ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name basda21
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|D01000.1|RICSODB Oryza sativa mRNA for copper/zinc-superoxid... 335 1e-88
2gb|AY103754.1| Zea mays PCO107770 mRNA sequence 272 1e-69
3gb|L32834.1|ASNCZSD Aspergillus japonicus (clone Assod4-g) coppe... 264 3e-67
4gb|BT017337.1| Zea mays clone EL01N0321D04.c mRNA sequence 258 2e-65
5emb|X17565.1|ZMSOD4 Zea mays mRNA for superoxide dismutase-4AP (... 258 2e-65
6gb|M15175.1|MZESOD2A Maize superoxide dismutase 2 (SOD2) mRNA, c... 256 8e-65
7gb|M54936.1|MZESOD2 Maize superoxide dismutase-2 (Sod-2) mRNA, c... 256 8e-65
8emb|X17564.1|ZMSOD4A Zea mays mRNA for superoxide dismutase-4A (... 250 5e-63
9gb|AY109448.1| Zea mays CL1415_1 mRNA sequence 250 5e-63
10ref|NM_186073.1| Oryza sativa (japonica cultivar-group), mRNA 232 1e-57
11dbj|AK120692.1| Oryza sativa (japonica cultivar-group) cDNA clon... 208 2e-50
12dbj|AK061662.1| Oryza sativa (japonica cultivar-group) cDNA clon... 208 2e-50
13dbj|D00999.1|RICSODA Oryza sativa mRNA for copper/zinc-superoxid... 208 2e-50
14gb|DQ058108.1| Oryza sativa (indica cultivar-group) cytoplasmic ... 200 4e-48
15gb|L36320.1|RICSOXDM Oryza sativa (clone cu101) superoxide dismu... 200 4e-48
16gb|AY823553.1| Pennisetum glaucum superoxide dismutase mRNA, par... 157 5e-35
17gb|AF479059.1| Sandersonia aurantiaca copper/zinc superoxide dis... 127 5e-26
18emb|AJ250667.1|ACO250667 Ananas comosus mRNA for copper/zinc-sup... 119 1e-23
19dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 105 2e-19
20dbj|AP003825.3| Oryza sativa (japonica cultivar-group) genomic D... 105 2e-19
21dbj|AP004274.5| Oryza sativa (japonica cultivar-group) genomic D... 105 2e-19
22gb|L19434.1|RICSODCC2A Oryza sativa cytosolic copper/zinc-supero... 105 2e-19
23emb|AJ586519.1| Fagus sylvatica partial sod1 mRNA for superoxide... 98 4e-17
24gb|AF328859.1| Avicennia marina Cu-Zn superoxide dismutase mRNA,... 90 1e-14
25gb|U34726.1|ZMU34726 Zea mays superoxide dismutase 4 (sod4) gene... 88 4e-14
26gb|AY833718.1| Codonopsis lanceolata CuZn superoxide dismutase (... 86 2e-13
27emb|AJ844003.1| Plantago major mRNA for copper-zinc superoxide d... 86 2e-13
28gb|DQ078121.2| Rheum australe copper/zinc superoxide dismutase m... 84 6e-13
29gb|AF037359.1|AF037359 Paulownia kawakamii superoxide dismutase ... 84 6e-13
30gb|U34727.1|ZMU34727 Zea mays superoxide dismutase 4A (sod4A) ge... 84 6e-13
31gb|AF426829.1|AF426829 Olea europaea Cu/Zn-superoxide dismutase ... 82 2e-12
32gb|AF054150.1|AF054150 Zantedeschia aethiopica cytosolic Cu/Zn-s... 82 2e-12
33gb|DQ088818.1| Gossypium hirsutum cytoplasmic Cu/ZnSOD mRNA, com... 78 4e-11
34emb|AJ428575.2|OEU428575 Olea europaea Cu/Zn super-oxide dismuta... 78 4e-11
35emb|AJ278669.1|PTR278669 Populus tremula x Populus tremuloides m... 78 4e-11
36dbj|AB091055.1| Barbula unguiculata mRNA for cytosolic copper/zi... 78 4e-11
37gb|AF016892.1|AF016892 Populus tremuloides cytoplasmic superoxid... 78 4e-11
38gb|U80069.1|MCU80069 Mesembryanthemum crystallinum cytosolic cop... 78 4e-11
39emb|X73139.1|IBSOD I.batatas mRNA for superoxide dismutase 76 2e-10
40gb|AY694187.1| Camellia sinensis Cu/Zn superoxide dismutase mRNA... 74 6e-10
41gb|DQ481231.1| Populus suaveolens cytoplasmic Cu/Zn-superoxide d... 74 6e-10
42gb|DQ499511.1| Arachis hypogaea cultivar JL-24 Cu-Zn superoxide ... 74 6e-10
43gb|DQ097721.1| Arachis hypogaea Cu-Zn superoxide dismutase mRNA,... 74 6e-10
44emb|AJ786258.1| Helianthus annuus mRNA for Cu/Zn superoxide dism... 74 6e-10
45gb|AF355460.1|AF355460 Solanum tuberosum Cu/Zn-superoxide dismut... 74 6e-10
46gb|AF354748.1|AF354748 Solanum tuberosum copper-zinc superoxide ... 74 6e-10
47dbj|AB062752.1| Bruguiera gymnorhiza SodC mRNA for copper/zinc s... 74 6e-10
48ref|NM_100757.2| Arabidopsis thaliana CSD1; copper, zinc superox... 72 2e-09
49gb|DQ227345.1| Nelumbo nucifera isolate 0 copper-zinc superoxide... 72 2e-09
50gb|AY091168.1| Arabidopsis thaliana putative superoxide dismutas... 72 2e-09
51gb|AY050932.1| Arabidopsis thaliana putative superoxidase dismut... 72 2e-09
52emb|X60935.1|ATCZSUDI A.thaliana mRNA for Cu,Zn superoxide dismu... 72 2e-09
53emb|BX818158.1|CNS0AE2K Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
54gb|AY087273.1| Arabidopsis thaliana clone 33493 mRNA, complete s... 72 2e-09
55gb|AY881163.1| Nelumbo nucifera isolate 13 copper-zinc superoxid... 72 2e-09
56gb|AY881162.1| Nelumbo nucifera isolate 11 copper-zinc superoxid... 72 2e-09
57gb|AY881155.1| Nelumbo nucifera isolate 4 copper-zinc superoxide... 72 2e-09
58gb|AY646367.1| Malus xiaojinensis superoxide dismutase (Sod1) mR... 70 9e-09
59emb|X14040.1|LECYTSOD Tomato mRNA for cytoplasmic Cu-Zn superoxi... 70 9e-09
60emb|AJ844861.1| Drosophila bipectinata partial Sod gene, exons 1... 70 9e-09
61emb|AJ844854.1| Drosophila malerkotliana pallens partial Sod gen... 70 9e-09
62emb|AJ844850.1| Drosophila bipectinata partial Sod gene, exons 1... 70 9e-09
63emb|AJ844844.1| Drosophila malerkotliana malerkotliana partial S... 70 9e-09
64dbj|AB190501.1| Populus alba x Populus tremula var. glandulosa C... 70 9e-09
65dbj|AB190500.1| Populus alba x Populus tremula var. glandulosa C... 70 9e-09
66gb|M37150.1|TOMSODA Tomato superoxide dismutase (SOD) mRNA, comp... 70 9e-09
67gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 68 4e-08
68gb|AC135257.1| Genomic sequence for Oryza sativa, Nipponbare str... 68 4e-08
69emb|AJ844862.1| Drosophila bipectinata partial Sod gene, exons 1... 68 4e-08
70dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 68 4e-08
71gb|L19435.1|RICSODCC Oryza sativa cytosolic copper/zinc-superoxi... 68 4e-08
72emb|X58578.1|PSCUZNPS3 P.sylvestris mRNA for CuZn superoxide dis... 66 1e-07
73emb|AJ844839.1| Drosophila malerkotliana malerkotliana partial S... 66 1e-07
74emb|AJ278671.1|PTR278671 Populus tremula x Populus tremuloides m... 66 1e-07
75emb|AJ278670.1|PTR278670 Populus tremula x Populus tremuloides p... 66 1e-07
76dbj|D49485.1| Solidago canadensis var. scabra mRNA for copper/zi... 66 1e-07
77gb|AF071112.1|AF071112 Brassica rapa ssp. pekinensis cytosolic C... 66 1e-07
78gb|DQ124227.1| Fagus sylvatica putative copper/zinc-superoxide d... 64 6e-07
79emb|X55974.1|NPSODM N.plumbaginifolia mRNA for superoxide dismutase 64 6e-07
80emb|BX816203.1|CNS0AE91 Arabidopsis thaliana Full-length cDNA Co... 64 6e-07
81gb|AF016893.1|AF016893 Populus tremuloides copper/zinc-superoxid... 64 6e-07
82gb|AF318938.1| Citrus limon copper/zinc superoxide dismutase mRN... 62 2e-06
83emb|Y13610.1|CPCZSD Carica papaya mRNA for copper/zinc-superoxid... 62 2e-06
84emb|AJ844865.1| Drosophila parabipectinata partial Sod gene, exo... 62 2e-06
85emb|AJ844860.1| Drosophila bipectinata partial Sod gene, exons 1... 62 2e-06
86emb|AJ844859.1| Drosophila bipectinata partial Sod gene, exons 1... 62 2e-06
87emb|AJ844855.1| Drosophila malerkotliana pallens partial Sod gen... 62 2e-06
88gb|AF191342.1| Olea europaea copper/zinc superoxide dismutase (S... 62 2e-06
89gb|AY642137.1| Manihot esculenta copper/zinc superoxide dismutas... 62 2e-06
90gb|AY881165.1| Nelumbo nucifera isolate 16 copper-zinc superoxid... 62 2e-06
91gb|AY881164.1| Nelumbo nucifera isolate 14 copper-zinc superoxid... 62 2e-06
92gb|AF009734.1|AF009734 Capsicum annuum Cu/Zn superoxide dismutas... 62 2e-06
93emb|X95728.1|BJMSOD1GE B.juncea mRNA for Cu/Zn-superoxide dismutase 60 9e-06
94emb|X53872.1|SOSODCY Spinacia oleracea mRNA for cytosolic copper... 60 9e-06
95gb|DQ431473.1| Malus xiaojinensis Sod2 (Sod2) mRNA, complete cds 60 9e-06
96gb|S72444.1| Drosophila subobscura Sod gene, partial cds 60 9e-06
97gb|AC003981.2|AC003981 Genomic sequence for Arabidopsis thaliana... 60 9e-06
98gb|AF457209.1| Hevea brasiliensis Cu/Zn superoxide dismutase (Cu... 60 9e-06
99gb|L13281.1|DROCUZNSOD Drosophila willistoni Cu/Zn-superoxide di... 60 9e-06
100gb|AF009735.1| Raphanus sativus Cu/Zn superoxide dismutase (SOD)... 60 9e-06
101gb|AF034630.1|AF034630 Panax ginseng Cu/Zn superoxide dismutase ... 60 9e-06
102gb|AF540558.1| Brassica juncea clone SOD 8A superoxide dismutase... 58 4e-05
103emb|AJ012739.1|CAR012739 Cicer arietinum mRNA for superoxide dis... 58 4e-05
104emb|AJ012691.1|CAR012691 Cicer arietinum mRNA for superoxide dis... 58 4e-05
105dbj|AB189165.1| Pisum sativum mRNA for copper zinc superoxide di... 58 4e-05
106dbj|AB087845.1| Pisum sativum SOD mRNA for superoxide dismutase,... 58 4e-05
107gb|U37714.1|DHU37714 Drosophila hydei Cu,Zn superoxide dismutase... 58 4e-05
108gb|M63003.1|PEACUZNSD Pea Cu-Zn superoxide dismutase mRNA, compl... 58 4e-05
109gb|DQ445093.1| Gossypium hirsutum putative cytosolic copper/zinc... 56 1e-04
110gb|AF127156.1| Drosophila erecta Cu-Zn superoxide dismutase (Sod... 56 1e-04
111gb|AY335229.1| Drosophila sucinea clone D.suc23 superoxide dismu... 56 1e-04
112gb|AY335228.1| Drosophila capricorni clone D.cap3 superoxide dis... 56 1e-04
113gb|AY335226.1| Drosophila capricorni clone D.cap1 superoxide dis... 56 1e-04
114gb|AF021825.1|AF021825 Drosophila immigrans superoxide dismutase... 56 1e-04
115gb|U47868.1|DAU47868 Drosophila ambigua NDSSC 14011-0091.1 Cu,Zn... 56 1e-04
116gb|DQ178940.1| Cucumis sativus Cu/Zn superoxide dismutase 1 mRNA... 54 6e-04
117gb|AY257198.1| Lotus corniculatus var. japonicus cytosolic CuZn-... 54 6e-04
118emb|Z19591.1|DMCZSUDMA D.melanogaster Cu-Zn superoxide dismutase... 52 0.002
119emb|Y00367.1|DMSOD Drosophila mRNA for Cu-Zn superoxide dismutase 52 0.002
120emb|X17332.1|DMSODG2 Drosophila Cu-Zn superoxide dismutase gene ... 52 0.002
121emb|X13780.1|DMSODG Drosophila melanogaster sod gene for Cu-Zn s... 52 0.002
122gb|AC010023.6| Drosophila melanogaster 3L BAC RP98-19G23 (Roswel... 52 0.002
123gb|AC096692.5| Drosophila melanogaster 3L BAC RP98-48O3 (Roswell... 52 0.002
124ref|NM_057387.3| Drosophila melanogaster Superoxide dismutase CG... 52 0.002
125gb|AY071435.1| Drosophila melanogaster RE52090 full length cDNA 52 0.002
126gb|AF127158.1| Drosophila mauritiana Cu-Zn superoxide dismutase ... 52 0.002
127gb|AF127157.1| Drosophila sechellia Cu-Zn superoxide dismutase (... 52 0.002
128gb|AY335227.1| Drosophila capricorni clone D.cap2 superoxide dis... 52 0.002
129gb|AC006562.8|AC006562 Drosophila melanogaster, chromosome 3L, r... 52 0.002
130gb|S72589.1|S72589 Drosophila melanogaster slow superoxide dismu... 52 0.002
131gb|AE003546.4| Drosophila melanogaster chromosome 3L, section 39... 52 0.002
132gb|U47892.1|DOU47892 Drosophila obscura Cu,Zn superoxide dismuta... 52 0.002
133gb|M24421.1|DROSODCUZN Drosophila melanogaster Cu-Zn superoxide ... 52 0.002
134gb|AY804513.1| Drosophila yakuba strain Tai18 sod (sod) gene, pa... 50 0.009
135gb|AY804512.1| Drosophila santomea strain STO.4 sod (sod) gene, ... 50 0.009
136emb|X95726.1|BJMSOD2GE B.juncea mRNA for Cu/Zn-superoxide dismutase 50 0.009
137emb|X56435.1|PSSODII Pea mRNA for Cu/Zn superoxide dismutase II ... 50 0.009
138gb|DQ286712.1| Eisenia fetida superoxide dismutase mRNA, partial... 50 0.009
139gb|AF127160.1| Drosophila teissieri Cu-Zn superoxide dismutase (... 50 0.009
140gb|AF127159.1| Drosophila yakuba Cu-Zn superoxide dismutase (Sod... 50 0.009
141gb|AF021830.1|AF021830 Drosophila nebulosa superoxide dismutase ... 50 0.009
142gb|AF021829.1|AF021829 Drosophila paulistorum superoxide dismuta... 50 0.009
143gb|AF021828.1|AF021828 Drosophila teissieri superoxide dismutase... 50 0.009
144gb|AF021824.1|AF021824 Hirtodrosophila pictiventris superoxide d... 50 0.009
145gb|AF021823.1|AF021823 Zaprionus tuberculatus superoxide dismuta... 50 0.009
146gb|U08097.1|PTU08097 Populus tremuloides Cu/Zn-superoxide dismut... 50 0.009
147gb|J04087.1|PEASOD Pea chloroplastic copper/zinc-superoxide dism... 50 0.009
148gb|DQ088819.1| Gossypium hirsutum chloroplast Cu/ZnSOD mRNA, com... 48 0.034
149gb|AC156827.4| Medicago truncatula clone mth2-15c17, complete se... 48 0.034
150gb|DQ120514.1| Gossypium hirsutum chloroplast Cu/Zn superoxide d... 48 0.034
151emb|X87372.1|LESODCC L.esculentum SodCc;Le;2 gene 48 0.034
152gb|AY898945.1| Lilium hybrid cultivar superoxide dismutase (SOD)... 48 0.034
153dbj|AB066500.1| Barbula unguiculata mRNA for chloroplastic coppe... 48 0.034
154gb|AF059879.1|AF059879 Drosophila immigrans Cu-Zn superoxide dis... 48 0.034
155gb|AF021822.1|AF021822 Scaptodrosophila lebanonensis superoxide ... 48 0.034
156gb|DQ440061.1| Aedes aegypti clone AE-321 Cu2+/Zn2+ superoxide d... 46 0.14
157emb|AJ971950.1| Pinus pinea partial mRNA for chloroplast CuZn su... 46 0.14
158gb|AY434497.1| Trifolium pratense superoxide dismutase mRNA, com... 46 0.14
159gb|AC126007.16| Medicago truncatula clone mth2-11o4, complete se... 46 0.14
160emb|X58579.1|PSCUZNPST P.sylvestris mRNA for CuZn superoxide dis... 46 0.14
161emb|X15685.1|DSSOD Drosophila simulans DNA for Cu-Zn superoxide ... 46 0.14
162emb|AJ279694.1|BPE279694 Betula pendula partial mRNA for copper/... 46 0.14
163gb|AY867724.1| Pinus taeda isolate FBRC30 chloroplast Cu/Zn supe... 46 0.14
164gb|AY867723.1| Pinus taeda isolate FBRC29 chloroplast Cu/Zn supe... 46 0.14
165gb|AY867722.1| Pinus taeda isolate FBRC28 chloroplast Cu/Zn supe... 46 0.14
166gb|AY867719.1| Pinus taeda isolate FBRC25 chloroplast Cu/Zn supe... 46 0.14
167gb|AY867717.1| Pinus taeda isolate FBRC23 chloroplast Cu/Zn supe... 46 0.14
168gb|AY867714.1| Pinus taeda isolate FBRC20 chloroplast Cu/Zn supe... 46 0.14
169gb|AY867713.1| Pinus taeda isolate FBRC19 chloroplast Cu/Zn supe... 46 0.14
170gb|AY867712.1| Pinus taeda isolate FBRC18 chloroplast Cu/Zn supe... 46 0.14
171gb|AY867710.1| Pinus taeda isolate FBRC16 chloroplast Cu/Zn supe... 46 0.14
172gb|AY867708.1| Pinus taeda isolate FBRC14 chloroplast Cu/Zn supe... 46 0.14
173gb|AY867707.1| Pinus taeda isolate FBRC13 chloroplast Cu/Zn supe... 46 0.14
174gb|AY867706.1| Pinus taeda isolate FBRC12 chloroplast Cu/Zn supe... 46 0.14
175gb|AY867703.1| Pinus taeda isolate FBRC9 chloroplast Cu/Zn super... 46 0.14
176gb|AY867702.1| Pinus taeda isolate FBRC8 chloroplast Cu/Zn super... 46 0.14
177gb|AY867700.1| Pinus taeda isolate FBRC6 chloroplast Cu/Zn super... 46 0.14
178gb|AY867697.1| Pinus taeda isolate FBRC3 chloroplast Cu/Zn super... 46 0.14
179gb|AF434186.1|AF434186 Pinus pinaster Cu-Zn-superoxide dismutase... 46 0.14
180gb|AF056621.1|AF056621 Medicago sativa putative Cu/Zn superoxide... 46 0.14
181gb|L08253.1|TOBCCZSODM Nicotiana plumbaginifolia Cu/Zn-superoxid... 46 0.14
182gb|AY172569.1| Helianthus annuus cultivar EL64 cytosolic Cu/Zn-s... 44 0.53
183emb|AJ971949.1| Pinus pinea partial mRNA for cytosolic CuZn supe... 44 0.53
184gb|AC130801.16| Medicago truncatula clone mth2-12p19, complete s... 44 0.53
185emb|X61687.1|CASOD C.amoena sod gene for Cu,Zn superoxidase dism... 44 0.53
186gb|AC158975.9| Mus musculus chromosome 18, clone RP24-192J22, co... 44 0.53
187gb|AF127155.1| Drosophila orena Cu-Zn superoxide dismutase (Sod)... 44 0.53
188gb|AY754566.1| Drosophila miranda strain MSH22 superoxide dismut... 44 0.53
189gb|AF170297.1|AF170297 Manihot esculenta copper/zinc-superoxide ... 44 0.53
190gb|AF021826.1|AF021826 Drosophila guttifera superoxide dismutase... 44 0.53
191gb|AC119259.15| Mus musculus chromosome 18, clone RP24-285N19, c... 44 0.53
192gb|U47873.1|DPU47873 Drosophila persimilis NDSSC 14011-0111.2 Cu... 44 0.53
193gb|U47872.1|DPU47872 Drosophila pseudoobscura bogotana NDSSC 140... 44 0.53
194gb|U47871.1|DPU47871 Drosophila pseudoobscura pseudoobscura NDSS... 44 0.53
195gb|U47870.1|DMU47870 Drosophila miranda NDSSC 14011-0101.1 Cu,Zn... 44 0.53
196gb|U47869.1|DBU47869 Drosophila bifasciata NDSSC 14012-0181.0 Cu... 44 0.53
197gb|L36229.1|IPBCCZS Ipomoea batatas cytosolic Cu/Zn-superoxide d... 44 0.53
198gb|BT012694.1| Lycopersicon esculentum clone 113564F, mRNA sequence 42 2.1
199gb|AF385581.2| Dichanthelium lanuginosum copper/zinc superoxide ... 42 2.1
200emb|X14041.1|LECHSOD Tomato mRNA for chloroplast Cu-Zn superoxid... 42 2.1
201emb|X13831.1|DVSOD Drosophila sod gene for Cu-Zn superoxide dism... 42 2.1
202gb|AY081436.1| Drosophila guttifera superoxide dismutase (Sod) g... 42 2.1
203gb|AY081435.1| Drosophila flexa superoxide dismutase (Sod) gene,... 42 2.1
204gb|AY081434.1| Drosophila ornatipennis superoxide dismutase (Sod... 42 2.1
205gb|AY081433.1| Drosophila nannoptera superoxide dismutase (Sod) ... 42 2.1
206dbj|D49486.1| Solidago canadensis var. scabra mRNA for copper/zi... 42 2.1
207ref|NM_143372.1| Drosophila melanogaster huntingtin CG9995-RA (h... 42 2.1
208gb|AC007827.5|AC007827 Drosophila melanogaster, chromosome 3R, r... 42 2.1
209gb|AY754565.1| Drosophila affinis superoxide dismutase (Sod) gen... 42 2.1
210gb|AF147779.1|AF147779 Drosophila melanogaster Huntington diseas... 42 2.1
211gb|AF146362.1|AF146362 Drosophila melanogaster Huntington diseas... 42 2.1
212gb|AF177386.1|AF177386 Drosophila melanogaster huntingtin homolo... 42 2.1
213gb|AE003766.2| Drosophila melanogaster chromosome 3R, section 10... 42 2.1
214emb|X77175.1|LESOD1 L.esculentum (cherry tomato) SOD Cp;Le:1 gen... 42 2.1
215gb|U39445.1|DBU39445 Drosophila busckii Cu,Zn superoxide dismuta... 42 2.1
216gb|M37151.1|TOMSODB Tomato superoxide dismutase (SOD) mRNA, comp... 42 2.1
217gb|DQ497636.1| Thermoascus aurantiacus var. levisporus Cu,Zn-sup... 40 8.3
218gb|DQ226932.1| Boechera divaricarpa isolate SLW-E-A10 mRNA sequence 40 8.3
219gb|AY566699.1| Citrullus lanatus copper-zinc superoxide dismutas... 40 8.3
220ref|XM_748622.1| Aspergillus fumigatus Af293 Cu,Zn superoxide di... 40 8.3
221ref|XM_385171.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 40 8.3
222gb|AC121893.3| Mus musculus BAC clone RP24-157C12 from chromosom... 40 8.3
223gb|AF264031.1| Callinectes sapidus extracellular Cu, Zn-superoxi... 40 8.3
224emb|AL732596.2| Human DNA sequence from clone RP11-48D14 on chro... 40 8.3
225ref|XM_503850.1| Yarrowia lipolytica CLIB122, YALI0E12133g predi... 40 8.3
226emb|Y11280.1|AVLEBIO A.vinelandii yoh-1, ibpB, cynR, leuC, leuD,... 40 8.3
227emb|BX842646.1| Bdellovibrio bacteriovorus complete genome, stra... 40 8.3
228emb|AJ002604.1|PSAJ2604 Pinus sylvestris mRNA for novel high pI ... 40 8.3
229emb|AJ307586.1|PSY307586 Pinus sylvestris mRNA for superoxide di... 40 8.3
230emb|AJ305146.1|PAN305146 Podospora anserina sod1 gene for copper... 40 8.3
231emb|AJ278668.1|PTR278668 Populus tremula x Populus tremuloides c... 40 8.3
232gb|AF401280.1| Aspergillus flavus Cu,Zn-superoxide dismutase mRN... 40 8.3
233gb|AC091201.4| Drosophila melanogaster 3L BAC RP98-47H5 (Roswell... 40 8.3
234dbj|AB226266.1| Aspergillus oryzae cDNA, contig sequence: AoEST3125 40 8.3
235dbj|AB223448.1| Aspergillus oryzae cDNA, contig sequence: AoEST0280 40 8.3
236gb|AC097497.2| Homo sapiens BAC clone RP11-324J17 from 4, comple... 40 8.3
237gb|AC079614.7| Homo sapiens BAC clone RP11-424I4 from 2, complet... 40 8.3
238gb|AC021120.6| Homo sapiens BAC clone RP11-347O8 from 4, complet... 40 8.3
239dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.3
240gb|AC140006.1| Oryza sativa (japonica cultivar-group) chromosome... 40 8.3
241gb|AY223820.1| Homo sapiens nuclear factor of kappa light polype... 40 8.3
242gb|AC104474.2| Oryza sativa (japonica cultivar-group) chromosome... 40 8.3
243dbj|AP004556.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.3
244dbj|AP005415.2| Oryza sativa (japonica cultivar-group) genomic D... 40 8.3
245gb|AF213884.1|AF213884S1 Homo sapiens nuclear factor of kappa li... 40 8.3
246gb|AF128886.1|AF128886 Aspergillus fumigatus Cu,Zn superoxide di... 40 8.3
247dbj|AK073785.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.3
248gb|AF021827.1|AF021827 Scaptomyza adusta superoxide dismutase (S... 40 8.3
249gb|AE003566.3| Drosophila melanogaster chromosome 3L, section 19... 40 8.3
250gb|AF059886.1|AF059886 Drosophila tanythrix Cu-Zn superoxide dis... 40 8.3
251gb|AF021821.1|AF021821 Chymomyza procnemis superoxide dismutase ... 40 8.3
252emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 40 8.3

>dbj|D01000.1|RICSODB Oryza sativa mRNA for copper/zinc-superoxide dismutase, complete
           cds, clone:RSODB
          Length = 667

 Score =  335 bits (169), Expect = 1e-88
 Identities = 325/377 (86%)
 Strand = Plus / Plus

                                                                       
Query: 5   ccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtg 64
           |||||| ||||||||||||||||| | || ||||||  ||||||||| || |||||||||
Sbjct: 94  ccgacctctgtgacgggaagtgtctctgggctcaagccagggctccatggattccatgtg 153

                                                                       
Query: 65  cacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccccgct 124
           ||||| || ||||||||||| || |||||||||||||||||||| |||||||| ||  ||
Sbjct: 154 cacgcgctcggtgacaccactaatggctgcatgtcaactggaccacacttcaatcctact 213

                                                                       
Query: 125 ggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtg 184
           ||  | |  |||||||||||  ||||||| | ||||||||| ||||| || |||||| | 
Sbjct: 214 gggaaggaacatggggcaccacaagatgagaaccgccatgccggtgatcttggaaatata 273

                                                                       
Query: 185 acagctggagcggatggtgttgctaacatcaatgttactgactgccatatcccccttgct 244
           ||||||||||| ||||||||||||||  |||||||  ||||| |||| ||||||||| ||
Sbjct: 274 acagctggagcagatggtgttgctaatgtcaatgtctctgacagccagatcccccttact 333

                                                                       
Query: 245 ggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggc 304
           ||| |||| || ||||||||||| |||||||| ||||||| |||| ||||||||||||||
Sbjct: 334 ggagcacactccatcattggccgagctgttgttgtccatgctgatcctgatgatcttggc 393

                                                                       
Query: 305 aagggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcggg 364
           ||||||||||||||||||||||||| ||||||||| |||||||  || ||||||||||| 
Sbjct: 394 aagggtggacatgagcttagcaagaccactggaaatgctgggggccgagttgcttgcgga 453

                            
Query: 365 atcatcgggctccaggg 381
           |||||||| ||||||||
Sbjct: 454 atcatcggactccaggg 470



to top

>gb|AY103754.1| Zea mays PCO107770 mRNA sequence
          Length = 910

 Score =  272 bits (137), Expect = 1e-69
 Identities = 320/381 (83%)
 Strand = Plus / Plus

                                                                       
Query: 5   ccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtg 64
           |||||||| ||||| |||||| || | || ||||||  ||||||||| || |||||||||
Sbjct: 274 ccgaccaccgtgactggaagtatctctggcctcaagccagggctccatgggttccatgtg 333

                                                                       
Query: 65  cacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccccgct 124
           ||||| ||||| ||||||||||||||||||||||| ||||| || |||||||| || | |
Sbjct: 334 cacgcgcttggcgacaccaccaacggctgcatgtcgactgggccacacttcaatcctgtt 393

                                                                       
Query: 125 ggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtg 184
           ||  | | |||||| ||||| ||||||||   ||||||||| ||||| || || ||||||
Sbjct: 394 ggcaaggagcatggcgcaccggaagatgaggaccgccatgccggtgatcttgggaatgtg 453

                                                                       
Query: 185 acagctggagcggatggtgttgctaacatcaatgttactgactgccatatcccccttgct 244
           ||||| ||||  |||||||||| |||  ||||| |||||||| |||| || || ||||||
Sbjct: 454 acagcgggagaagatggtgttgttaatgtcaatattactgacagccagatacctcttgct 513

                                                                       
Query: 245 ggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggc 304
           ||||| || || ||||||||||| |||||||| ||||||| |||| | ||||||||||||
Sbjct: 514 ggaccccactcgatcattggccgagctgttgttgtccatgctgatccggatgatcttggc 573

                                                                       
Query: 305 aagggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcggg 364
           || |||||||||||||||||||||||||| ||||| ||||| |  |||||||| || || 
Sbjct: 574 aaaggtggacatgagcttagcaagagcacgggaaatgctggcggacgtgttgcctgtggt 633

                                
Query: 365 atcatcgggctccagggctaa 385
           ||||| |||||||| ||||||
Sbjct: 634 atcattgggctccaaggctaa 654



to top

>gb|L32834.1|ASNCZSD Aspergillus japonicus (clone Assod4-g) copper/zinc-superoxide
           dismutase gene, 3' end
          Length = 393

 Score =  264 bits (133), Expect = 3e-67
 Identities = 253/293 (86%)
 Strand = Plus / Plus

                                                                       
Query: 47  ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 106
           ||||| || |||||||||||||| || ||||||||||| || ||||||||||||||||||
Sbjct: 20  ctccatggattccatgtgcacgcgctcggtgacaccactaatggctgcatgtcaactgga 79

                                                                       
Query: 107 ccgcacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgct 166
           || |||||||| ||  ||||  | |  |||||||||||  ||||||| | ||||||||| 
Sbjct: 80  ccacacttcaatcctactgggaaggaacatggggcaccacaagatgagaaccgccatgcc 139

                                                                       
Query: 167 ggtgacctcggaaatgtgacagctggagcggatggtgttgctaacatcaatgttactgac 226
           ||||| || |||||| | ||||||||||| ||||||||||||||  |||||||  |||||
Sbjct: 140 ggtgatcttggaaatataacagctggagcagatggtgttgctaatgtcaatgtctctgac 199

                                                                       
Query: 227 tgccatatcccccttgctggaccacattcaatcattggccgtgctgttgtcgtccatggt 286
            |||| ||||||||| ||||| |||| || ||||||||||| |||||||| ||||||| |
Sbjct: 200 agccagatcccccttactggagcacactccatcattggccgagctgttgttgtccatgct 259

                                                                
Query: 287 gatgctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaa 339
           ||| ||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 260 gatcctgatgatcttggcaagggtggacatgagcttagcaagaccactggaaa 312



to top

>gb|BT017337.1| Zea mays clone EL01N0321D04.c mRNA sequence
          Length = 756

 Score =  258 bits (130), Expect = 2e-65
 Identities = 319/382 (83%)
 Strand = Plus / Plus

                                                                       
Query: 2   ggcccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccat 61
           ||||| ||| |||| || ||||||||| | || ||||||   || ||||| || ||||||
Sbjct: 138 ggccctaccgctgtcaccggaagtgtctctggcctcaagcctggcctccatgggttccat 197

                                                                       
Query: 62  gtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 121
           || || || ||||||||||||||||| || ||||||||||||||||| |||| ||| || 
Sbjct: 198 gtacatgcacttggtgacaccaccaatggatgcatgtcaactggaccacactacaatcct 257

                                                                       
Query: 122 gctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaat 181
           ||  |  | | |||||||||||| |||||||| | ||||||||| ||||| || ||||||
Sbjct: 258 gcgagcaaggagcatggggcaccagaagatgagaaccgccatgccggtgatcttggaaat 317

                                                                       
Query: 182 gtgacagctggagcggatggtgttgctaacatcaatgttactgactgccatatccccctt 241
           |||||||||||||| |||||||||||||| |||||||| |||||| |||| ||||| || 
Sbjct: 318 gtgacagctggagcagatggtgttgctaatatcaatgtcactgacagccagatcccactg 377

                                                                       
Query: 242 gctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatctt 301
            |||| ||| | |||||||||||| | |||||||| || || | |||| |||||||||||
Sbjct: 378 actgggccaaactcaatcattggcagagctgttgttgttcacgctgatcctgatgatctt 437

                                                                       
Query: 302 ggcaagggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgc 361
           || |||||||| || ||||| |||||||||||||||||||| || |  ||||||||||| 
Sbjct: 438 ggaaagggtgggcacgagctgagcaagagcactggaaacgccggtggccgtgttgcttgt 497

                                 
Query: 362 gggatcatcgggctccagggct 383
           |||||||| || ||||||||||
Sbjct: 498 gggatcattggactccagggct 519



to top

>emb|X17565.1|ZMSOD4 Zea mays mRNA for superoxide dismutase-4AP (Sod4AP gene)
          Length = 722

 Score =  258 bits (130), Expect = 2e-65
 Identities = 319/382 (83%)
 Strand = Plus / Plus

                                                                       
Query: 2   ggcccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccat 61
           ||||| |||||||| || ||||||||| | || ||||||   || ||||| || ||||||
Sbjct: 167 ggccctaccactgtcactggaagtgtctctggcctcaagcctggcctccatgggttccat 226

                                                                       
Query: 62  gtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 121
           ||||| || ||||||||||||||||| |||||||||||||||||||| |||| ||| || 
Sbjct: 227 gtgcatgcacttggtgacaccaccaatggctgcatgtcaactggaccacactacaatcct 286

                                                                       
Query: 122 gctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaat 181
           ||  |  | |  ||||| ||||| |||||||| | ||||||||| ||||| || ||||||
Sbjct: 287 gcgagcaaggaacatggagcaccagaagatgagaaccgccatgccggtgatcttggaaat 346

                                                                       
Query: 182 gtgacagctggagcggatggtgttgctaacatcaatgttactgactgccatatccccctt 241
           |||||||||||||| || |||||||| ||||| |||||||| ||| |||| ||||| || 
Sbjct: 347 gtgacagctggagcagacggtgttgcaaacattaatgttaccgacagccagatcccactg 406

                                                                       
Query: 242 gctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatctt 301
            |||| ||| | |||||||||||| | |||||||| || || | |||| | |||||||||
Sbjct: 407 actgggccaaactcaatcattggcagagctgttgttgttcacgctgatcccgatgatctt 466

                                                                       
Query: 302 ggcaagggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgc 361
           || ||||||||||| ||||| ||||||||||| ||||||||||| |  ||||||||||| 
Sbjct: 467 ggaaagggtggacacgagctcagcaagagcaccggaaacgctggcggccgtgttgcttgt 526

                                 
Query: 362 gggatcatcgggctccagggct 383
           ||||||||||| ||||||||||
Sbjct: 527 gggatcatcggactccagggct 548



to top

>gb|M15175.1|MZESOD2A Maize superoxide dismutase 2 (SOD2) mRNA, complete cds
          Length = 694

 Score =  256 bits (129), Expect = 8e-65
 Identities = 318/381 (83%)
 Strand = Plus / Plus

                                                                       
Query: 5   ccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtg 64
           |||||||| ||||| |||||| || | || ||||||  ||| ||||| || |||||||||
Sbjct: 112 ccgaccaccgtgactggaagtatctctggcctcaagccaggcctccatgggttccatgtg 171

                                                                       
Query: 65  cacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccccgct 124
           ||||| ||||| ||||||||||||||||||||||| ||||| || |||||||| || | |
Sbjct: 172 cacgcgcttggcgacaccaccaacggctgcatgtcgactgggccacacttcaatcctgtt 231

                                                                       
Query: 125 ggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtg 184
           ||  | | |||||| ||||| ||||||||   ||||||||| ||||| || || ||||||
Sbjct: 232 ggcaaggagcatggtgcaccggaagatgaggaccgccatgccggtgatcttgggaatgtg 291

                                                                       
Query: 185 acagctggagcggatggtgttgctaacatcaatgttactgactgccatatcccccttgct 244
           ||||| ||||  |||||||||| |||  ||||| |||||||| |||| || || ||||||
Sbjct: 292 acagcgggagaagatggtgttgttaatgtcaatattactgacagccagatacctcttgct 351

                                                                       
Query: 245 ggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggc 304
           ||||| || || ||||||||||| |||||||| ||||||| |||| | ||||| ||||||
Sbjct: 352 ggaccccactcgatcattggccgagctgttgttgtccatgctgatccggatgaccttggc 411

                                                                       
Query: 305 aagggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcggg 364
           || |||||||||||||||||||||||||| ||||| ||||| |  |||||||| || || 
Sbjct: 412 aaaggtggacatgagcttagcaagagcaccggaaatgctggcggacgtgttgcctgtggt 471

                                
Query: 365 atcatcgggctccagggctaa 385
           ||||| |||||||| ||||||
Sbjct: 472 atcattgggctccaaggctaa 492



to top

>gb|M54936.1|MZESOD2 Maize superoxide dismutase-2 (Sod-2) mRNA, complete cds
          Length = 694

 Score =  256 bits (129), Expect = 8e-65
 Identities = 318/381 (83%)
 Strand = Plus / Plus

                                                                       
Query: 5   ccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtg 64
           |||||||| ||||| |||||| || | || ||||||  ||| ||||| || |||||||||
Sbjct: 112 ccgaccaccgtgactggaagtatctctggcctcaagccaggcctccatgggttccatgtg 171

                                                                       
Query: 65  cacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccccgct 124
           ||||| ||||| ||||||||||||||||||||||| ||||| || |||||||| || | |
Sbjct: 172 cacgcgcttggcgacaccaccaacggctgcatgtcgactgggccacacttcaatcctgtt 231

                                                                       
Query: 125 ggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtg 184
           ||  | | |||||| ||||| ||||||||   ||||||||| ||||| || || ||||||
Sbjct: 232 ggcaaggagcatggtgcaccggaagatgaggaccgccatgccggtgatcttgggaatgtg 291

                                                                       
Query: 185 acagctggagcggatggtgttgctaacatcaatgttactgactgccatatcccccttgct 244
           ||||| ||||  |||||||||| |||  ||||| |||||||| |||| || || ||||||
Sbjct: 292 acagcgggagaagatggtgttgttaatgtcaatattactgacagccagatacctcttgct 351

                                                                       
Query: 245 ggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggc 304
           ||||| || || ||||||||||| |||||||| ||||||| |||| | ||||| ||||||
Sbjct: 352 ggaccccactcgatcattggccgagctgttgttgtccatgctgatccggatgaccttggc 411

                                                                       
Query: 305 aagggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcggg 364
           || |||||||||||||||||||||||||| ||||| ||||| |  |||||||| || || 
Sbjct: 412 aaaggtggacatgagcttagcaagagcaccggaaatgctggcggacgtgttgcctgtggt 471

                                
Query: 365 atcatcgggctccagggctaa 385
           ||||| |||||||| ||||||
Sbjct: 472 atcattgggctccaaggctaa 492



to top

>emb|X17564.1|ZMSOD4A Zea mays mRNA for superoxide dismutase-4A (Sod4A gene)
          Length = 691

 Score =  250 bits (126), Expect = 5e-63
 Identities = 318/382 (83%)
 Strand = Plus / Plus

                                                                       
Query: 2   ggcccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccat 61
           ||||| ||| |||| || ||||||||| | || ||||||   || ||||| || ||||||
Sbjct: 124 ggccctaccgctgtcactggaagtgtctctggcctcaagcctggcctccatgggttccat 183

                                                                       
Query: 62  gtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 121
           || || || ||||||||||||||||| || ||||||||||||||||   ||| ||| || 
Sbjct: 184 gtacatgcacttggtgacaccaccaatggatgcatgtcaactggacacgactacaatcct 243

                                                                       
Query: 122 gctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaat 181
           ||  |  | | |||||||||||| |||||||| | ||||||||| ||||| || ||||||
Sbjct: 244 gcgagcaaggagcatggggcaccagaagatgagaaccgccatgccggtgatcttggaaat 303

                                                                       
Query: 182 gtgacagctggagcggatggtgttgctaacatcaatgttactgactgccatatccccctt 241
           |||||||||||||| |||||||||||||| |||||||| |||||| |||| ||||| || 
Sbjct: 304 gtgacagctggagcagatggtgttgctaatatcaatgtcactgacagccagatcccactg 363

                                                                       
Query: 242 gctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatctt 301
            |||| ||| | |||||||||||| | |||||||| || || | |||| |||||||||||
Sbjct: 364 actgggccaaactcaatcattggcagagctgttgttgttcacgctgatcctgatgatctt 423

                                                                       
Query: 302 ggcaagggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgc 361
           || |||||||| || |||||||||||||||||||||||||| || |  ||||||||||| 
Sbjct: 424 ggaaagggtgggcacgagcttagcaagagcactggaaacgcgggtggccgtgttgcttgt 483

                                 
Query: 362 gggatcatcgggctccagggct 383
           |||||||| || ||||||||||
Sbjct: 484 gggatcattggactccagggct 505



to top

>gb|AY109448.1| Zea mays CL1415_1 mRNA sequence
          Length = 1046

 Score =  250 bits (126), Expect = 5e-63
 Identities = 318/382 (83%)
 Strand = Plus / Plus

                                                                       
Query: 2   ggcccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccat 61
           ||||| ||| |||| || ||||||||| | || ||||||   || ||||| || ||||||
Sbjct: 295 ggccctaccgctgtcaccggaagtgtctctggcctcaagcctggcctccatgggttccat 354

                                                                       
Query: 62  gtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 121
           || || || ||||||||||||||||| || ||||||||||||||||| |||| ||| || 
Sbjct: 355 gtacatgcacttggtgacaccaccaatggatgcatgtcaactggaccacactacaatcct 414

                                                                       
Query: 122 gctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaat 181
           ||  |  | | |||||||||||| |||||||| | ||||||||||||||| || ||||| 
Sbjct: 415 gcgagcaaggagcatggggcaccagaagatgagaaccgccatgctggtgatcttggaaac 474

                                                                       
Query: 182 gtgacagctggagcggatggtgttgctaacatcaatgttactgactgccatatccccctt 241
           |||||||||||||| |||||||||||||| |||||||| || ||| |||| ||||| || 
Sbjct: 475 gtgacagctggagcagatggtgttgctaatatcaatgtcaccgacagccagatcccactg 534

                                                                       
Query: 242 gctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatctt 301
            |||| ||| | |||||||||||| | |||||||| || || | |||| |||||||||||
Sbjct: 535 actgggccaaactcaatcattggcagagctgttgttgttcacgctgatcctgatgatctt 594

                                                                       
Query: 302 ggcaagggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgc 361
           || |||||||| || ||||| |||||||||||||||||||| || |  ||||||||||| 
Sbjct: 595 ggaaagggtgggcacgagctcagcaagagcactggaaacgccggtggccgtgttgcttgt 654

                                 
Query: 362 gggatcatcgggctccagggct 383
           |||||||| || ||||||||||
Sbjct: 655 gggatcattggactccagggct 676



to top

>ref|NM_186073.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 444

 Score =  232 bits (117), Expect = 1e-57
 Identities = 314/377 (83%), Gaps = 12/377 (3%)
 Strand = Plus / Plus

                                                                       
Query: 5   ccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtg 64
           |||||| ||||||||||||||||| | || ||||||  ||||||||| || |||||||||
Sbjct: 76  ccgacctctgtgacgggaagtgtctctgggctcaagccagggctccatggattccatgtg 135

                                                                       
Query: 65  cacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccccgct 124
           ||||| || ||||||||||| || |||||||||||||||   || |||||||| ||  ||
Sbjct: 136 cacgcgctcggtgacaccactaatggctgcatgtcaact---ccacacttcaatcctact 192

                                                                       
Query: 125 ggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtg 184
           ||  | |  |||||||||||  ||||||| | ||||||||| ||||| || |||||| | 
Sbjct: 193 gggaaggaacatggggcaccacaagatgagaaccgccatgccggtgatcttggaaatata 252

                                                                       
Query: 185 acagctggagcggatggtgttgctaacatcaatgttactgactgccatatcccccttgct 244
           ||||||||||| ||||   |||||||  |||||||  ||||| |||| ||||||||| ||
Sbjct: 253 acagctggagcagatg---ttgctaatgtcaatgtctctgacagccagatcccccttact 309

                                                                       
Query: 245 ggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggc 304
           ||| |||| || ||||||||||| |||||||| ||||||| |||| ||||||||||||||
Sbjct: 310 ggagcacactccatcattggccgagctgttgttgtccatgctgatcctgatgatcttggc 369

                                                                       
Query: 305 aagggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcggg 364
           |||   ||||||||||||||||||| ||||||||| |||||||  || |||||||||   
Sbjct: 370 aag---ggacatgagcttagcaagaccactggaaatgctgggggccgagttgcttgc--- 423

                            
Query: 365 atcatcgggctccaggg 381
           |||||||| ||||||||
Sbjct: 424 atcatcggactccaggg 440



to top

>dbj|AK120692.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013169L20, full
           insert sequence
          Length = 829

 Score =  208 bits (105), Expect = 2e-50
 Identities = 300/365 (82%)
 Strand = Plus / Plus

                                                                       
Query: 8   accactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcac 67
           ||||||||||| ||||||||| | || ||||||   || ||||| || |||||| | || 
Sbjct: 177 accactgtgactggaagtgtctctggcctcaagcctggtctccatgggttccatattcat 236

                                                                       
Query: 68  gctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggt 127
           || ||||||||||||||||| || |||||||||||||| || |||| ||| || || || 
Sbjct: 237 gcacttggtgacaccaccaatggttgcatgtcaactgggccacactacaatcctgccgga 296

                                                                       
Query: 128 catgtgcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgaca 187
            | | |||||| ||||| |||||||| | ||||||||||||||| || |||||||| || 
Sbjct: 297 aaggagcatggagcaccagaagatgagacccgccatgctggtgatcttggaaatgtcacc 356

                                                                       
Query: 188 gctggagcggatggtgttgctaacatcaatgttactgactgccatatcccccttgctgga 247
           |||||||  |||||||||||||| ||| |||||  |||| | || || || ||| |||||
Sbjct: 357 gctggagaagatggtgttgctaatatccatgttgttgacagtcagattccacttactgga 416

                                                                       
Query: 248 ccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaag 307
           ||| |||||||||||||| | || || || || ||||  ||| ||||||||||||| |||
Sbjct: 417 ccaaattcaatcattggcagagccgtcgttgtgcatgccgatcctgatgatcttggaaag 476

                                                                       
Query: 308 ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgggatc 367
           ||||| || ||||| ||||||| ||| ||||||||||| |  ||||||||||||||||||
Sbjct: 477 ggtgggcacgagctgagcaagaccaccggaaacgctggtggccgtgttgcttgcgggatc 536

                
Query: 368 atcgg 372
           |||||
Sbjct: 537 atcgg 541



to top

>dbj|AK061662.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-036-E04, full
           insert sequence
          Length = 786

 Score =  208 bits (105), Expect = 2e-50
 Identities = 300/365 (82%)
 Strand = Plus / Plus

                                                                       
Query: 8   accactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcac 67
           ||||||||||| ||||||||| | || ||||||   || ||||| || |||||| | || 
Sbjct: 185 accactgtgactggaagtgtctctggcctcaagcctggtctccatgggttccatattcat 244

                                                                       
Query: 68  gctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggt 127
           || ||||||||||||||||| || |||||||||||||| || |||| ||| || || || 
Sbjct: 245 gcacttggtgacaccaccaatggttgcatgtcaactgggccacactacaatcctgccgga 304

                                                                       
Query: 128 catgtgcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgaca 187
            | | |||||| ||||| |||||||| | ||||||||||||||| || |||||||| || 
Sbjct: 305 aaggagcatggagcaccagaagatgagacccgccatgctggtgatcttggaaatgtcacc 364

                                                                       
Query: 188 gctggagcggatggtgttgctaacatcaatgttactgactgccatatcccccttgctgga 247
           |||||||  |||||||||||||| ||| |||||  |||| | || || || ||| |||||
Sbjct: 365 gctggagaagatggtgttgctaatatccatgttgttgacagtcagattccacttactgga 424

                                                                       
Query: 248 ccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaag 307
           ||| |||||||||||||| | || || || || ||||  ||| ||||||||||||| |||
Sbjct: 425 ccaaattcaatcattggcagagccgtcgttgtgcatgccgatcctgatgatcttggaaag 484

                                                                       
Query: 308 ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgggatc 367
           ||||| || ||||| ||||||| ||| ||||||||||| |  ||||||||||||||||||
Sbjct: 485 ggtgggcacgagctgagcaagaccaccggaaacgctggtggccgtgttgcttgcgggatc 544

                
Query: 368 atcgg 372
           |||||
Sbjct: 545 atcgg 549



to top

>dbj|D00999.1|RICSODA Oryza sativa mRNA for copper/zinc-superoxide dismutase, complete
           cds, clone:RSODA
          Length = 760

 Score =  208 bits (105), Expect = 2e-50
 Identities = 300/365 (82%)
 Strand = Plus / Plus

                                                                       
Query: 8   accactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcac 67
           ||||||||||| ||||||||| | || ||||||   || ||||| || |||||| | || 
Sbjct: 155 accactgtgactggaagtgtctctggcctcaagcctggtctccatgggttccatattcat 214

                                                                       
Query: 68  gctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggt 127
           || ||||||||||||||||| || |||||||||||||| || |||| ||| || || || 
Sbjct: 215 gcacttggtgacaccaccaatggttgcatgtcaactgggccacactacaatcctgccgga 274

                                                                       
Query: 128 catgtgcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgaca 187
            | | |||||| ||||| |||||||| | ||||||||||||||| || |||||||| || 
Sbjct: 275 aaggagcatggagcaccagaagatgagacccgccatgctggtgatcttggaaatgtcacc 334

                                                                       
Query: 188 gctggagcggatggtgttgctaacatcaatgttactgactgccatatcccccttgctgga 247
           |||||||  |||||||||||||| ||| |||||  |||| | || || || ||| |||||
Sbjct: 335 gctggagaagatggtgttgctaatatccatgttgttgacagtcagattccacttactgga 394

                                                                       
Query: 248 ccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaag 307
           ||| |||||||||||||| | || || || || ||||  ||| ||||||||||||| |||
Sbjct: 395 ccaaattcaatcattggcagagccgtcgttgtgcatgccgatcctgatgatcttggaaag 454

                                                                       
Query: 308 ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgggatc 367
           ||||| || ||||| ||||||| ||| ||||||||||| |  ||||||||||||||||||
Sbjct: 455 ggtgggcacgagctgagcaagaccaccggaaacgctggtggccgtgttgcttgcgggatc 514

                
Query: 368 atcgg 372
           |||||
Sbjct: 515 atcgg 519



to top

>gb|DQ058108.1| Oryza sativa (indica cultivar-group) cytoplasmic
           copper/zinc-superoxide dismutase mRNA, complete cds
          Length = 698

 Score =  200 bits (101), Expect = 4e-48
 Identities = 299/365 (81%)
 Strand = Plus / Plus

                                                                       
Query: 8   accactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcac 67
           ||||||||||| ||||||||| | || || |||   || ||||| || |||||| | || 
Sbjct: 138 accactgtgactggaagtgtctctggccttaagcctggtctccatgggttccatattcat 197

                                                                       
Query: 68  gctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggt 127
           || ||||||||||||||||| || |||||||||||||| || |||| ||| || || || 
Sbjct: 198 gcacttggtgacaccaccaatggttgcatgtcaactgggccacactacaatcctgccgga 257

                                                                       
Query: 128 catgtgcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgaca 187
            | | |||||| ||||| |||||||| | ||||||||||||||| || |||||||| || 
Sbjct: 258 aaggagcatggagcaccagaagatgagacccgccatgctggtgatcttggaaatgtcacc 317

                                                                       
Query: 188 gctggagcggatggtgttgctaacatcaatgttactgactgccatatcccccttgctgga 247
           |||||||  |||||||||||||| ||| |||||  |||| | || || || ||| |||||
Sbjct: 318 gctggagaagatggtgttgctaatatccatgttgttgacagtcagattccacttactgga 377

                                                                       
Query: 248 ccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaag 307
           ||| |||||||||||||| | || || || || ||||  ||| ||||||||||||| |||
Sbjct: 378 ccaaattcaatcattggcagagccgtcgttgtgcatgccgatcctgatgatcttggaaag 437

                                                                       
Query: 308 ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgggatc 367
           ||||| || ||||| ||||||| ||| ||||||||||| |  ||||||||||||||||||
Sbjct: 438 ggtgggcacgagctgagcaagaccaccggaaacgctggtggccgtgttgcttgcgggatc 497

                
Query: 368 atcgg 372
           |||||
Sbjct: 498 atcgg 502



to top

>gb|L36320.1|RICSOXDM Oryza sativa (clone cu101) superoxide dismutase (cuznsod1) mRNA,
           complete cds
          Length = 768

 Score =  200 bits (101), Expect = 4e-48
 Identities = 299/365 (81%)
 Strand = Plus / Plus

                                                                       
Query: 8   accactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcac 67
           ||||||||||| ||||||||| | || ||||||   || ||||| || |||||| | || 
Sbjct: 169 accactgtgactggaagtgtctctggcctcaagcctggtctccatgggttccatattcat 228

                                                                       
Query: 68  gctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggt 127
           || ||||||||||||||||| || ||||| |||||||| || |||| ||| || || || 
Sbjct: 229 gcacttggtgacaccaccaatggttgcatctcaactgggccacactacaatcctgccgga 288

                                                                       
Query: 128 catgtgcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgaca 187
            | | |||||| ||||| |||||||| | ||||||||||||||| || |||||||| || 
Sbjct: 289 aaggagcatggagcaccagaagatgagacccgccatgctggtgatcttggaaatgtcacc 348

                                                                       
Query: 188 gctggagcggatggtgttgctaacatcaatgttactgactgccatatcccccttgctgga 247
           |||||||  |||||||||||||| ||| |||||  |||| | || || || ||| |||||
Sbjct: 349 gctggagaagatggtgttgctaatatccatgttgttgacagtcagattccacttactgga 408

                                                                       
Query: 248 ccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaag 307
           ||| |||||||||||||| | || || || || ||||  ||| ||||||||||||| |||
Sbjct: 409 ccaaattcaatcattggcagagccgtcgttgtgcatgccgatcctgatgatcttggaaag 468

                                                                       
Query: 308 ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgggatc 367
           ||||| || ||||| ||||||| ||| ||||||||||| |  ||||||||||||||||||
Sbjct: 469 ggtgggcacgagctgagcaagaccaccggaaacgctggtggccgtgttgcttgcgggatc 528

                
Query: 368 atcgg 372
           |||||
Sbjct: 529 atcgg 533



to top

>gb|AY823553.1| Pennisetum glaucum superoxide dismutase mRNA, partial cds
          Length = 439

 Score =  157 bits (79), Expect = 5e-35
 Identities = 145/167 (86%)
 Strand = Plus / Plus

                                                                       
Query: 179 aatgtgacagctggagcggatggtgttgctaacatcaatgttactgactgccatatcccc 238
           ||||||||||| ||||| |||||||||||||||||||||||||| ||| |||| ||||| 
Sbjct: 7   aatgtgacagcaggagcagatggtgttgctaacatcaatgttaccgacagccagatccca 66

                                                                       
Query: 239 cttgctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgat 298
           ||  |||| ||| | |||||||||||||| |||||||| || || | |||| ||||||||
Sbjct: 67  ctgactgggccaaactcaatcattggccgagctgttgttgttcacgctgatcctgatgat 126

                                                          
Query: 299 cttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           ||||| | |||||| || ||||| |||||||||||||||||||||||
Sbjct: 127 cttggaaggggtgggcacgagctgagcaagagcactggaaacgctgg 173



to top

>gb|AF479059.1| Sandersonia aurantiaca copper/zinc superoxide dismutase mRNA,
           complete cds
          Length = 799

 Score =  127 bits (64), Expect = 5e-26
 Identities = 238/296 (80%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           ||||| |||||||| || || || |||||||| || || ||||||||||| ||||| |||
Sbjct: 143 cacggattccatgttcatgcgctcggtgacactacaaatggctgcatgtctactgggccg 202

                                                                       
Query: 110 cacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggt 169
           || || || || |||||  | | |||||| ||||| ||||| |||| ||||||||| |||
Sbjct: 203 cattttaatcctgctgggaaggagcatggagcaccggaagacgaaaaccgccatgccggt 262

                                                                       
Query: 170 gacctcggaaatgtgacagctggagcggatggtgttgctaacatcaatgttactgactgc 229
           || || || |||||||||||||| | |||||||  ||  ||| | |    | |||| |||
Sbjct: 263 gatcttgggaatgtgacagctggggaggatggtaatgtcaactttaccacttctgattgc 322

                                                                       
Query: 230 catatcccccttgctggaccacattcaatcattggccgtgctgttgtcgtccatggtgat 289
           || || || ||| |||| |||||||| || |||||  | |||||||| ||||||| ||||
Sbjct: 323 cagatacctcttactgggccacattccattattggaagggctgttgttgtccatgctgat 382

                                                                   
Query: 290 gctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
            ||||||| ||||| |||||||| ||||| |||||||||||||||||||| |||||
Sbjct: 383 cctgatgaccttggaaagggtgggcatgaacttagcaagagcactggaaatgctgg 438



to top

>emb|AJ250667.1|ACO250667 Ananas comosus mRNA for copper/zinc-superoxide dismutase (sod1
           gene)
          Length = 820

 Score =  119 bits (60), Expect = 1e-23
 Identities = 303/384 (78%)
 Strand = Plus / Plus

                                                                       
Query: 5   ccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtg 64
           ||||| |||||||| |||||| || |||| ||||||   || || || || || ||||| 
Sbjct: 120 ccgacaactgtgactggaagtatctcgggcctcaagcccggacttcatggatttcatgtt 179

                                                                       
Query: 65  cacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccccgct 124
           || || ||||| |||||||| || || |||||||||||||| || || ||||| || || 
Sbjct: 180 catgcacttggcgacaccacaaatggttgcatgtcaactgggccacatttcaatcctgcc 239

                                                                       
Query: 125 ggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtg 184
           ||  |||  ||||| ||||| |||||||| | ||||||||||||||| || |||||||||
Sbjct: 240 gggaatgaacatggcgcacctgaagatgagacccgccatgctggtgatcttggaaatgtg 299

                                                                       
Query: 185 acagctggagcggatggtgttgctaacatcaatgttactgactgccatatcccccttgct 244
           || | ||| | ||||||   || |||| | ||| ||  |||| |||| || || ||| ||
Sbjct: 300 actgttggcgaggatggcactgttaacgtaaatattgttgacagccagattccgctttct 359

                                                                       
Query: 245 ggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggc 304
           ||| |  | || || |||||||| || ||||| ||||||| |||  |||||||||| || 
Sbjct: 360 ggatcgaactccattattggccgagcagttgttgtccatgctgaccctgatgatctcgga 419

                                                                       
Query: 305 aagggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcggg 364
           ||||||||||||||||||||||||| ||| ||||| ||||| | | | |||||||| || 
Sbjct: 420 aagggtggacatgagcttagcaagaccacgggaaatgctggcgggagagttgcttgtgga 479

                                   
Query: 365 atcatcgggctccagggctaagat 388
           || ||||| || ||||| ||||||
Sbjct: 480 attatcggactgcaggggtaagat 503



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  105 bits (53), Expect = 2e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                            
Query: 5        ccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtg 64
                |||||| ||||||||||||||||| | || ||||||  ||||||||| || |||||||||
Sbjct: 28023204 ccgacctctgtgacgggaagtgtctctgggctcaagccagggctccatggattccatgtg 28023145

                                                         
Query: 65       cacgctcttggtgacaccaccaacggctgcatgtcaactgg 105
                ||||| || ||||||||||| || |||||||||||||||||
Sbjct: 28023144 cacgcgctcggtgacaccactaatggctgcatgtcaactgg 28023104



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 70/78 (89%)
 Strand = Plus / Minus

                                                                            
Query: 233      atcccccttgctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgct 292
                ||||||||| ||||| |||| || ||||||||||| |||||||| ||||||| |||| ||
Sbjct: 28022620 atcccccttactggagcacactccatcattggccgagctgttgttgtccatgctgatcct 28022561

                                  
Query: 293      gatgatcttggcaagggt 310
                ||||||||||||||||||
Sbjct: 28022560 gatgatcttggcaagggt 28022543



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                        
Query: 308      ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgg 363
                |||||||||||||||||||||| ||||||||| |||||||  || |||||||||||
Sbjct: 28022409 ggtggacatgagcttagcaagaccactggaaatgctgggggccgagttgcttgcgg 28022354



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                            
Query: 134      catggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgga 193
                |||||||||||  ||||||| | ||||||||| ||||| || |||||| | |||||||||
Sbjct: 28022987 catggggcaccacaagatgagaaccgccatgccggtgatcttggaaatataacagctgga 28022928

                         
Query: 194      gcggatggt 202
                || ||||||
Sbjct: 28022927 gcagatggt 28022919



to top

>dbj|AP003825.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1343_D04
          Length = 143407

 Score =  105 bits (53), Expect = 2e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                          
Query: 5      ccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtg 64
              |||||| ||||||||||||||||| | || ||||||  ||||||||| || |||||||||
Sbjct: 112538 ccgacctctgtgacgggaagtgtctctgggctcaagccagggctccatggattccatgtg 112479

                                                       
Query: 65     cacgctcttggtgacaccaccaacggctgcatgtcaactgg 105
              ||||| || ||||||||||| || |||||||||||||||||
Sbjct: 112478 cacgcgctcggtgacaccactaatggctgcatgtcaactgg 112438



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 70/78 (89%)
 Strand = Plus / Minus

                                                                          
Query: 233    atcccccttgctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgct 292
              ||||||||| ||||| |||| || ||||||||||| |||||||| ||||||| |||| ||
Sbjct: 111954 atcccccttactggagcacactccatcattggccgagctgttgttgtccatgctgatcct 111895

                                
Query: 293    gatgatcttggcaagggt 310
              ||||||||||||||||||
Sbjct: 111894 gatgatcttggcaagggt 111877



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                      
Query: 308    ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgg 363
              |||||||||||||||||||||| ||||||||| |||||||  || |||||||||||
Sbjct: 111743 ggtggacatgagcttagcaagaccactggaaatgctgggggccgagttgcttgcgg 111688



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                          
Query: 134    catggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgga 193
              |||||||||||  ||||||| | ||||||||| ||||| || |||||| | |||||||||
Sbjct: 112321 catggggcaccacaagatgagaaccgccatgccggtgatcttggaaatataacagctgga 112262

                       
Query: 194    gcggatggt 202
              || ||||||
Sbjct: 112261 gcagatggt 112253



to top

>dbj|AP004274.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
            clone:P0450A04
          Length = 162545

 Score =  105 bits (53), Expect = 2e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                        
Query: 5    ccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtg 64
            |||||| ||||||||||||||||| | || ||||||  ||||||||| || |||||||||
Sbjct: 6500 ccgacctctgtgacgggaagtgtctctgggctcaagccagggctccatggattccatgtg 6441

                                                     
Query: 65   cacgctcttggtgacaccaccaacggctgcatgtcaactgg 105
            ||||| || ||||||||||| || |||||||||||||||||
Sbjct: 6440 cacgcgctcggtgacaccactaatggctgcatgtcaactgg 6400



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 70/78 (89%)
 Strand = Plus / Minus

                                                                        
Query: 233  atcccccttgctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgct 292
            ||||||||| ||||| |||| || ||||||||||| |||||||| ||||||| |||| ||
Sbjct: 5916 atcccccttactggagcacactccatcattggccgagctgttgttgtccatgctgatcct 5857

                              
Query: 293  gatgatcttggcaagggt 310
            ||||||||||||||||||
Sbjct: 5856 gatgatcttggcaagggt 5839



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                    
Query: 308  ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgg 363
            |||||||||||||||||||||| ||||||||| |||||||  || |||||||||||
Sbjct: 5705 ggtggacatgagcttagcaagaccactggaaatgctgggggccgagttgcttgcgg 5650



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                        
Query: 134  catggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgga 193
            |||||||||||  ||||||| | ||||||||| ||||| || |||||| | |||||||||
Sbjct: 6283 catggggcaccacaagatgagaaccgccatgccggtgatcttggaaatataacagctgga 6224

                     
Query: 194  gcggatggt 202
            || ||||||
Sbjct: 6223 gcagatggt 6215



to top

>gb|L19434.1|RICSODCC2A Oryza sativa cytosolic copper/zinc-superoxide dismutase (SodCc2)
            gene, complete cds
          Length = 3522

 Score =  105 bits (53), Expect = 2e-19
 Identities = 89/101 (88%)
 Strand = Plus / Plus

                                                                        
Query: 5    ccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtg 64
            |||||| ||||||||||||||||| | || ||||||  ||||||||| || |||||||||
Sbjct: 2291 ccgacctctgtgacgggaagtgtctctgggctcaagccagggctccatggattccatgtg 2350

                                                     
Query: 65   cacgctcttggtgacaccaccaacggctgcatgtcaactgg 105
            ||||| || ||||||||||| || |||||||||||||||||
Sbjct: 2351 cacgcgctcggtgacaccactaatggctgcatgtcaactgg 2391



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 70/78 (89%)
 Strand = Plus / Plus

                                                                        
Query: 233  atcccccttgctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgct 292
            ||||||||| ||||| |||| || ||||||||||| |||||||| ||||||| |||| ||
Sbjct: 2875 atcccccttactggagcacactccatcattggccgagctgttgttgtccatgctgatcct 2934

                              
Query: 293  gatgatcttggcaagggt 310
            ||||||||||||||||||
Sbjct: 2935 gatgatcttggcaagggt 2952



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                    
Query: 308  ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgg 363
            |||||||||||||||||||||| ||||||||| |||||||  || |||||||||||
Sbjct: 3086 ggtggacatgagcttagcaagaccactggaaatgctgggggccgagttgcttgcgg 3141



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 59/69 (85%)
 Strand = Plus / Plus

                                                                        
Query: 134  catggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgga 193
            |||||||||||  ||||||| | ||||||||| ||||| || |||||| | |||||||||
Sbjct: 2508 catggggcaccacaagatgagaaccgccatgccggtgatcttggaaatataacagctgga 2567

                     
Query: 194  gcggatggt 202
            || ||||||
Sbjct: 2568 gcagatggt 2576



to top

>emb|AJ586519.1| Fagus sylvatica partial sod1 mRNA for superoxide dismutase
          Length = 710

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 70/77 (90%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| |||||||| ||| | ||||||||||||||||| |||||||| |||||||||
Sbjct: 385 gctgttgttgtccatggagatccagatgatcttggcaaggggggacatgaacttagcaag 444

                            
Query: 329 agcactggaaacgctgg 345
           ||||||||||| |||||
Sbjct: 445 agcactggaaatgctgg 461



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                       
Query: 47  ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 106
           ||||| |||||||| ||||| |||||||| ||||| || || || |||||||||||||||
Sbjct: 163 ctccatggcttccacgtgcatgctcttggggacacaacaaatggttgcatgtcaactgga 222

                               
Query: 107 ccgcacttcaaccccgctgg 126
           || || ||||| || |||||
Sbjct: 223 ccacatttcaatcctgctgg 242



to top

>gb|AF328859.1| Avicennia marina Cu-Zn superoxide dismutase mRNA, complete cds
          Length = 768

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 105/125 (84%)
 Strand = Plus / Plus

                                                                       
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 112
           ||||| |||||||| || ||||||||||||||||| ||||| ||||||||||| || |||
Sbjct: 173 ggctttcatgtgcatgcccttggtgacaccaccaatggctgtatgtcaactggtcctcac 232

                                                                       
Query: 113 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgac 172
           ||||| || |||||  | |  ||||| || || ||||||||  | |||||||||||||||
Sbjct: 233 ttcaatccggctggcaaagaccatggtgctccagaagatgaggttcgccatgctggtgac 292

                
Query: 173 ctcgg 177
           |||||
Sbjct: 293 ctcgg 297



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 82/101 (81%)
 Strand = Plus / Plus

                                                                       
Query: 245 ggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggc 304
           ||||||||||| ||  ||||  | ||||| || |||||||  ||| ||||||||||||| 
Sbjct: 365 ggaccacattccatagttggaagagctgtagttgtccatgccgatcctgatgatcttgga 424

                                                    
Query: 305 aagggtggacatgagcttagcaagagcactggaaacgctgg 345
           ||||| |||||||| || ||||| |  |||||||| |||||
Sbjct: 425 aagggcggacatgaactaagcaaaactactggaaatgctgg 465



to top

>gb|U34726.1|ZMU34726 Zea mays superoxide dismutase 4 (sod4) gene, partial cds
          Length = 3039

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 89/104 (85%)
 Strand = Plus / Plus

                                                                        
Query: 2    ggcccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccat 61
            ||||| |||||||| || ||||||||| | || ||||||   || ||||| || ||||||
Sbjct: 2375 ggccctaccactgtcactggaagtgtctctggcctcaagcctggcctccatgggttccat 2434

                                                        
Query: 62   gtgcacgctcttggtgacaccaccaacggctgcatgtcaactgg 105
            ||||| || ||||||||||||||||| |||||||||||||||||
Sbjct: 2435 gtgcatgcacttggtgacaccaccaatggctgcatgtcaactgg 2478



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                        
Query: 134  catggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgga 193
            ||||| ||||| |||||||| | ||||||||| ||||| || ||||||||||||||||||
Sbjct: 2612 catggagcaccagaagatgagaaccgccatgccggtgatcttggaaatgtgacagctgga 2671

              
Query: 194  gc 195
            ||
Sbjct: 2672 gc 2673



to top

>gb|AY833718.1| Codonopsis lanceolata CuZn superoxide dismutase (SODCc) mRNA,
           complete cds
          Length = 799

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 302
           ||||||| ||||| ||||||||  | ||||| || ||||||| |||| ||||||||||||
Sbjct: 471 ctggacctcattctatcattggaagggctgtagttgtccatgctgatcctgatgatcttg 530

                                                      
Query: 303 gcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           | |||||||| ||||| || ||||| ||||||||||| |||||
Sbjct: 531 gaaagggtggccatgaactcagcaaaagcactggaaatgctgg 573



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgg 105
           ||||| |||||||| || || ||||||||||| ||||| || ||||||||||||||
Sbjct: 278 cacggtttccatgttcatgcccttggtgacacaaccaatggttgcatgtcaactgg 333



to top

>emb|AJ844003.1| Plantago major mRNA for copper-zinc superoxide dismutase (csd1
           gene)
          Length = 779

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 115/139 (82%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           |||||||||||||| || |||||||||||||| |||||||| ||||||||||| ||||| 
Sbjct: 187 cacggcttccatgttcatgctcttggtgacactaccaacggttgcatgtcaacaggacca 246

                                                                       
Query: 110 cacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggt 169
           || ||||| || ||||   | | |||||| || || || |||||  | ||||||||||||
Sbjct: 247 catttcaatccggctgcaaaagagcatggtgctcctgatgatgaggttcgccatgctggt 306

                              
Query: 170 gacctcggaaatgtgacag 188
           ||||| || ||||| ||||
Sbjct: 307 gaccttggtaatgtcacag 325



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 70/85 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 302
           ||||||||||||| ||||||||  | |||||||| ||||||| |||  | |||||| | |
Sbjct: 380 ctggaccacattccatcattggaagggctgttgttgtccatgctgaccccgatgatttgg 439

                                    
Query: 303 gcaagggtggacatgagcttagcaa 327
           | | |||||||||||| || |||||
Sbjct: 440 gaaggggtggacatgaactcagcaa 464



to top

>gb|DQ078121.2| Rheum australe copper/zinc superoxide dismutase mRNA, complete cds
          Length = 586

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                       
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 115
           |||||||||||||||||||||||||| || || |||||||||||||||||||| || |||
Sbjct: 194 ttccatgtgcacgctcttggtgacacaacaaatggctgcatgtcaactggaccacatttc 253

             
Query: 116 aa 117
           ||
Sbjct: 254 aa 255



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 86/107 (80%)
 Strand = Plus / Plus

                                                                       
Query: 239 cttgctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgat 298
           |||| ||||||| | |||||||||||  | || || || || |||| |||| | ||||| 
Sbjct: 377 cttgttggaccaaactcaatcattggaagggcggtggttgttcatgctgatccggatgac 436

                                                          
Query: 299 cttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           |||||||||||||| ||||| || |||| || ||| ||||| |||||
Sbjct: 437 cttggcaagggtggtcatgaactgagcacgaccacaggaaatgctgg 483



to top

>gb|AF037359.1|AF037359 Paulownia kawakamii superoxide dismutase (SOD5) mRNA, complete cds
          Length = 794

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 117/142 (82%)
 Strand = Plus / Plus

                                                                       
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 112
           ||||| |||||||| || ||||||||||||||||| || ||  ||||||||||||| |||
Sbjct: 214 ggctttcatgtgcatgcccttggtgacaccaccaatggttgtttgtcaactggacctcac 273

                                                                       
Query: 113 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgac 172
           ||||| || |||||  | | |||||| || || || |||||  | |||||||||||||||
Sbjct: 274 ttcaatcctgctggcaaagagcatggagctcctgatgatgaggttcgccatgctggtgac 333

                                 
Query: 173 ctcggaaatgtgacagctggag 194
           || || ||||| |||| |||||
Sbjct: 334 cttgggaatgtcacagttggag 355



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 245 ggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggc 304
           ||||||||||| || |||||  | ||||| || || |||| |||| ||||||||||||| 
Sbjct: 406 ggaccacattccataattggaagagctgtagttgttcatgctgatcctgatgatcttgga 465

                                              
Query: 305 aagggtggacatgagcttagcaagagcactggaaa 339
           |||||||||||||| || ||||| | |||||||||
Sbjct: 466 aagggtggacatgaactgagcaaaaccactggaaa 500



to top

>gb|U34727.1|ZMU34727 Zea mays superoxide dismutase 4A (sod4A) gene, complete cds
          Length = 4326

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 63/70 (90%)
 Strand = Plus / Plus

                                                                        
Query: 133  gcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgg 192
            |||||||||||| |||||||| | ||||||||| ||||| || |||||||||||||||||
Sbjct: 2733 gcatggggcaccagaagatgagaaccgccatgccggtgatcttggaaatgtgacagctgg 2792

                      
Query: 193  agcggatggt 202
            ||| ||||||
Sbjct: 2793 agcagatggt 2802



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                        
Query: 2    ggcccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccat 61
            ||||| ||| |||| || ||||||||| | || ||||||   || ||||| || ||||||
Sbjct: 2505 ggccctaccgctgtcactggaagtgtctctggcctcaagcctggcctccatgggttccat 2564

                                                        
Query: 62   gtgcacgctcttggtgacaccaccaacggctgcatgtcaactgg 105
            || || || ||||||||||||||||| || ||||||||||||||
Sbjct: 2565 gtacatgcacttggtgacaccaccaatggatgcatgtcaactgg 2608



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                 
Query: 308  ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttg 360
            ||||| || |||||||||||||||||||||||||| || |  |||||||||||
Sbjct: 3776 ggtgggcacgagcttagcaagagcactggaaacgcgggtggccgtgttgcttg 3828



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                     
Query: 254  tcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggt 310
            |||||||||||| | |||||||| || || | |||| ||||||||||||| ||||||
Sbjct: 3116 tcaatcattggcagagctgttgttgttcacgctgatcctgatgatcttggaaagggt 3172



to top

>gb|AF426829.1|AF426829 Olea europaea Cu/Zn-superoxide dismutase mRNA, partial cds
          Length = 312

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 112
           ||||||||||| ||||| ||||||||||||||||| ||||| |||||||||||||| || 
Sbjct: 13  ggcttccatgtccacgcccttggtgacaccaccaatggctgtatgtcaactggacctcat 72

                
Query: 113 ttcaa 117
           |||||
Sbjct: 73  ttcaa 77



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 291 ctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           ||||||||||||| | |||||| |||||||| |||||||| ||||||||||||||
Sbjct: 251 ctgatgatcttggaaggggtggtcatgagctgagcaagagaactggaaacgctgg 305



to top

>gb|AF054150.1|AF054150 Zantedeschia aethiopica cytosolic Cu/Zn-superoxide dismutase (sod3)
           mRNA, complete cds
          Length = 832

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| ||||||| |||  ||||||||||||| ||||| ||||||||||| ||||||
Sbjct: 487 gctgttgttgtccatgctgactctgatgatcttgggaaggggggacatgagctcagcaag 546

                            
Query: 329 agcactggaaacgctgg 345
           | ||||||||| |||||
Sbjct: 547 accactggaaatgctgg 563



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 44  gggctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 99
           ||||| |||||||| ||||||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 262 gggcttcacggctttcatgtgcacgcgcttggtgacactaccaatggctgtatgtc 317



to top

>gb|DQ088818.1| Gossypium hirsutum cytoplasmic Cu/ZnSOD mRNA, complete cds
          Length = 459

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 112/137 (81%)
 Strand = Plus / Plus

                                                                       
Query: 47  ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 106
           ||||| ||||||||||| || || ||||| ||||| || ||||| |||||||||||||||
Sbjct: 121 ctccatggcttccatgttcatgcccttggggacacaactaacgggtgcatgtcaactgga 180

                                                                       
Query: 107 ccgcacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgct 166
           || || || || || |||||  | | |||||| || || |||||||| | ||||||||||
Sbjct: 181 ccccattttaatcctgctggcaaagagcatggtgctccngaagatgagaaccgccatgct 240

                            
Query: 167 ggtgacctcggaaatgt 183
           ||||| || || |||||
Sbjct: 241 ggtgatctaggnaatgt 257



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 293 gatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           ||||| ||||||||||| || |||||||| ||||| ||||| ||||| |||||
Sbjct: 367 gatgaccttggcaagggcggccatgagctcagcaaaagcacaggaaatgctgg 419



to top

>emb|AJ428575.2|OEU428575 Olea europaea Cu/Zn super-oxide dismutase (ole e 5 allergen)
          Length = 714

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 99/119 (83%)
 Strand = Plus / Plus

                                                                       
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 112
           ||||| ||||| ||||| ||||||||||||||||| ||||| |||||||||||||| || 
Sbjct: 127 ggctttcatgtccacgcccttggtgacaccaccaatggctgtatgtcaactggacctcat 186

                                                                      
Query: 113 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 171
           ||||| || | |||  | | |||||| ||||| | |||||| | ||| |||||||||||
Sbjct: 187 ttcaatcctgttgggaaagagcatggtgcacctggagatgagaaccgtcatgctggtga 245



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 291 ctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           ||||||||||||| | |||||| ||||| || ||||||||||||||||| |||||
Sbjct: 365 ctgatgatcttggaaggggtggtcatgaactgagcaagagcactggaaatgctgg 419



to top

>emb|AJ278669.1|PTR278669 Populus tremula x Populus tremuloides mRNA for putative cytosolic
           CuZn-superoxide dismutase (cyt-SOD1 gene)
          Length = 851

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                       
Query: 243 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 302
           |||||||| |||| ||| ||||  | |||||||| || ||||  ||| ||||||||||||
Sbjct: 395 ctggaccaaattccatcgttggaagggctgttgttgttcatgcagatcctgatgatcttg 454

                                                      
Query: 303 gcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           ||||||| |||||||| |||||||| |||||||| || |||||
Sbjct: 455 gcaagggaggacatgaacttagcaaaagcactggtaatgctgg 497



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgca 111
           ||||||||||| || || ||||| |||||||| || ||||||||||||||||| |||||
Sbjct: 205 ggcttccatgttcatgcccttggagacaccacaaatggctgcatgtcaactggcccgca 263



to top

>dbj|AB091055.1| Barbula unguiculata mRNA for cytosolic copper/zinc superoxide
           dismutase, partial cds
          Length = 276

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                       
Query: 47  ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 106
           |||||||| ||||| || ||||| || |||||||| ||||| ||||||||||||||||| 
Sbjct: 4   ctccacggattccacgttcacgccctgggtgacacaaccaatggctgcatgtcaactggt 63

                          
Query: 107 ccgcacttcaacccc 121
           || ||||||||||||
Sbjct: 64  ccccacttcaacccc 78



to top

>gb|AF016892.1|AF016892 Populus tremuloides cytoplasmic superoxide dismutase 1 (SODcyt1)
           mRNA, complete cds
          Length = 787

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                       
Query: 243 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 302
           ||||||||||||| || |||||  | |||||||| || ||||| ||| ||||||||||||
Sbjct: 395 ctggaccacattccattattggttgggctgttgttgttcatggagatcctgatgatcttg 454

                                                      
Query: 303 gcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           ||||||| |||||||| || ||||| | |||||| || |||||
Sbjct: 455 gcaagggaggacatgaactcagcaaaaccactggtaatgctgg 497



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgca 111
           |||||||| || || || ||||| |||||||| || ||||||||||||||||| |||||
Sbjct: 205 ggcttccacgtccatgcccttggagacaccacaaatggctgcatgtcaactgggccgca 263



to top

>gb|U80069.1|MCU80069 Mesembryanthemum crystallinum cytosolic copper/zinc superoxide
           dismutase (SOD) mRNA, complete cds
          Length = 816

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 44  gggctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaact 103
           |||||||| || || ||||| ||||| |||||||||||||| || ||||||||||| |||
Sbjct: 248 gggctccatggatttcatgttcacgcccttggtgacaccacaaatggctgcatgtccact 307

                                  
Query: 104 ggaccgcacttcaaccccgctgg 126
           ||||| |||||||| || |||||
Sbjct: 308 ggaccacacttcaatcctgctgg 330



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           ||||| || ||||||| |||| ||||||||||||| | ||| ||||||||||| ||||||
Sbjct: 473 gctgtcgttgtccatgctgatcctgatgatcttggaagggggggacatgagctcagcaag 532



to top

>emb|X73139.1|IBSOD I.batatas mRNA for superoxide dismutase
          Length = 702

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| || ||||||||| | ||||||||||| || ||||| |||||||| ||||| 
Sbjct: 369 gctgttgttgttcatggtgatcccgatgatcttggtaaaggtggccatgagctcagcaaa 428

                                                                     
Query: 329 agcactggaaacgctggggcgcgtgttgcttgcgggatcatcgggctccagggctaag 386
           ||||||||||| ||||| | | | ||||| ||||| ||||| || || ||||| ||||
Sbjct: 429 agcactggaaatgctggcgggagggttgcctgcggtatcattggcctgcagggttaag 486



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 112
           ||||||||||| || || || |||||||| || || || |||||||| |||||||| || 
Sbjct: 153 ggcttccatgtccatgccctaggtgacacaacaaatggatgcatgtctactggaccacat 212

                         
Query: 113 ttcaaccccgctgg 126
           ||||| || |||||
Sbjct: 213 ttcaatcctgctgg 226



to top

>gb|AY694187.1| Camellia sinensis Cu/Zn superoxide dismutase mRNA, partial cds
          Length = 403

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 73/85 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 302
           |||||||||| || ||||||||  | || ||||| |||||||  ||  ||||||| ||||
Sbjct: 260 ctggaccacactctatcattggtagggccgttgttgtccatgcagaccctgatgaccttg 319

                                    
Query: 303 gcaagggtggacatgagcttagcaa 327
           |||||||||||||||||||||||||
Sbjct: 320 gcaagggtggacatgagcttagcaa 344



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 103/126 (81%)
 Strand = Plus / Plus

                                                                       
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 115
           |||||||| || |||||||| ||||| ||||| || ||||||||||||||||| || |||
Sbjct: 73  ttccatgttcatgctcttggggacacaaccaatggttgcatgtcaactggaccacatttc 132

                                                                       
Query: 116 aaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctc 175
           || || |||||  | | ||||||| | || |||||||| |  || ||||||||||| || 
Sbjct: 133 aatcctgctggcaaagagcatgggtctcctgaagatgagactcgtcatgctggtgatctt 192

                 
Query: 176 ggaaat 181
           ||||||
Sbjct: 193 ggaaat 198



to top

>gb|DQ481231.1| Populus suaveolens cytoplasmic Cu/Zn-superoxide dismutase (SODcyt1)
           mRNA, complete cds
          Length = 487

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 73/85 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 302
           ||||||||||||| || |||||  | |||||||| || ||||| ||| ||||||||||||
Sbjct: 336 ctggaccacattccattattggaagggctgttgttgttcatggagatcctgatgatcttg 395

                                    
Query: 303 gcaagggtggacatgagcttagcaa 327
           ||||||| |||||||| || |||||
Sbjct: 396 gcaagggaggacatgaactcagcaa 420



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 77  gacaccaccaacggctgcatgtcaactggaccgca 111
           |||||||| || ||||||||||||||||| |||||
Sbjct: 170 gacaccacaaatggctgcatgtcaactgggccgca 204



to top

>gb|DQ499511.1| Arachis hypogaea cultivar JL-24 Cu-Zn superoxide dismutase mRNA,
           complete cds
          Length = 562

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| ||||||| |||| ||||||||||||| || ||||| |||||||||||||| 
Sbjct: 349 gctgttgttgtccatgctgatcctgatgatcttgggaaaggtgggcatgagcttagcaaa 408

                            
Query: 329 agcactggaaacgctgg 345
             ||||||||| |||||
Sbjct: 409 tccactggaaatgctgg 425



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 115
           |||||||| || || ||||| |||||||| || || ||| |||||||||||||||| |||
Sbjct: 136 ttccatgtccatgcccttggagacaccacaaatggttgcctgtcaactggaccgcatttc 195

             
Query: 116 aa 117
           ||
Sbjct: 196 aa 197



to top

>gb|DQ097721.1| Arachis hypogaea Cu-Zn superoxide dismutase mRNA, complete cds
          Length = 617

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| ||||||| |||| ||||||||||||| || ||||| |||||||||||||| 
Sbjct: 393 gctgttgttgtccatgctgatcctgatgatcttgggaaaggtgggcatgagcttagcaaa 452

                            
Query: 329 agcactggaaacgctgg 345
             ||||||||| |||||
Sbjct: 453 tccactggaaatgctgg 469



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 115
           |||||||| || || ||||| |||||||| || || ||| |||||||||||||||| |||
Sbjct: 180 ttccatgtccatgcccttggagacaccacaaatggttgcctgtcaactggaccgcatttc 239

             
Query: 116 aa 117
           ||
Sbjct: 240 aa 241



to top

>emb|AJ786258.1| Helianthus annuus mRNA for Cu/Zn superoxide dismutase, (sod2 gene)
          Length = 729

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           ||||| || ||||||| |||| ||||||||||||| ||||| || |||||||| ||||| 
Sbjct: 432 gctgtggttgtccatgctgatcctgatgatcttggaaagggagggcatgagctaagcaaa 491

                            
Query: 329 agcactggaaacgctgg 345
           ||||||||||| |||||
Sbjct: 492 agcactggaaatgctgg 508



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaac 102
           |||||||| || || ||||||||||| ||||| || |||||||||||
Sbjct: 219 ttccatgttcatgcgcttggtgacacaaccaatggatgcatgtcaac 265



to top

>gb|AF355460.1|AF355460 Solanum tuberosum Cu/Zn-superoxide dismutase mRNA, partial cds
          Length = 617

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| || |||| |||| ||||||||||||| ||||| ||||||||||| || || 
Sbjct: 321 gctgttgttgttcatgctgatcctgatgatcttggaaagggaggacatgagctcagtaaa 380

                            
Query: 329 agcactggaaacgctgg 345
           ||||||||||| |||||
Sbjct: 381 agcactggaaatgctgg 397



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 112
           ||||||||||| || || |||||||| ||||| || |||||||||||||| ||||| || 
Sbjct: 105 ggcttccatgtccatgcccttggtgataccacaaatggctgcatgtcaacaggaccacat 164

                                                                      
Query: 113 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 171
           | ||| || |||||| | | |||||| || || ||||||||  | || |||||||||||
Sbjct: 165 tacaatcctgctggtaaggagcatggtgctcctgaagatgaggtgcgtcatgctggtga 223



to top

>gb|AF354748.1|AF354748 Solanum tuberosum copper-zinc superoxide dismutase mRNA, partial
           cds
          Length = 443

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| || |||| |||| ||||||||||||| ||||| ||||||||||| || || 
Sbjct: 331 gctgttgttgttcatgctgatcctgatgatcttggaaagggaggacatgagctcagtaaa 390

                            
Query: 329 agcactggaaacgctgg 345
           ||||||||||| |||||
Sbjct: 391 agcactggaaatgctgg 407



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 112
           ||||||||||| || || |||||||| ||||| || |||||||||||||| ||||| || 
Sbjct: 115 ggcttccatgtccatgcccttggtgataccacaaatggctgcatgtcaacaggaccacat 174

                                                                      
Query: 113 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 171
           | ||| || |||||| | | |||||| || || ||||||||  | || |||||||||||
Sbjct: 175 tacaatcctgctggtaaggagcatggtgctcctgaagatgaggtgcgtcatgctggtga 233



to top

>dbj|AB062752.1| Bruguiera gymnorhiza SodC mRNA for copper/zinc superoxide
           dismutase, complete cds
          Length = 874

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| || |||| |||| |||||||||| |||||||| || ||||| |||||||| 
Sbjct: 482 gctgttgttgttcatgctgatcctgatgatctgggcaagggagggcatgaacttagcaaa 541

                            
Query: 329 agcactggaaacgctgg 345
           ||||||||||| |||||
Sbjct: 542 agcactggaaatgctgg 558



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 65/75 (86%)
 Strand = Plus / Plus

                                                                       
Query: 43  agggctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaac 102
           |||||| || ||||||||||| || |||||||| ||||| || || || |||||||||||
Sbjct: 256 agggcttcatggcttccatgttcatgctcttggggacactacaaatggttgcatgtcaac 315

                          
Query: 103 tggaccgcacttcaa 117
           ||| |||||||||||
Sbjct: 316 tgggccgcacttcaa 330



to top

>ref|NM_100757.2| Arabidopsis thaliana CSD1; copper, zinc superoxide dismutase
           AT1G08830 (CSD1) mRNA, complete cds
          Length = 789

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 115
           |||||||| || ||||||||||||||||| ||||| |||||||| ||||| || || |||
Sbjct: 256 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactggtccacatttc 315

                       
Query: 116 aaccccgctggt 127
           ||||||| ||||
Sbjct: 316 aaccccgatggt 327



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 332 actggaaacgctggggcgcgtgttgcttgcgggatcatcgggctccagggctaa 385
           ||||||||||| || |  |||||||||||||| ||||| || ||||||||||||
Sbjct: 532 actggaaacgcaggcggccgtgttgcttgcggcatcattggtctccagggctaa 585



to top

>gb|DQ227345.1| Nelumbo nucifera isolate 0 copper-zinc superoxide dismutase
           (CuZn-SOD) mRNA, complete cds
          Length = 461

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 115
           |||||||| || |||||||||||||| || || || ||||||||||| ||||| || || 
Sbjct: 131 ttccatgtccatgctcttggtgacacaacaaatggttgcatgtcaacaggaccacatttt 190

                                                                       
Query: 116 aaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctc 175
           |||||   |||| | | |||||| || ||||| ||||||| ||| |||||||||||||| 
Sbjct: 191 aaccctcatggtaaagagcatggtgctcccgaggatgaaaaccgtcatgctggtgacctt 250

                   
Query: 176 ggaaatgt 183
           || |||||
Sbjct: 251 gggaatgt 258



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 96/118 (81%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| || |||| |||| ||||||||||||| || || |||||||| || ||||| 
Sbjct: 344 gctgttgttgtgcatgctgatcctgatgatcttggaaaaggaggacatgaactcagcaaa 403

                                                                     
Query: 329 agcactggaaacgctggggcgcgtgttgcttgcgggatcatcgggctccagggctaag 386
           |||||||| || ||||| |   | || || ||||| ||||||||||| || |||||||
Sbjct: 404 agcactgggaatgctggtggcagagtagcctgcggaatcatcgggctgcaaggctaag 461



to top

>gb|AY091168.1| Arabidopsis thaliana putative superoxide dismutase (At1g08830)
           mRNA, complete cds
          Length = 490

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 115
           |||||||| || ||||||||||||||||| ||||| |||||||| ||||| || || |||
Sbjct: 130 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactggtccacatttc 189

                       
Query: 116 aaccccgctggt 127
           ||||||| ||||
Sbjct: 190 aaccccgatggt 201



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 332 actggaaacgctggggcgcgtgttgcttgcgggatcatcgggctccagggctaa 385
           ||||||||||| || |  |||||||||||||| ||||| || ||||||||||||
Sbjct: 406 actggaaacgcaggcggccgtgttgcttgcggcatcattggtctccagggctaa 459



to top

>gb|AY050932.1| Arabidopsis thaliana putative superoxidase dismutase (At1g08830)
           mRNA, complete cds
          Length = 769

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 115
           |||||||| || ||||||||||||||||| ||||| |||||||| ||||| || || |||
Sbjct: 225 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactggtccacatttc 284

                       
Query: 116 aaccccgctggt 127
           ||||||| ||||
Sbjct: 285 aaccccgatggt 296



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 332 actggaaacgctggggcgcgtgttgcttgcgggatcatcgggctccagggctaa 385
           ||||||||||| || |  |||||||||||||| ||||| || ||||||||||||
Sbjct: 501 actggaaacgcaggcggccgtgttgcttgcggcatcattggtctccagggctaa 554



to top

>emb|X60935.1|ATCZSUDI A.thaliana mRNA for Cu,Zn superoxide dismutase
          Length = 788

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 115
           |||||||| || ||||||||||||||||| ||||| |||||||| ||||| || || |||
Sbjct: 242 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactggtccacatttc 301

                       
Query: 116 aaccccgctggt 127
           ||||||| ||||
Sbjct: 302 aaccccgatggt 313



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 332 actggaaacgctggggcgcgtgttgcttgcgggatcatcgggctccagggctaa 385
           ||||||||||| || |  |||||||||||||| ||||| || ||||||||||||
Sbjct: 518 actggaaacgcaggcggccgtgttgcttgcggcatcattggtctccagggctaa 571



to top

>emb|BX818158.1|CNS0AE2K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL64ZA05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 737

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 115
           |||||||| || ||||||||||||||||| ||||| |||||||| ||||| || || |||
Sbjct: 204 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactggtccacatttc 263

                       
Query: 116 aaccccgctggt 127
           ||||||| ||||
Sbjct: 264 aaccccgatggt 275



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 332 actggaaacgctggggcgcgtgttgcttgcgggatcatcgggctccagggctaa 385
           ||||||||||| || |  |||||||||||||| ||||| || ||||||||||||
Sbjct: 480 actggaaacgcaggcggccgtgttgcttgcggcatcattggtctccagggctaa 533



to top

>gb|AY087273.1| Arabidopsis thaliana clone 33493 mRNA, complete sequence
          Length = 788

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 115
           |||||||| || ||||||||||||||||| ||||| |||||||| ||||| || || |||
Sbjct: 256 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactggtccacatttc 315

                       
Query: 116 aaccccgctggt 127
           ||||||| ||||
Sbjct: 316 aaccccgatggt 327



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 332 actggaaacgctggggcgcgtgttgcttgcgggatcatcgggctccagggctaa 385
           ||||||||||| || |  |||||||||||||| ||||| || ||||||||||||
Sbjct: 532 actggaaacgcaggcggccgtgttgcttgcggcatcattggtctccagggctaa 585



to top

>gb|AY881163.1| Nelumbo nucifera isolate 13 copper-zinc superoxide dismutase mRNA,
           partial cds
          Length = 457

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 115
           |||||||| || |||||||||||||| || || || ||||||||||| ||||| || || 
Sbjct: 131 ttccatgtccatgctcttggtgacacaacaaatggttgcatgtcaacaggaccacatttt 190

                                                                       
Query: 116 aaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctc 175
           |||||   |||| | | |||||| || ||||| ||||||| ||| |||||||||||||| 
Sbjct: 191 aaccctcatggtaaagagcatggtgctcccgaggatgaaaaccgtcatgctggtgacctt 250

                   
Query: 176 ggaaatgt 183
           || |||||
Sbjct: 251 gggaatgt 258



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| || |||| |||| ||||||||||||| || || |||||||| || ||||| 
Sbjct: 344 gctgttgttgtgcatgctgatcctgatgatcttggaaaaggaggacatgaactcagcaaa 403

                            
Query: 329 agcactggaaacgctgg 345
           |||||||| || |||||
Sbjct: 404 agcactgggaatgctgg 420



to top

>gb|AY881162.1| Nelumbo nucifera isolate 11 copper-zinc superoxide dismutase mRNA,
           partial cds
          Length = 457

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 115
           |||||||| || |||||||||||||| || || || ||||||||||| ||||| || || 
Sbjct: 131 ttccatgtccatgctcttggtgacacaacaaatggttgcatgtcaacaggaccacatttt 190

                                                                       
Query: 116 aaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctc 175
           |||||   |||| | | |||||| || ||||| ||||||| ||| |||||||||||||| 
Sbjct: 191 aaccctcatggtaaagagcatggtgctcccgaggatgaaaaccgtcatgctggtgacctt 250

                   
Query: 176 ggaaatgt 183
           || |||||
Sbjct: 251 gggaatgt 258



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| || |||| |||| ||||||||||||| || || |||||||| || ||||| 
Sbjct: 344 gctgttgttgtgcatgctgatcctgatgatcttggaaaaggaggacatgaactcagcaaa 403

                            
Query: 329 agcactggaaacgctgg 345
           |||||||| || |||||
Sbjct: 404 agcactgggaatgctgg 420



to top

>gb|AY881155.1| Nelumbo nucifera isolate 4 copper-zinc superoxide dismutase mRNA,
           partial cds
          Length = 457

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 115
           |||||||| || |||||||||||||| || || || ||||||||||| ||||| || || 
Sbjct: 131 ttccatgtccatgctcttggtgacacaacaaatggttgcatgtcaacaggaccacatttt 190

                                                                       
Query: 116 aaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtgacctc 175
           |||||   |||| | | |||||| || ||||| ||||||| ||| |||||||||||||| 
Sbjct: 191 aaccctcatggtaaagagcatggtgctcccgaggatgaaaaccgtcatgctggtgacctt 250

                   
Query: 176 ggaaatgt 183
           || |||||
Sbjct: 251 gggaatgt 258



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| || |||| |||| ||||||||||||| || || |||||||| || ||||| 
Sbjct: 344 gctgttgttgtgcatgctgatcctgatgatcttggaaaaggaggacatgaactcagcaaa 403

                            
Query: 329 agcactggaaacgctgg 345
           |||||||| || |||||
Sbjct: 404 agcactgggaatgctgg 420



to top

>gb|AY646367.1| Malus xiaojinensis superoxide dismutase (Sod1) mRNA, complete cds
          Length = 805

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 2   ggcccgaccactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccat 61
           ||||| || |||||||| ||||||||| | || ||||||   || || || || ||||||
Sbjct: 188 ggcccaactactgtgactggaagtgtctctggcctcaagcctggacttcatggtttccat 247

                                                                       
Query: 62  gtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 121
           || || |||||||| ||||| || ||||| |||||||||||||| || |||||||| || 
Sbjct: 248 gtccatgctcttggagacacaacaaacggttgcatgtcaactgggccacacttcaatcct 307

                                                          
Query: 122 gctggtcatgtgcatggggcacccgaagatgaaatccgccatgctgg 168
           |||||  | | |||||| || || ||||||||  | |||||||||||
Sbjct: 308 gctggaaaagagcatggtgcccctgaagatgagcttcgccatgctgg 354



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 73/86 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatctt 301
           ||||||||||| || ||||||||  | || ||||| ||||| |  ||  ||||||| |||
Sbjct: 428 gctggaccacactctatcattggtagggcggttgttgtccacgcagaccctgatgacctt 487

                                     
Query: 302 ggcaagggtggacatgagcttagcaa 327
           ||||||||||||||||||||||||||
Sbjct: 488 ggcaagggtggacatgagcttagcaa 513



to top

>emb|X14040.1|LECYTSOD Tomato mRNA for cytoplasmic Cu-Zn superoxide dismutase (EC
           1.15.1.1)
          Length = 777

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 86/103 (83%)
 Strand = Plus / Plus

                                                                       
Query: 243 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 302
           |||| ||||| || ||||||||  | |||||||| || |||| |||| ||||||||||||
Sbjct: 322 ctggtccacagtccatcattggaagagctgttgttgttcatgctgatcctgatgatcttg 381

                                                      
Query: 303 gcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           | ||||| ||||||||||| || || ||||| ||||| |||||
Sbjct: 382 gaaagggaggacatgagctcagtaaaagcaccggaaatgctgg 424



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 96/119 (80%)
 Strand = Plus / Plus

                                                                       
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 112
           ||||||||||| || || |||||||| ||||| || ||||| |||||||| ||||| || 
Sbjct: 132 ggcttccatgtccatgcccttggtgataccacaaatggctgtatgtcaacaggaccacat 191

                                                                      
Query: 113 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 171
           | ||| || |||||| | | |||||| || || ||||||||  | || |||||||||||
Sbjct: 192 tacaatcctgctggtaaggagcatggtgctcctgaagatgaggtgcgtcatgctggtga 250



to top

>emb|AJ844861.1| Drosophila bipectinata partial Sod gene, exons 1-2, strain Pune
          Length = 996

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           |||||||||||||||||||   ||||||||| ||||||||||||||||||  |||| || 
Sbjct: 714 cacggcttccatgtgcacgagtttggtgacaacaccaacggctgcatgtcctctggtcct 773

                      
Query: 110 cacttcaaccc 120
           || ||||||||
Sbjct: 774 catttcaaccc 784



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 287 gatgctgatgatcttggcaagggtggacatgagcttagcaaga 329
           ||||| |||||||| |||||||||||||| ||||| |||||||
Sbjct: 951 gatgccgatgatctgggcaagggtggacacgagctcagcaaga 993



to top

>emb|AJ844854.1| Drosophila malerkotliana pallens partial Sod gene, exons 1-2,
           strain KB270
          Length = 1000

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           |||||||||||||||||||   ||||||||| ||||||||||||||||||  |||| || 
Sbjct: 718 cacggcttccatgtgcacgagtttggtgacaacaccaacggctgcatgtcctctggtcct 777

                      
Query: 110 cacttcaaccc 120
           || ||||||||
Sbjct: 778 catttcaaccc 788



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 257 atcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacat 316
           |||||||| ||| |||| || ||||| |  ||||| |||||||| |||||||||||||| 
Sbjct: 925 atcattggacgtactgtagtggtccacgccgatgccgatgatctgggcaagggtggacac 984

                        
Query: 317 gagcttagcaaga 329
           ||||| |||||||
Sbjct: 985 gagctcagcaaga 997



to top

>emb|AJ844850.1| Drosophila bipectinata partial Sod gene, exons 1-2, strain 381.3
          Length = 994

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           |||||||||||||||||||   ||||||||| ||||||||||||||||||  |||| || 
Sbjct: 712 cacggcttccatgtgcacgagtttggtgacaacaccaacggctgcatgtcctctggtcct 771

                      
Query: 110 cacttcaaccc 120
           || ||||||||
Sbjct: 772 catttcaaccc 782



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                       
Query: 257 atcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacat 316
           |||||||| ||| |||| |||||||| |  ||||| |||||||| |||||||||||||| 
Sbjct: 919 atcattggacgtactgtggtcgtccacgccgatgccgatgatctgggcaagggtggacac 978

                        
Query: 317 gagcttagcaaga 329
           ||||| |||||||
Sbjct: 979 gagctcagcaaga 991



to top

>emb|AJ844844.1| Drosophila malerkotliana malerkotliana partial Sod gene, exons 1-2,
           strain 391.0
          Length = 994

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           |||||||||||||||||||   ||||||||| ||||||||||||||||||  |||| || 
Sbjct: 712 cacggcttccatgtgcacgagtttggtgacaacaccaacggctgcatgtcctctggtccc 771

                      
Query: 110 cacttcaaccc 120
           || ||||||||
Sbjct: 772 catttcaaccc 782



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 287 gatgctgatgatcttggcaagggtggacatgagcttagcaaga 329
           ||||| |||||||| |||||||||||||| ||||| |||||||
Sbjct: 949 gatgccgatgatctgggcaagggtggacacgagctcagcaaga 991



to top

>dbj|AB190501.1| Populus alba x Populus tremula var. glandulosa CuZn-SOD mRNA for
           CuZn-superoxide dismutase, complete cds, clone:
           PO3024C12
          Length = 730

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 291 ctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           ||||||||||||||||||| |||||||| |||||||| |||||||| || |||||
Sbjct: 442 ctgatgatcttggcaagggaggacatgaacttagcaaaagcactggtaatgctgg 496



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgca 111
           ||||||||||| || || ||||| |||||||| || ||||||||||||||||| |||||
Sbjct: 204 ggcttccatgttcatgcccttggagacaccacaaatggctgcatgtcaactggcccgca 262



to top

>dbj|AB190500.1| Populus alba x Populus tremula var. glandulosa CuZn-SOD mRNA for
           CuZn-superoxide dismutase, complete cds, clone:
           PO3023E02
          Length = 725

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 291 ctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           ||||||||||||||||||| |||||||| |||||||| |||||||| || |||||
Sbjct: 462 ctgatgatcttggcaagggaggacatgaacttagcaaaagcactggtaatgctgg 516



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgca 111
           ||||||||||| || || ||||| |||||||| || ||||||||||||||||| |||||
Sbjct: 224 ggcttccatgttcatgcccttggagacaccacaaatggctgcatgtcaactggcccgca 282



to top

>gb|M37150.1|TOMSODA Tomato superoxide dismutase (SOD) mRNA, complete cds
          Length = 776

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 86/103 (83%)
 Strand = Plus / Plus

                                                                       
Query: 243 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 302
           |||| ||||| || ||||||||  | |||||||| || |||| |||| ||||||||||||
Sbjct: 322 ctggtccacagtccatcattggaagagctgttgttgttcatgctgatcctgatgatcttg 381

                                                      
Query: 303 gcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           | ||||| ||||||||||| || || ||||| ||||| |||||
Sbjct: 382 gaaagggaggacatgagctcagtaaaagcaccggaaatgctgg 424



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 96/119 (80%)
 Strand = Plus / Plus

                                                                       
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 112
           ||||||||||| || || |||||||| ||||| || ||||| |||||||| ||||| || 
Sbjct: 132 ggcttccatgtccatgcccttggtgataccacaaatggctgtatgtcaacaggaccacat 191

                                                                      
Query: 113 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 171
           | ||| || |||||| | | |||||| || || ||||||||  | || |||||||||||
Sbjct: 192 tacaatcctgctggtaaggagcatggtgctcctgaagatgaggtgcgtcatgctggtga 250



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                            
Query: 8        accactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcac 67
                ||||||||||| ||||||||| | || ||||||   || ||||| || |||||| | || 
Sbjct: 13157201 accactgtgactggaagtgtctctggcctcaagcctggtctccatgggttccatattcat 13157260

                                                      
Query: 68       gctcttggtgacaccaccaacggctgcatgtcaactgg 105
                || ||||||||||||||||| || ||||||||||||||
Sbjct: 13157261 gcacttggtgacaccaccaatggttgcatgtcaactgg 13157298



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                            
Query: 133      gcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgg 192
                |||||| ||||| |||||||| | ||||||||||||||| || |||||||| || |||||
Sbjct: 13157450 gcatggagcaccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctgg 13157509

                  
Query: 193      ag 194
                ||
Sbjct: 13157510 ag 13157511



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                        
Query: 308      ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgg 363
                ||||| || ||||| ||||||| ||| ||||||||||| |  ||||||||||||||
Sbjct: 13158488 ggtgggcacgagctgagcaagaccaccggaaacgctggtggccgtgttgcttgcgg 13158543



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                            
Query: 243      ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 302
                |||||||| |||||||||||||| | || || || || ||||  ||| ||||||||||||
Sbjct: 13157962 ctggaccaaattcaatcattggcagagccgtcgttgtgcatgccgatcctgatgatcttg 13158021

                        
Query: 303      gcaagggt 310
                | ||||||
Sbjct: 13158022 gaaagggt 13158029



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 72      ttggtgacaccaccaacggctgca 95
               |||| |||||||||||||||||||
Sbjct: 6243317 ttggcgacaccaccaacggctgca 6243294



to top

>gb|AC135257.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1113A07,
             from chromosome 3, complete sequence
          Length = 151173

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                         
Query: 8     accactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcac 67
             ||||||||||| ||||||||| | || ||||||   || ||||| || |||||| | || 
Sbjct: 69437 accactgtgactggaagtgtctctggcctcaagcctggtctccatgggttccatattcat 69378

                                                   
Query: 68    gctcttggtgacaccaccaacggctgcatgtcaactgg 105
             || ||||||||||||||||| || ||||||||||||||
Sbjct: 69377 gcacttggtgacaccaccaatggttgcatgtcaactgg 69340



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                         
Query: 133   gcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgg 192
             |||||| ||||| |||||||| | ||||||||||||||| || |||||||| || |||||
Sbjct: 69188 gcatggagcaccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctgg 69129

               
Query: 193   ag 194
             ||
Sbjct: 69128 ag 69127



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                         
Query: 243   ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 302
             |||||||| |||||||||||||| | || || || || ||||  ||| ||||||||||||
Sbjct: 68676 ctggaccaaattcaatcattggcagagccgtcgttgtgcatgccgatcctgatgatcttg 68617

                     
Query: 303   gcaagggt 310
             | ||||||
Sbjct: 68616 gaaagggt 68609



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                     
Query: 308   ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgg 363
             ||||| || ||||| ||||||| ||| ||||||||||| |  ||||||||||||||
Sbjct: 68150 ggtgggcacgagctgagcaagaccaccggaaacgctggtggccgtgttgcttgcgg 68095



to top

>emb|AJ844862.1| Drosophila bipectinata partial Sod gene, exons 1-2, strain KB51
          Length = 1001

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 99
           |||||||||||||||||||   ||||||||| ||||||||||||||||||
Sbjct: 719 cacggcttccatgtgcacgagtttggtgacaacaccaacggctgcatgtc 768



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 287 gatgctgatgatcttggcaagggtggacatgagcttagcaaga 329
           ||||| |||||||| |||||||||||||| ||||| |||||||
Sbjct: 956 gatgccgatgatctgggcaagggtggacacgagctcagcaaga 998



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                            
Query: 8        accactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcac 67
                ||||||||||| ||||||||| | || ||||||   || ||||| || |||||| | || 
Sbjct: 13153976 accactgtgactggaagtgtctctggcctcaagcctggtctccatgggttccatattcat 13154035

                                                      
Query: 68       gctcttggtgacaccaccaacggctgcatgtcaactgg 105
                || ||||||||||||||||| || ||||||||||||||
Sbjct: 13154036 gcacttggtgacaccaccaatggttgcatgtcaactgg 13154073



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                            
Query: 133      gcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgg 192
                |||||| ||||| |||||||| | ||||||||||||||| || |||||||| || |||||
Sbjct: 13154225 gcatggagcaccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctgg 13154284

                  
Query: 193      ag 194
                ||
Sbjct: 13154285 ag 13154286



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                        
Query: 308      ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgg 363
                ||||| || ||||| ||||||| ||| ||||||||||| |  ||||||||||||||
Sbjct: 13155263 ggtgggcacgagctgagcaagaccaccggaaacgctggtggccgtgttgcttgcgg 13155318



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                            
Query: 243      ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 302
                |||||||| |||||||||||||| | || || || || ||||  ||| ||||||||||||
Sbjct: 13154737 ctggaccaaattcaatcattggcagagccgtcgttgtgcatgccgatcctgatgatcttg 13154796

                        
Query: 303      gcaagggt 310
                | ||||||
Sbjct: 13154797 gaaagggt 13154804



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 72      ttggtgacaccaccaacggctgca 95
               |||| |||||||||||||||||||
Sbjct: 6242530 ttggcgacaccaccaacggctgca 6242507



to top

>gb|L19435.1|RICSODCC Oryza sativa cytosolic copper/zinc-superoxide dismutase (SodCc1)
            gene, complete cds
          Length = 4253

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                        
Query: 8    accactgtgacgggaagtgtcacgggactcaaggaagggctccacggcttccatgtgcac 67
            ||||||||||| ||||||||| | || ||||||   || ||||| || |||||| | || 
Sbjct: 2429 accactgtgactggaagtgtctctggcctcaagcctggtctccatgggttccatattcat 2488

                                                  
Query: 68   gctcttggtgacaccaccaacggctgcatgtcaactgg 105
            || ||||||||||||||||| || ||||||||||||||
Sbjct: 2489 gcacttggtgacaccaccaatggttgcatgtcaactgg 2526



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                        
Query: 133  gcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacagctgg 192
            |||||| ||||| |||||||| | ||||||||||||||| || |||||||| || |||||
Sbjct: 2678 gcatggagcaccagaagatgagacccgccatgctggtgatcttggaaatgtcaccgctgg 2737

              
Query: 193  ag 194
            ||
Sbjct: 2738 ag 2739



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 308  ggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgcgg 363
            ||||| || ||||| ||||||| ||| ||||||||||| |  ||||||||||||||
Sbjct: 3613 ggtgggcacgagctgagcaagaccaccggaaacgctggtggccgtgttgcttgcgg 3668



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 243  ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 302
            |||||||| |||||||||||||| | || || || || ||||  ||| ||||||||||||
Sbjct: 3087 ctggaccaaattcaatcattggcagagccgtcgttgtgcatgccgatcctgatgatcttg 3146

                    
Query: 303  gcaagggt 310
            | ||||||
Sbjct: 3147 gaaagggt 3154



to top

>emb|X58578.1|PSCUZNPS3 P.sylvestris mRNA for CuZn superoxide dismutase, clone PS3
          Length = 821

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           ||||| || ||||||| |||| |||||||||||||||| ||||| ||||| || || |||
Sbjct: 461 gctgtagttgtccatgctgatcctgatgatcttggcaaaggtggccatgaactgagtaag 520

                            
Query: 329 agcactggaaacgctgg 345
           ||||| ||||| |||||
Sbjct: 521 agcacaggaaatgctgg 537



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 47  ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 106
           ||||| || |||||||| || || || |||||||| || || || |||||||||||||||
Sbjct: 239 ctccatggtttccatgttcatgcactaggtgacacaacaaatgggtgcatgtcaactgga 298

             
Query: 107 cc 108
           ||
Sbjct: 299 cc 300



to top

>emb|AJ844839.1| Drosophila malerkotliana malerkotliana partial Sod gene, exons 1-2,
           strain Raichuri
          Length = 1000

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                       
Query: 257 atcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacat 316
           |||||||| ||| |||| || ||||| |  |||||||||||||| |||||||||||||| 
Sbjct: 925 atcattggacgtactgtggttgtccacgccgatgctgatgatctgggcaagggtggacac 984

                        
Query: 317 gagcttagcaaga 329
           ||||| |||||||
Sbjct: 985 gagctcagcaaga 997



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           |||||||||||||||||||   |||| |||| ||||||||||||||||||  |||| || 
Sbjct: 718 cacggcttccatgtgcacgaatttggcgacaacaccaacggctgcatgtcctctggtcct 777

                      
Query: 110 cacttcaaccc 120
           || ||||||||
Sbjct: 778 catttcaaccc 788



to top

>emb|AJ278671.1|PTR278671 Populus tremula x Populus tremuloides mRNA for putative
           CuZn-superoxide dismutase (hipI-SOD1 gene)
          Length = 780

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| || |||| |||| ||||||||||||| || ||||||||||| |||||||||
Sbjct: 415 gctgttgttgtgcatgctgatcctgatgatcttggaaaaggtggacatgaacttagcaag 474

            
Query: 329 a 329
           |
Sbjct: 475 a 475



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 68  gctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
           |||||||||||||||||||| |||||||  || |||||||| || |||||
Sbjct: 214 gctcttggtgacaccaccaatggctgcaattccactggacctcatttcaa 263



to top

>emb|AJ278670.1|PTR278670 Populus tremula x Populus tremuloides partial mRNA for putative
           CuZn-superoxide dismutase (hipI-SOD 2 gene)
          Length = 691

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| || |||| |||| ||||||||||||| || ||||||||||| |||||||||
Sbjct: 359 gctgttgttgtgcatgctgatcctgatgatcttggaaaaggtggacatgaacttagcaag 418

            
Query: 329 a 329
           |
Sbjct: 419 a 419



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 68  gctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
           |||||||||||||||||||| |||||||  || |||||||| || |||||
Sbjct: 158 gctcttggtgacaccaccaatggctgcaattccactggacctcatttcaa 207



to top

>dbj|D49485.1| Solidago canadensis var. scabra mRNA for copper/zinc-superoxide
           dismutase, complete cds, clone: SAcSODcy
          Length = 700

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           ||||| || ||||||| |||| ||||||||||||| ||||| || |||||||| ||||| 
Sbjct: 367 gctgtagttgtccatgctgatcctgatgatcttggaaagggaggccatgagctcagcaaa 426

                            
Query: 329 agcactggaaacgctgg 345
           | ||||||||| |||||
Sbjct: 427 accactggaaatgctgg 443



to top

>gb|AF071112.1|AF071112 Brassica rapa ssp. pekinensis cytosolic Cu/Zn superoxide dismutase
           mRNA, complete cds
          Length = 757

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 115
           |||||||| || ||||||||||||||||||||||| |||||||| || || || || |||
Sbjct: 224 ttccatgtccatgctcttggtgacaccaccaacggttgcatgtctaccggtccacatttc 283

                
Query: 116 aaccc 120
           |||||
Sbjct: 284 aaccc 288



to top

>gb|DQ124227.1| Fagus sylvatica putative copper/zinc-superoxide dismutase mRNA,
           partial cds
          Length = 388

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                       
Query: 47  ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 106
           ||||| |||||||| ||||| |||||||| ||||| || || || |||||||||||||||
Sbjct: 122 ctccatggcttccacgtgcatgctcttggggacacaacaaatggttgcatgtcaactgga 181

                               
Query: 107 ccgcacttcaaccccgctgg 126
           || || ||||| || |||||
Sbjct: 182 ccacatttcaatcctgctgg 201



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtgga 313
           |||||||| |||||||| ||| | |||||||||||||||||||||
Sbjct: 344 gctgttgttgtccatggagatccagatgatcttggcaagggtgga 388



to top

>emb|X55974.1|NPSODM N.plumbaginifolia mRNA for superoxide dismutase
          Length = 837

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 113/140 (80%)
 Strand = Plus / Plus

                                                                       
Query: 242 gctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatctt 301
           ||||| ||||| || ||||||||  | ||||| || || |||| |||| |||||||||||
Sbjct: 404 gctggtccacaatccatcattggtagagctgtggttgttcatgctgatcctgatgatctt 463

                                                                       
Query: 302 ggcaagggtggacatgagcttagcaagagcactggaaacgctggggcgcgtgttgcttgc 361
           || ||||| ||||| ||||| || || | ||||||||| ||||| |   | |||||||| 
Sbjct: 464 ggaaagggaggacacgagctcagtaaaaccactggaaatgctggtggaagggttgcttgt 523

                               
Query: 362 gggatcatcgggctccaggg 381
           || |||||||| ||||||||
Sbjct: 524 ggtatcatcggcctccaggg 543



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 112
           ||||||||||| || || |||||||| ||||| || |||||||||||||| ||||| || 
Sbjct: 215 ggcttccatgtccatgcccttggtgataccacaaatggctgcatgtcaacgggaccacat 274

                                                                      
Query: 113 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 171
           | ||| || |||||| | | |||||| || || ||||||||  | || |||||||||||
Sbjct: 275 tacaatcctgctggtaaggagcatggtgctcctgaagatgaggtgcgtcatgctggtga 333



to top

>emb|BX816203.1|CNS0AE91 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH34ZB02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 748

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 115
           ||||||||||| |||||||||||||||||  |||| ||||| || ||||| || || |||
Sbjct: 225 ttccatgtgcatgctcttggtgacaccactgacggttgcatctctactggtccacatttc 284

                       
Query: 116 aaccccgctggt 127
           ||||||| ||||
Sbjct: 285 aaccccgatggt 296



to top

>gb|AF016893.1|AF016893 Populus tremuloides copper/zinc-superoxide dismutase (SodCc1) gene,
            complete cds
          Length = 4390

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                        
Query: 243  ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 302
            ||||||||||||| || |||||  | |||||||| || ||||| ||| ||||||||||||
Sbjct: 3183 ctggaccacattccattattggaagggctgttgttgttcatggagatcctgatgatcttg 3242

                    
Query: 303  gcaagggt 310
            ||||||||
Sbjct: 3243 gcaagggt 3250



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                 
Query: 53   ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgg 105
            |||||||| || || || ||||| |||||||| || |||||||||||||||||
Sbjct: 2626 ggcttccacgtccatgcccttggagacaccacaaatggctgcatgtcaactgg 2678



to top

>gb|AF318938.1| Citrus limon copper/zinc superoxide dismutase mRNA, complete cds
          Length = 744

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 302
           |||||||| |||| || |||||  | |||||||| ||||| |  ||| | ||||||||||
Sbjct: 444 ctggaccaaattccattattggaagggctgttgtagtccacgcagatcccgatgatcttg 503

                                                      
Query: 303 gcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           ||||||| || |||||||| ||||| | ||||||||| |||||
Sbjct: 504 gcaagggcggtcatgagctgagcaaaaccactggaaatgctgg 546



to top

>emb|Y13610.1|CPCZSD Carica papaya mRNA for copper/zinc-superoxide dismutase
          Length = 768

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| ||||| | |||| |||||||||||||||| || || |||||||| || |||
Sbjct: 397 gctgttgttgtccacgctgatcctgatgatcttggcaaaggggggcatgagctcagtaag 456

                              
Query: 329 agcactggaaacgctgggg 347
           |  |||||||| |||||||
Sbjct: 457 actactggaaatgctgggg 475



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           |||||||||||||| || ||  | |||||||| || || ||||||||||| ||||| || 
Sbjct: 178 cacggcttccatgttcatgccttgggtgacacaacaaatggctgcatgtcgactggtcct 237

                                                                       
Query: 110 cacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggt 169
           || ||||| || |||||  | |  ||||| || || || ||||| ||||| |||||||||
Sbjct: 238 catttcaatcctgctggcaaagaacatggtgctccagaggatgacatccgtcatgctggt 297

                         
Query: 170 gacctcggaaatgt 183
           ||||| ||||||||
Sbjct: 298 gaccttggaaatgt 311



to top

>emb|AJ844865.1| Drosophila parabipectinata partial Sod gene, exons 1-2, strain
           Yunnan 7
          Length = 977

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           |||||||||||||||||||   |||| |||| ||||||||||||||||||  |||| || 
Sbjct: 695 cacggcttccatgtgcacgagtttggcgacaacaccaacggctgcatgtcctctggtcct 754

                      
Query: 110 cacttcaaccc 120
           || ||||||||
Sbjct: 755 catttcaaccc 765



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 287 gatgctgatgatcttggcaagggtggacatgagcttagcaaga 329
           ||||| |||||||| |||||||||||||| ||||| |||||||
Sbjct: 932 gatgccgatgatctgggcaagggtggacacgagctcagcaaga 974



to top

>emb|AJ844860.1| Drosophila bipectinata partial Sod gene, exons 1-2, strain 211.5
          Length = 933

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           |||||||||||||||||||   |||| |||| ||||||||||||||||||  |||| || 
Sbjct: 651 cacggcttccatgtgcacgagtttggcgacaacaccaacggctgcatgtcctctggtcct 710

                      
Query: 110 cacttcaaccc 120
           || ||||||||
Sbjct: 711 catttcaaccc 721



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 257 atcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacat 316
           |||||||| ||| |||| || ||||| |  ||||| |||||||| |||||||||||||| 
Sbjct: 858 atcattggacgtactgtggttgtccacgccgatgccgatgatctgggcaagggtggacac 917

                        
Query: 317 gagcttagcaaga 329
           ||||| |||||||
Sbjct: 918 gagctcagcaaga 930



to top

>emb|AJ844859.1| Drosophila bipectinata partial Sod gene, exons 1-2, strain 381.4
          Length = 995

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           |||||||||||||||||||   |||| |||| ||||||||||||||||||  |||| || 
Sbjct: 713 cacggcttccatgtgcacgagtttggcgacaacaccaacggctgcatgtcctctggtcct 772

                      
Query: 110 cacttcaaccc 120
           || ||||||||
Sbjct: 773 catttcaaccc 783



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 287 gatgctgatgatcttggcaagggtggacatgagcttagcaaga 329
           ||||| |||||||| |||||||||||||| ||||| |||||||
Sbjct: 950 gatgccgatgatctgggcaagggtggacacgagctcagcaaga 992



to top

>emb|AJ844855.1| Drosophila malerkotliana pallens partial Sod gene, exons 1-2,
           strain KB447
          Length = 1025

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           |||||||| ||||||||||   ||||||||| ||||||||||||||||||  |||| || 
Sbjct: 743 cacggctttcatgtgcacgagtttggtgacaacaccaacggctgcatgtcctctggtcct 802

                      
Query: 110 cacttcaaccc 120
           || ||||||||
Sbjct: 803 catttcaaccc 813



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                        
Query: 257  atcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacat 316
            |||||||| ||| |||| || ||||| |  ||||| |||||||| |||||||||||||| 
Sbjct: 950  atcattggacgtactgtggttgtccacgccgatgccgatgatctgggcaagggtggacac 1009

                         
Query: 317  gagcttagcaaga 329
            ||||| |||||||
Sbjct: 1010 gagctcagcaaga 1022



to top

>gb|AF191342.1| Olea europaea copper/zinc superoxide dismutase (SOD1) mRNA, partial
           cds
          Length = 276

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 291 ctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           ||||||||||||| | |||||| ||||| || |||||||| ||||||||||||||
Sbjct: 209 ctgatgatcttggaaggggtggtcatgaactgagcaagagaactggaaacgctgg 263



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                       
Query: 89  ggctgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatggggcacccgaa 148
           |||||||||||||||||||| || ||||| || | |||  | | |||||| ||||| | |
Sbjct: 7   ggctgcatgtcaactggacctcatttcaatcctgttgggaaagagcatggtgcacctgga 66

                                  
Query: 149 gatgaaatccgccatgctggtga 171
           ||||| | |||||||||||||||
Sbjct: 67  gatgagaaccgccatgctggtga 89



to top

>gb|AY642137.1| Manihot esculenta copper/zinc superoxide dismutase mRNA, complete
           cds
          Length = 774

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 291 ctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           ||||||||||||| ||||| |||||||| |||||||| | ||||||||| |||||
Sbjct: 378 ctgatgatcttggaaaggggggacatgaacttagcaaaaccactggaaatgctgg 432



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 43  agggctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaac 102
           |||||| || || |||||||| || || ||||| ||||| || || || |||||||||||
Sbjct: 130 agggcttcatggattccatgttcatgcccttggagacacaacaaatggttgcatgtcaac 189

                             
Query: 103 tggaccgcacttcaaccc 120
           ||| || || ||||||||
Sbjct: 190 tgggccacatttcaaccc 207



to top

>gb|AY881165.1| Nelumbo nucifera isolate 16 copper-zinc superoxide dismutase mRNA,
           partial cds
          Length = 457

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 76/91 (83%)
 Strand = Plus / Plus

                                                                       
Query: 243 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 302
           |||||||  ||||||| |||||  | ||||| || || |||| |||| ||||||||||||
Sbjct: 318 ctggaccctattcaattattggaagggctgtcgtggtacatgctgatcctgatgatcttg 377

                                          
Query: 303 gcaagggtggacatgagcttagcaagagcac 333
           | ||||| |||||||| |||||||| |||||
Sbjct: 378 ggaagggaggacatgaacttagcaaaagcac 408



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggacc 108
           |||||||| || || |||||||||||||| || || || |||||||| |||||
Sbjct: 131 ttccatgtccatgcccttggtgacaccacaaatggttgtatgtcaacaggacc 183



to top

>gb|AY881164.1| Nelumbo nucifera isolate 14 copper-zinc superoxide dismutase mRNA,
           partial cds
          Length = 457

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 76/91 (83%)
 Strand = Plus / Plus

                                                                       
Query: 243 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 302
           |||||||  ||||||| |||||  | ||||| || || |||| |||| ||||||||||||
Sbjct: 318 ctggaccctattcaattattggaagggctgtcgtagtacatgctgatcctgatgatcttg 377

                                          
Query: 303 gcaagggtggacatgagcttagcaagagcac 333
           | ||||| |||||||| |||||||| |||||
Sbjct: 378 ggaagggaggacatgaacttagcaaaagcac 408



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggacc 108
           |||||||| || || |||||||||||||| || || || |||||||| |||||
Sbjct: 131 ttccatgtccatgcccttggtgacaccacaaatggttgtatgtcaacaggacc 183



to top

>gb|AF009734.1|AF009734 Capsicum annuum Cu/Zn superoxide dismutase (SOD) mRNA, complete cds
          Length = 730

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 112
           ||||||||||| || || |||||||| ||||| || |||||||||||||| ||||| || 
Sbjct: 173 ggcttccatgtacatgcccttggtgataccacaaatggctgcatgtcaacaggaccacat 232

                                                                      
Query: 113 ttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatccgccatgctggtga 171
           | ||| || |||||| | |  ||||| || || |||||||| | ||| |||||||||||
Sbjct: 233 tacaatcctgctggtaaggaacatggtgctcctgaagatgagaaccgtcatgctggtga 291



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 281 catggtgatgctgatgatcttggcaagggtggacatgagcttagcaagagcactggaaac 340
           |||| |||| ||||||||||||| ||||| ||||||||||| |  || | ||||||||||
Sbjct: 401 catgctgatcctgatgatcttggaaagggaggacatgagctcactaaaaccactggaaac 460

                
Query: 341 gctgg 345
           |||||
Sbjct: 461 gctgg 465



to top

>emb|X95728.1|BJMSOD1GE B.juncea mRNA for Cu/Zn-superoxide dismutase
          Length = 766

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 47  ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 106
           ||||| || |||||||| || ||||||||||||||||| ||||| |||||||| || || 
Sbjct: 199 ctccatggtttccatgtccatgctcttggtgacaccactaacggttgcatgtctaccggt 258

                         
Query: 107 ccgcacttcaaccc 120
           || || ||||||||
Sbjct: 259 ccacatttcaaccc 272



to top

>emb|X53872.1|SOSODCY Spinacia oleracea mRNA for cytosolic copper/zinc-superoxide
           dismutase (EC 1.15.1.1)
          Length = 795

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 44  gggctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaact 103
           |||||||| || || ||||| || || ||||||||||| || || |||||||||||||||
Sbjct: 188 gggctccatggatttcatgttcatgcccttggtgacacaacaaatggctgcatgtcaact 247

                     
Query: 104 ggaccgcact 113
           || |||||||
Sbjct: 248 gggccgcact 257



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                     
Query: 272 gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaaga 329
           ||||| ||||||| |||  | ||||||||||| | |||||||||||| || |||||||
Sbjct: 416 gttgttgtccatgctgaacccgatgatcttggaaggggtggacatgaactcagcaaga 473



to top

>gb|DQ431473.1| Malus xiaojinensis Sod2 (Sod2) mRNA, complete cds
          Length = 805

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 272 gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaagagc 331
           ||||| |||||||| ||  | ||||| || ||||||||||||||||||||||||||   |
Sbjct: 478 gttgttgtccatggcgacccagatgacctgggcaagggtggacatgagcttagcaaatcc 537

                         
Query: 332 actggaaacgctgg 345
           |||||||| |||||
Sbjct: 538 actggaaatgctgg 551



to top

>gb|S72444.1| Drosophila subobscura Sod gene, partial cds
          Length = 439

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 287 gatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||||||||||||| |||||||||| ||||| ||||||
Sbjct: 338 gatgctgatgatcttggccagggtggacacgagctgagcaag 379



to top

>gb|AC003981.2|AC003981 Genomic sequence for Arabidopsis thaliana BAC F22O13 from chromosome I,
              complete sequence
          Length = 133843

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 56     ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgg 105
              |||||||| || ||||||||||||||||| ||||| |||||||| |||||
Sbjct: 125851 ttccatgtccatgctcttggtgacaccactaacggttgcatgtctactgg 125900



to top

>gb|AF457209.1| Hevea brasiliensis Cu/Zn superoxide dismutase (Cu/Zn-SOD) mRNA,
           complete cds
          Length = 738

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 292 tgatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           |||||||||||||||||| |||||||| || ||||| | ||||||||| |||||
Sbjct: 417 tgatgatcttggcaaggggggacatgaactcagcaaaatcactggaaatgctgg 470



to top

>gb|L13281.1|DROCUZNSOD Drosophila willistoni Cu/Zn-superoxide dismutase (Sod) gene,
           partial cds; and unknown gene
          Length = 1472

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 272 gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaaga 329
           |||||||||||||  ||| | |||||||| |||||||||||||| ||||| |||||||
Sbjct: 773 gttgtcgtccatgccgatcccgatgatctgggcaagggtggacacgagctgagcaaga 830



to top

>gb|AF009735.1| Raphanus sativus Cu/Zn superoxide dismutase (SOD) mRNA, complete
           cds
          Length = 576

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 47  ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 106
           ||||| || |||||||| || ||||||||||||||||| || || |||||||| || || 
Sbjct: 198 ctccatggtttccatgtccatgctcttggtgacaccactaatggttgcatgtccaccggt 257

                         
Query: 107 ccgcacttcaaccc 120
           ||||| ||||||||
Sbjct: 258 ccgcatttcaaccc 271



to top

>gb|AF034630.1|AF034630 Panax ginseng Cu/Zn superoxide dismutase (SOD) mRNA, complete cds
          Length = 624

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 96/118 (81%)
 Strand = Plus / Plus

                                                                       
Query: 71  cttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccccgctggtcat 130
           |||||||| || || ||||| ||| ||||||||||||| || |  ||||| |||  | | 
Sbjct: 163 cttggtgatacaacaaacggttgcctgtcaactggaccccattataaccctgctaataaa 222

                                                                     
Query: 131 gtgcatggggcacccgaagatgaaatccgccatgctggtgacctcggaaatgtgacag 188
           | |||||| || || |||||||| | ||||||||||||||| ||||| ||||||||||
Sbjct: 223 gagcatggtgctccggaagatgagacccgccatgctggtgatctcgggaatgtgacag 280



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 305 aagggtggacatgagcttagcaagagcactggaaacgctgg 345
           |||||||| ||||| || ||||| ||||||||||| |||||
Sbjct: 397 aagggtggtcatgaactcagcaaaagcactggaaatgctgg 437



to top

>gb|AF540558.1| Brassica juncea clone SOD 8A superoxide dismutase mRNA, complete
           cds
          Length = 755

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 115
           |||||||| || ||||||||||||||||| ||||| |||||||| || || || || |||
Sbjct: 203 ttccatgtccatgctcttggtgacaccactaacggttgcatgtccaccggtccacatttc 262

                
Query: 116 aaccc 120
           |||||
Sbjct: 263 aaccc 267



to top

>emb|AJ012739.1|CAR012739 Cicer arietinum mRNA for superoxide dismutase
          Length = 702

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| || |||| |||| ||||||||||||| || ||||| || ||||||||||| 
Sbjct: 364 gctgttgttgttcatgctgatcctgatgatcttgggaaaggtggtcacgagcttagcaaa 423

                            
Query: 329 agcactggaaacgctgg 345
           |  |||||||| |||||
Sbjct: 424 actactggaaatgctgg 440



to top

>emb|AJ012691.1|CAR012691 Cicer arietinum mRNA for superoxide dismutase
          Length = 809

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| || |||| |||| ||||||||||||| || ||||| || ||||||||||| 
Sbjct: 387 gctgttgttgttcatgctgatcctgatgatcttgggaaaggtggtcacgagcttagcaaa 446

                            
Query: 329 agcactggaaacgctgg 345
           |  |||||||| |||||
Sbjct: 447 actactggaaatgctgg 463



to top

>dbj|AB189165.1| Pisum sativum mRNA for copper zinc superoxide dismutase, complete
           cds
          Length = 857

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| |||||||  ||| ||||||||||||| || ||||| || ||||||||||| 
Sbjct: 408 gctgttgttgtccatgccgatcctgatgatcttgggaaaggtggtcacgagcttagcaaa 467

                            
Query: 329 agcactggaaacgctgg 345
           |  |||||||| |||||
Sbjct: 468 actactggaaatgctgg 484



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 47  ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 106
           ||||||||||||||| | || ||  | || |||||||| ||||| ||||| |||||||||
Sbjct: 186 ctccacggcttccatatccatgccttgggagacaccacaaacggttgcatttcaactgga 245

                      
Query: 107 ccgcacttcaa 117
           || || |||||
Sbjct: 246 ccacatttcaa 256



to top

>dbj|AB087845.1| Pisum sativum SOD mRNA for superoxide dismutase, complete cds
          Length = 850

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| |||||||  ||| ||||||||||||| || ||||| || ||||||||||| 
Sbjct: 404 gctgttgttgtccatgccgatcctgatgatcttgggaaaggtggtcacgagcttagcaaa 463

                            
Query: 329 agcactggaaacgctgg 345
           |  |||||||| |||||
Sbjct: 464 actactggaaatgctgg 480



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 47  ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 106
           ||||||||||||||| | || ||  | || |||||||| ||||| ||||| |||||||||
Sbjct: 182 ctccacggcttccatatccatgccttgggagacaccacaaacggttgcatttcaactgga 241

                      
Query: 107 ccgcacttcaa 117
           || || |||||
Sbjct: 242 ccacatttcaa 252



to top

>gb|U37714.1|DHU37714 Drosophila hydei Cu,Zn superoxide dismutase mRNA, partial cds
          Length = 439

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 293 gatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           ||||| || ||||| ||||| ||||||||||||||||  ||||||||||||||
Sbjct: 344 gatgacctcggcaaaggtggccatgagcttagcaagacaactggaaacgctgg 396



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgca 111
           |||||||||||||| |   |||| |||| ||||||||||||||||||  ||||||||||
Sbjct: 104 ggcttccatgtgcatgagtttggcgacaacaccaacggctgcatgtcctctggaccgca 162



to top

>gb|M63003.1|PEACUZNSD Pea Cu-Zn superoxide dismutase mRNA, complete cds
          Length = 738

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| |||||||  ||| ||||||||||||| || ||||| || ||||||||||| 
Sbjct: 358 gctgttgttgtccatgccgatcctgatgatcttgggaaaggtggtcacgagcttagcaaa 417

                            
Query: 329 agcactggaaacgctgg 345
           |  |||||||| |||||
Sbjct: 418 actactggaaatgctgg 434



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 47  ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 106
           ||||||||||||||| | || ||  | || |||||||| ||||| ||||| |||||||||
Sbjct: 136 ctccacggcttccatatccatgccttgggagacaccacaaacggttgcatttcaactgga 195

                      
Query: 107 ccgcacttcaa 117
           || || |||||
Sbjct: 196 ccacatttcaa 206



to top

>gb|DQ445093.1| Gossypium hirsutum putative cytosolic copper/zinc superoxide
           dismutase mRNA, complete cds
          Length = 682

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 278 gtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaagagcactgga 337
           ||||||| |||| | ||||| ||||||||||| || || ||||||||||| ||||| |||
Sbjct: 471 gtccatgctgatccggatgaccttggcaagggggggcacgagcttagcaaaagcaccgga 530

                   
Query: 338 aacgctgg 345
           || |||||
Sbjct: 531 aatgctgg 538



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 75/92 (81%)
 Strand = Plus / Plus

                                                                       
Query: 92  tgcatgtcaactggaccgcacttcaaccccgctggtcatgtgcatggggcacccgaagat 151
           ||||||||||| ||||| |||||||| || |||||  | | |||||| || || ||||||
Sbjct: 285 tgcatgtcaacaggacctcacttcaatcctgctggaaaagggcatggtgctcctgaagat 344

                                           
Query: 152 gaaatccgccatgctggtgacctcggaaatgt 183
           |  |  |||||||||||||| || ||||||||
Sbjct: 345 gtgaatcgccatgctggtgatctaggaaatgt 376



to top

>gb|AF127156.1| Drosophila erecta Cu-Zn superoxide dismutase (Sod) gene, exons 1 and
            2 and complete cds
          Length = 1509

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                        
Query: 50   cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
            ||||| ||||| |||||||   |||| |||| ||||||||||||||||||  | ||||||
Sbjct: 1157 cacggattccacgtgcacgagtttggagacaacaccaacggctgcatgtcgtccggaccg 1216

                    
Query: 110  cacttcaa 117
            ||||||||
Sbjct: 1217 cacttcaa 1224



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                      
Query: 287  gatgctgatgatcttggcaagggtggacatgagcttagcaag 328
            ||||| |||||||| ||||||||||| || ||||| ||||||
Sbjct: 1394 gatgccgatgatctcggcaagggtggccacgagctgagcaag 1435



to top

>gb|AY335229.1| Drosophila sucinea clone D.suc23 superoxide dismutase (Sod) gene,
           partial cds
          Length = 706

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 272 gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaa 327
           |||||||| ||||  || ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 628 gttgtcgttcatgccgacgctgatgatctcggcaagggtggacacgagctgagcaa 683



to top

>gb|AY335228.1| Drosophila capricorni clone D.cap3 superoxide dismutase (Sod) gene,
           partial cds
          Length = 706

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 272 gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaa 327
           |||||||| ||||  || ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 628 gttgtcgttcatgccgacgctgatgatctcggcaagggtggacacgagctgagcaa 683



to top

>gb|AY335226.1| Drosophila capricorni clone D.cap1 superoxide dismutase (Sod) gene,
           partial cds
          Length = 706

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 272 gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaa 327
           |||||||| ||||  || ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 628 gttgtcgttcatgccgacgctgatgatctcggcaagggtggacacgagctgagcaa 683



to top

>gb|AF021825.1|AF021825 Drosophila immigrans superoxide dismutase (Sod) gene, partial cds
          Length = 1350

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           ||||| |||||||||||||   |||| || | ||||||||||||||||||| ||||||| 
Sbjct: 500 cacggattccatgtgcacgagtttggcgataacaccaacggctgcatgtcatctggaccc 559

                   
Query: 110 cacttcaa 117
           || |||||
Sbjct: 560 catttcaa 567



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 287 gatgctgatgatcttggcaagggtggacatgagcttagcaa 327
           ||||| |||||||| ||||||||||| || ||||| |||||
Sbjct: 737 gatgccgatgatctgggcaagggtggccacgagctgagcaa 777



to top

>gb|U47868.1|DAU47868 Drosophila ambigua NDSSC 14011-0091.1 Cu,Zn superoxide dismutase
           (Sod) gene, partial cds
          Length = 720

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           ||||| |||||||||||||   | ||||||| ||||||||||||||||||  | || |||
Sbjct: 478 cacggattccatgtgcacgagttcggtgacaacaccaacggctgcatgtcgtccggcccg 537

                   
Query: 110 cacttcaa 117
           ||||||||
Sbjct: 538 cacttcaa 545



to top

>gb|DQ178940.1| Cucumis sativus Cu/Zn superoxide dismutase 1 mRNA, partial cds
          Length = 283

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcacttc 115
           |||||||| |||||  | |||||||| ||||| ||||||||||| ||||| || || |||
Sbjct: 69  ttccatgttcacgccttaggtgacacaaccaatggctgcatgtcgactgggccacatttc 128

                      
Query: 116 aaccccgctgg 126
           ||||| |||||
Sbjct: 129 aaccctgctgg 139



to top

>gb|AY257198.1| Lotus corniculatus var. japonicus cytosolic CuZn-superoxide
           dismutase (sodCc) gene, complete cds
          Length = 3172

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 47  ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgg 105
           ||||| ||||||||||| || ||  | |||||||||||||| |||||| ||||||||||
Sbjct: 593 ctccatggcttccatgtccatgccttgggtgacaccaccaatggctgcttgtcaactgg 651



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 308  ggtggacatgagcttagcaagagcactggaaacgctgg 345
            ||||| ||||||||||||||||  |||||||| |||||
Sbjct: 2650 ggtggccatgagcttagcaagactactggaaatgctgg 2687



to top

>emb|Z19591.1|DMCZSUDMA D.melanogaster Cu-Zn superoxide dismutase gene
          Length = 1844

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 287  gatgctgatgatcttggcaagggtggacatgagcttagcaag 328
            ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 1499 gatgccgatgatcttggccagggtggacacgagctgagcaag 1540



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 74   ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
            ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 1286 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 1329



to top

>emb|Y00367.1|DMSOD Drosophila mRNA for Cu-Zn superoxide dismutase
          Length = 724

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 287 gatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 429 gatgccgatgatcttggccagggtggacacgagctgagcaag 470



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 74  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
           ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 216 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 259



to top

>emb|X17332.1|DMSODG2 Drosophila Cu-Zn superoxide dismutase gene (EC 1.15.1.1)
          Length = 2458

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 287  gatgctgatgatcttggcaagggtggacatgagcttagcaag 328
            ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 2113 gatgccgatgatcttggccagggtggacacgagctgagcaag 2154



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 74   ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
            ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 1900 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 1943



to top

>emb|X13780.1|DMSODG Drosophila melanogaster sod gene for Cu-Zn superoxide dismutase (EC
            1.15.1.1)
          Length = 1844

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 287  gatgctgatgatcttggcaagggtggacatgagcttagcaag 328
            ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 1499 gatgccgatgatcttggccagggtggacacgagctgagcaag 1540



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 74   ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
            ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 1286 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 1329



to top

>gb|AC010023.6| Drosophila melanogaster 3L BAC RP98-19G23 (Roswell Park Cancer
           Institute Drosophila BAC Library) complete sequence
          Length = 161175

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 287 gatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 346 gatgccgatgatcttggccagggtggacacgagctgagcaag 305



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 74  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
           ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 559 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 516



to top

>gb|AC096692.5| Drosophila melanogaster 3L BAC RP98-48O3 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 173782

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                       
Query: 287   gatgctgatgatcttggcaagggtggacatgagcttagcaag 328
             ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 28573 gatgccgatgatcttggccagggtggacacgagctgagcaag 28614



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 74    ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
             ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 28360 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 28403



to top

>ref|NM_057387.3| Drosophila melanogaster Superoxide dismutase CG11793-RA (Sod), mRNA
          Length = 741

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 287 gatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 460 gatgccgatgatcttggccagggtggacacgagctgagcaag 501



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 74  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
           ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 247 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 290



to top

>gb|AY071435.1| Drosophila melanogaster RE52090 full length cDNA
          Length = 747

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 287 gatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 458 gatgccgatgatcttggccagggtggacacgagctgagcaag 499



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 74  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
           ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 245 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 288



to top

>gb|AF127158.1| Drosophila mauritiana Cu-Zn superoxide dismutase (Sod) gene, exons 1
            and 2 and complete cds
          Length = 1539

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 287  gatgctgatgatcttggcaagggtggacatgagcttagcaag 328
            ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 1424 gatgccgatgatcttggccagggtggacacgagctgagcaag 1465



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 56/68 (82%)
 Strand = Plus / Plus

                                                                        
Query: 50   cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
            ||||| ||||| |||||||   |||| |||| |||||| |||||||||||  | || |||
Sbjct: 1187 cacggattccacgtgcacgagtttggagacaacaccaatggctgcatgtcgtccgggccg 1246

                    
Query: 110  cacttcaa 117
            ||||||||
Sbjct: 1247 cacttcaa 1254



to top

>gb|AF127157.1| Drosophila sechellia Cu-Zn superoxide dismutase (Sod) gene, exons 1
            and 2 and complete cds
          Length = 1532

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 287  gatgctgatgatcttggcaagggtggacatgagcttagcaag 328
            ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 1417 gatgccgatgatcttggccagggtggacacgagctgagcaag 1458



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 72   ttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
            |||| |||| ||||||||||||||||||| | ||||| ||||||||
Sbjct: 1202 ttggagacaacaccaacggctgcatgtcatccggaccccacttcaa 1247



to top

>gb|AY335227.1| Drosophila capricorni clone D.cap2 superoxide dismutase (Sod) gene,
           partial cds
          Length = 706

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 272 gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagct 321
           |||||||| ||||  || ||||||||||| |||||||||||||| |||||
Sbjct: 628 gttgtcgttcatgccgacgctgatgatctcggcaagggtggacacgagct 677



to top

>gb|AC006562.8|AC006562 Drosophila melanogaster, chromosome 3L, region 68A1-68B2, BAC clone
              BACR48O03, complete sequence
          Length = 173781

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                        
Query: 287    gatgctgatgatcttggcaagggtggacatgagcttagcaag 328
              ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 145209 gatgccgatgatcttggccagggtggacacgagctgagcaag 145168



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 74     ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
              ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 145422 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 145379



to top

>gb|S72589.1|S72589 Drosophila melanogaster slow superoxide dismutase (Sod) gene, partial
            cds
          Length = 1410

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 287  gatgctgatgatcttggcaagggtggacatgagcttagcaag 328
            ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 1065 gatgccgatgatcttggccagggtggacacgagctgagcaag 1106



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 74  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
           ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 852 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 895



to top

>gb|AE003546.4| Drosophila melanogaster chromosome 3L, section 39 of 83 of the complete
              sequence
          Length = 281589

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                        
Query: 287    gatgctgatgatcttggcaagggtggacatgagcttagcaag 328
              ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 224414 gatgccgatgatcttggccagggtggacacgagctgagcaag 224373



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 74     ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
              ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 224627 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 224584



to top

>gb|U47892.1|DOU47892 Drosophila obscura Cu,Zn superoxide dismutase (Sod) gene, partial
           cds
          Length = 718

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 99
           ||||| |||||||||||||   | ||||||| ||||||||||||||||||
Sbjct: 476 cacggattccatgtgcacgagttcggtgacaacaccaacggctgcatgtc 525



to top

>gb|M24421.1|DROSODCUZN Drosophila melanogaster Cu-Zn superoxide dismutase (SOD) gene,
           complete cds
          Length = 462

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 287 gatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           ||||| |||||||||||| |||||||||| ||||| ||||||
Sbjct: 361 gatgccgatgatcttggccagggtggacacgagctgagcaag 402



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 74  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
           ||||||| |||||| |||||||||||  | ||||||||||||||
Sbjct: 148 ggtgacaacaccaatggctgcatgtcgtccggaccgcacttcaa 191



to top

>gb|AY804513.1| Drosophila yakuba strain Tai18 sod (sod) gene, partial cds
          Length = 663

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 77  gacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
           |||| ||||||||||||||||||  | ||||||||||||||
Sbjct: 388 gacaacaccaacggctgcatgtcgtccggaccgcacttcaa 428



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 287 gatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           ||||| |||||||| ||||||||||| || ||||| ||||||
Sbjct: 598 gatgccgatgatctcggcaagggtggccacgagctgagcaag 639



to top

>gb|AY804512.1| Drosophila santomea strain STO.4 sod (sod) gene, partial cds
          Length = 715

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 272 gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
           |||||||| || | |||||| |||||||| ||||||||||| || ||||| ||||||
Sbjct: 635 gttgtcgtgcacgctgatgccgatgatctcggcaagggtggccacgagctgagcaag 691



to top

>emb|X95726.1|BJMSOD2GE B.juncea mRNA for Cu/Zn-superoxide dismutase
          Length = 722

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 56  ttccatgtgcacgctcttggtgacaccaccaacggct 92
           |||||||| || ||||||||||||||||| |||||||
Sbjct: 242 ttccatgtccatgctcttggtgacaccactaacggct 278



to top

>emb|X56435.1|PSSODII Pea mRNA for Cu/Zn superoxide dismutase II (SOD9)
          Length = 901

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 293 gatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           ||||| ||||| |||||||||||||| |||||   |||||||||||| |||||
Sbjct: 547 gatgaccttggaaagggtggacatgaacttagtttgagcactggaaatgctgg 599



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 146 gaagatgaaatccgccatgctggtgacctcggaaa 180
           |||||||||||||| ||||| |||||||| |||||
Sbjct: 400 gaagatgaaatccgtcatgcgggtgacctgggaaa 434



to top

>gb|DQ286712.1| Eisenia fetida superoxide dismutase mRNA, partial cds
          Length = 319

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 296 gatcttggcaagggtggacatgagcttagcaagagcactggaaac 340
           ||||||||||| ||||| |||||| | ||||||| ||||||||||
Sbjct: 262 gatcttggcaaaggtggtcatgagttcagcaagaccactggaaac 306



to top

>gb|AF127160.1| Drosophila teissieri Cu-Zn superoxide dismutase (Sod) gene, exons 1
            and 2 and complete cds
          Length = 1617

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 77   gacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
            |||| ||||||||||||||||||  | ||||||||||||||
Sbjct: 1292 gacaacaccaacggctgcatgtcgtccggaccgcacttcaa 1332



to top

>gb|AF127159.1| Drosophila yakuba Cu-Zn superoxide dismutase (Sod) gene, exons 1 and
            2 and complete cds
          Length = 1563

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                     
Query: 272  gttgtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaag 328
            |||||||| || | |||||| |||||||| ||||||||||| || ||||| ||||||
Sbjct: 1433 gttgtcgtgcacgctgatgccgatgatctcggcaagggtggccacgagctgagcaag 1489



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 77   gacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
            |||| ||||||||||||||||||  | ||||||||||||||
Sbjct: 1238 gacaacaccaacggctgcatgtcgtccggaccgcacttcaa 1278



to top

>gb|AF021830.1|AF021830 Drosophila nebulosa superoxide dismutase (Sod) mRNA, partial cds
          Length = 439

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 287 gatgctgatgatcttggcaagggtggacatgagcttagcaa 327
           ||||| |||||||| |||||||||||||| ||||| |||||
Sbjct: 338 gatgccgatgatctgggcaagggtggacacgagctgagcaa 378



to top

>gb|AF021829.1|AF021829 Drosophila paulistorum superoxide dismutase (Sod) mRNA, partial cds
          Length = 439

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 275 gtcgtccatggtgatgctgatgatcttggcaagggtggacatgagcttagcaa 327
           ||||||||||  ||| | |||||||| |||||||||||||| ||||| |||||
Sbjct: 326 gtcgtccatgccgatcccgatgatctgggcaagggtggacacgagctgagcaa 378



to top

>gb|AF021828.1|AF021828 Drosophila teissieri superoxide dismutase (Sod) gene, partial cds
          Length = 1856

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 77  gacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
           |||| ||||||||||||||||||  | ||||||||||||||
Sbjct: 911 gacaacaccaacggctgcatgtcgtccggaccgcacttcaa 951



to top

>gb|AF021824.1|AF021824 Hirtodrosophila pictiventris superoxide dismutase (Sod) gene,
           partial cds
          Length = 890

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           |||||||||||||||||||   |||| |||| |||||| || ||||||||| |||| || 
Sbjct: 648 cacggcttccatgtgcacgaatttggggacaacaccaatggttgcatgtcatctgggcca 707

                
Query: 110 cactt 114
           |||||
Sbjct: 708 cactt 712



to top

>gb|AF021823.1|AF021823 Zaprionus tuberculatus superoxide dismutase (Sod) mRNA, partial cds
          Length = 439

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                       
Query: 257 atcattggccgtgctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacat 316
           |||||||| ||  ||||||||||||| | |||| | |||||||| ||||||||||| || 
Sbjct: 308 atcattggacgcactgttgtcgtccacgctgatcccgatgatctgggcaagggtggccac 367

                                        
Query: 317 gagcttagcaagagcactggaaacgctgg 345
           ||| | ||||||   |||||||| |||||
Sbjct: 368 gagttgagcaagtcaactggaaatgctgg 396



to top

>gb|U08097.1|PTU08097 Populus tremuloides Cu/Zn-superoxide dismutase preprotein
           (Cu/Zn-SOD) mRNA, complete cds
          Length = 685

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 293 gatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           ||||| ||||| |||||||||||||| |||||   |||||||||||| |||||
Sbjct: 522 gatgaccttggaaagggtggacatgaacttagtttgagcactggaaatgctgg 574



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 146 gaagatgaaatccgccatgctggtgacctcggaaa 180
           |||||||||||||| ||||| |||||||| |||||
Sbjct: 372 gaagatgaaatccgtcatgcgggtgacctgggaaa 406



to top

>gb|J04087.1|PEASOD Pea chloroplastic copper/zinc-superoxide dismutase mRNA, complete
           cds
          Length = 825

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 293 gatgatcttggcaagggtggacatgagcttagcaagagcactggaaacgctgg 345
           ||||| ||||| |||||||||||||| |||||   |||||||||||| |||||
Sbjct: 524 gatgaccttggaaagggtggacatgaacttagtttgagcactggaaatgctgg 576



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 146 gaagatgaaatccgccatgctggtgacctcggaaa 180
           |||||||||||||| ||||| |||||||| |||||
Sbjct: 377 gaagatgaaatccgtcatgcgggtgacctgggaaa 411



to top

>gb|DQ088819.1| Gossypium hirsutum chloroplast Cu/ZnSOD mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 762

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 293 gatgatcttggcaagggtggacatgagcttag 324
           ||||||||||| |||||||||||||| |||||
Sbjct: 667 gatgatcttggaaagggtggacatgaacttag 698



to top

>gb|AC156827.4| Medicago truncatula clone mth2-15c17, complete sequence
          Length = 110578

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 68     gctcttggtgacaccaccaacggctgca 95
              |||||||||||||||||||| |||||||
Sbjct: 100894 gctcttggtgacaccaccaatggctgca 100867



to top

>gb|DQ120514.1| Gossypium hirsutum chloroplast Cu/Zn superoxide dismutase mRNA,
           complete cds; nuclear gene for chloroplast product
          Length = 1043

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 293 gatgatcttggcaagggtggacatgagcttag 324
           ||||||||||| |||||||||||||| |||||
Sbjct: 650 gatgatcttggaaagggtggacatgaacttag 681



to top

>emb|X87372.1|LESODCC L.esculentum  SodCc;Le;2 gene
          Length = 11053

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 243  ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 302
            |||| ||||| || ||||||||  | |||||||| || |||| |||| ||||||||||||
Sbjct: 7285 ctggtccacagtccatcattggaagagctgttgttgttcatgctgatcctgatgatcttg 7344

                    
Query: 303  gcaagggt 310
            | ||||||
Sbjct: 7345 gaaagggt 7352



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 53   ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaac 102
            ||||||||||| || || |||||||| ||||| || ||||| ||||||||
Sbjct: 6599 ggcttccatgtccatgcccttggtgataccacaaatggctgtatgtcaac 6648



to top

>gb|AY898945.1| Lilium hybrid cultivar superoxide dismutase (SOD) mRNA, complete
           cds
          Length = 872

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 137 ggggcacccgaagatgaaatccgccatgctggtgacctcggaaa 180
           ||||| || |||||||||||||| ||||| |||||||| |||||
Sbjct: 438 ggggctcctgaagatgaaatccgtcatgcgggtgacctgggaaa 481



to top

>dbj|AB066500.1| Barbula unguiculata mRNA for chloroplastic copper/zinc superoxide
           dismutase, complete cds
          Length = 946

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 74  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaa 117
           |||||||| ||||| ||||||||||| ||||| || ||||||||
Sbjct: 426 ggtgacacaaccaatggctgcatgtcgactggtcctcacttcaa 469



to top

>gb|AF059879.1|AF059879 Drosophila immigrans Cu-Zn superoxide dismutase (Sod) gene, exon 2
           and partial cds
          Length = 282

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           ||||| |||||||||||||   |||| || | |||||||||||||||||||  |||||| 
Sbjct: 46  cacggattccatgtgcacgagtttggcgataacaccaacggctgcatgtcatatggaccc 105

                   
Query: 110 cacttcaa 117
           || |||||
Sbjct: 106 catttcaa 113



to top

>gb|AF021822.1|AF021822 Scaptodrosophila lebanonensis superoxide dismutase (Sod) mRNA,
           partial cds
          Length = 439

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           |||||||||||||||||||   |||| || |  |||||||||||||||||  ||||||| 
Sbjct: 101 cacggcttccatgtgcacgagtttggagataataccaacggctgcatgtccgctggacct 160

                   
Query: 110 cacttcaa 117
           || |||||
Sbjct: 161 catttcaa 168



to top

>gb|DQ440061.1| Aedes aegypti clone AE-321 Cu2+/Zn2+ superoxide dismutase mRNA,
           complete cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 74  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccc 120
           ||||||| ||||||||| ||||  ||  |||||||||||||||||||
Sbjct: 148 ggtgacaacaccaacggatgcacctcggctggaccgcacttcaaccc 194



to top

>emb|AJ971950.1| Pinus pinea partial mRNA for chloroplast CuZn superoxide dismutase
           (cuZnsodchl gene)
          Length = 233

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 39  ttggtgacacaaccaatggctgcatgtcaac 69



to top

>gb|AY434497.1| Trifolium pratense superoxide dismutase mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1016

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 146 gaagatgaaatccgccatgctggtgacctcggaaa 180
           |||||||||||||| ||||| |||||||| |||||
Sbjct: 447 gaagatgaaatccgtcatgcgggtgacctgggaaa 481



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 305 aagggtggacatgagcttagcaagagcactggaaacgctgg 345
           |||||||||||||| |||||   |||||||||||| |||||
Sbjct: 606 aagggtggacatgaacttagtttgagcactggaaatgctgg 646



to top

>gb|AC126007.16| Medicago truncatula clone mth2-11o4, complete sequence
          Length = 106747

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 146   gaagatgaaatccgccatgctggtgacctcggaaa 180
             |||||||||||||| ||||| |||||||| |||||
Sbjct: 51081 gaagatgaaatccgtcatgcgggtgacctgggaaa 51047



to top

>emb|X58579.1|PSCUZNPST P.sylvestris mRNA for CuZn superoxide dismutase, clone PST13
          Length = 676

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 111 ttggtgacacaaccaatggctgcatgtcaac 141



to top

>emb|X15685.1|DSSOD Drosophila simulans DNA for Cu-Zn superoxide dismutase (EC 1.15.1.1)
          Length = 1793

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                        
Query: 47   ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 106
            |||||||| ||||| |||||||   |||| |||| |||||| |||||||||||  | |||
Sbjct: 1242 ctccacggattccacgtgcacgagtttggagacaacaccaatggctgcatgtcgtccgga 1301

                       
Query: 107  ccgcacttcaa 117
            || ||||||||
Sbjct: 1302 ccccacttcaa 1312



to top

>emb|AJ279694.1|BPE279694 Betula pendula partial mRNA for copper/zinc-superoxide dismutase
           (cu/Zn sod gene)
          Length = 355

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 243 ctggaccacattcaatcattggccgtgctgttgtcgtccatggtgatgctgatgatcttg 302
           ||||||||||||| || |||||  | |||||||| ||||| || ||| | ||||||||||
Sbjct: 293 ctggaccacattctattattggaagggctgttgttgtccacggggatccagatgatcttg 352

              
Query: 303 gca 305
           |||
Sbjct: 353 gca 355



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Plus

                                                                       
Query: 44  gggctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaact 103
           |||||||| || |||||||| || || ||||| ||||| || || || ||||||||||||
Sbjct: 94  gggctccatgggttccatgtccatgcacttggggacacaacaaatggttgcatgtcaact 153

                                  
Query: 104 ggaccgcacttcaaccccgctgg 126
           || || || ||||| || |||||
Sbjct: 154 gggccacatttcaatcctgctgg 176



to top

>gb|AY867724.1| Pinus taeda isolate FBRC30 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867723.1| Pinus taeda isolate FBRC29 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867722.1| Pinus taeda isolate FBRC28 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867719.1| Pinus taeda isolate FBRC25 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867717.1| Pinus taeda isolate FBRC23 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867714.1| Pinus taeda isolate FBRC20 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867713.1| Pinus taeda isolate FBRC19 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867712.1| Pinus taeda isolate FBRC18 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867710.1| Pinus taeda isolate FBRC16 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867708.1| Pinus taeda isolate FBRC14 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867707.1| Pinus taeda isolate FBRC13 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867706.1| Pinus taeda isolate FBRC12 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867703.1| Pinus taeda isolate FBRC9 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867702.1| Pinus taeda isolate FBRC8 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867700.1| Pinus taeda isolate FBRC6 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AY867697.1| Pinus taeda isolate FBRC3 chloroplast Cu/Zn superoxide dismutase
           (sod-chl) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 688

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 147 ttggtgacacaaccaatggctgcatgtcaac 177



to top

>gb|AF434186.1|AF434186 Pinus pinaster Cu-Zn-superoxide dismutase precursor, mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 961

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 72  ttggtgacaccaccaacggctgcatgtcaac 102
           |||||||||| ||||| ||||||||||||||
Sbjct: 332 ttggtgacacaaccaatggctgcatgtcaac 362



to top

>gb|AF056621.1|AF056621 Medicago sativa putative Cu/Zn superoxide dismutase precursor,
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 900

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 293 gatgatcttggcaagggtggacatgagcttagcaagagcactggaaa 339
           ||||| ||||| |||||||||||||| |||||   ||||||||||||
Sbjct: 567 gatgaccttggaaagggtggacatgaacttagtttgagcactggaaa 613



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 146 gaagatgaaatccgccatgctggtgacctcggaaa 180
           |||||||||||||| ||||| |||||||| |||||
Sbjct: 420 gaagatgaaatccgtcatgcgggtgacctgggaaa 454



to top

>gb|L08253.1|TOBCCZSODM Nicotiana plumbaginifolia Cu/Zn-superoxide dismutase gene, 5' end
          Length = 2742

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 53   ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 99
            ||||||||||| || || |||||||| ||||| || |||||||||||
Sbjct: 2693 ggcttccatgtccatgcccttggtgataccacaaatggctgcatgtc 2739



to top

>gb|AY172569.1| Helianthus annuus cultivar EL64 cytosolic Cu/Zn-superoxide
           dismutase mRNA, partial cds
          Length = 221

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 269 gctgttgtcgtccatggtgatgctgatgatcttggcaagggtggacatga 318
           ||||| || ||||||| |||| ||||||||||||| ||||| || |||||
Sbjct: 169 gctgtggttgtccatgctgatcctgatgatcttggaaagggaggccatga 218



to top

>emb|AJ971949.1| Pinus pinea partial mRNA for cytosolic CuZn superoxide dismutase
           (cuZnsodcyt gene)
          Length = 250

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 47  ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactgga 106
           ||||| || |||||||| || || || |||||||| || || || |||||||||||||||
Sbjct: 11  ctccatggtttccatgttcatgcactaggtgacacaacaaatgggtgcatgtcaactgga 70

             
Query: 107 cc 108
           ||
Sbjct: 71  cc 72



to top

>gb|AC130801.16| Medicago truncatula clone mth2-12p19, complete sequence
          Length = 119328

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 308   ggtggacatgagcttagcaagagcactggaaacgctgg 345
             ||||| ||||||||||||||||  |||||||| |||||
Sbjct: 77374 ggtggtcatgagcttagcaagactactggaaatgctgg 77337



to top

>emb|X61687.1|CASOD C.amoena sod gene for Cu,Zn superoxidase dismutase
          Length = 1920

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 291  ctgatgatcttggcaagggtggacatgagcttagcaag 328
            |||||||| | |||||||||||||||||| | ||||||
Sbjct: 1295 ctgatgatttgggcaagggtggacatgagttgagcaag 1332



to top

>gb|AC158975.9| Mus musculus chromosome 18, clone RP24-192J22, complete sequence
          Length = 178651

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 165    ctggtgacctcggaaatgtgacagct 190
              ||||||||||| ||||||||||||||
Sbjct: 113393 ctggtgacctcagaaatgtgacagct 113368



to top

>gb|AF127155.1| Drosophila orena Cu-Zn superoxide dismutase (Sod) gene, exons 1 and 2
            and complete cds
          Length = 1583

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                      
Query: 287  gatgctgatgatcttggcaagggtggacatgagcttagcaag 328
            ||||| |||||||| ||||||||||| || ||||| ||||||
Sbjct: 1468 gatgccgatgatctcggcaagggtggccacgagctgagcaag 1509



to top

>gb|AY754566.1| Drosophila miranda strain MSH22 superoxide dismutase (Sod) gene,
           exons 1, 2 and partial cds
          Length = 721

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 99
           ||||| |||||||||||||   | || |||| ||||||||||||||||||
Sbjct: 479 cacggattccatgtgcacgagttcggggacaacaccaacggctgcatgtc 528



to top

>gb|AF170297.1|AF170297 Manihot esculenta copper/zinc-superoxide dismutase mRNA, complete
           cds
          Length = 801

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 71  cttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccc 120
           ||||| ||||| || ||||| |||||||||||||| || ||||| |||||
Sbjct: 199 cttggagacacaacaaacggttgcatgtcaactgggccacactttaaccc 248



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 291 ctgatgatcttggcaagggtggacatga 318
           ||||||||||||||| ||| ||||||||
Sbjct: 419 ctgatgatcttggcaggggaggacatga 446



to top

>gb|AF021826.1|AF021826 Drosophila guttifera superoxide dismutase (Sod) gene, partial cds
          Length = 960

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 296 gatcttggcaagggtggacatgagcttagcaaga 329
           ||||| |||||||||||||||||| | |||||||
Sbjct: 867 gatctcggcaagggtggacatgagttgagcaaga 900



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 112
           ||||||||||||||||   |||| |||| ||| || |||||||||||  ||||||| || 
Sbjct: 624 ggcttccatgtgcacgagtttggcgacaacacaaatggctgcatgtcgtctggaccacat 683

                
Query: 113 ttcaa 117
           |||||
Sbjct: 684 ttcaa 688



to top

>gb|AC119259.15| Mus musculus chromosome 18, clone RP24-285N19, complete sequence
          Length = 169310

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 165   ctggtgacctcggaaatgtgacagct 190
             ||||||||||| ||||||||||||||
Sbjct: 10079 ctggtgacctcagaaatgtgacagct 10054



to top

>gb|U47873.1|DPU47873 Drosophila persimilis NDSSC 14011-0111.2 Cu,Zn superoxide dismutase
           (Sod) gene, partial cds
          Length = 721

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 99
           ||||| |||||||||||||   | || |||| ||||||||||||||||||
Sbjct: 479 cacggattccatgtgcacgagttcggggacaacaccaacggctgcatgtc 528



to top

>gb|U47872.1|DPU47872 Drosophila pseudoobscura bogotana NDSSC 14011-0121.69 Cu,Zn
           superoxide dismutase (Sod) gene, partial cds
          Length = 720

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 99
           ||||| |||||||||||||   | || |||| ||||||||||||||||||
Sbjct: 478 cacggattccatgtgcacgagttcggggacaacaccaacggctgcatgtc 527



to top

>gb|U47871.1|DPU47871 Drosophila pseudoobscura pseudoobscura NDSSC 14011-0121.43 Cu,Zn
           superoxide dismutase (Sod) gene, partial cds
          Length = 721

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 99
           ||||| |||||||||||||   | || |||| ||||||||||||||||||
Sbjct: 479 cacggattccatgtgcacgagttcggggacaacaccaacggctgcatgtc 528



to top

>gb|U47870.1|DMU47870 Drosophila miranda NDSSC 14011-0101.1 Cu,Zn superoxide dismutase
           (Sod) gene, partial cds
          Length = 721

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 99
           ||||| |||||||||||||   | || |||| ||||||||||||||||||
Sbjct: 479 cacggattccatgtgcacgagttcggggacaacaccaacggctgcatgtc 528



to top

>gb|U47869.1|DBU47869 Drosophila bifasciata NDSSC 14012-0181.0 Cu,Zn superoxide dismutase
           (Sod) gene, partial cds
          Length = 739

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 99
           ||||| |||||||||||||   | || |||| ||||||||||||||||||
Sbjct: 497 cacggattccatgtgcacgagttcggggacaacaccaacggctgcatgtc 546



to top

>gb|L36229.1|IPBCCZS Ipomoea batatas cytosolic Cu/Zn-superoxide dismutase gene, complete
            cds
          Length = 3950

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 308  ggtggacatgagcttagcaagagcactggaaacgctgg 345
            ||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 2862 ggtggccatgagctcagcaaaagcactggaaatgctgg 2899



to top

>gb|BT012694.1| Lycopersicon esculentum clone 113564F, mRNA sequence
          Length = 1048

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 148 agatgaaatccgccatgctggtgacctcggaaa 180
           |||||||||||| ||||| |||||||| |||||
Sbjct: 461 agatgaaatccgtcatgcgggtgacctgggaaa 493



to top

>gb|AF385581.2| Dichanthelium lanuginosum copper/zinc superoxide dismutase
           precursor (SOD1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 643

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 72  ttggtgacaccaccaacggctgcatgtcaactggaccgcacttcaaccc 120
           |||||||||||||||| || ||||| || || ||||| || ||||||||
Sbjct: 327 ttggtgacaccaccaatggatgcatatcgacaggaccacatttcaaccc 375



to top

>emb|X14041.1|LECHSOD Tomato mRNA for chloroplast Cu-Zn superoxide dismutase (SOD)
          Length = 1033

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 148 agatgaaatccgccatgctggtgacctcggaaa 180
           |||||||||||| ||||| |||||||| |||||
Sbjct: 445 agatgaaatccgtcatgcgggtgacctgggaaa 477



to top

>emb|X13831.1|DVSOD Drosophila sod gene for Cu-Zn superoxide dismutase (EC 1.15.1.1)
          Length = 2103

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 112
           |||||||||||||| |   | || |||| |||||| |||||||||||  | |||||||||
Sbjct: 830 ggcttccatgtgcatgagttcggcgacaacaccaatggctgcatgtcgtcgggaccgcac 889

                
Query: 113 ttcaa 117
           |||||
Sbjct: 890 ttcaa 894



to top

>gb|AY081436.1| Drosophila guttifera superoxide dismutase (Sod) gene, partial cds
          Length = 282

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 112
           ||||||||||||||||   |||| |||| ||| || |||||||||||  ||||||| || 
Sbjct: 49  ggcttccatgtgcacgagtttggcgacaacacaaatggctgcatgtcgtctggaccacat 108

                
Query: 113 ttcaa 117
           |||||
Sbjct: 109 ttcaa 113



to top

>gb|AY081435.1| Drosophila flexa superoxide dismutase (Sod) gene, partial cds
          Length = 253

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           ||||||||||||||||| |   |||| ||||  || || |||||||||||  ||||||||
Sbjct: 46  cacggcttccatgtgcatgagtttggggacaatacgaatggctgcatgtcgtctggaccg 105

                
Query: 110 cactt 114
           |||||
Sbjct: 106 cactt 110



to top

>gb|AY081434.1| Drosophila ornatipennis superoxide dismutase (Sod) gene, partial
          cds
          Length = 282

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                               
Query: 47 ctccacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtc 99
          ||||| ||||||||||||||||   |||| |||| ||| || |||||||||||
Sbjct: 43 ctccatggcttccatgtgcacgagtttggcgacaacacaaatggctgcatgtc 95



to top

>gb|AY081433.1| Drosophila nannoptera superoxide dismutase (Sod) gene, partial cds
          Length = 282

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 112
           ||||||||||||||||   ||||||| | ||| || ||||| |||||  |||||||||| 
Sbjct: 49  ggcttccatgtgcacgagtttggtgataacacgaatggctgtatgtccgctggaccgcat 108

                
Query: 113 ttcaa 117
           |||||
Sbjct: 109 ttcaa 113



to top

>dbj|D49486.1| Solidago canadensis var. scabra mRNA for copper/zinc-superoxide
           dismutase precursor, complete cds, clone: SAcSODpl
          Length = 820

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 289 tgctgatgatcttggcaagggtggacatgagcttagc 325
           ||||||||| || || |||||||| ||||||||||||
Sbjct: 579 tgctgatgacctcggaaagggtggtcatgagcttagc 615



to top

>ref|NM_143372.1| Drosophila melanogaster huntingtin CG9995-RA (huntingtin), mRNA
          Length = 11579

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 283  tggtgatgctgatgatcttgg 303
            |||||||||||||||||||||
Sbjct: 5926 tggtgatgctgatgatcttgg 5906



to top

>gb|AC007827.5|AC007827 Drosophila melanogaster, chromosome 3R, region 98E-98E, BAC clone
              BACR10P23, complete sequence
          Length = 180946

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 283    tggtgatgctgatgatcttgg 303
              |||||||||||||||||||||
Sbjct: 104069 tggtgatgctgatgatcttgg 104049



to top

>gb|AY754565.1| Drosophila affinis superoxide dismutase (Sod) gene, exons 1, 2 and
           partial cds
          Length = 698

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 60/73 (82%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           ||||| |||||||||||||   | || |||| ||||||||| ||||||||  | || || 
Sbjct: 477 cacggattccatgtgcacgagttcggggacaacaccaacggatgcatgtcgtcaggcccc 536

                        
Query: 110 cacttcaaccccg 122
           |||||||||||||
Sbjct: 537 cacttcaaccccg 549



to top

>gb|AF147779.1|AF147779 Drosophila melanogaster Huntington disease protein homolog (Hsap\HD)
             gene, complete cds
          Length = 43125

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 283   tggtgatgctgatgatcttgg 303
             |||||||||||||||||||||
Sbjct: 22957 tggtgatgctgatgatcttgg 22937



to top

>gb|AF146362.1|AF146362 Drosophila melanogaster Huntington disease protein homolog (Hsap\HD)
            mRNA, complete cds
          Length = 11579

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 283  tggtgatgctgatgatcttgg 303
            |||||||||||||||||||||
Sbjct: 5926 tggtgatgctgatgatcttgg 5906



to top

>gb|AF177386.1|AF177386 Drosophila melanogaster huntingtin homolog mRNA, complete cds
          Length = 11572

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 283  tggtgatgctgatgatcttgg 303
            |||||||||||||||||||||
Sbjct: 5904 tggtgatgctgatgatcttgg 5884



to top

>gb|AE003766.2| Drosophila melanogaster chromosome 3R, section 104 of 118 of the complete
              sequence
          Length = 232302

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 283    tggtgatgctgatgatcttgg 303
              |||||||||||||||||||||
Sbjct: 146996 tggtgatgctgatgatcttgg 146976



to top

>emb|X77175.1|LESOD1 L.esculentum (cherry tomato) SOD Cp;Le:1 gene (part 1)
          Length = 3676

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 148  agatgaaatccgccatgctggtgacctcggaaa 180
            |||||||||||| ||||| |||||||| |||||
Sbjct: 2238 agatgaaatccgtcatgcgggtgacctgggaaa 2270



to top

>gb|U39445.1|DBU39445 Drosophila busckii Cu,Zn superoxide dismutase (Sod) and unknown
           protein genes, partial cds
          Length = 1177

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 53  ggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccgcac 112
           ||||||||||||||||   |||| |||| ||| || |||||||||||  |||| || |||
Sbjct: 459 ggcttccatgtgcacgaatttggcgacaacacaaatggctgcatgtcgtctggcccccac 518

                
Query: 113 ttcaa 117
           |||||
Sbjct: 519 ttcaa 523



to top

>gb|M37151.1|TOMSODB Tomato superoxide dismutase (SOD) mRNA, complete cds
          Length = 1034

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 148 agatgaaatccgccatgctggtgacctcggaaa 180
           |||||||||||| ||||| |||||||| |||||
Sbjct: 445 agatgaaatccgtcatgcgggtgacctgggaaa 477



to top

>gb|DQ497636.1| Thermoascus aurantiacus var. levisporus Cu,Zn-superoxide dismutase
           (CZSOD-1) mRNA, complete cds
          Length = 705

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 74  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 121
           ||||||| ||||||||||||||  ||  | || |||||||||||||||
Sbjct: 154 ggtgacaacaccaacggctgcacctccgccggcccgcacttcaacccc 201



to top

>gb|DQ226932.1| Boechera divaricarpa isolate SLW-E-A10 mRNA sequence
          Length = 519

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 305 aagggtggacatgagcttag 324
           ||||||||||||||||||||
Sbjct: 418 aagggtggacatgagcttag 437



to top

>gb|AY566699.1| Citrullus lanatus copper-zinc superoxide dismutase (CuZn-SOD II)
           mRNA, partial cds
          Length = 444

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 149 gatgaaatccgccatgctggtgacctcggaaa 180
           ||||||||||| ||||| |||||||| |||||
Sbjct: 227 gatgaaatccgtcatgcgggtgacctgggaaa 258



to top

>ref|XM_748622.1| Aspergillus fumigatus Af293 Cu,Zn superoxide dismutase SOD1
           (Afu5g09240) partial mRNA
          Length = 477

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 74  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 121
           ||||||| ||||||||||||||  ||  |||| || ||||||||||||
Sbjct: 166 ggtgacaacaccaacggctgcacctccgctggtcctcacttcaacccc 213



to top

>ref|XM_385171.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG04995.1)
            partial mRNA
          Length = 3447

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 72   ttggtgacaccaccaacggc 91
            ||||||||||||||||||||
Sbjct: 1547 ttggtgacaccaccaacggc 1528



to top

>gb|AC121893.3| Mus musculus BAC clone RP24-157C12 from chromosome 16, complete
             sequence
          Length = 137384

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 530   ctactctgaactttcatatc 549
             ||||||||||||||||||||
Sbjct: 50575 ctactctgaactttcatatc 50556



to top

>gb|AF264031.1| Callinectes sapidus extracellular Cu, Zn-superoxide dismutase mRNA,
           complete cds
          Length = 756

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 47  ctccacggcttccatgtgca 66
           ||||||||||||||||||||
Sbjct: 350 ctccacggcttccatgtgca 369



to top

>emb|AL732596.2| Human DNA sequence from clone RP11-48D14 on chromosome X, complete
             sequence
          Length = 89677

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 491   tttttagtgtgcatcatttg 510
             ||||||||||||||||||||
Sbjct: 46530 tttttagtgtgcatcatttg 46549



to top

>ref|XM_503850.1| Yarrowia lipolytica CLIB122, YALI0E12133g predicted mRNA
          Length = 465

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 72  ttggtgacaccaccaacggctgca 95
           ||||||||| ||||||||||||||
Sbjct: 152 ttggtgacaacaccaacggctgca 175



to top

>emb|Y11280.1|AVLEBIO A.vinelandii yoh-1, ibpB, cynR, leuC, leuD, leuB, asd, usg-1 genes
          Length = 8784

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 430  cttgaaggacaccgacttgc 449
            ||||||||||||||||||||
Sbjct: 7908 cttgaaggacaccgacttgc 7889



to top

>emb|BX842646.1| Bdellovibrio bacteriovorus complete genome, strain HD100; segment 1/11
          Length = 349761

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 275   gtcgtccatggtgatgctga 294
             ||||||||||||||||||||
Sbjct: 67527 gtcgtccatggtgatgctga 67546



to top

>emb|AJ002604.1|PSAJ2604 Pinus sylvestris mRNA for novel high pI CuZn-superoxide dismutase
          Length = 1038

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 292 tgatgatcttggcaagggtggacatgagcttagcaa 327
           |||||| |||||||  |||||||||||||| |||||
Sbjct: 360 tgatgaccttggcagaggtggacatgagctaagcaa 395



to top

>emb|AJ307586.1|PSY307586 Pinus sylvestris mRNA for superoxide dismutase (sod gene)
          Length = 1072

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 292 tgatgatcttggcaagggtggacatgagcttagcaa 327
           |||||| |||||||  |||||||||||||| |||||
Sbjct: 394 tgatgaccttggcagaggtggacatgagctaagcaa 429



to top

>emb|AJ305146.1|PAN305146 Podospora anserina sod1 gene for copper/zinc superoxide dismutase,
           exons 1-4
          Length = 1586

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 72  ttggtgacaccaccaacggctgca 95
           ||||||||| ||||||||||||||
Sbjct: 604 ttggtgacaacaccaacggctgca 627



to top

>emb|AJ278668.1|PTR278668 Populus tremula x Populus tremuloides chloroplast mRNA for putative
           CuZn-superoxide dismutase (cp-SOD 1 gene)
          Length = 1029

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 149 gatgaaatccgccatgctggtgacctcggaaa 180
           ||||||||||| ||||| |||||||| |||||
Sbjct: 411 gatgaaatccgtcatgcgggtgacctgggaaa 442



to top

>gb|AF401280.1| Aspergillus flavus Cu,Zn-superoxide dismutase mRNA, partial cds
          Length = 463

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 74  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 121
           ||||||| ||||||||||||||  ||  |||| || ||||||||||||
Sbjct: 152 ggtgacaacaccaacggctgcacctccgctggccctcacttcaacccc 199



to top

>gb|AC091201.4| Drosophila melanogaster 3L BAC RP98-47H5 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 187000

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 549    cactgtcatttggctttttg 568
              ||||||||||||||||||||
Sbjct: 176514 cactgtcatttggctttttg 176533



to top

>dbj|AB226266.1| Aspergillus oryzae cDNA, contig sequence: AoEST3125
          Length = 761

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 74  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 121
           ||||||| ||||||||||||||  ||  |||| || ||||||||||||
Sbjct: 217 ggtgacaacaccaacggctgcacctccgctggccctcacttcaacccc 264



to top

>dbj|AB223448.1| Aspergillus oryzae cDNA, contig sequence: AoEST0280
          Length = 779

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 74  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 121
           ||||||| ||||||||||||||  ||  |||| || ||||||||||||
Sbjct: 195 ggtgacaacaccaacggctgcacctccgctggccctcacttcaacccc 242



to top

>gb|AC097497.2| Homo sapiens BAC clone RP11-324J17 from 4, complete sequence
          Length = 195069

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 424  ttggcacttgaaggacaccg 443
            ||||||||||||||||||||
Sbjct: 1821 ttggcacttgaaggacaccg 1802



to top

>gb|AC079614.7| Homo sapiens BAC clone RP11-424I4 from 2, complete sequence
          Length = 131215

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 457   atctattttaaataagcaca 476
             ||||||||||||||||||||
Sbjct: 45970 atctattttaaataagcaca 45989



to top

>gb|AC021120.6| Homo sapiens BAC clone RP11-347O8 from 4, complete sequence
          Length = 193980

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 526    gctgctactctgaactttca 545
              ||||||||||||||||||||
Sbjct: 117535 gctgctactctgaactttca 117516



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 535      ctgaactttcatatcactgt 554
                ||||||||||||||||||||
Sbjct: 10788198 ctgaactttcatatcactgt 10788217



to top

>gb|AC140006.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNAa0090D11, complete sequence
          Length = 115403

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 72    ttggtgacaccaccaacggctgca 95
             |||| |||||||||||||||||||
Sbjct: 81928 ttggcgacaccaccaacggctgca 81905



to top

>gb|AY223820.1| Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in
             B-cells 1 (p105) (NFKB1) gene, complete cds
          Length = 117359

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 526   gctgctactctgaactttca 545
             ||||||||||||||||||||
Sbjct: 42395 gctgctactctgaactttca 42414



to top

>gb|AC104474.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0024O21, complete sequence
          Length = 155651

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 72    ttggtgacaccaccaacggctgca 95
             |||| |||||||||||||||||||
Sbjct: 56525 ttggcgacaccaccaacggctgca 56502



to top

>dbj|AP004556.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
            clone:P0026A08
          Length = 171272

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 535  ctgaactttcatatcactgt 554
            ||||||||||||||||||||
Sbjct: 1983 ctgaactttcatatcactgt 2002



to top

>dbj|AP005415.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBa0091M20
          Length = 132976

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 535   ctgaactttcatatcactgt 554
             ||||||||||||||||||||
Sbjct: 85330 ctgaactttcatatcactgt 85349



to top

>gb|AF213884.1|AF213884S1 Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in
              B-cells 1 (NFKB1) gene, complete cds
          Length = 190000

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 526    gctgctactctgaactttca 545
              ||||||||||||||||||||
Sbjct: 107343 gctgctactctgaactttca 107362



to top

>gb|AF128886.1|AF128886 Aspergillus fumigatus Cu,Zn superoxide dismutase mRNA, complete cds
          Length = 465

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 74  ggtgacaccaccaacggctgcatgtcaactggaccgcacttcaacccc 121
           ||||||| ||||||||||||||  ||  |||| || ||||||||||||
Sbjct: 154 ggtgacaacaccaacggctgcacctccgctggtcctcacttcaacccc 201



to top

>dbj|AK073785.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033068D19, full
           insert sequence
          Length = 801

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 72  ttggtgacaccaccaacggctgca 95
           |||| |||||||||||||||||||
Sbjct: 172 ttggcgacaccaccaacggctgca 195



to top

>gb|AF021827.1|AF021827 Scaptomyza adusta superoxide dismutase (Sod) mRNA, partial cds
          Length = 343

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 56/68 (82%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           |||||||||||||||||||   ||||||| |  ||||| || ||||||||  | ||||| 
Sbjct: 101 cacggcttccatgtgcacgaatttggtgataataccaatggatgcatgtcctcgggacca 160

                   
Query: 110 cacttcaa 117
           ||||||||
Sbjct: 161 cacttcaa 168



to top

>gb|AE003566.3| Drosophila melanogaster chromosome 3L, section 19 of 83 of the complete
              sequence
          Length = 251457

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 549    cactgtcatttggctttttg 568
              ||||||||||||||||||||
Sbjct: 217004 cactgtcatttggctttttg 217023



to top

>gb|AF059886.1|AF059886 Drosophila tanythrix Cu-Zn superoxide dismutase (Sod) gene, exon 2
           and partial cds
          Length = 282

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 56/68 (82%)
 Strand = Plus / Plus

                                                                       
Query: 50  cacggcttccatgtgcacgctcttggtgacaccaccaacggctgcatgtcaactggaccg 109
           ||||||||||||||||| |   |||||||||  || ||||| ||||||||  | ||||||
Sbjct: 46  cacggcttccatgtgcatgaatttggtgacaatacaaacggatgcatgtcgtcaggaccg 105

                   
Query: 110 cacttcaa 117
           || |||||
Sbjct: 106 catttcaa 113


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,428,636
Number of Sequences: 3902068
Number of extensions: 4428636
Number of successful extensions: 79293
Number of sequences better than 10.0: 252
Number of HSP's better than 10.0 without gapping: 243
Number of HSP's successfully gapped in prelim test: 11
Number of HSP's that attempted gapping in prelim test: 78655
Number of HSP's gapped (non-prelim): 611
length of query: 612
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 589
effective length of database: 17,143,297,704
effective search space: 10097402347656
effective search space used: 10097402347656
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top