top
>emb|BX010604.1|CNS08GCG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 656 tgtggatgacggtgcacaaca 636
to top
>emb|BX010581.1|CNS08GBT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 799

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 492 tgtggatgacggtgcacaaca 512
to top
>emb|BX010191.1|CNS08G0Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16BF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 730

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 484 tgtggatgacggtgcacaaca 504
to top
>emb|BX008394.1|CNS08EN2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 435 tgtggatgacggtgcacaaca 455
to top
>emb|BX005487.1|CNS08CEB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA1AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 215 tgtggatgacggtgcacaaca 235
           |||||||||||||||||||||
Sbjct: 483 tgtggatgacggtgcacaaca 503
to top
>dbj|AP006697.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT41M05, TM0404,
             complete sequence
          Length = 103744

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 371   accttacaaatgaagagttca 391
             |||||||||||||||||||||
Sbjct: 27543 accttacaaatgaagagttca 27563
to top
>dbj|AP004519.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT07K08, TM0046b,
            complete sequence
          Length = 71321

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 371  accttacaaatgaagagttca 391
            |||||||||||||||||||||
Sbjct: 4738 accttacaaatgaagagttca 4758
to top
>gb|AC150540.2| Bos taurus  BAC CH240-385H19 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 172471

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tctccagttctagatgttcatcat 67
             |||||||||||||||||| |||||
Sbjct: 63974 tctccagttctagatgttaatcat 63951
to top
>gb|AC124322.7| Mus musculus chromosome 7, clone RP24-330M21, complete sequence
          Length = 139336

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 129    gctgctgacaagtgatgttc 148
              ||||||||||||||||||||
Sbjct: 127541 gctgctgacaagtgatgttc 127522
to top
>gb|AC110175.14| Mus musculus chromosome 12, clone RP23-124B21, complete sequence
          Length = 242870

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 75     ctatgtgctccttgccacaa 94
              ||||||||||||||||||||
Sbjct: 169514 ctatgtgctccttgccacaa 169495
to top
>gb|DQ160197.1| Homo sapiens RAD51-like 1 (S. cerevisiae) (RAD51L1) gene, complete cds
          Length = 660392

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 386    agttcatggagctatacact 405
              ||||||||||||||||||||
Sbjct: 571412 agttcatggagctatacact 571393
to top
>emb|CT010432.7| Mouse DNA sequence from clone RP23-337G13 on chromosome 12, complete
              sequence
          Length = 207186

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 75     ctatgtgctccttgccacaa 94
              ||||||||||||||||||||
Sbjct: 127264 ctatgtgctccttgccacaa 127283
to top
>ref|XM_762816.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_69_19980_21188)
            partial mRNA
          Length = 1209

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 441  tgacgacgacgagcagatta 460
            ||||||||||||||||||||
Sbjct: 1179 tgacgacgacgagcagatta 1198
to top
>emb|AL008721.1|HS390C10 Human DNA sequence from clone CTA-390C10 on chromosome 22q11.21-12.1,
             complete sequence
          Length = 114231

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   ggcggccacctctgggctca 340
             ||||||||||||||||||||
Sbjct: 51012 ggcggccacctctgggctca 50993
to top
>gb|AC164000.2| Mus musculus chromosome 7, clone RP23-157G7, complete sequence
          Length = 206022

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 129    gctgctgacaagtgatgttc 148
              ||||||||||||||||||||
Sbjct: 192876 gctgctgacaagtgatgttc 192895
to top
>gb|AC068292.8| Homo sapiens BAC clone RP11-738L3 from 2, complete sequence
          Length = 113810

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 130   ctgctgacaagtgatgttct 149
             ||||||||||||||||||||
Sbjct: 57630 ctgctgacaagtgatgttct 57649
to top
>dbj|AK199351.1| Mus musculus cDNA, clone:Y1G0130O18, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000006948, based on BLAT search
          Length = 295

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 109 gctggctgctcttcagagtc 128
           ||||||||||||||||||||
Sbjct: 138 gctggctgctcttcagagtc 119
to top
>emb|AL122013.5|CNS01DSU Human chromosome 14 DNA sequence BAC R-204K16 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 173010

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 386   agttcatggagctatacact 405
             ||||||||||||||||||||
Sbjct: 69917 agttcatggagctatacact 69936
to top
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 165     ggacatcgacaccgacaacc 184
               ||||||||||||||||||||
Sbjct: 1845681 ggacatcgacaccgacaacc 1845700
to top
>gb|AF007101.1|AF007101 Streptomyces hygroscopicus putative pteridine-dependent dioxygenase,
             PKS modules 1,2,3 and 4, and putative regulatory protein
             genes, complete cds and putative hydroxylase gene, partial
             cds
          Length = 32870

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 168   catcgacaccgacaaccacc 187
             ||||||||||||||||||||
Sbjct: 18866 catcgacaccgacaaccacc 18885



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 168   catcgacaccgacaaccacc 187
             ||||||||||||||||||||
Sbjct: 13437 catcgacaccgacaaccacc 13456



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 168  catcgacaccgacaaccacc 187
            ||||||||||||||||||||
Sbjct: 8179 catcgacaccgacaaccacc 8198
to top
>emb|AL607142.16| Mouse DNA sequence from clone RP23-98J9 on chromosome 4, complete
              sequence
          Length = 188716

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 292    atgaggttcatagaggccgt 311
              ||||||||||||||||||||
Sbjct: 114953 atgaggttcatagaggccgt 114934


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,637,133
Number of Sequences: 3902068
Number of extensions: 3637133
Number of successful extensions: 64780
Number of sequences better than 10.0: 76
Number of HSP's better than 10.0 without gapping: 76
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 64661
Number of HSP's gapped (non-prelim): 119
length of query: 504
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 482
effective length of database: 17,147,199,772
effective search space: 8264950290104
effective search space used: 8264950290104
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top