ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bah63p13
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_468939.1| Oryza sativa (japonica cultivar-group), mRNA 153 7e-34
2gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 153 7e-34
3dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 153 7e-34
4gb|AC137925.2| Oryza sativa chromosome 3 BAC OSJNBb0047D08 genom... 153 7e-34
5gb|AC135226.4| Oryza sativa chromosome 3 BAC OSJNBa0037J17 genom... 153 7e-34
6dbj|AK119178.1| Oryza sativa (japonica cultivar-group) cDNA clon... 153 7e-34
7dbj|AK065820.1| Oryza sativa (japonica cultivar-group) cDNA clon... 153 7e-34
8dbj|AK060924.1| Oryza sativa (japonica cultivar-group) cDNA clon... 153 7e-34
9gb|AY107457.1| Zea mays PCO103582 mRNA sequence 48 0.032
10gb|AC152000.3| Ornithorhynchus anatinus chromosome UNK clone OAB... 48 0.032
11gb|AC155718.4| Mus musculus 10 BAC RP24-217J7 (Roswell Park Canc... 46 0.13
12gb|AC164171.5| Mus musculus 10 BAC RP24-574G7 (Roswell Park Canc... 46 0.13
13gb|AC116825.23| Mus musculus chromosome 8, clone RP24-367H14, co... 44 0.50
14ref|XM_464949.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.50
15gb|AF016494.1| Fugu rubripes gamma-aminobutyric acid receptor be... 44 0.50
16gb|AC102686.7| Mus musculus chromosome 1, clone RP24-467J24, com... 44 0.50
17ref|NM_022654.1| Mus musculus leucine-rich and death domain cont... 44 0.50
18gb|BC099686.1| Mus musculus leucine-rich and death domain contai... 44 0.50
19gb|AC102547.8| Mus musculus chromosome 7, clone RP23-134L4, comp... 44 0.50
20ref|XM_540883.2| PREDICTED: Canis familiaris similar to Akt-phos... 44 0.50
21gb|BC032202.1| Mus musculus leucine-rich and death domain contai... 44 0.50
22gb|AC114995.7| Mus musculus chromosome 8, clone RP23-171P5, comp... 44 0.50
23gb|BC056987.1| Mus musculus leucine-rich and death domain contai... 44 0.50
24gb|AC102426.6| Mus musculus chromosome 1, clone RP24-88A10, comp... 44 0.50
25emb|X81359.1|FRP55 F.rubripes p55 gene 44 0.50
26gb|AC160863.10| Mus musculus 10 BAC RP23-234F23 (Roswell Park Ca... 44 0.50
27dbj|AK156863.1| Mus musculus activated spleen cDNA, RIKEN full-l... 44 0.50
28gb|AC158236.2| Mus musculus BAC clone RP23-132B15 from chromosom... 44 0.50
29dbj|AK087880.1| Mus musculus 2 days pregnant adult female ovary ... 44 0.50
30dbj|AK004702.1| Mus musculus adult male lung cDNA, RIKEN full-le... 44 0.50
31gb|AC153937.11| Mus musculus 10 BAC RP24-458J4 (Roswell Park Can... 44 0.50
32dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.50
33gb|AC158224.6| Mus musculus chromosome 7, clone RP23-103H3, comp... 44 0.50
34gb|AF255560.1|AF255560 Notothenia coriiceps alpha tubulin mRNA, ... 44 0.50
35gb|AF274973.1|AF274973 Mus musculus PIDD mRNA, complete cds 44 0.50
36dbj|AK183598.1| Mus musculus cDNA, clone:Y0G0126H17, strand:minu... 44 0.50
37dbj|AP005398.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.50
38gb|BC089373.1| Mus musculus leucine-rich and death domain contai... 44 0.50
39dbj|AP005694.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.50
40gb|AC147500.6| Mus musculus BAC clone RP24-281C21 from chromosom... 44 0.50
41ref|NM_028317.1| Mus musculus RIKEN cDNA 2810030E01 gene (281003... 42 2.0
42gb|AC121297.20| Mus musculus chromosome 1, clone RP23-326H11, co... 42 2.0
43gb|AC152409.8| Mus musculus chromosome 1, clone RP23-395C1, comp... 42 2.0
44gb|AC105256.7| Mus musculus BAC clone RP23-413O13 from chromosom... 42 2.0
45gb|AC121933.3| Mus musculus BAC clone RP24-206I11 from chromosom... 42 2.0
46emb|AL845439.5| Human DNA sequence from clone DAQB-215D11 on chr... 42 2.0
47ref|XM_791403.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 2.0
48dbj|AB210196.1| Pan troglodytes ZNRD1, PPP1R11, RNF genes for zi... 42 2.0
49dbj|AB210195.1| Pan troglodytes ZNRD1, PPP1R11, RNF39 genes for ... 42 2.0
50dbj|AB202082.1| Homo sapiens ZNRD1, PPP1R11, RNF39 genes for zin... 42 2.0
51gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 42 2.0
52gb|AC135355.3| Mus musculus BAC clone RP24-495F22 from chromosom... 42 2.0
53dbj|AK037681.1| Mus musculus 16 days neonate thymus cDNA, RIKEN ... 42 2.0
54gb|AC148667.1| Macaca mulatta Major Histocompatibility Complex B... 42 2.0
55dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partia... 42 2.0
56gb|AC154383.2| Mus musculus BAC clone RP23-38N16 from chromosome... 42 2.0
57gb|AC116317.4| Homo sapiens BAC clone RP11-1406H17 from 4, compl... 42 2.0
58gb|AF511330.1| Sus scrofa clone UMNp513 microsatellite sequence 42 2.0
59dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility co... 42 2.0
60gb|AC153873.5| Mus musculus 10 BAC RP23-87M12 (Roswell Park Canc... 42 2.0
61dbj|AK111435.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.0
62ref|NM_209099.1| Eremothecium gossypii ADL349Wp (ADL349W), mRNA 42 2.0
63gb|BC050860.1| Mus musculus RIKEN cDNA 2810030E01 gene, mRNA (cD... 42 2.0
64gb|AC165437.5| Mus musculus chromosome 15, clone RP23-285N11, co... 42 2.0
65gb|AC144778.3| Mus musculus BAC clone RP23-278A22 from 6, comple... 42 2.0
66gb|AC166110.3| Mus musculus BAC clone RP23-130A4 from chromosome... 42 2.0
67emb|AL928589.11| Mouse DNA sequence from clone RP23-350C1 on chr... 42 2.0
68emb|AL591067.35| Mouse DNA sequence from clone RP23-333D2 on chr... 42 2.0
69gb|AC153022.1| Mus musculus 6 BAC RP23-115M13 (Roswell Park Canc... 42 2.0
70gb|AC130201.3| Mus musculus BAC clone RP24-570A9 from chromosome... 42 2.0
71gb|AC105173.10| Mus musculus chromosome 8, clone RP23-319J15, co... 40 7.7
72gb|AC167972.3| Mus musculus BAC clone RP24-73H24 from chromosome... 40 7.7
73ref|NM_175294.2| Mus musculus nuclear casein kinase and cyclin-d... 40 7.7
74gb|AC164622.3| Mus musculus BAC clone CH36-287E13 from chromosom... 40 7.7
75gb|AC134341.2| Oryza sativa (japonica cultivar-group) chromosome... 40 7.7
76ref|XM_324191.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.7
77ref|XM_614574.2| PREDICTED: Bos taurus similar to Ras-related GT... 40 7.7
78ref|XM_955301.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.7
79ref|XM_606838.2| PREDICTED: Bos taurus similar to gamma filamin ... 40 7.7
80gb|AC163346.3| Mus musculus BAC clone RP23-370A2 from chromosome... 40 7.7
81gb|AC122418.4| Mus musculus BAC clone RP24-159E6 from chromosome... 40 7.7
82gb|AC074257.5| Homo sapiens BAC clone RP11-796I2 from 7, complet... 40 7.7
83ref|XM_862106.1| PREDICTED: Canis familiaris hypothetical protei... 40 7.7
84gb|AC145474.2| Rattus norvegicus chromosome 1 clone RP32-113N8 m... 40 7.7
85gb|AC126426.3| Mus musculus BAC clone RP24-291G13 from chromosom... 40 7.7
86gb|AC133648.3| Mus musculus BAC clone RP23-291B1 from chromosome... 40 7.7
87ref|XM_818292.1| Trypanosoma brucei TREU927 hypothetical protein... 40 7.7
88ref|XM_746883.1| Aspergillus fumigatus Af293 transcription initi... 40 7.7
89gb|AC138768.3| Mus musculus BAC clone RP24-465E14 from chromosom... 40 7.7
90gb|AC122050.3| Mus musculus BAC clone RP24-457L7 from chromosome... 40 7.7
91ref|XM_804918.1| Trypanosoma cruzi strain CL Brener ribonuclease... 40 7.7
92ref|XM_805147.1| Trypanosoma cruzi strain CL Brener ribonuclease... 40 7.7
93gb|AC122043.4| Mus musculus BAC clone RP24-448C16 from chromosom... 40 7.7
94gb|AC126544.5| Homo sapiens chromosome 17, clone RP11-707O23, co... 40 7.7
95gb|AC122824.3| Mus musculus BAC clone RP23-206D5 from 13, comple... 40 7.7
96ref|XM_806298.1| Trypanosoma cruzi strain CL Brener separase (Tc... 40 7.7
97emb|CR388094.8| Zebrafish DNA sequence from clone CH211-214A5 in... 40 7.7
98gb|AC093583.3| Homo sapiens BAC clone RP13-452N2 from 7, complet... 40 7.7
99ref|XM_721979.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 7.7
100gb|AY376991.1| Litopenaeus vannamei microsatellite TUGAPv7-9.188... 40 7.7
101gb|AC148154.15| Medicago truncatula clone mth2-17a6, complete se... 40 7.7
102emb|AL592308.3| Human DNA sequence from clone RP13-610P22 on chr... 40 7.7
103ref|NM_205332.3| Gallus gallus CCCTC-binding factor (zinc finger... 40 7.7
104emb|AL357503.12| Human DNA sequence from clone RP5-899C14 on chr... 40 7.7
105emb|AL356986.11| Human DNA sequence from clone RP11-395N6 on chr... 40 7.7
106emb|AL139254.23| Human DNA sequence from clone RP4-749H3 on chro... 40 7.7
107gb|AC090419.7| Homo sapiens chromosome 17, clone CTD-2107B16, co... 40 7.7
108emb|Z22605.1|GDCTCFPRA G.domesticus CTCF protein mRNA 40 7.7
109emb|X65515.1|AVFIXABCX A.vinelandii genes fixA, fixB, fixC, fixX... 40 7.7
110emb|AL645943.19| Mouse DNA sequence from clone RP23-130E22 on ch... 40 7.7
111gb|AC157512.3| Mus musculus BAC clone RP24-399L6 from chromosome... 40 7.7
112gb|AC093122.12| Homo sapiens 12 BAC RP11-317E2 (Roswell Park Can... 40 7.7
113gb|AC161266.2| Mus musculus BAC clone RP23-231B13 from chromosom... 40 7.7
114emb|BX088698.22| Mouse DNA sequence from clone RP23-309D15 on ch... 40 7.7
115gb|AC156247.2| Xenopus tropicalis clone ISB1-181M9, complete seq... 40 7.7
116dbj|AK078816.1| Mus musculus 16 days embryo lung cDNA, RIKEN ful... 40 7.7
117dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
118dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
119gb|AC155655.8| Mus musculus 6 BAC RP24-66L18 (Roswell Park Cance... 40 7.7
120gb|AC133521.3| Mus musculus BAC clone RP23-189F22 from chromosom... 40 7.7
121ref|XM_223992.3| PREDICTED: Rattus norvegicus sal-like 2 (Drosop... 40 7.7
122gb|AY035782.1| Rhipicephalus appendiculatus serine proteinase in... 40 7.7
123dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g... 40 7.7
124gb|AC153862.8| Mus musculus 10 BAC RP23-353K11 (Roswell Park Can... 40 7.7
125dbj|AP003798.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
126gb|AC155924.2| Mus musculus BAC clone RP24-366C10 from 12, compl... 40 7.7
127gb|AC140442.4| Mus musculus BAC clone RP24-106P1 from 12, comple... 40 7.7
128gb|AC132132.4| Mus musculus BAC clone RP23-235K2 from 8, complet... 40 7.7
129gb|AC154630.2| Mus musculus BAC clone RP23-319C8 from 9, complet... 40 7.7
130gb|AC169186.4| Erinaceus europaeus, clone XX-29994857F23, comple... 40 7.7
131emb|BX005242.6| Zebrafish DNA sequence from clone DKEY-67N17 in ... 40 7.7
132gb|AC005829.1|AC005829 Homo sapiens chromosome 17, clone hRPK.25... 40 7.7
133gb|AC174447.2| Mus musculus BAC clone RP23-377C21 from chromosom... 40 7.7
134gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome 40 7.7
135gb|AE017221.1| Thermus thermophilus HB27, complete genome 40 7.7
136gb|AC127691.4| Mus musculus BAC clone RP24-216M10 from 9, comple... 40 7.7
137gb|AC125102.4| Mus musculus BAC clone RP24-208N22 from 6, comple... 40 7.7
138gb|U27180.1|TAU27180 Thermus aquaticus orotate phosphoribosyltra... 40 7.7
139gb|AC163040.5| Mus musculus BAC clone RP23-71C23 from chromosome... 40 7.7
140emb|AL603706.13| Mouse DNA sequence from clone RP23-407I21 on ch... 40 7.7
141emb|AL772258.9| Mouse DNA sequence from clone RP23-337P24 on chr... 40 7.7
142emb|AL928939.6| Mouse DNA sequence from clone RP23-294B13 on chr... 40 7.7
143gb|AC127032.8| Homo sapiens chromosome 17, clone RP11-162O14, co... 40 7.7
144dbj|D83330.1| Thermus thermophilus DNA for orotate phosphoribosy... 40 7.7
145emb|AL645928.9| Mouse DNA sequence from clone RP23-185J21 on chr... 40 7.7 
>ref|XM_468939.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 981

 Score =  153 bits (77), Expect = 7e-34
 Identities = 155/181 (85%)
 Strand = Plus / Plus

                                                                       
Query: 390 agttcgcggcaccaccggagggatacatcgagccggcgtcattcgacgagttgccgccgg 449
           |||||||| | || |||||||| ||| | ||||||||  | ||||||||| |||| ||||
Sbjct: 305 agttcgcgtcgccgccggagggctacgtggagccggccccgttcgacgagctgcccccgg 364

                                                                       
Query: 450 aatcaccagaggacgtggcagcagcgtacgagtcgctctacgggccggccttcagcggcg 509
           | || || |||||||||||||| ||||||||  ||||||||||||||||||| |||||||
Sbjct: 365 agtcgcccgaggacgtggcagcggcgtacgaagcgctctacgggccggcctttagcggcg 424

                                                                       
Query: 510 agtcgttgatggggaacaacgtgttcgaggtgaaagttgtggatcccgtcgacatggacc 569
           || || | ||||| |||||||| |||||||| || || ||||||||||||||||||||||
Sbjct: 425 agacggtcatgggcaacaacgtcttcgaggtcaaggtggtggatcccgtcgacatggacc 484

            
Query: 570 g 570
           |
Sbjct: 485 g 485
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  153 bits (77), Expect = 7e-34
 Identities = 155/181 (85%)
 Strand = Plus / Minus

                                                                            
Query: 390      agttcgcggcaccaccggagggatacatcgagccggcgtcattcgacgagttgccgccgg 449
                |||||||| | || |||||||| ||| | ||||||||  | ||||||||| |||| ||||
Sbjct: 19228453 agttcgcgtcgccgccggagggctacgtggagccggccccgttcgacgagctgcccccgg 19228394

                                                                            
Query: 450      aatcaccagaggacgtggcagcagcgtacgagtcgctctacgggccggccttcagcggcg 509
                | || || |||||||||||||| ||||||||  ||||||||||||||||||| |||||||
Sbjct: 19228393 agtcgcccgaggacgtggcagcggcgtacgaagcgctctacgggccggcctttagcggcg 19228334

                                                                            
Query: 510      agtcgttgatggggaacaacgtgttcgaggtgaaagttgtggatcccgtcgacatggacc 569
                || || | ||||| |||||||| |||||||| || || ||||||||||||||||||||||
Sbjct: 19228333 agacggtcatgggcaacaacgtcttcgaggtcaaggtggtggatcccgtcgacatggacc 19228274

                 
Query: 570      g 570
                |
Sbjct: 19228273 g 19228273
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  153 bits (77), Expect = 7e-34
 Identities = 155/181 (85%)
 Strand = Plus / Minus

                                                                            
Query: 390      agttcgcggcaccaccggagggatacatcgagccggcgtcattcgacgagttgccgccgg 449
                |||||||| | || |||||||| ||| | ||||||||  | ||||||||| |||| ||||
Sbjct: 19222494 agttcgcgtcgccgccggagggctacgtggagccggccccgttcgacgagctgcccccgg 19222435

                                                                            
Query: 450      aatcaccagaggacgtggcagcagcgtacgagtcgctctacgggccggccttcagcggcg 509
                | || || |||||||||||||| ||||||||  ||||||||||||||||||| |||||||
Sbjct: 19222434 agtcgcccgaggacgtggcagcggcgtacgaagcgctctacgggccggcctttagcggcg 19222375

                                                                            
Query: 510      agtcgttgatggggaacaacgtgttcgaggtgaaagttgtggatcccgtcgacatggacc 569
                || || | ||||| |||||||| |||||||| || || ||||||||||||||||||||||
Sbjct: 19222374 agacggtcatgggcaacaacgtcttcgaggtcaaggtggtggatcccgtcgacatggacc 19222315

                 
Query: 570      g 570
                |
Sbjct: 19222314 g 19222314
to top
>gb|AC137925.2| Oryza sativa chromosome 3 BAC OSJNBb0047D08 genomic sequence, complete
             sequence
          Length = 140507

 Score =  153 bits (77), Expect = 7e-34
 Identities = 155/181 (85%)
 Strand = Plus / Minus

                                                                         
Query: 390   agttcgcggcaccaccggagggatacatcgagccggcgtcattcgacgagttgccgccgg 449
             |||||||| | || |||||||| ||| | ||||||||  | ||||||||| |||| ||||
Sbjct: 12614 agttcgcgtcgccgccggagggctacgtggagccggccccgttcgacgagctgcccccgg 12555

                                                                         
Query: 450   aatcaccagaggacgtggcagcagcgtacgagtcgctctacgggccggccttcagcggcg 509
             | || || |||||||||||||| ||||||||  ||||||||||||||||||| |||||||
Sbjct: 12554 agtcgcccgaggacgtggcagcggcgtacgaagcgctctacgggccggcctttagcggcg 12495

                                                                         
Query: 510   agtcgttgatggggaacaacgtgttcgaggtgaaagttgtggatcccgtcgacatggacc 569
             || || | ||||| |||||||| |||||||| || || ||||||||||||||||||||||
Sbjct: 12494 agacggtcatgggcaacaacgtcttcgaggtcaaggtggtggatcccgtcgacatggacc 12435

              
Query: 570   g 570
             |
Sbjct: 12434 g 12434
to top
>gb|AC135226.4| Oryza sativa chromosome 3 BAC OSJNBa0037J17 genomic sequence, complete
             sequence
          Length = 150137

 Score =  153 bits (77), Expect = 7e-34
 Identities = 155/181 (85%)
 Strand = Plus / Plus

                                                                         
Query: 390   agttcgcggcaccaccggagggatacatcgagccggcgtcattcgacgagttgccgccgg 449
             |||||||| | || |||||||| ||| | ||||||||  | ||||||||| |||| ||||
Sbjct: 15009 agttcgcgtcgccgccggagggctacgtggagccggccccgttcgacgagctgcccccgg 15068

                                                                         
Query: 450   aatcaccagaggacgtggcagcagcgtacgagtcgctctacgggccggccttcagcggcg 509
             | || || |||||||||||||| ||||||||  ||||||||||||||||||| |||||||
Sbjct: 15069 agtcgcccgaggacgtggcagcggcgtacgaagcgctctacgggccggcctttagcggcg 15128

                                                                         
Query: 510   agtcgttgatggggaacaacgtgttcgaggtgaaagttgtggatcccgtcgacatggacc 569
             || || | ||||| |||||||| |||||||| || || ||||||||||||||||||||||
Sbjct: 15129 agacggtcatgggcaacaacgtcttcgaggtcaaggtggtggatcccgtcgacatggacc 15188

              
Query: 570   g 570
             |
Sbjct: 15189 g 15189
to top
>dbj|AK119178.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-G07, full
           insert sequence
          Length = 1281

 Score =  153 bits (77), Expect = 7e-34
 Identities = 155/181 (85%)
 Strand = Plus / Plus

                                                                       
Query: 390 agttcgcggcaccaccggagggatacatcgagccggcgtcattcgacgagttgccgccgg 449
           |||||||| | || |||||||| ||| | ||||||||  | ||||||||| |||| ||||
Sbjct: 354 agttcgcgtcgccgccggagggctacgtggagccggccccgttcgacgagctgcccccgg 413

                                                                       
Query: 450 aatcaccagaggacgtggcagcagcgtacgagtcgctctacgggccggccttcagcggcg 509
           | || || |||||||||||||| ||||||||  ||||||||||||||||||| |||||||
Sbjct: 414 agtcgcccgaggacgtggcagcggcgtacgaagcgctctacgggccggcctttagcggcg 473

                                                                       
Query: 510 agtcgttgatggggaacaacgtgttcgaggtgaaagttgtggatcccgtcgacatggacc 569
           || || | ||||| |||||||| |||||||| || || ||||||||||||||||||||||
Sbjct: 474 agacggtcatgggcaacaacgtcttcgaggtcaaggtggtggatcccgtcgacatggacc 533

            
Query: 570 g 570
           |
Sbjct: 534 g 534
to top
>dbj|AK065820.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013042D13, full
           insert sequence
          Length = 1296

 Score =  153 bits (77), Expect = 7e-34
 Identities = 155/181 (85%)
 Strand = Plus / Plus

                                                                       
Query: 390 agttcgcggcaccaccggagggatacatcgagccggcgtcattcgacgagttgccgccgg 449
           |||||||| | || |||||||| ||| | ||||||||  | ||||||||| |||| ||||
Sbjct: 360 agttcgcgtcgccgccggagggctacgtggagccggccccgttcgacgagctgcccccgg 419

                                                                       
Query: 450 aatcaccagaggacgtggcagcagcgtacgagtcgctctacgggccggccttcagcggcg 509
           | || || |||||||||||||| ||||||||  ||||||||||||||||||| |||||||
Sbjct: 420 agtcgcccgaggacgtggcagcggcgtacgaagcgctctacgggccggcctttagcggcg 479

                                                                       
Query: 510 agtcgttgatggggaacaacgtgttcgaggtgaaagttgtggatcccgtcgacatggacc 569
           || || | ||||| |||||||| |||||||| || || ||||||||||||||||||||||
Sbjct: 480 agacggtcatgggcaacaacgtcttcgaggtcaaggtggtggatcccgtcgacatggacc 539

            
Query: 570 g 570
           |
Sbjct: 540 g 540
to top
>dbj|AK060924.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-H10, full
           insert sequence
          Length = 1201

 Score =  153 bits (77), Expect = 7e-34
 Identities = 155/181 (85%)
 Strand = Plus / Plus

                                                                       
Query: 390 agttcgcggcaccaccggagggatacatcgagccggcgtcattcgacgagttgccgccgg 449
           |||||||| | || |||||||| ||| | ||||||||  | ||||||||| |||| ||||
Sbjct: 364 agttcgcgtcgccgccggagggctacgtggagccggccccgttcgacgagctgcccccgg 423

                                                                       
Query: 450 aatcaccagaggacgtggcagcagcgtacgagtcgctctacgggccggccttcagcggcg 509
           | || || |||||||||||||| ||||||||  ||||||||||||||||||| |||||||
Sbjct: 424 agtcgcccgaggacgtggcagcggcgtacgaagcgctctacgggccggcctttagcggcg 483

                                                                       
Query: 510 agtcgttgatggggaacaacgtgttcgaggtgaaagttgtggatcccgtcgacatggacc 569
           || || | ||||| |||||||| |||||||| || || ||||||||||||||||||||||
Sbjct: 484 agacggtcatgggcaacaacgtcttcgaggtcaaggtggtggatcccgtcgacatggacc 543

            
Query: 570 g 570
           |
Sbjct: 544 g 544
to top
>gb|AY107457.1| Zea mays PCO103582 mRNA sequence
          Length = 840

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 499 cttcagcggcgagtcgttgatggggaacaacgtgttcgaggtgaaagttgtggatcccgt 558
           ||||||||||||| | ||| |||||||||| || || ||||| || || || || ||| |
Sbjct: 8   cttcagcggcgagacattgctggggaacaatgtctttgaggtcaaggtggtcgaccccat 67

                       
Query: 559 cgacatggaccg 570
           ||||||||||||
Sbjct: 68  cgacatggaccg 79
to top
>gb|AC152000.3| Ornithorhynchus anatinus chromosome UNK clone OABb-501A1, complete
             sequence
          Length = 149165

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 273   aagaggatgaggaaggagaggcggagga 300
             ||||||| ||||||||||||||||||||
Sbjct: 29694 aagaggaggaggaaggagaggcggagga 29721
to top
>gb|AC155718.4| Mus musculus 10 BAC RP24-217J7 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 155643

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 270    aagaagaggatgaggaaggagaggcggagga 300
              |||||||||| ||||||||||||| ||||||
Sbjct: 152963 aagaagaggaagaggaaggagaggaggagga 152993
to top
>gb|AC164171.5| Mus musculus 10 BAC RP24-574G7 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 147660

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                             
Query: 270    aagaagaggatgaggaaggagaggcggagga 300
              |||||||||| ||||||||||||| ||||||
Sbjct: 125446 aagaagaggaagaggaaggagaggaggagga 125416
to top
>gb|AC116825.23| Mus musculus chromosome 8, clone RP24-367H14, complete sequence
          Length = 182808

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 275   gaggatgaggaaggagaggcggagga 300
             ||||||||||||||||||| ||||||
Sbjct: 40188 gaggatgaggaaggagaggaggagga 40213
to top
>ref|XM_464949.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 351

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 271 agaagaggatgaggaaggagag 292
           ||||||||||||||||||||||
Sbjct: 85  agaagaggatgaggaaggagag 64
to top
>gb|AF016494.1| Fugu rubripes gamma-aminobutyric acid receptor beta subunit gene,
             partial cds; 55kd erythrocyte membrane protein (P55),
             synaptic vesicle-associated integral membrane protein
             (VAMP-1), procollagen C-proteinase enhancer protein
             (PCOLCE) genes, complete cds; and glucose repression
             mediator protein (GRMP) gene, partial cds
          Length = 66729

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 143   gttcccgcactgttctccttccttca 168
             ||||||| ||||||||||||||||||
Sbjct: 33044 gttcccgaactgttctccttccttca 33069
to top
>gb|AC102686.7| Mus musculus chromosome 1, clone RP24-467J24, complete sequence
          Length = 156547

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 270  aagaagaggatgaggaaggaga 291
            ||||||||||||||||||||||
Sbjct: 8331 aagaagaggatgaggaaggaga 8310
to top
>ref|NM_022654.1| Mus musculus leucine-rich and death domain containing (Lrdd), mRNA
          Length = 2900

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 9    gagggagcacttctctgctcct 30
            ||||||||||||||||||||||
Sbjct: 1483 gagggagcacttctctgctcct 1504
to top
>gb|BC099686.1| Mus musculus leucine-rich and death domain containing, mRNA (cDNA
            clone IMAGE:30728077)
          Length = 3757

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 9    gagggagcacttctctgctcct 30
            ||||||||||||||||||||||
Sbjct: 1821 gagggagcacttctctgctcct 1842
to top
>gb|AC102547.8| Mus musculus chromosome 7, clone RP23-134L4, complete sequence
          Length = 220452

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 9     gagggagcacttctctgctcct 30
             ||||||||||||||||||||||
Sbjct: 33976 gagggagcacttctctgctcct 33997
to top
>ref|XM_540883.2| PREDICTED: Canis familiaris similar to Akt-phosphorylation enhancer
           (LOC483762), mRNA
          Length = 4047

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 272 gaagaggatgaggaaggagagg 293
           ||||||||||||||||||||||
Sbjct: 148 gaagaggatgaggaaggagagg 169
to top
>gb|BC032202.1| Mus musculus leucine-rich and death domain containing, mRNA (cDNA
            clone IMAGE:5342299), containing frame-shift errors
          Length = 3192

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 9    gagggagcacttctctgctcct 30
            ||||||||||||||||||||||
Sbjct: 1444 gagggagcacttctctgctcct 1465
to top
>gb|AC114995.7| Mus musculus chromosome 8, clone RP23-171P5, complete sequence
          Length = 242745

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 272    gaagaggatgaggaaggagaggcggaggat 301
              |||||||||||||||| ||||| |||||||
Sbjct: 220332 gaagaggatgaggaagaagagggggaggat 220303
to top
>gb|BC056987.1| Mus musculus leucine-rich and death domain containing, mRNA (cDNA
            clone IMAGE:6813129), partial cds
          Length = 3676

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 9    gagggagcacttctctgctcct 30
            ||||||||||||||||||||||
Sbjct: 1834 gagggagcacttctctgctcct 1855
to top
>gb|AC102426.6| Mus musculus chromosome 1, clone RP24-88A10, complete sequence
          Length = 192016

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 270   aagaagaggatgaggaaggaga 291
             ||||||||||||||||||||||
Sbjct: 65203 aagaagaggatgaggaaggaga 65224
to top
>emb|X81359.1|FRP55 F.rubripes p55 gene
          Length = 6085

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 143 gttcccgcactgttctccttccttca 168
           ||||||| ||||||||||||||||||
Sbjct: 885 gttcccgaactgttctccttccttca 910
to top
>gb|AC160863.10| Mus musculus 10 BAC RP23-234F23 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 189718

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 270    aagaagaggatgaggaaggagaggcggagg 299
              |||||||||| ||||||||||||| |||||
Sbjct: 136806 aagaagaggaggaggaaggagaggaggagg 136777
to top
>dbj|AK156863.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830103N10 product:leucine-rich and death
            domain containing, full insert sequence
          Length = 3278

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 9    gagggagcacttctctgctcct 30
            ||||||||||||||||||||||
Sbjct: 1471 gagggagcacttctctgctcct 1492
to top
>gb|AC158236.2| Mus musculus BAC clone RP23-132B15 from chromosome 8, complete sequence
          Length = 209957

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 272    gaagaggatgaggaaggagaggcggaggat 301
              |||||||||||||||| ||||| |||||||
Sbjct: 188951 gaagaggatgaggaagaagagggggaggat 188980
to top
>dbj|AK087880.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
            full-length enriched library, clone:E330035H01
            product:p53 protein induced, with death domain, full
            insert sequence
          Length = 3670

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 9    gagggagcacttctctgctcct 30
            ||||||||||||||||||||||
Sbjct: 1702 gagggagcacttctctgctcct 1723
to top
>dbj|AK004702.1| Mus musculus adult male lung cDNA, RIKEN full-length enriched
            library, clone:1200011D09 product:p53 protein induced,
            with death domain, full insert sequence
          Length = 3318

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 9    gagggagcacttctctgctcct 30
            ||||||||||||||||||||||
Sbjct: 1426 gagggagcacttctctgctcct 1447
to top
>gb|AC153937.11| Mus musculus 10 BAC RP24-458J4 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 195695

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 270   aagaagaggatgaggaaggagaggcggagg 299
             |||||||||| ||||||||||||| |||||
Sbjct: 43063 aagaagaggaggaggaaggagaggaggagg 43034
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 271      agaagaggatgaggaaggagag 292
                ||||||||||||||||||||||
Sbjct: 10452485 agaagaggatgaggaaggagag 10452464
to top
>gb|AC158224.6| Mus musculus chromosome 7, clone RP23-103H3, complete sequence
          Length = 224545

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 9     gagggagcacttctctgctcct 30
             ||||||||||||||||||||||
Sbjct: 90007 gagggagcacttctctgctcct 89986
to top
>gb|AF255560.1|AF255560 Notothenia coriiceps alpha tubulin mRNA, partial cds
          Length = 1062

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 272 gaagaggatgaggaaggagagg 293
           ||||||||||||||||||||||
Sbjct: 946 gaagaggatgaggaaggagagg 967
to top
>gb|AF274973.1|AF274973 Mus musculus PIDD mRNA, complete cds
          Length = 2900

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 9    gagggagcacttctctgctcct 30
            ||||||||||||||||||||||
Sbjct: 1483 gagggagcacttctctgctcct 1504
to top
>dbj|AK183598.1| Mus musculus cDNA, clone:Y0G0126H17, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000026580, based on BLAT search
          Length = 410

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 9   gagggagcacttctctgctcct 30
           ||||||||||||||||||||||
Sbjct: 230 gagggagcacttctctgctcct 251
to top
>dbj|AP005398.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0669G10
          Length = 133372

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 271   agaagaggatgaggaaggagag 292
             ||||||||||||||||||||||
Sbjct: 94907 agaagaggatgaggaaggagag 94886
to top
>gb|BC089373.1| Mus musculus leucine-rich and death domain containing, mRNA (cDNA
            clone IMAGE:30608420)
          Length = 3325

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 9    gagggagcacttctctgctcct 30
            ||||||||||||||||||||||
Sbjct: 1455 gagggagcacttctctgctcct 1476
to top
>dbj|AP005694.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0063E14
          Length = 174415

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 271   agaagaggatgaggaaggagag 292
             ||||||||||||||||||||||
Sbjct: 33653 agaagaggatgaggaaggagag 33632
to top
>gb|AC147500.6| Mus musculus BAC clone RP24-281C21 from chromosome 8, complete sequence
          Length = 185450

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 270    aagaagaggatgaggaaggaga 291
              ||||||||||||||||||||||
Sbjct: 146329 aagaagaggatgaggaaggaga 146350
to top
>ref|NM_028317.1| Mus musculus RIKEN cDNA 2810030E01 gene (2810030E01Rik), mRNA
          Length = 2985

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 272  gaagaggatgaggaaggagaggcggagga 300
            |||||||| ||||||||||||| ||||||
Sbjct: 1080 gaagaggaggaggaaggagaggaggagga 1108
to top
>gb|AC121297.20| Mus musculus chromosome 1, clone RP23-326H11, complete sequence
          Length = 207496

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 272   gaagaggatgaggaaggagaggcggagga 300
             ||||||||||||||||| |||| ||||||
Sbjct: 92746 gaagaggatgaggaaggggaggaggagga 92774
to top
>gb|AC152409.8| Mus musculus chromosome 1, clone RP23-395C1, complete sequence
          Length = 191100

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 272   gaagaggatgaggaaggagaggcggagga 300
             |||||||||||||||| ||||| ||||||
Sbjct: 84871 gaagaggatgaggaagaagaggaggagga 84843
to top
>gb|AC105256.7| Mus musculus BAC clone RP23-413O13 from chromosome 8, complete sequence
          Length = 210086

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 216    gcctccttctccctgtctcca 236
              |||||||||||||||||||||
Sbjct: 170133 gcctccttctccctgtctcca 170153
to top
>gb|AC121933.3| Mus musculus BAC clone RP24-206I11 from chromosome 8, complete sequence
          Length = 182816

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 272   gaagaggatgaggaaggagaggcggagga 300
             |||||||| ||||||||||||| ||||||
Sbjct: 55376 gaagaggaggaggaaggagaggaggagga 55348
to top
>emb|AL845439.5| Human DNA sequence from clone DAQB-215D11 on chromosome 6 Contains 3'
             end of C6orf12 for chromosome 6 open reading frame 12,
             ETF1P1 for eukaryotic translation termination factor 1
             pseudogene 1, ZNRD1 for zinc ribbon domain containing, 1,
             PPP1R11 for protein phosphatase 1, regulatory (inhibitor)
             subunit 11, RNF39 for ring finger protein 39 and 3 CpG
             islands, complete sequence
          Length = 74764

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 332   ggggaggatgaggacgacgag 352
             |||||||||||||||||||||
Sbjct: 46251 ggggaggatgaggacgacgag 46231
to top
>ref|XM_791403.1| PREDICTED: Strongylocentrotus purpuratus similar to CG7917-PA
           (LOC591856), partial mRNA
          Length = 1188

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 275 gaggatgaggaaggagaggcggaggattc 303
           ||||||||||||| ||||| |||||||||
Sbjct: 940 gaggatgaggaagaagaggaggaggattc 968
to top
>dbj|AB210196.1| Pan troglodytes ZNRD1, PPP1R11, RNF genes for zinc ribbon domain
             containing, 1, protein phosphatase 1, regulatory
             (inhibitor) subunit 11 isoform 1, HZFw1 protein isoform 1,
             complete cds, HTEX4 gene, exon 1, 2, 3, 4, cell_line:
             Ericka
          Length = 46836

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 332   ggggaggatgaggacgacgag 352
             |||||||||||||||||||||
Sbjct: 41033 ggggaggatgaggacgacgag 41013
to top
>dbj|AB210195.1| Pan troglodytes ZNRD1, PPP1R11, RNF39 genes for zinc ribbon domain
             containing, 1, protein phosphatase 1, regulatory
             (inhibitor) subunit 11 isoform 1, HZFw1 protein isoform 1,
             complete cds, HTEX4 gene, exon 1, 2, 3, 4, cell_line:
             Borie
          Length = 46836

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 332   ggggaggatgaggacgacgag 352
             |||||||||||||||||||||
Sbjct: 41033 ggggaggatgaggacgacgag 41013
to top
>dbj|AB202082.1| Homo sapiens ZNRD1, PPP1R11, RNF39 genes for zinc ribbon domain
             containing, 1, protein phosphatase 1, regulatory
             (inhibitor) subunit 11, ring finger protein 39, complete
             cds
          Length = 45907

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 332   ggggaggatgaggacgacgag 352
             |||||||||||||||||||||
Sbjct: 40097 ggggaggatgaggacgacgag 40077
to top
>gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome IV,
             complete sequence
          Length = 1466886

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 334   ggaggatgaggacgacgagaa 354
             |||||||||||||||||||||
Sbjct: 91878 ggaggatgaggacgacgagaa 91898
to top
>gb|AC135355.3| Mus musculus BAC clone RP24-495F22 from chromosome 6, complete sequence
          Length = 171057

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 272   gaagaggatgaggaaggagaggcggagga 300
             |||||||| ||||||||||||| ||||||
Sbjct: 44812 gaagaggaggaggaaggagaggaggagga 44784
to top
>dbj|AK037681.1| Mus musculus 16 days neonate thymus cDNA, RIKEN full-length
           enriched library, clone:A130036O06
           product:unclassifiable, full insert sequence
          Length = 2376

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 272 gaagaggatgaggaaggagaggcggagga 300
           |||||||| ||||||||||||| ||||||
Sbjct: 413 gaagaggaggaggaaggagaggaggagga 385
to top
>gb|AC148667.1| Macaca mulatta Major Histocompatibility Complex BAC MMU025A04, complete
             sequence
          Length = 218267

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 332   ggggaggatgaggacgacgag 352
             |||||||||||||||||||||
Sbjct: 98035 ggggaggatgaggacgacgag 98015
to top
>dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partial and complete cds
          Length = 3284914

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 332     ggggaggatgaggacgacgag 352
               |||||||||||||||||||||
Sbjct: 2335876 ggggaggatgaggacgacgag 2335896
to top
>gb|AC154383.2| Mus musculus BAC clone RP23-38N16 from chromosome 16, complete sequence
          Length = 205926

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 269    caagaagaggatgaggaaggagagg 293
              ||||||||||| |||||||||||||
Sbjct: 173920 caagaagaggaagaggaaggagagg 173896
to top
>gb|AC116317.4| Homo sapiens BAC clone RP11-1406H17 from 4, complete sequence
          Length = 160943

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 68    ccccaggaacctgttaaaatg 88
             |||||||||||||||||||||
Sbjct: 26262 ccccaggaacctgttaaaatg 26282
to top
>gb|AF511330.1| Sus scrofa clone UMNp513 microsatellite sequence
          Length = 238

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 267 accaagaagaggatgaggaaggaga 291
           |||| ||||||||||||||||||||
Sbjct: 234 accaggaagaggatgaggaaggaga 210
to top
>dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility complex class I region
          Length = 1750601

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 332     ggggaggatgaggacgacgag 352
               |||||||||||||||||||||
Sbjct: 1412845 ggggaggatgaggacgacgag 1412865
to top
>gb|AC153873.5| Mus musculus 10 BAC RP23-87M12 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 207864

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 270    aagaagaggatgaggaaggagaggcggag 298
              |||||||||| ||||||||||||| ||||
Sbjct: 181599 aagaagaggaggaggaaggagaggaggag 181627
to top
>dbj|AK111435.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-182-H12, full
           insert sequence
          Length = 831

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 220 ccttctccctgtctccaggtt 240
           |||||||||||||||||||||
Sbjct: 781 ccttctccctgtctccaggtt 801
to top
>ref|NM_209099.1| Eremothecium gossypii ADL349Wp (ADL349W), mRNA
          Length = 1239

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 334 ggaggatgaggacgacgagaa 354
           |||||||||||||||||||||
Sbjct: 81  ggaggatgaggacgacgagaa 101
to top
>gb|BC050860.1| Mus musculus RIKEN cDNA 2810030E01 gene, mRNA (cDNA clone MGC:59463
            IMAGE:6331376), complete cds
          Length = 2985

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 272  gaagaggatgaggaaggagaggcggagga 300
            |||||||| ||||||||||||| ||||||
Sbjct: 1080 gaagaggaggaggaaggagaggaggagga 1108
to top
>gb|AC165437.5| Mus musculus chromosome 15, clone RP23-285N11, complete sequence
          Length = 228289

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 272    gaagaggatgaggaaggagaggcggagga 300
              |||||||| ||||||||||||| ||||||
Sbjct: 155667 gaagaggaggaggaaggagaggaggagga 155695
to top
>gb|AC144778.3| Mus musculus BAC clone RP23-278A22 from 6, complete sequence
          Length = 187115

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 272    gaagaggatgaggaaggagaggcggagga 300
              |||||||| ||||||||||||| ||||||
Sbjct: 147572 gaagaggaggaggaaggagaggaggagga 147544
to top
>gb|AC166110.3| Mus musculus BAC clone RP23-130A4 from chromosome 17, complete sequence
          Length = 209815

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 272   gaagaggatgaggaaggagaggcggagga 300
             ||||||||||||||||| |||| ||||||
Sbjct: 59624 gaagaggatgaggaaggggaggaggagga 59596
to top
>emb|AL928589.11| Mouse DNA sequence from clone RP23-350C1 on chromosome 2, complete
              sequence
          Length = 209053

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 272    gaagaggatgaggaaggagaggcggagga 300
              |||||||| ||||||||||||| ||||||
Sbjct: 172392 gaagaggaggaggaaggagaggaggagga 172364
to top
>emb|AL591067.35| Mouse DNA sequence from clone RP23-333D2 on chromosome 11, complete
              sequence
          Length = 196512

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 314    gccttcggggatgaggtgggggagg 338
              ||||| |||||||||||||||||||
Sbjct: 112312 gccttgggggatgaggtgggggagg 112336
to top
>gb|AC153022.1| Mus musculus 6 BAC RP23-115M13 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 201949

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 270   aagaagaggatgaggaaggagaggcggag 298
             |||||||||| ||||||||||||| ||||
Sbjct: 51254 aagaagaggaggaggaaggagaggaggag 51282
to top
>gb|AC130201.3| Mus musculus BAC clone RP24-570A9 from chromosome 1, complete sequence
          Length = 147016

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 275    gaggatgaggaaggagaggcggagg 299
              ||||||||||||||||||| |||||
Sbjct: 117778 gaggatgaggaaggagaggaggagg 117802
to top
>gb|AC105173.10| Mus musculus chromosome 8, clone RP23-319J15, complete sequence
          Length = 186945

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 271    agaagaggatgaggaaggagaggc 294
              ||||||||| ||||||||||||||
Sbjct: 164290 agaagaggaagaggaaggagaggc 164313
to top
>gb|AC167972.3| Mus musculus BAC clone RP24-73H24 from chromosome 13, complete sequence
          Length = 224330

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 272    gaagaggatgaggaaggagaggcggagg 299
              |||||||| ||||||||||||| |||||
Sbjct: 146109 gaagaggaggaggaaggagaggaggagg 146082
to top
>ref|NM_175294.2| Mus musculus nuclear casein kinase and cyclin-dependent kinase
           substrate 1 (Nucks1), mRNA
          Length = 2667

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 268 ccaagaagaggatgaggaag 287
           ||||||||||||||||||||
Sbjct: 812 ccaagaagaggatgaggaag 831
to top
>gb|AC164622.3| Mus musculus BAC clone CH36-287E13 from chromosome 13, complete sequence
          Length = 174691

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 272    gaagaggatgaggaaggagaggcggagg 299
              |||||||| ||||||||||||| |||||
Sbjct: 117166 gaagaggaggaggaaggagaggaggagg 117193
to top
>gb|AC134341.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0027N19, complete sequence
          Length = 141368

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 36    ccctcgcggcctcgcctcgc 55
             ||||||||||||||||||||
Sbjct: 61654 ccctcgcggcctcgcctcgc 61673
to top
>ref|XM_324191.1| Neurospora crassa OR74A hypothetical protein (NCU04835.1) partial
           mRNA
          Length = 2379

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 332 ggggaggatgaggacgacgagaag 355
           |||||||| |||||||||||||||
Sbjct: 230 ggggaggaggaggacgacgagaag 207
to top
>ref|XM_614574.2| PREDICTED: Bos taurus similar to Ras-related GTP binding D,
           transcript variant 1 (LOC541106), mRNA
          Length = 1466

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 352 gaagccgcagccggaggagg 371
           ||||||||||||||||||||
Sbjct: 55  gaagccgcagccggaggagg 74
to top
>ref|XM_955301.1| Neurospora crassa OR74A hypothetical protein (NCU04835.1) partial
           mRNA
          Length = 2379

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 332 ggggaggatgaggacgacgagaag 355
           |||||||| |||||||||||||||
Sbjct: 230 ggggaggaggaggacgacgagaag 207
to top
>ref|XM_606838.2| PREDICTED: Bos taurus similar to gamma filamin (LOC528415), mRNA
          Length = 7863

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 333 gggaggatgaggacgacgag 352
           ||||||||||||||||||||
Sbjct: 242 gggaggatgaggacgacgag 261
to top
>gb|AC163346.3| Mus musculus BAC clone RP23-370A2 from chromosome 6, complete
            sequence
          Length = 173936

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 270  aagaagaggatgaggaaggagagg 293
            |||||||||| |||||||||||||
Sbjct: 4158 aagaagaggaggaggaaggagagg 4181
to top
>gb|AC122418.4| Mus musculus BAC clone RP24-159E6 from chromosome 13, complete sequence
          Length = 221980

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 270    aagaagaggatgaggaaggagagg 293
              |||||||||| |||||||||||||
Sbjct: 220905 aagaagaggaggaggaaggagagg 220882
to top
>gb|AC074257.5| Homo sapiens BAC clone RP11-796I2 from 7, complete sequence
          Length = 186047

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 97    cgccacagccatggcgatggccac 120
             |||||||||||||||| |||||||
Sbjct: 82740 cgccacagccatggcggtggccac 82717
to top
>ref|XM_862106.1| PREDICTED: Canis familiaris hypothetical protein LOC610688
           (LOC610688), mRNA
          Length = 312

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 273 aagaggatgaggaaggagaggcggagga 300
           ||||||| ||||||||||||| ||||||
Sbjct: 86  aagaggaggaggaaggagaggaggagga 113
to top
>gb|AC145474.2| Rattus norvegicus chromosome 1 clone RP32-113N8 map q32, complete
              sequence
          Length = 137003

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 270    aagaagaggatgaggaaggagagg 293
              |||||||||| |||||||||||||
Sbjct: 102956 aagaagaggaggaggaaggagagg 102979
to top
>gb|AC126426.3| Mus musculus BAC clone RP24-291G13 from chromosome 13, complete sequence
          Length = 201051

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 270    aagaagaggatgaggaaggagagg 293
              |||||||||||||||||| |||||
Sbjct: 122291 aagaagaggatgaggaagaagagg 122268
to top
>gb|AC133648.3| Mus musculus BAC clone RP23-291B1 from chromosome 7, complete sequence
          Length = 207234

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 270    aagaagaggatgaggaaggagagg 293
              |||||||||| |||||||||||||
Sbjct: 113521 aagaagaggaagaggaaggagagg 113498
to top
>ref|XM_818292.1| Trypanosoma brucei TREU927 hypothetical protein (Tb10.26.0090)
            partial mRNA
          Length = 3492

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 272  gaagaggatgaggaaggaga 291
            ||||||||||||||||||||
Sbjct: 1984 gaagaggatgaggaaggaga 2003
to top
>ref|XM_746883.1| Aspergillus fumigatus Af293 transcription initiation protein spt5
           (Afu4g08500) partial mRNA
          Length = 3177

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 320 ggggatgaggtgggggaggatgaggacgacga 351
           ||||| |||| || ||||||||||||||||||
Sbjct: 313 ggggaggaggaggaggaggatgaggacgacga 344
to top
>gb|AC138768.3| Mus musculus BAC clone RP24-465E14 from chromosome 18, complete
             sequence
          Length = 158065

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 273   aagaggatgaggaaggagaggcggagga 300
             ||||||| ||||||||||||| ||||||
Sbjct: 26241 aagaggaagaggaaggagaggaggagga 26268
to top
>gb|AC122050.3| Mus musculus BAC clone RP24-457L7 from chromosome 6, complete sequence
          Length = 179078

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 270   aagaagaggatgaggaaggagagg 293
             |||||||||| |||||||||||||
Sbjct: 55502 aagaagaggaggaggaaggagagg 55479
to top
>ref|XM_804918.1| Trypanosoma cruzi strain CL Brener ribonuclease H1
           (Tc00.1047053505939.60) partial mRNA
          Length = 972

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 210 tccaccgcctccttctccct 229
           ||||||||||||||||||||
Sbjct: 431 tccaccgcctccttctccct 412
to top
>ref|XM_805147.1| Trypanosoma cruzi strain CL Brener ribonuclease H1
           (Tc00.1047053506351.40) partial mRNA
          Length = 972

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 210 tccaccgcctccttctccct 229
           ||||||||||||||||||||
Sbjct: 431 tccaccgcctccttctccct 412
to top
>gb|AC122043.4| Mus musculus BAC clone RP24-448C16 from chromosome 5, complete sequence
          Length = 187106

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 270   aagaagaggatgaggaaggagagg 293
             |||||||||| |||||||||||||
Sbjct: 92445 aagaagaggaggaggaaggagagg 92468
to top
>gb|AC126544.5| Homo sapiens chromosome 17, clone RP11-707O23, complete sequence
          Length = 172940

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 270   aagaagaggatgaggaaggagagg 293
             |||||||||| |||||||||||||
Sbjct: 39894 aagaagaggaagaggaaggagagg 39917
to top
>gb|AC122824.3| Mus musculus BAC clone RP23-206D5 from 13, complete sequence
          Length = 195655

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 273    aagaggatgaggaaggagaggcggagga 300
              ||||||| ||||||||||||| ||||||
Sbjct: 136084 aagaggaggaggaaggagaggaggagga 136057
to top
>ref|XM_806298.1| Trypanosoma cruzi strain CL Brener separase
           (Tc00.1047053506363.159) partial mRNA
          Length = 502

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 207 ccttccaccgcctccttctc 226
           ||||||||||||||||||||
Sbjct: 296 ccttccaccgcctccttctc 277
to top
>emb|CR388094.8| Zebrafish DNA sequence from clone CH211-214A5 in linkage group 16,
             complete sequence
          Length = 80756

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 66    caccccaggaacctgttaaa 85
             ||||||||||||||||||||
Sbjct: 78595 caccccaggaacctgttaaa 78614
to top
>gb|AC093583.3| Homo sapiens BAC clone RP13-452N2 from 7, complete sequence
          Length = 178471

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 97     cgccacagccatggcgatggccac 120
              |||||||||||||||| |||||||
Sbjct: 128901 cgccacagccatggcggtggccac 128878
to top
>ref|XM_721979.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY06422)
            partial mRNA
          Length = 7950

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 270  aagaagaggatgaggaaggagagg 293
            |||||||||| |||||||||||||
Sbjct: 1232 aagaagaggaagaggaaggagagg 1255
to top
>gb|AY376991.1| Litopenaeus vannamei microsatellite TUGAPv7-9.188 sequence
          Length = 517

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 271 agaagaggatgaggaaggagaggcggaggatt 302
           ||||||||| ||||||||||| | ||||||||
Sbjct: 464 agaagaggaggaggaaggagaagaggaggatt 495
to top
>gb|AC148154.15| Medicago truncatula clone mth2-17a6, complete sequence
          Length = 138465

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 272   gaagaggatgaggaaggaga 291
             ||||||||||||||||||||
Sbjct: 63508 gaagaggatgaggaaggaga 63527
to top
>emb|AL592308.3| Human DNA sequence from clone RP13-610P22 on chromosome 1, complete
            sequence
          Length = 170581

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 71   caggaacctgttaaaatggc 90
            ||||||||||||||||||||
Sbjct: 2217 caggaacctgttaaaatggc 2236
to top
>ref|NM_205332.3| Gallus gallus CCCTC-binding factor (zinc finger protein) (CTCF),
           mRNA
          Length = 4034

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 26  ctcctgccctccctcgcggc 45
           ||||||||||||||||||||
Sbjct: 562 ctcctgccctccctcgcggc 543
to top
>emb|AL357503.12| Human DNA sequence from clone RP5-899C14 on chromosome 20 Contains
            the 3' end of the C20orf101 gene, complete sequence
          Length = 133288

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 272  gaagaggatgaggaaggaga 291
            ||||||||||||||||||||
Sbjct: 5430 gaagaggatgaggaaggaga 5411
to top
>emb|AL356986.11| Human DNA sequence from clone RP11-395N6 on chromosome 1 Contains the
             5' end of a known gene (FLJ10276), a
             glyceraldehyde-3-phosphate dehydrogenase (GAPD)
             pseudogene, a novel pseudogene, the 5' end of the ZBTB8
             gene for zinc finger and BTB domain containing 8 and five
             CpG islands, complete sequence
          Length = 98390

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 270   aagaagaggatgaggaaggagagg 293
             |||||||||| |||||||||||||
Sbjct: 70692 aagaagaggaagaggaaggagagg 70669
to top
>emb|AL139254.23| Human DNA sequence from clone RP4-749H3 on chromosome 1p35.1-36
             Contains a novel gene (LOC339505), complete sequence
          Length = 120455

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 223   tctccctgtctccaggttct 242
             ||||||||||||||||||||
Sbjct: 45405 tctccctgtctccaggttct 45386
to top
>gb|AC090419.7| Homo sapiens chromosome 17, clone CTD-2107B16, complete sequence
          Length = 139585

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 270   aagaagaggatgaggaaggagagg 293
             |||||||||| |||||||||||||
Sbjct: 60825 aagaagaggaagaggaaggagagg 60848
to top
>emb|Z22605.1|GDCTCFPRA G.domesticus CTCF protein mRNA
          Length = 4252

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 26  ctcctgccctccctcgcggc 45
           ||||||||||||||||||||
Sbjct: 780 ctcctgccctccctcgcggc 761
to top
>emb|X65515.1|AVFIXABCX A.vinelandii genes fixA, fixB, fixC, fixX and ORF6
          Length = 4394

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 310  agccgccttcggggatgaggtggg 333
            |||||||||||||||| |||||||
Sbjct: 3557 agccgccttcggggatcaggtggg 3534
to top
>emb|AL645943.19| Mouse DNA sequence from clone RP23-130E22 on chromosome 11 Contains a
             prohibitin (Phb) pseudogene and a novel gene, complete
             sequence
          Length = 213383

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 270   aagaagaggatgaggaaggagagg 293
             |||||||||| |||||||||||||
Sbjct: 70346 aagaagaggaggaggaaggagagg 70369
to top
>gb|AC157512.3| Mus musculus BAC clone RP24-399L6 from chromosome 9, complete sequence
          Length = 148736

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 268   ccaagaagaggatgaggaag 287
             ||||||||||||||||||||
Sbjct: 69848 ccaagaagaggatgaggaag 69829
to top
>gb|AC093122.12| Homo sapiens 12 BAC RP11-317E2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 108125

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 270   aagaagaggatgaggaaggagagg 293
             |||||||||||||||||| |||||
Sbjct: 59683 aagaagaggatgaggaagcagagg 59706
to top
>gb|AC161266.2| Mus musculus BAC clone RP23-231B13 from chromosome 13, complete sequence
          Length = 190192

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 270    aagaagaggatgaggaaggagagg 293
              |||||||||| |||||||||||||
Sbjct: 129535 aagaagaggaggaggaaggagagg 129558
to top
>emb|BX088698.22| Mouse DNA sequence from clone RP23-309D15 on chromosome X, complete
             sequence
          Length = 184201

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 270   aagaagaggatgaggaaggagaggcggaggat 301
             ||||||| ||||| |||| |||||||||||||
Sbjct: 11931 aagaagaagatgaagaagaagaggcggaggat 11900
to top
>gb|AC156247.2| Xenopus tropicalis clone ISB1-181M9, complete sequence
          Length = 96628

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 273   aagaggatgaggaaggagag 292
             ||||||||||||||||||||
Sbjct: 13049 aagaggatgaggaaggagag 13030
to top
>dbj|AK078816.1| Mus musculus 16 days embryo lung cDNA, RIKEN full-length enriched
           library, clone:8430423A01 product:NUCLEAR UBIQUITOUS
           CASEIN AND CYCLIN-DEPENDENT KINASES SUBSTRATE homolog
           [Rattus norvegicus], full insert sequence
          Length = 2667

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 268 ccaagaagaggatgaggaag 287
           ||||||||||||||||||||
Sbjct: 812 ccaagaagaggatgaggaag 831
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 36       ccctcgcggcctcgcctcgccgga 59
                ||||||||||||||||||| ||||
Sbjct: 21980907 ccctcgcggcctcgcctcgtcgga 21980930
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 36      ccctcgcggcctcgcctcgc 55
               ||||||||||||||||||||
Sbjct: 3740724 ccctcgcggcctcgcctcgc 3740743
to top
>gb|AC155655.8| Mus musculus 6 BAC RP24-66L18 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 203618

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   gggatgaggtgggggaggat 340
             ||||||||||||||||||||
Sbjct: 80609 gggatgaggtgggggaggat 80590
to top
>gb|AC133521.3| Mus musculus BAC clone RP23-189F22 from chromosome 12, complete sequence
          Length = 219682

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 270    aagaagaggatgaggaaggagagg 293
              |||||||||| |||||||||||||
Sbjct: 174130 aagaagaggaggaggaaggagagg 174107
to top
>ref|XM_223992.3| PREDICTED: Rattus norvegicus sal-like 2 (Drosophila) (predicted)
            (Sall2_predicted), mRNA
          Length = 4012

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 270  aagaagaggatgaggaaggagagg 293
            |||||||||||||||||| |||||
Sbjct: 2930 aagaagaggatgaggaagaagagg 2953
to top
>gb|AY035782.1| Rhipicephalus appendiculatus serine proteinase inhibitor serpin-4
           mRNA, complete cds
          Length = 1900

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 99  ccacagccatggcgatggcc 118
           ||||||||||||||||||||
Sbjct: 350 ccacagccatggcgatggcc 369
to top
>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome
          Length = 1849742

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 311     gccgccttcggggatgaggtgggggagg 338
               |||||| ||||||| |||||||||||||
Sbjct: 1631340 gccgccctcggggaggaggtgggggagg 1631313
to top
>gb|AC153862.8| Mus musculus 10 BAC RP23-353K11 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 223830

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 320   ggggatgaggtgggggagga 339
             ||||||||||||||||||||
Sbjct: 82170 ggggatgaggtgggggagga 82151
to top
>dbj|AP003798.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1005_H01
          Length = 128124

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 36    ccctcgcggcctcgcctcgccgga 59
             ||||||||||||||||||| ||||
Sbjct: 66656 ccctcgcggcctcgcctcgtcgga 66679
to top
>gb|AC155924.2| Mus musculus BAC clone RP24-366C10 from 12, complete sequence
          Length = 142540

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 270    aagaagaggatgaggaaggagagg 293
              |||||||||| |||||||||||||
Sbjct: 110241 aagaagaggaggaggaaggagagg 110264
to top
>gb|AC140442.4| Mus musculus BAC clone RP24-106P1 from 12, complete sequence
          Length = 153574

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 270   aagaagaggatgaggaaggagagg 293
             |||||||||||||||||| |||||
Sbjct: 25548 aagaagaggatgaggaagaagagg 25525
to top
>gb|AC132132.4| Mus musculus BAC clone RP23-235K2 from 8, complete sequence
          Length = 198321

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 272    gaagaggatgaggaaggaga 291
              ||||||||||||||||||||
Sbjct: 103813 gaagaggatgaggaaggaga 103832
to top
>gb|AC154630.2| Mus musculus BAC clone RP23-319C8 from 9, complete sequence
          Length = 182834

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 268   ccaagaagaggatgaggaag 287
             ||||||||||||||||||||
Sbjct: 23379 ccaagaagaggatgaggaag 23398
to top
>gb|AC169186.4| Erinaceus europaeus, clone XX-29994857F23, complete sequence
          Length = 33803

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 270   aagaagaggatgaggaaggagagg 293
             |||||||||| |||||||||||||
Sbjct: 13565 aagaagaggaagaggaaggagagg 13542
to top
>emb|BX005242.6| Zebrafish DNA sequence from clone DKEY-67N17 in linkage group 16,
              complete sequence
          Length = 192177

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 66     caccccaggaacctgttaaa 85
              ||||||||||||||||||||
Sbjct: 129631 caccccaggaacctgttaaa 129650
to top
>gb|AC005829.1|AC005829 Homo sapiens chromosome 17, clone hRPK.259_G_18, complete sequence
          Length = 170030

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 270   aagaagaggatgaggaaggagagg 293
             |||||||||| |||||||||||||
Sbjct: 49961 aagaagaggaagaggaaggagagg 49984
to top
>gb|AC174447.2| Mus musculus BAC clone RP23-377C21 from chromosome 9, complete sequence
          Length = 170748

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 268    ccaagaagaggatgaggaag 287
              ||||||||||||||||||||
Sbjct: 117615 ccaagaagaggatgaggaag 117634
to top
>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome
          Length = 7215267

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 431     ttcgacgagttgccgccggaatca 454
               ||||||||||||||||| ||||||
Sbjct: 6101607 ttcgacgagttgccgccagaatca 6101584
to top
>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 311     gccgccttcggggatgaggtgggggagg 338
               |||||| ||||||| |||||||||||||
Sbjct: 1308348 gccgccctcggggaggaggtgggggagg 1308321
to top
>gb|AC127691.4| Mus musculus BAC clone RP24-216M10 from 9, complete sequence
          Length = 153242

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 217   cctccttctccctgtctcca 236
             ||||||||||||||||||||
Sbjct: 54853 cctccttctccctgtctcca 54834
to top
>gb|AC125102.4| Mus musculus BAC clone RP24-208N22 from 6, complete sequence
          Length = 163235

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 273   aagaggatgaggaaggagag 292
             ||||||||||||||||||||
Sbjct: 74253 aagaggatgaggaaggagag 74272
to top
>gb|U27180.1|TAU27180 Thermus aquaticus orotate phosphoribosyltransferase (pyrE) gene,
            complete cds
          Length = 1719

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 311  gccgccttcggggatgaggtgggggagg 338
            |||||| ||||||| |||||||||||||
Sbjct: 1068 gccgccctcggggaggaggtgggggagg 1095
to top
>gb|AC163040.5| Mus musculus BAC clone RP23-71C23 from chromosome 12, complete sequence
          Length = 235086

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 270    aagaagaggatgaggaaggagagg 293
              |||||||||||||||||| |||||
Sbjct: 194345 aagaagaggatgaggaagaagagg 194322
to top
>emb|AL603706.13| Mouse DNA sequence from clone RP23-407I21 on chromosome 11, complete
              sequence
          Length = 220242

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                  
Query: 320    ggggatgaggtgggggaggatgaggacgacgagaag 355
              ||||| |||||||||||||| ||||| || ||||||
Sbjct: 147251 ggggaggaggtgggggaggaggaggaagaggagaag 147286
to top
>emb|AL772258.9| Mouse DNA sequence from clone RP23-337P24 on chromosome 2, complete
             sequence
          Length = 200480

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 272   gaagaggatgaggaaggagaggcggagg 299
             |||||||| ||||||||||||| |||||
Sbjct: 40593 gaagaggaggaggaaggagaggaggagg 40620
to top
>emb|AL928939.6| Mouse DNA sequence from clone RP23-294B13 on chromosome 2, complete
              sequence
          Length = 191291

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 270    aagaagaggatgaggaaggagagg 293
              ||||||||||||||||||| ||||
Sbjct: 105300 aagaagaggatgaggaaggggagg 105277
to top
>gb|AC127032.8| Homo sapiens chromosome 17, clone RP11-162O14, complete sequence
          Length = 187685

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 270   aagaagaggatgaggaaggagagg 293
             |||||||||| |||||||||||||
Sbjct: 76526 aagaagaggaagaggaaggagagg 76549
to top
>dbj|D83330.1| Thermus thermophilus DNA for orotate phosphoribosyltransferase,
            orotidine-5'-phosphate decarboxylase, complete and
            partial cds
          Length = 2185

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 311  gccgccttcggggatgaggtgggggagg 338
            |||||| ||||||| |||||||||||||
Sbjct: 1538 gccgccctcggggaggaggtgggggagg 1565
to top
>emb|AL645928.9| Mouse DNA sequence from clone RP23-185J21 on chromosome 11, complete
              sequence
          Length = 158913

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 270    aagaagaggatgaggaaggagagg 293
              |||||||||| |||||||||||||
Sbjct: 128281 aagaagaggaggaggaaggagagg 128258


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,380,306
Number of Sequences: 3902068
Number of extensions: 4380306
Number of successful extensions: 112816
Number of sequences better than 10.0: 145
Number of HSP's better than 10.0 without gapping: 145
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 112061
Number of HSP's gapped (non-prelim): 755
length of query: 570
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 547
effective length of database: 17,143,297,704
effective search space: 9377383844088
effective search space used: 9377383844088
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top