ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name basdg19
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK100941.1| Oryza sativa (japonica cultivar-group) cDNA clon... 389 e-105
2dbj|AB112060.1| Oryza sativa (indica cultivar-group) OsMGD mRNA ... 383 e-103
3dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 121 3e-24
4dbj|AP005056.2| Oryza sativa (japonica cultivar-group) genomic D... 121 3e-24
5ref|XM_481404.1| Oryza sativa (japonica cultivar-group), mRNA 109 1e-20
6dbj|AK064148.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 1e-20
7gb|U62622.1|CSU62622 Cucumis sativus monogalactosyldiacylglycero... 98 4e-17
8gb|DQ455240.1| Medicago truncatula cDNA-AFLP fragment BC43M32_17... 78 4e-11
9ref|NM_126865.2| Arabidopsis thaliana MGDC; 1,2-diacylglycerol 3... 72 2e-09
10dbj|AB047398.1| Arabidopsis thaliana mgdC mRNA for MGDG synthase... 72 2e-09
11ref|NM_122048.2| Arabidopsis thaliana MGD2; 1,2-diacylglycerol 3... 68 4e-08
12gb|AY078038.1| Arabidopsis thaliana AT5g20410/F5O24_300 mRNA, co... 68 4e-08
13gb|AF372926.1|AF372926 Arabidopsis thaliana AT5g20410/F5O24_300 ... 68 4e-08
14emb|AJ000331.1|ATMGDGSYN Arabidopsis thaliana mRNA for monogalac... 68 4e-08
15gb|AC151744.23| Medicago truncatula clone mth2-32k10, complete s... 60 9e-06
16gb|AC157349.7| Medicago truncatula clone mth2-139l1, complete se... 60 9e-06
17gb|AY360394.1| Oryza sativa (japonica cultivar-group) chromosome... 58 3e-05
18dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
19dbj|AP005819.2| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
20dbj|AP004458.2| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
21emb|AJ249607.1|SOL249607 Spinacia oleracea mRNA for MGDG synthas... 58 3e-05
22dbj|AB047476.1| Nicotiana tabacum ntMGD A mRNA for MGDG synthase... 58 3e-05
23ref|NM_119327.2| Arabidopsis thaliana MGD1 (MONOGALACTOSYLDIACYL... 56 1e-04
24ref|NM_179151.1| Arabidopsis thaliana MGD1 (MONOGALACTOSYLDIACYL... 56 1e-04
25gb|BT008890.1| Arabidopsis thaliana At4g31780 mRNA, complete cds 56 1e-04
26gb|AY092965.1| Arabidopsis thaliana strong similarity to monogal... 56 1e-04
27gb|AF241797.1|AF241797 Arabidopsis thaliana monogalactosyldiacyl... 56 1e-04
28dbj|AB047399.1| Arabidopsis thaliana mgdA mRNA for MGDG synthase... 56 1e-04
29gb|AC007187.5| Arabidopsis thaliana chromosome 2 clone F7E22 map... 48 0.033
30emb|BX819497.1|CNS0AA20 Arabidopsis thaliana Full-length cDNA Co... 48 0.033
31emb|AL844550.5| Mouse DNA sequence from clone RP23-277K21 on chr... 44 0.52
32gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 42 2.0
33dbj|AK036870.1| Mus musculus adult female vagina cDNA, RIKEN ful... 42 2.0
34ref|NG_001019.4| Homo sapiens immunoglobulin heavy locus (IGH@) ... 42 2.0
35gb|AC129223.5| Mus musculus BAC clone RP24-535L7 from 9, complet... 42 2.0
36dbj|AB019438.1| Homo sapiens DNA for immunoglobulin heavy-chain ... 42 2.0
37gb|AC121141.12| Mus musculus chromosome 17, clone RP23-430A11, c... 40 8.1
38gb|AC163623.5| Mus musculus BAC clone RP23-123D6 from chromosome... 40 8.1
39ref|XM_418354.1| PREDICTED: Gallus gallus similar to Cohen syndr... 40 8.1
40gb|AC122286.4| Mus musculus BAC clone RP23-252F4 from chromosome... 40 8.1
41gb|AC099654.5| Homo sapiens BAC clone RP11-1217F2 from 7, comple... 40 8.1
42emb|Z95330.11|HS73E16 Human DNA sequence from clone RP1-73E16 on... 40 8.1
43emb|AL136102.10| Human DNA sequence from clone RP3-453O12 on chr... 40 8.1
44emb|AL121777.39|HSJ1057D4 Human DNA sequence from clone RP5-1057... 40 8.1
45emb|AL049541.24|HSJ991B18 Human DNA sequence from clone RP5-991B... 40 8.1
46emb|Y13657.2|RLFERUPTA Rhizobium leguminosarum fur gene for puta... 40 8.1
47gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 8.1
48dbj|AP007161.1| Aspergillus oryzae RIB40 genomic DNA, SC012 40 8.1
49emb|AL929393.8| Mouse DNA sequence from clone RP23-94P7 on chrom... 40 8.1
50gb|AC025759.4| Homo sapiens chromosome 5 clone CTD-2367B21, comp... 40 8.1
51gb|AC025466.6| Homo sapiens chromosome 5 clone CTD-2317L2, compl... 40 8.1
52gb|AC078952.20| Homo sapiens 3 BAC RP11-764E15 (Roswell Park Can... 40 8.1
53emb|AL732517.20| Mouse DNA sequence from clone RP23-134K17 on ch... 40 8.1
54gb|AC159308.4| Mus musculus BAC clone RP23-187B11 from chromosom... 40 8.1 
>dbj|AK100941.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023138C14, full
            insert sequence
          Length = 1679

 Score =  389 bits (196), Expect = e-105
 Identities = 430/507 (84%), Gaps = 1/507 (0%)
 Strand = Plus / Plus

                                                                        
Query: 16   ttgtttgacaaagnagcttggaaagccgattgggcagcttgttgtcatttgtggtcggaa 75
            ||||||||||| | |||||||||| || ||||| ||| |  |||||||||||||||||||
Sbjct: 687  ttgtttgacaa-ggagcttggaaaaccaattggacagttaattgtcatttgtggtcggaa 745

                                                                        
Query: 76   caaaacactgagctcttcattgcaggctcttgaatggaaaatgccaataaagattagggg 135
            |||||| |||||||| |||||||||||||||||||||||||| ||||| ||| |||||||
Sbjct: 746  caaaacgctgagctcctcattgcaggctcttgaatggaaaataccaattaaggttagggg 805

                                                                        
Query: 136  attcgagacccaaatggaaaagtggatgggggcttgtgattgcattataacaaaggctgg 195
            ||| |||||||| ||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 806  atttgagacccagatggagaaatggatgggggcttgtgattgcattataacaaaggctgg 865

                                                                        
Query: 196  accaggcaccattgctgaagccttgattaggggtcttcctatcatccttaatgacttcat 255
            |||||| ||||| || |||||||||||||| ||  | |||||||||||||||||||||||
Sbjct: 866  accaggtaccatcgccgaagccttgattagagggttgcctatcatccttaatgacttcat 925

                                                                        
Query: 256  acctggacaggaagtcggcaacgtcccttatgtcgtggacaacggcgcaggcgtgttctc 315
            ||||||||||||||| ||||| ||||||||||| |||||||| || || || || |||||
Sbjct: 926  acctggacaggaagttggcaatgtcccttatgttgtggacaatggtgctggtgtcttctc 985

                                                                        
Query: 316  caagagccccaaggaaaccgccgaacttgtcgcccactggttcggtccaggctcagagga 375
            ||| ||  | | |||||| ||  ||||||| |||| |||||| |||||||  || || ||
Sbjct: 986  caaaagttctagggaaactgctaaacttgttgcccgctggtttggtccagattctgatga 1045

                                                                        
Query: 376  ccgcaagagaatgtcggagaacgcgttgaaattggcccagccggaagccgtgttcgacat 435
             |  ||||| ||||| || || ||||| ||| |||| ||||| ||||| ||||| || ||
Sbjct: 1046 actgaagaggatgtcagaaaaagcgttaaaactggctcagccagaagcggtgtttgatat 1105

                                                                        
Query: 436  cgtcagggacatccacgagctctcccaggagcaaggggtgaaggcgcagatctccagctc 495
             ||||| |||||||| ||||| || | ||||||||||||||   | ||||| ||||| ||
Sbjct: 1106 tgtcagagacatccatgagctatctcgggagcaaggggtgatttcacagatatccagttc 1165

                                       
Query: 496  cctgacatcgtctttcttcataccatc 522
            | ||||||| || || |||||||||||
Sbjct: 1166 cttgacatcatcctttttcataccatc 1192
to top
>dbj|AB112060.1| Oryza sativa (indica cultivar-group) OsMGD mRNA for putative
            monogalactosyldiacylglycerol synthase, complete cds
          Length = 1671

 Score =  383 bits (193), Expect = e-103
 Identities = 418/493 (84%)
 Strand = Plus / Plus

                                                                        
Query: 30   agcttggaaagccgattgggcagcttgttgtcatttgtggtcggaacaaaacactgagct 89
            |||||||||| || ||||| ||| |  ||||||||||||||||||||||||| |||||||
Sbjct: 734  agcttggaaaaccaattggacagttaattgtcatttgtggtcggaacaaaacgctgagct 793

                                                                        
Query: 90   cttcattgcaggctcttgaatggaaaatgccaataaagattaggggattcgagacccaaa 149
            | |||||||||||||||||||||||||| ||||| ||| |||||||||| |||||||| |
Sbjct: 794  cctcattgcaggctcttgaatggaaaataccaattaaggttaggggatttgagacccaga 853

                                                                        
Query: 150  tggaaaagtggatgggggcttgtgattgcattataacaaaggctggaccaggcaccattg 209
            |||| || |||||||||||||||||||||||||||||||||||||||||||| ||||| |
Sbjct: 854  tggagaaatggatgggggcttgtgattgcattataacaaaggctggaccaggtaccatcg 913

                                                                        
Query: 210  ctgaagccttgattaggggtcttcctatcatccttaatgacttcatacctggacaggaag 269
            | |||||||||||||| ||  | |||||||||||||||||||||||||||||||||||||
Sbjct: 914  ccgaagccttgattagagggttgcctatcatccttaatgacttcatacctggacaggaag 973

                                                                        
Query: 270  tcggcaacgtcccttatgtcgtggacaacggcgcaggcgtgttctccaagagccccaagg 329
            | ||||| ||||||||||| |||||||| || || || || |||||||| ||  | | ||
Sbjct: 974  ttggcaatgtcccttatgttgtggacaatggtgctggtgtcttctccaaaagttctaggg 1033

                                                                        
Query: 330  aaaccgccgaacttgtcgcccactggttcggtccaggctcagaggaccgcaagagaatgt 389
            |||| ||  ||||||| |||| |||||| |||||||  || || || |  ||||| ||||
Sbjct: 1034 aaactgctaaacttgttgcccgctggtttggtccagattctgatgaactgaagaggatgt 1093

                                                                        
Query: 390  cggagaacgcgttgaaattggcccagccggaagccgtgttcgacatcgtcagggacatcc 449
            | || || ||||| ||| |||| ||||| ||||| ||||| || || ||||| |||||||
Sbjct: 1094 cagaaaaagcgttaaaactggctcagccagaagcggtgtttgatattgtcagagacatcc 1153

                                                                        
Query: 450  acgagctctcccaggagcaaggggtgaaggcgcagatctccagctccctgacatcgtctt 509
            | ||||| || | ||||||||||||||   | ||||| ||||| ||| ||||||| || |
Sbjct: 1154 atgagctatctcgggagcaaggggtgatttcacagatatccagttccttgacatcatcct 1213

                         
Query: 510  tcttcataccatc 522
            | |||||||||||
Sbjct: 1214 ttttcataccatc 1226
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  121 bits (61), Expect = 3e-24
 Identities = 97/108 (89%), Gaps = 1/108 (0%)
 Strand = Plus / Plus

                                                                            
Query: 16       ttgtttgacaaagnagcttggaaagccgattgggcagcttgttgtcatttgtggtcggaa 75
                ||||||||||| | |||||||||| || ||||| ||| |  |||||||||||||||||||
Sbjct: 34244434 ttgtttgacaa-ggagcttggaaaaccaattggacagttaattgtcatttgtggtcggaa 34244492

                                                                
Query: 76       caaaacactgagctcttcattgcaggctcttgaatggaaaatgccaat 123
                |||||| |||||||| |||||||||||||||||||||||||| |||||
Sbjct: 34244493 caaaacgctgagctcctcattgcaggctcttgaatggaaaataccaat 34244540



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 71/78 (91%)
 Strand = Plus / Plus

                                                                            
Query: 189      aggctggaccaggcaccattgctgaagccttgattaggggtcttcctatcatccttaatg 248
                ||||||||||||| ||||| || |||||||||||||| ||  | ||||||||||||||||
Sbjct: 34244815 aggctggaccaggtaccatcgccgaagccttgattagagggttgcctatcatccttaatg 34244874

                                  
Query: 249      acttcatacctggacagg 266
                ||||||||||||||||||
Sbjct: 34244875 acttcatacctggacagg 34244892



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 207/260 (79%)
 Strand = Plus / Plus

                                                                            
Query: 263      caggaagtcggcaacgtcccttatgtcgtggacaacggcgcaggcgtgttctccaagagc 322
                |||||||| ||||| ||||||||||| |||||||| || || || || |||||||| || 
Sbjct: 34245195 caggaagttggcaatgtcccttatgttgtggacaatggtgctggtgtcttctccaaaagt 34245254

                                                                            
Query: 323      cccaaggaaaccgccgaacttgtcgcccactggttcggtccaggctcagaggaccgcaag 382
                 | | |||||| ||  ||||||| |||| |||||| |||||||  || || || |  |||
Sbjct: 34245255 tctagggaaactgctaaacttgttgcccgctggtttggtccagattctgatgaactgaag 34245314

                                                                            
Query: 383      agaatgtcggagaacgcgttgaaattggcccagccggaagccgtgttcgacatcgtcagg 442
                || ||||| || || ||||| ||| |||| ||||| ||||| ||||| || || ||||| 
Sbjct: 34245315 aggatgtcagaaaaagcgttaaaactggctcagccagaagcggtgtttgatattgtcaga 34245374

                                                                            
Query: 443      gacatccacgagctctcccaggagcaaggggtgaaggcgcagatctccagctccctgaca 502
                |||||||| ||||| || | ||||||||||||||   | ||||| ||||| ||| |||||
Sbjct: 34245375 gacatccatgagctatctcgggagcaaggggtgatttcacagatatccagttccttgaca 34245434

                                    
Query: 503      tcgtctttcttcataccatc 522
                || || || |||||||||||
Sbjct: 34245435 tcatcctttttcataccatc 34245454



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 63/68 (92%)
 Strand = Plus / Plus

                                                                            
Query: 124      aaagattaggggattcgagacccaaatggaaaagtggatgggggcttgtgattgcattat 183
                |||| |||||||||| |||||||| ||||| || ||||||||||||||||||||||||||
Sbjct: 34244645 aaaggttaggggatttgagacccagatggagaaatggatgggggcttgtgattgcattat 34244704

                        
Query: 184      aacaaagg 191
                ||||||||
Sbjct: 34244705 aacaaagg 34244712



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                               
Query: 236      atcatccttaatgacttcatacctggacagg 266
                ||||||||||||||||||||  |||||||||
Sbjct: 34252197 atcatccttaatgacttcatcgctggacagg 34252227
to top
>dbj|AP005056.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0689B12
          Length = 154745

 Score =  121 bits (61), Expect = 3e-24
 Identities = 97/108 (89%), Gaps = 1/108 (0%)
 Strand = Plus / Plus

                                                                         
Query: 16    ttgtttgacaaagnagcttggaaagccgattgggcagcttgttgtcatttgtggtcggaa 75
             ||||||||||| | |||||||||| || ||||| ||| |  |||||||||||||||||||
Sbjct: 79707 ttgtttgacaa-ggagcttggaaaaccaattggacagttaattgtcatttgtggtcggaa 79765

                                                             
Query: 76    caaaacactgagctcttcattgcaggctcttgaatggaaaatgccaat 123
             |||||| |||||||| |||||||||||||||||||||||||| |||||
Sbjct: 79766 caaaacgctgagctcctcattgcaggctcttgaatggaaaataccaat 79813



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 71/78 (91%)
 Strand = Plus / Plus

                                                                         
Query: 189   aggctggaccaggcaccattgctgaagccttgattaggggtcttcctatcatccttaatg 248
             ||||||||||||| ||||| || |||||||||||||| ||  | ||||||||||||||||
Sbjct: 80088 aggctggaccaggtaccatcgccgaagccttgattagagggttgcctatcatccttaatg 80147

                               
Query: 249   acttcatacctggacagg 266
             ||||||||||||||||||
Sbjct: 80148 acttcatacctggacagg 80165



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 207/260 (79%)
 Strand = Plus / Plus

                                                                         
Query: 263   caggaagtcggcaacgtcccttatgtcgtggacaacggcgcaggcgtgttctccaagagc 322
             |||||||| ||||| ||||||||||| |||||||| || || || || |||||||| || 
Sbjct: 80468 caggaagttggcaatgtcccttatgttgtggacaatggtgctggtgtcttctccaaaagt 80527

                                                                         
Query: 323   cccaaggaaaccgccgaacttgtcgcccactggttcggtccaggctcagaggaccgcaag 382
              | | |||||| ||  ||||||| |||| |||||| |||||||  || || || |  |||
Sbjct: 80528 tctagggaaactgctaaacttgttgcccgctggtttggtccagattctgatgaactgaag 80587

                                                                         
Query: 383   agaatgtcggagaacgcgttgaaattggcccagccggaagccgtgttcgacatcgtcagg 442
             || ||||| || || ||||| ||| |||| ||||| ||||| ||||| || || ||||| 
Sbjct: 80588 aggatgtcagaaaaagcgttaaaactggctcagccagaagcggtgtttgatattgtcaga 80647

                                                                         
Query: 443   gacatccacgagctctcccaggagcaaggggtgaaggcgcagatctccagctccctgaca 502
             |||||||| ||||| || | ||||||||||||||   | ||||| ||||| ||| |||||
Sbjct: 80648 gacatccatgagctatctcgggagcaaggggtgatttcacagatatccagttccttgaca 80707

                                 
Query: 503   tcgtctttcttcataccatc 522
             || || || |||||||||||
Sbjct: 80708 tcatcctttttcataccatc 80727



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 63/68 (92%)
 Strand = Plus / Plus

                                                                         
Query: 124   aaagattaggggattcgagacccaaatggaaaagtggatgggggcttgtgattgcattat 183
             |||| |||||||||| |||||||| ||||| || ||||||||||||||||||||||||||
Sbjct: 79918 aaaggttaggggatttgagacccagatggagaaatggatgggggcttgtgattgcattat 79977

                     
Query: 184   aacaaagg 191
             ||||||||
Sbjct: 79978 aacaaagg 79985



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 236   atcatccttaatgacttcatacctggacagg 266
             ||||||||||||||||||||  |||||||||
Sbjct: 87470 atcatccttaatgacttcatcgctggacagg 87500
to top
>ref|XM_481404.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1410

 Score =  109 bits (55), Expect = 1e-20
 Identities = 142/171 (83%)
 Strand = Plus / Plus

                                                                        
Query: 149  atggaaaagtggatgggggcttgtgattgcattataacaaaggctggaccaggcaccatt 208
            ||||| ||||||||||| ||||| |||||||| || ||||||||||| || || || |||
Sbjct: 1033 atggagaagtggatgggcgcttgcgattgcatcatcacaaaggctggtcctggtacaatt 1092

                                                                        
Query: 209  gctgaagccttgattaggggtcttcctatcatccttaatgacttcatacctggacaggaa 268
            || || ||| |||| || || || || || || || || |||||||||||||||||||||
Sbjct: 1093 gcagaggccctgataagaggactcccaattattctcaacgacttcatacctggacaggaa 1152

                                                               
Query: 269  gtcggcaacgtcccttatgtcgtggacaacggcgcaggcgtgttctccaag 319
            ||||| || || ||||| ||||||||||| || || || ||||||||||||
Sbjct: 1153 gtcgggaatgtgccttacgtcgtggacaatggtgccggtgtgttctccaag 1203



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                         
Query: 413  cagccggaagccgtgttcgacatcgtcagggacatccacgagctc 457
            ||||| |||||||||||||||||||| | |||||||||| |||||
Sbjct: 1297 cagccagaagccgtgttcgacatcgtgaaggacatccacaagctc 1341
to top
>dbj|AK064148.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-103-C09, full
            insert sequence
          Length = 1345

 Score =  109 bits (55), Expect = 1e-20
 Identities = 142/171 (83%)
 Strand = Plus / Plus

                                                                        
Query: 149  atggaaaagtggatgggggcttgtgattgcattataacaaaggctggaccaggcaccatt 208
            ||||| ||||||||||| ||||| |||||||| || ||||||||||| || || || |||
Sbjct: 850  atggagaagtggatgggcgcttgcgattgcatcatcacaaaggctggtcctggtacaatt 909

                                                                        
Query: 209  gctgaagccttgattaggggtcttcctatcatccttaatgacttcatacctggacaggaa 268
            || || ||| |||| || || || || || || || || |||||||||||||||||||||
Sbjct: 910  gcagaggccctgataagaggactcccaattattctcaacgacttcatacctggacaggaa 969

                                                               
Query: 269  gtcggcaacgtcccttatgtcgtggacaacggcgcaggcgtgttctccaag 319
            ||||| || || ||||| ||||||||||| || || || ||||||||||||
Sbjct: 970  gtcgggaatgtgccttacgtcgtggacaatggtgccggtgtgttctccaag 1020



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                         
Query: 413  cagccggaagccgtgttcgacatcgtcagggacatccacgagctc 457
            ||||| |||||||||||||||||||| | |||||||||| |||||
Sbjct: 1114 cagccagaagccgtgttcgacatcgtgaaggacatccacaagctc 1158
to top
>gb|U62622.1|CSU62622 Cucumis sativus monogalactosyldiacylglycerol synthase mRNA, complete
            cds
          Length = 2142

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 94/109 (86%)
 Strand = Plus / Plus

                                                                        
Query: 161  atgggggcttgtgattgcattataacaaaggctggaccaggcaccattgctgaagccttg 220
            ||||| |||||||||||||||||||||||||| || || || || |||||||||||| ||
Sbjct: 1559 atgggagcttgtgattgcattataacaaaggcgggccctggaacgattgctgaagccatg 1618

                                                             
Query: 221  attaggggtcttcctatcatccttaatgacttcatacctggacaggaag 269
            || || ||||||||||| || || ||||||| |||  ||||||||||||
Sbjct: 1619 ataagaggtcttcctataattctgaatgactacattgctggacaggaag 1667
to top
>gb|DQ455240.1| Medicago truncatula cDNA-AFLP fragment BC43M32_171 sequence
          Length = 415

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 93/111 (83%)
 Strand = Plus / Plus

                                                                       
Query: 158 tggatgggggcttgtgattgcattataacaaaggctggaccaggcaccattgctgaagcc 217
           |||||||| || ||||| ||||| ||| |||| ||||||||||| || ||||| ||||| 
Sbjct: 168 tggatgggagcatgtgactgcatcatatcaaaagctggaccaggaacaattgcagaagca 227

                                                              
Query: 218 ttgattaggggtcttcctatcatccttaatgacttcatacctggacaggaa 268
           ||||| || ||||||||||| ||||| || ||||  || ||||||||||||
Sbjct: 228 ttgatcagaggtcttcctataatcctcaacgactatatccctggacaggaa 278
to top
>ref|NM_126865.2| Arabidopsis thaliana MGDC; 1,2-diacylglycerol
            3-beta-galactosyltransferase AT2G11810 (MGDC) mRNA,
            complete cds
          Length = 1564

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Plus

                                                                        
Query: 146  caaatggaaaagtggatgggggcttgtgattgcattataacaaaggctggaccaggcacc 205
            ||||||||||| |||||||| ||||||||||| || || || |||||||| || || || 
Sbjct: 1061 caaatggaaaaatggatgggagcttgtgattgtatcatcactaaggctggtccgggtacg 1120

                                                                        
Query: 206  attgctgaagccttgattaggggtcttcctatcatccttaatgacttcatacctggacag 265
            ||||| |||||  ||||| | || || || || ||||| |||||||  || |||||||||
Sbjct: 1121 attgcggaagcactgatttgcggcctcccaattatcctcaatgactatattcctggacag 1180

                                            
Query: 266  gaagtcggcaacgtcccttatgtcgtggacaa 297
            |||   |||||||| || ||||| ||||||||
Sbjct: 1181 gaaaaaggcaacgtgccgtatgttgtggacaa 1212
to top
>dbj|AB047398.1| Arabidopsis thaliana mgdC mRNA for MGDG synthase type C, complete cds
          Length = 1574

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Plus

                                                                        
Query: 146  caaatggaaaagtggatgggggcttgtgattgcattataacaaaggctggaccaggcacc 205
            ||||||||||| |||||||| ||||||||||| || || || |||||||| || || || 
Sbjct: 1061 caaatggaaaaatggatgggagcttgtgattgtatcatcactaaggctggtccgggtacg 1120

                                                                        
Query: 206  attgctgaagccttgattaggggtcttcctatcatccttaatgacttcatacctggacag 265
            ||||| |||||  ||||| | || || || || ||||| |||||||  || |||||||||
Sbjct: 1121 attgcggaagcactgatttgcggcctcccaattatcctcaatgactatattcctggacag 1180

                                            
Query: 266  gaagtcggcaacgtcccttatgtcgtggacaa 297
            |||   |||||||| || ||||| ||||||||
Sbjct: 1181 gaaaaaggcaacgtgccgtatgttgtggacaa 1212
to top
>ref|NM_122048.2| Arabidopsis thaliana MGD2; 1,2-diacylglycerol
            3-beta-galactosyltransferase/ transferase, transferring
            glycosyl groups AT5G20410 (MGD2) mRNA, complete cds
          Length = 1697

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 109/134 (81%)
 Strand = Plus / Plus

                                                                        
Query: 134  ggattcgagacccaaatggaaaagtggatgggggcttgtgattgcattataacaaaggct 193
            ||||| ||||| |||||||| || |||||||| |||||||| ||||| || ||||| |||
Sbjct: 1103 ggatttgagactcaaatggagaaatggatgggagcttgtgactgcatcatcacaaaagct 1162

                                                                        
Query: 194  ggaccaggcaccattgctgaagccttgattaggggtcttcctatcatccttaatgacttc 253
            |||||||| || || |||||| |  ||||| |    |||||||||||||| || || | |
Sbjct: 1163 ggaccaggaacaatcgctgaatcgctgattcgatcacttcctatcatcctcaacgattac 1222

                          
Query: 254  atacctggacagga 267
            || |||||||||||
Sbjct: 1223 attcctggacagga 1236
to top
>gb|AY078038.1| Arabidopsis thaliana AT5g20410/F5O24_300 mRNA, complete cds
          Length = 1185

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 109/134 (81%)
 Strand = Plus / Plus

                                                                       
Query: 134 ggattcgagacccaaatggaaaagtggatgggggcttgtgattgcattataacaaaggct 193
           ||||| ||||| |||||||| || |||||||| |||||||| ||||| || ||||| |||
Sbjct: 793 ggatttgagactcaaatggagaaatggatgggagcttgtgactgcatcatcacaaaagct 852

                                                                       
Query: 194 ggaccaggcaccattgctgaagccttgattaggggtcttcctatcatccttaatgacttc 253
           |||||||| || || |||||| |  ||||| |    |||||||||||||| || || | |
Sbjct: 853 ggaccaggaacaatcgctgaatcgctgattcgatcacttcctatcatcctcaacgattac 912

                         
Query: 254 atacctggacagga 267
           || |||||||||||
Sbjct: 913 attcctggacagga 926
to top
>gb|AF372926.1|AF372926 Arabidopsis thaliana AT5g20410/F5O24_300 mRNA, complete cds
          Length = 1585

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 109/134 (81%)
 Strand = Plus / Plus

                                                                        
Query: 134  ggattcgagacccaaatggaaaagtggatgggggcttgtgattgcattataacaaaggct 193
            ||||| ||||| |||||||| || |||||||| |||||||| ||||| || ||||| |||
Sbjct: 991  ggatttgagactcaaatggagaaatggatgggagcttgtgactgcatcatcacaaaagct 1050

                                                                        
Query: 194  ggaccaggcaccattgctgaagccttgattaggggtcttcctatcatccttaatgacttc 253
            |||||||| || || |||||| |  ||||| |    |||||||||||||| || || | |
Sbjct: 1051 ggaccaggaacaatcgctgaatcgctgattcgatcacttcctatcatcctcaacgattac 1110

                          
Query: 254  atacctggacagga 267
            || |||||||||||
Sbjct: 1111 attcctggacagga 1124
to top
>emb|AJ000331.1|ATMGDGSYN Arabidopsis thaliana mRNA for monogalactosyldiacylglycerol synthase
          Length = 1648

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 109/134 (81%)
 Strand = Plus / Plus

                                                                        
Query: 134  ggattcgagacccaaatggaaaagtggatgggggcttgtgattgcattataacaaaggct 193
            ||||| ||||| |||||||| || |||||||| |||||||| ||||| || ||||| |||
Sbjct: 1103 ggatttgagactcaaatggagaaatggatgggagcttgtgactgcatcatcacaaaagct 1162

                                                                        
Query: 194  ggaccaggcaccattgctgaagccttgattaggggtcttcctatcatccttaatgacttc 253
            |||||||| || || |||||| |  ||||| |    |||||||||||||| || || | |
Sbjct: 1163 ggaccaggaacaatcgctgaatcgctgattcgatcacttcctatcatcctcaacgattac 1222

                          
Query: 254  atacctggacagga 267
            || |||||||||||
Sbjct: 1223 attcctggacagga 1236
to top
>gb|AC151744.23| Medicago truncatula clone mth2-32k10, complete sequence
          Length = 110897

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                        
Query: 189  aggctggaccaggcaccattgctgaagccttgattaggggtcttcctatcatccttaatg 248
            ||||||||||||| || ||||| ||||| ||||| || ||||||||||| ||||| || |
Sbjct: 4913 aggctggaccaggaacaattgcagaagcattgatcagaggtcttcctataatcctcaacg 4854

                              
Query: 249  acttcatacctggacagg 266
            |||  || ||||||||||
Sbjct: 4853 actatatccctggacagg 4836
to top
>gb|AC157349.7| Medicago truncatula clone mth2-139l1, complete sequence
          Length = 116909

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                         
Query: 189   aggctggaccaggcaccattgctgaagccttgattaggggtcttcctatcatccttaatg 248
             ||||||||||||| || ||||| ||||| ||||| || ||||||||||| ||||| || |
Sbjct: 13109 aggctggaccaggaacaattgcagaagcattgatcagaggtcttcctataatcctcaacg 13168

                               
Query: 249   acttcatacctggacagg 266
             |||  || ||||||||||
Sbjct: 13169 actatatccctggacagg 13186
to top
>gb|AY360394.1| Oryza sativa (japonica cultivar-group) chromosome 8 BAC OSJNBa0070J19,
              complete sequence
          Length = 158749

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                           
Query: 413    cagccggaagccgtgttcgacatcgtcagggacatccacgagctc 457
              ||||| |||||||||||||||||||| | |||||||||| |||||
Sbjct: 131784 cagccagaagccgtgttcgacatcgtgaaggacatccacaagctc 131740



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                        
Query: 262    acaggaagtcggcaacgtcccttatgtcgtggacaacggcgcaggcgtgttctccaag 319
              |||||||||||| || || ||||| ||||||||||| || || || ||||||||||||
Sbjct: 131935 acaggaagtcgggaatgtgccttacgtcgtggacaatggtgccggtgtgttctccaag 131878



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                         
Query: 149    atggaaaagtggatgggggcttgtgattgcattataacaaagg 191
              ||||| ||||||||||| ||||| |||||||| || |||||||
Sbjct: 133470 atggagaagtggatgggcgcttgcgattgcatcatcacaaagg 133428
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                             
Query: 413      cagccggaagccgtgttcgacatcgtcagggacatccacgagctc 457
                ||||| |||||||||||||||||||| | |||||||||| |||||
Sbjct: 12262047 cagccagaagccgtgttcgacatcgtgaaggacatccacaagctc 12262091



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                          
Query: 262      acaggaagtcggcaacgtcccttatgtcgtggacaacggcgcaggcgtgttctccaag 319
                |||||||||||| || || ||||| ||||||||||| || || || ||||||||||||
Sbjct: 12261896 acaggaagtcgggaatgtgccttacgtcgtggacaatggtgccggtgtgttctccaag 12261953



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                           
Query: 149      atggaaaagtggatgggggcttgtgattgcattataacaaagg 191
                ||||| ||||||||||| ||||| |||||||| || |||||||
Sbjct: 12260361 atggagaagtggatgggcgcttgcgattgcatcatcacaaagg 12260403
to top
>dbj|AP005819.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OSJNBa0063H21
          Length = 188058

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                           
Query: 413    cagccggaagccgtgttcgacatcgtcagggacatccacgagctc 457
              ||||| |||||||||||||||||||| | |||||||||| |||||
Sbjct: 135539 cagccagaagccgtgttcgacatcgtgaaggacatccacaagctc 135583



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                        
Query: 262    acaggaagtcggcaacgtcccttatgtcgtggacaacggcgcaggcgtgttctccaag 319
              |||||||||||| || || ||||| ||||||||||| || || || ||||||||||||
Sbjct: 135388 acaggaagtcgggaatgtgccttacgtcgtggacaatggtgccggtgtgttctccaag 135445



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                         
Query: 149    atggaaaagtggatgggggcttgtgattgcattataacaaagg 191
              ||||| ||||||||||| ||||| |||||||| || |||||||
Sbjct: 133853 atggagaagtggatgggcgcttgcgattgcatcatcacaaagg 133895
to top
>dbj|AP004458.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0045D08
          Length = 160541

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                          
Query: 413   cagccggaagccgtgttcgacatcgtcagggacatccacgagctc 457
             ||||| |||||||||||||||||||| | |||||||||| |||||
Sbjct: 20696 cagccagaagccgtgttcgacatcgtgaaggacatccacaagctc 20740



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                       
Query: 262   acaggaagtcggcaacgtcccttatgtcgtggacaacggcgcaggcgtgttctccaag 319
             |||||||||||| || || ||||| ||||||||||| || || || ||||||||||||
Sbjct: 20545 acaggaagtcgggaatgtgccttacgtcgtggacaatggtgccggtgtgttctccaag 20602



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                        
Query: 149   atggaaaagtggatgggggcttgtgattgcattataacaaagg 191
             ||||| ||||||||||| ||||| |||||||| || |||||||
Sbjct: 19010 atggagaagtggatgggcgcttgcgattgcatcatcacaaagg 19052
to top
>emb|AJ249607.1|SOL249607 Spinacia oleracea mRNA for MGDG synthase A (mgd A gene)
          Length = 1569

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                        
Query: 156  agtggatgggggcttgtgattgcattataacaaaggctggaccaggcaccattgctgaag 215
            |||| ||||| ||||||||||| ||||||||||||||||| || || || ||||| ||||
Sbjct: 1223 agtgcatgggagcttgtgattgtattataacaaaggctggccctggaacgattgcagaag 1282

             
Query: 216  c 216
            |
Sbjct: 1283 c 1283
to top
>dbj|AB047476.1| Nicotiana tabacum ntMGD A mRNA for MGDG synthase type A, complete cds
          Length = 2055

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 89/109 (81%)
 Strand = Plus / Plus

                                                                        
Query: 161  atgggggcttgtgattgcattataacaaaggctggaccaggcaccattgctgaagccttg 220
            ||||| ||||||||||| ||||| || |||||||| || || || ||||| |||||| ||
Sbjct: 1439 atgggcgcttgtgattgtattatcactaaggctgggccggggactattgcagaagccgtg 1498

                                                             
Query: 221  attaggggtcttcctatcatccttaatgacttcatacctggacaggaag 269
            ||| | || || ||||| || |||||||| | |||  ||||||||||||
Sbjct: 1499 attcgaggactgcctataattcttaatgattacattgctggacaggaag 1547
to top
>ref|NM_119327.2| Arabidopsis thaliana MGD1 (MONOGALACTOSYLDIACYLGLYCEROL SYNTHASE 1);
            1,2-diacylglycerol 3-beta-galactosyltransferase AT4G31780
            (MGD1) transcript variant AT4G31780.2 mRNA, complete cds
          Length = 1998

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 161  atgggggcttgtgattgcattataacaaaggctggaccaggcaccattgctgaagc 216
            ||||| || ||||| ||||| |||||||||||||| |||||||| || ||||||||
Sbjct: 1484 atgggtgcctgtgactgcatcataacaaaggctggtccaggcactatagctgaagc 1539
to top
>ref|NM_179151.1| Arabidopsis thaliana MGD1 (MONOGALACTOSYLDIACYLGLYCEROL SYNTHASE 1);
            1,2-diacylglycerol 3-beta-galactosyltransferase/
            transferase, transferring glyc> AT4G31780 (MGD1)
            transcript variant AT4G31780.1 mRNA, complete cds
          Length = 1999

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 161  atgggggcttgtgattgcattataacaaaggctggaccaggcaccattgctgaagc 216
            ||||| || ||||| ||||| |||||||||||||| |||||||| || ||||||||
Sbjct: 1484 atgggtgcctgtgactgcatcataacaaaggctggtccaggcactatagctgaagc 1539
to top
>gb|BT008890.1| Arabidopsis thaliana At4g31780 mRNA, complete cds
          Length = 1602

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 161  atgggggcttgtgattgcattataacaaaggctggaccaggcaccattgctgaagc 216
            ||||| || ||||| ||||| |||||||||||||| |||||||| || ||||||||
Sbjct: 1261 atgggtgcctgtgactgcatcataacaaaggctggtccaggcactatagctgaagc 1316
to top
>gb|AY092965.1| Arabidopsis thaliana strong similarity to
            monogalactosyldiacylglycerol synthase, Cucumis sativus,
            PID:g1805254 (At4g31780) mRNA, complete cds
          Length = 2116

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 161  atgggggcttgtgattgcattataacaaaggctggaccaggcaccattgctgaagc 216
            ||||| || ||||| ||||| |||||||||||||| |||||||| || ||||||||
Sbjct: 1561 atgggtgcctgtgactgcatcataacaaaggctggtccaggcactatagctgaagc 1616
to top
>gb|AF241797.1|AF241797 Arabidopsis thaliana monogalactosyldiacylglycerol synthase (MGD1)
            mRNA, complete cds
          Length = 1929

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 161  atgggggcttgtgattgcattataacaaaggctggaccaggcaccattgctgaagc 216
            ||||| || ||||| ||||| |||||||||||||| |||||||| || ||||||||
Sbjct: 1420 atgggtgcctgtgactgcatcataacaaaggctggtccaggcactatagctgaagc 1475
to top
>dbj|AB047399.1| Arabidopsis thaliana mgdA mRNA for MGDG synthase type A, complete cds
          Length = 1775

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 161  atgggggcttgtgattgcattataacaaaggctggaccaggcaccattgctgaagc 216
            ||||| || ||||| ||||| |||||||||||||| |||||||| || ||||||||
Sbjct: 1365 atgggtgcctgtgactgcatcataacaaaggctggtccaggcactatagctgaagc 1420
to top
>gb|AC007187.5| Arabidopsis thaliana chromosome 2 clone F7E22 map mi421, complete
             sequence
          Length = 98432

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 146   caaatggaaaagtggatgggggcttgtgattg 177
             ||||||||||| |||||||| |||||||||||
Sbjct: 37270 caaatggaaaaatggatgggagcttgtgattg 37239
to top
>emb|BX819497.1|CNS0AA20 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB83ZH08 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1565

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 146  caaatggaaaagtggatgggggcttgtgattg 177
            ||||||||||| |||||||| |||||||||||
Sbjct: 1080 caaatggaaaaatggatgggagcttgtgattg 1111
to top
>emb|AL844550.5| Mouse DNA sequence from clone RP23-277K21 on chromosome 2, complete
             sequence
          Length = 118080

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 149   atggaaaagtggatgggggctt 170
             ||||||||||||||||||||||
Sbjct: 13210 atggaaaagtggatgggggctt 13231
to top
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 419    gaagccgtgttcgacatcgtc 439
              |||||||||||||||||||||
Sbjct: 763026 gaagccgtgttcgacatcgtc 763006
to top
>dbj|AK036870.1| Mus musculus adult female vagina cDNA, RIKEN full-length enriched
            library, clone:9930020J04 product:similar to epidermal
            growth factor-receptor-binding protein GRB-4 (fragment)
            [Mus musculus], full insert sequence
          Length = 3560

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 571  ccttggaagatgtgtacatagctag 595
            |||||||| ||||||||||||||||
Sbjct: 2441 ccttggaaaatgtgtacatagctag 2465
to top
>ref|NG_001019.4| Homo sapiens immunoglobulin heavy locus (IGH@) on chromosome 14
          Length = 1279711

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 76     caaaacactgagctcttcatt 96
              |||||||||||||||||||||
Sbjct: 268850 caaaacactgagctcttcatt 268870
to top
>gb|AC129223.5| Mus musculus BAC clone RP24-535L7 from 9, complete sequence
          Length = 150462

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 571   ccttggaagatgtgtacatagctag 595
             |||||||| ||||||||||||||||
Sbjct: 54824 ccttggaaaatgtgtacatagctag 54800
to top
>dbj|AB019438.1| Homo sapiens DNA for immunoglobulin heavy-chain variable region,
             complete sequence, 2 of 5
          Length = 200000

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 76    caaaacactgagctcttcatt 96
             |||||||||||||||||||||
Sbjct: 68850 caaaacactgagctcttcatt 68870
to top
>gb|AC121141.12| Mus musculus chromosome 17, clone RP23-430A11, complete sequence
          Length = 182218

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 82     actgagctcttcattgcagg 101
              ||||||||||||||||||||
Sbjct: 103291 actgagctcttcattgcagg 103310
to top
>gb|AC163623.5| Mus musculus BAC clone RP23-123D6 from chromosome 9, complete sequence
          Length = 193784

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 536    agccattgccccagccccat 555
              ||||||||||||||||||||
Sbjct: 188152 agccattgccccagccccat 188171
to top
>ref|XM_418354.1| PREDICTED: Gallus gallus similar to Cohen syndrome 1 protein isoform
            1 (LOC420242), partial mRNA
          Length = 13362

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 52   gcttgttgtcatttgtggtc 71
            ||||||||||||||||||||
Sbjct: 4277 gcttgttgtcatttgtggtc 4258
to top
>gb|AC122286.4| Mus musculus BAC clone RP23-252F4 from chromosome 6, complete sequence
          Length = 178633

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 148    aatggaaaagtggatggggg 167
              ||||||||||||||||||||
Sbjct: 106119 aatggaaaagtggatggggg 106138
to top
>gb|AC099654.5| Homo sapiens BAC clone RP11-1217F2 from 7, complete sequence
          Length = 149259

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 482   cagatctccagctccctgac 501
             ||||||||||||||||||||
Sbjct: 94279 cagatctccagctccctgac 94260
to top
>emb|Z95330.11|HS73E16 Human DNA sequence from clone RP1-73E16 on chromosome 20q12-13.3
            Contains ESTs, STSs and GSSs, complete sequence
          Length = 43922

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 482  cagatctccagctccctgac 501
            ||||||||||||||||||||
Sbjct: 3658 cagatctccagctccctgac 3639
to top
>emb|AL136102.10| Human DNA sequence from clone RP3-453O12 on chromosome 20 Contains
             ESTs, STSs and GSSs, complete sequence
          Length = 78160

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 482   cagatctccagctccctgac 501
             ||||||||||||||||||||
Sbjct: 21314 cagatctccagctccctgac 21333
to top
>emb|AL121777.39|HSJ1057D4 Human DNA sequence from clone RP5-1057D4 on chromosome 20 Contains the
             SRMP1 gene for spermidine synthase pseudogene 1, the 5'
             end of the gene for a novel protein similar to
             glucosamine-6-sulfatases (SULF2) (sulfatase 2, H-SULF2,
             KIAA1247) and a CpG island, complete sequence
          Length = 131888

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 482   cagatctccagctccctgac 501
             ||||||||||||||||||||
Sbjct: 69052 cagatctccagctccctgac 69071
to top
>emb|AL049541.24|HSJ991B18 Human DNA sequence from clone RP5-991B18 on chromosome 20q13.11-13.3
             Contains a putative novel gene, ESTs, STSs and GSSs,
             complete sequence
          Length = 129874

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 482   cagatctccagctccctgac 501
             ||||||||||||||||||||
Sbjct: 69245 cagatctccagctccctgac 69264
to top
>emb|Y13657.2|RLFERUPTA Rhizobium leguminosarum fur gene for putative ferric uptake
           regulator
          Length = 670

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 412 ccagccggaagccgtgttcg 431
           ||||||||||||||||||||
Sbjct: 598 ccagccggaagccgtgttcg 579
to top
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 414     agccggaagccgtgttcgacatcg 437
               |||||||||||||| |||||||||
Sbjct: 2589452 agccggaagccgtgctcgacatcg 2589429
to top
>dbj|AP007161.1| Aspergillus oryzae RIB40 genomic DNA, SC012
          Length = 2668010

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 528     aagccagcagccattgcccc 547
               ||||||||||||||||||||
Sbjct: 1066915 aagccagcagccattgcccc 1066896
to top
>emb|AL929393.8| Mouse DNA sequence from clone RP23-94P7 on chromosome 4, complete
             sequence
          Length = 202299

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 536   agccattgccccagccccat 555
             ||||||||||||||||||||
Sbjct: 65009 agccattgccccagccccat 64990
to top
>gb|AC025759.4| Homo sapiens chromosome 5 clone CTD-2367B21, complete sequence
          Length = 147404

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 174    attgcattataacaaaggct 193
              ||||||||||||||||||||
Sbjct: 122411 attgcattataacaaaggct 122430
to top
>gb|AC025466.6| Homo sapiens chromosome 5 clone CTD-2317L2, complete sequence
          Length = 56719

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   attgcattataacaaaggct 193
             ||||||||||||||||||||
Sbjct: 19640 attgcattataacaaaggct 19659
to top
>gb|AC078952.20| Homo sapiens 3 BAC RP11-764E15 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 169103

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 229   tcttcctatcatccttaatgacttcata 256
             |||||||||| || ||||||||||||||
Sbjct: 47884 tcttcctatcttctttaatgacttcata 47911
to top
>emb|AL732517.20| Mouse DNA sequence from clone RP23-134K17 on chromosome 4, complete
             sequence
          Length = 139314

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 536   agccattgccccagccccat 555
             ||||||||||||||||||||
Sbjct: 73196 agccattgccccagccccat 73215
to top
>gb|AC159308.4| Mus musculus BAC clone RP23-187B11 from chromosome 9, complete
            sequence
          Length = 217927

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 536  agccattgccccagccccat 555
            ||||||||||||||||||||
Sbjct: 2941 agccattgccccagccccat 2960


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,672,880
Number of Sequences: 3902068
Number of extensions: 4672880
Number of successful extensions: 94318
Number of sequences better than 10.0: 54
Number of HSP's better than 10.0 without gapping: 54
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 94061
Number of HSP's gapped (non-prelim): 251
length of query: 595
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 572
effective length of database: 17,143,297,704
effective search space: 9805966286688
effective search space used: 9805966286688
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top