Clone Name	bah63l18
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|BT009537.1| Triticum aestivum clone wr1.pk0139.g3:fis, full i...	607	e-170
2	gb|AY452768.1| Oryza sativa (japonica cultivar-group) phytoene s...	565	e-158
3	dbj|AK073290.1| Oryza sativa (japonica cultivar-group) cDNA clon...	565	e-158
4	gb|AY024350.1| Oryza sativa (japonica cultivar-group) phytoene s...	470	e-129
5	dbj|AK063967.1| Oryza sativa (japonica cultivar-group) cDNA clon...	470	e-129
6	gb|AY450646.1| Zea mays phytoene synthase 2 mRNA, partial cds	412	e-112
7	gb|AY108547.1| Zea mays PCO131047 mRNA sequence	266	7e-68
8	gb|AY024351.1| Oryza sativa (japonica cultivar-group) phytoene s...	230	4e-57
9	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	230	4e-57
10	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	230	4e-57
11	emb|AL831803.4|CNS08CAG Oryza sativa chromosome 12, . BAC OSJNBb...	230	4e-57
12	gb|AY325302.1| Zea mays B73 phytoene synthase 2 (PSY2) gene, com...	170	3e-39
13	gb|AY266046.1| Zea mays phytoene synthase 2 gene, partial cds	170	3e-39
14	gb|AC137593.2| Oryza sativa (Japonica cultiva-group) chromosome ...	84	6e-13
15	dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D...	84	6e-13
16	dbj|AK108154.1| Oryza sativa (japonica cultivar-group) cDNA clon...	84	6e-13
17	gb|AY078162.1| Oryza sativa (indica cultivar-group) phytoene syn...	76	1e-10
18	gb|DQ494214.1| Citrullus lanatus phytoene synthase (psy) mRNA, p...	70	9e-09
19	gb|AY661705.1| Adonis palaestina phytoene synthase (Psy) mRNA, p...	66	1e-07
20	gb|BT012712.1| Lycopersicon esculentum clone 113593R, mRNA sequence	66	1e-07
21	emb|Y00521.1|LERIPE Tomato fruit ripening specific mRNA	66	1e-07
22	emb|X68017.1|CAPSY1 C.annuum psy1 mRNA for phytoene synthase	66	1e-07
23	emb|X67144.1|LERYGTOM5 L.esculentum (rY mutant) GTOM5 mRNA for m...	66	1e-07
24	gb|M84744.1|TOMCBPE Tomato phytoene synthetase mRNA, complete cds	66	1e-07
25	gb|DQ192187.1| Daucus carota subsp. sativus putative phytoene sy...	62	2e-06
26	gb|DQ335097.1| Lycopersicon esculentum phytoene synthase mRNA, c...	58	3e-05
27	gb|AY324431.1| Zea mays chloroplast phytoene synthase 1 (PSY1) g...	56	1e-04
28	gb|AY455286.1| Zea mays chloroplast phytoene synthase (Y1) gene,...	56	1e-04
29	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	56	1e-04
30	gb|AC137991.3| Oryza sativa chromosome 3 BAC OSJNBa0034D21 genom...	56	1e-04
31	gb|AY496865.1| Oncidium cv. 'Gower Ramsey' phytoene synthase (PS...	56	1e-04
32	emb|AJ889824.1| Populus alba x Populus tremula partial mRNA for ...	56	1e-04
33	gb|AY300602.1| Zea mays strain W-8 phytoene synthase 2 (psy2) ge...	56	1e-04
34	gb|AY300601.1| Zea mays strain W-7 phytoene synthase 2 (psy2) ge...	56	1e-04
35	gb|AY300600.1| Zea mays strain W-6 phytoene synthase 2 (psy2) ge...	56	1e-04
36	gb|AY300598.1| Zea mays strain W-45 phytoene synthase 2 (psy2) g...	56	1e-04
37	gb|AY300597.1| Zea mays strain W-37 phytoene synthase 2 (psy2) g...	56	1e-04
38	gb|AY300596.1| Zea mays strain W-28 phytoene synthase 2 (psy2) g...	56	1e-04
39	gb|AY300595.1| Zea mays strain W-21 phytoene synthase 2 (psy2) g...	56	1e-04
40	gb|AY300594.1| Zea mays strain W-20 phytoene synthase 2 (psy2) g...	56	1e-04
41	gb|AY300593.1| Zea mays strain W-2 phytoene synthase 2 (psy2) ge...	56	1e-04
42	gb|AY300591.1| Zea mays strain W-16 phytoene synthase 2 (psy2) g...	56	1e-04
43	gb|AY300590.1| Zea mays strain Stock6 phytoene synthase 2 (psy2)...	56	1e-04
44	gb|AY300589.1| Zea mays strain PI595547 phytoene synthase 2 (psy...	56	1e-04
45	gb|AY300588.1| Zea mays strain PI595546 phytoene synthase 2 (psy...	56	1e-04
46	gb|AY300587.1| Zea mays strain PI595539 phytoene synthase 2 (psy...	56	1e-04
47	gb|AY300586.1| Zea mays strain PI595532 phytoene synthase 2 (psy...	56	1e-04
48	gb|AY300585.1| Zea mays strain PI595531 phytoene synthase 2 (psy...	56	1e-04
49	gb|AY300583.1| Zea mays strain PI561605 phytoene synthase 2 (psy...	56	1e-04
50	gb|AY300582.1| Zea mays strain PI550545 phytoene synthase 2 (psy...	56	1e-04
51	gb|AY300581.1| Zea mays strain PI550442 phytoene synthase 2 (psy...	56	1e-04
52	gb|AY300580.1| Zea mays strain PI406108 phytoene synthase 2 (psy...	56	1e-04
53	gb|AY300579.1| Zea mays strain PI340838 phytoene synthase 2 (psy...	56	1e-04
54	gb|AY300577.1| Zea mays strain PI221738 phytoene synthase 2 (psy...	56	1e-04
55	gb|AY300575.1| Zea mays strain NC296 phytoene synthase 2 (psy2) ...	56	1e-04
56	gb|AY300574.1| Zea mays strain CIze127 phytoene synthase 2 (psy2...	56	1e-04
57	gb|AY300573.1| Zea mays strain Ames23418 phytoene synthase 2 (ps...	56	1e-04
58	gb|AY300572.1| Zea mays strain Ames22758 phytoene synthase 2 (ps...	56	1e-04
59	gb|AY300571.1| Zea mays strain Ames22754 phytoene synthase 2 (ps...	56	1e-04
60	gb|AY300570.1| Zea mays strain Ames22443 phytoene synthase 2 (ps...	56	1e-04
61	gb|AY300569.1| Zea mays strain Ames22026 phytoene synthase 2 (ps...	56	1e-04
62	gb|AY300567.1| Zea mays strain Y-13 phytoene synthase 2 (psy2) g...	56	1e-04
63	gb|AY300566.1| Zea mays strain Y-12 phytoene synthase 2 (psy2) g...	56	1e-04
64	gb|AY300565.1| Zea mays strain SC60 phytoene synthase 2 (psy2) g...	56	1e-04
65	gb|AY300564.1| Zea mays strain Y-11 phytoene synthase 2 (psy2) g...	56	1e-04
66	gb|AY300563.1| Zea mays strain PI595566 phytoene synthase 2 (psy...	56	1e-04
67	gb|AY300562.1| Zea mays strain PI595562 phytoene synthase 2 (psy...	56	1e-04
68	gb|AY300561.1| Zea mays strain PI595554 phytoene synthase 2 (psy...	56	1e-04
69	gb|AY300560.1| Zea mays strain PI595553 phytoene synthase 2 (psy...	56	1e-04
70	gb|AY300559.1| Zea mays strain PI593015 phytoene synthase 2 (psy...	56	1e-04
71	gb|AY300557.1| Zea mays strain PI583352 phytoene synthase 2 (psy...	56	1e-04
72	gb|AY300556.1| Zea mays strain PI583351 phytoene synthase 2 (psy...	56	1e-04
73	gb|AY300555.1| Zea mays strain PI583350 phytoene synthase 2 (psy...	56	1e-04
74	gb|AY300554.1| Zea mays strain PI542777 phytoene synthase 2 (psy...	56	1e-04
75	gb|AY300552.1| Zea mays strain PI270297 phytoene synthase 2 (psy...	56	1e-04
76	gb|AY300549.1| Zea mays strain PI186217 phytoene synthase 2 (psy...	56	1e-04
77	gb|AY300548.1| Zea mays strain Mo17 phytoene synthase 2 (psy2) g...	56	1e-04
78	gb|AY300546.1| Zea mays strain InbredLo32 phytoene synthase 2 (p...	56	1e-04
79	gb|AY300545.1| Zea mays strain Y-9 phytoene synthase 2 (psy2) ge...	56	1e-04
80	gb|AY300544.1| Zea mays strain H60 phytoene synthase 2 (psy2) ge...	56	1e-04
81	gb|AY300543.1| Zea mays strain Y-8 phytoene synthase 2 (psy2) ge...	56	1e-04
82	gb|AY300542.1| Zea mays strain Y-7 phytoene synthase 2 (psy2) ge...	56	1e-04
83	gb|AY300541.1| Zea mays strain Y-6 phytoene synthase 2 (psy2) ge...	56	1e-04
84	gb|AY300540.1| Zea mays strain Y-5 phytoene synthase 2 (psy2) ge...	56	1e-04
85	gb|AY300539.1| Zea mays strain B73 phytoene synthase 2 (psy2) ge...	56	1e-04
86	gb|AY300538.1| Zea mays strain Y-3 phytoene synthase 2 (psy2) ge...	56	1e-04
87	gb|AY300537.1| Zea mays strain Ames24575 phytoene synthase 2 (ps...	56	1e-04
88	gb|AY300536.1| Zea mays strain Ames23476 phytoene synthase 2 (ps...	56	1e-04
89	gb|AY300535.1| Zea mays strain Ames23427 phytoene synthase 2 (ps...	56	1e-04
90	gb|AY300534.1| Zea mays strain Ames12734 phytoene synthase 2 (ps...	56	1e-04
91	gb|AY300533.1| Zea mays strain Y-2 phytoene synthase 2 (psy2) ge...	56	1e-04
92	gb|AY300532.1| Zea mays strain 66a4-2 phytoene synthase 2 (psy2)...	56	1e-04
93	gb|AY300531.1| Zea mays strain 1033A Catsul phytoene synthase 2 ...	56	1e-04
94	gb|AY300530.1| Zea mays strain Y-1 phytoene synthase 2 (psy2) ge...	56	1e-04
95	gb|AY296472.1| Zea mays strain W-16 phytoene synthase (Y1) gene,...	56	1e-04
96	gb|AY296471.1| Zea mays strain Stock6 phytoene synthase (Y1) gen...	56	1e-04
97	gb|AY296470.1| Zea mays strain PI595547 phytoene synthase (Y1) g...	56	1e-04
98	gb|AY296469.1| Zea mays strain PI595546 phytoene synthase (Y1) g...	56	1e-04
99	gb|AY296468.1| Zea mays strain PI595539 phytoene synthase (Y1) g...	56	1e-04
100	gb|AY296467.1| Zea mays strain PI595532 phytoene synthase (Y1) g...	56	1e-04
101	gb|AY296466.1| Zea mays strain PI595531 phytoene synthase (Y1) g...	56	1e-04
102	gb|AY296465.1| Zea mays strain PI583846 phytoene synthase (Y1) g...	56	1e-04
103	gb|AY296464.1| Zea mays strain PI561605 phytoene synthase (Y1) g...	56	1e-04
104	gb|AY296463.1| Zea mays strain PI550545 phytoene synthase (Y1) g...	56	1e-04
105	gb|AY296462.1| Zea mays strain PI550442 phytoene synthase (Y1) g...	56	1e-04
106	gb|AY296461.1| Zea mays strain PI406108 phytoene synthase (Y1) g...	56	1e-04
107	gb|AY296460.1| Zea mays strain PI340838 phytoene synthase (Y1) g...	56	1e-04
108	gb|AY296459.1| Zea mays strain PI340836 phytoene synthase (Y1) g...	56	1e-04
109	gb|AY296457.1| Zea mays strain PI221733 phytoene synthase (Y1) g...	56	1e-04
110	gb|AY296456.1| Zea mays strain NC296 phytoene synthase (Y1) gene...	56	1e-04
111	gb|AY296455.1| Zea mays strain CIze127 phytoene synthase (Y1) ge...	56	1e-04
112	gb|AY296454.1| Zea mays strain Ames23418 phytoene synthase (Y1) ...	56	1e-04
113	gb|AY296453.1| Zea mays strain Ames22758 phytoene synthase (Y1) ...	56	1e-04
114	gb|AY296452.1| Zea mays strain Ames22754 phytoene synthase (Y1) ...	56	1e-04
115	gb|AY296451.1| Zea mays strain Ames22443 phytoene synthase (Y1) ...	56	1e-04
116	gb|AY296450.1| Zea mays strain Ames22026 phytoene synthase (Y1) ...	56	1e-04
117	gb|AY296447.1| Zea mays strain Y-12 phytoene synthase (Y1) gene,...	56	1e-04
118	gb|AY296446.1| Zea mays strain SC60 phytoene synthase (Y1) gene,...	56	1e-04
119	gb|AY296444.1| Zea mays strain PI595566 phytoene synthase (Y1) g...	56	1e-04
120	gb|AY296442.1| Zea mays strain PI595559 phytoene synthase (Y1) g...	56	1e-04
121	gb|AY296441.1| Zea mays strain PI595554 phytoene synthase (Y1) g...	56	1e-04
122	gb|AY296440.1| Zea mays strain PI595553 phytoene synthase (Y1) g...	56	1e-04
123	gb|AY296439.1| Zea mays strain PI593015 phytoene synthase (Y1) g...	56	1e-04
124	gb|AY296438.1| Zea mays strain PI587132 phytoene synthase (Y1) g...	56	1e-04
125	gb|AY296437.1| Zea mays strain PI583352 phytoene synthase (Y1) g...	56	1e-04
126	gb|AY296436.1| Zea mays strain PI583351 phytoene synthase (Y1) g...	56	1e-04
127	gb|AY296435.1| Zea mays strain PI583350 phytoene synthase (Y1) g...	56	1e-04
128	gb|AY296434.1| Zea mays strain PI542777 phytoene synthase (Y1) g...	56	1e-04
129	gb|AY296433.1| Zea mays strain PI340837 phytoene synthase (Y1) g...	56	1e-04
130	gb|AY296432.1| Zea mays strain PI221788 phytoene synthase (Y1) g...	56	1e-04
131	gb|AY296431.1| Zea mays strain PI221785 phytoene synthase (Y1) g...	56	1e-04
132	gb|AY296429.1| Zea mays strain Y-10 phytoene synthase (Y1) gene,...	56	1e-04
133	gb|AY296428.1| Zea mays strain InbredLo32 phytoene synthase (Y1)...	56	1e-04
134	gb|AY296418.1| Zea mays strain Ames24575 phytoene synthase (Y1) ...	56	1e-04
135	gb|AY296417.1| Zea mays strain Ames23476 phytoene synthase (Y1) ...	56	1e-04
136	gb|AY296416.1| Zea mays strain Ames23427 phytoene synthase (Y1) ...	56	1e-04
137	gb|AY296415.1| Zea mays strain Ames12734 phytoene synthase (Y1) ...	56	1e-04
138	gb|AY296412.1| Zea mays strain 66a42 phytoene synthase (Y1) gene...	56	1e-04
139	gb|AY296411.1| Zea mays strain PI270297 phytoene synthase (Y1) g...	56	1e-04
140	gb|AY296410.1| Zea mays strain PI186217 phytoene synthase (Y1) g...	56	1e-04
141	gb|AY296409.1| Zea mays strain 1033aCatsul phytoene synthase (Y1...	56	1e-04
142	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	56	1e-04
143	gb|U32636.1|ZMU32636 Zea mays phytoene synthase (Y1) gene, compl...	56	1e-04
144	gb|AY973631.1| Oncidium Gower Ramsey phytoene synthase mRNA, com...	54	5e-04
145	gb|AY300551.1| Zea mays strain PI221788 phytoene synthase 2 (psy...	54	5e-04
146	gb|AY296483.1| Zea mays strain W-8 phytoene synthase (Y1) gene, ...	54	5e-04
147	gb|AY296482.1| Zea mays strain W-7 phytoene synthase (Y1) gene, ...	54	5e-04
148	gb|AY296481.1| Zea mays strain W-6 phytoene synthase (Y1) gene, ...	54	5e-04
149	gb|AY296480.1| Zea mays strain W-50 phytoene synthase (Y1) gene,...	54	5e-04
150	gb|AY296479.1| Zea mays strain W-45 phytoene synthase (Y1) gene,...	54	5e-04
151	gb|AY296478.1| Zea mays strain W-37 phytoene synthase (Y1) gene,...	54	5e-04
152	gb|AY296477.1| Zea mays strain W-28 phytoene synthase (Y1) gene,...	54	5e-04
153	gb|AY296476.1| Zea mays strain W-21 phytoene synthase (Y1) gene,...	54	5e-04
154	gb|AY296475.1| Zea mays strain W-20 phytoene synthase (Y1) gene,...	54	5e-04
155	gb|AY296474.1| Zea mays strain W-2 phytoene synthase (Y1) gene, ...	54	5e-04
156	gb|AY296473.1| Zea mays strain W-17 phytoene synthase (Y1) gene,...	54	5e-04
157	gb|AY296449.1| Zea mays strain Y-14 phytoene synthase (Y1) gene,...	54	5e-04
158	gb|AY296448.1| Zea mays strain Y-13 phytoene synthase (Y1) gene,...	54	5e-04
159	gb|AY296445.1| Zea mays strain Y-11 phytoene synthase (Y1) gene,...	54	5e-04
160	gb|AY296443.1| Zea mays strain PI595562 phytoene synthase (Y1) g...	54	5e-04
161	gb|AY296430.1| Zea mays strain Mo17 phytoene synthase (Y1) gene,...	54	5e-04
162	gb|AY296427.1| Zea mays strain Y-9 phytoene synthase (Y1) gene, ...	54	5e-04
163	gb|AY296426.1| Zea mays strain H60 phytoene synthase (Y1) gene, ...	54	5e-04
164	gb|AY296425.1| Zea mays strain Y-8 phytoene synthase (Y1) gene, ...	54	5e-04
165	gb|AY296424.1| Zea mays strain Y-7 phytoene synthase (Y1) gene, ...	54	5e-04
166	gb|AY296423.1| Zea mays strain Y-6 phytoene synthase (Y1) gene, ...	54	5e-04
167	gb|AY296422.1| Zea mays strain Y-5 phytoene synthase (Y1) gene, ...	54	5e-04
168	gb|AY296421.1| Zea mays strain Y-4 phytoene synthase (Y1) gene, ...	54	5e-04
169	gb|AY296420.1| Zea mays strain B73 phytoene synthase (Y1) gene, ...	54	5e-04
170	gb|AY296419.1| Zea mays strain Y-3 phytoene synthase (Y1) gene, ...	54	5e-04
171	gb|AY296414.1| Zea mays strain Y-2 phytoene synthase (Y1) gene, ...	54	5e-04
172	gb|AY296413.1| Zea mays strain Y-1 phytoene synthase (Y1) gene, ...	54	5e-04
173	dbj|AB011014.1| Gentiana lutea GENPSY4 mRNA for phytoene synthas...	54	5e-04
174	gb|AY986508.1| Mespilus germanica PSY mRNA, complete cds	54	5e-04
175	gb|AY920918.1| Lycium barbarum phytoene synthase mRNA, complete cds	54	5e-04
176	emb|X60441.1|LEGTOM5 L.esculentum GTom5 gene for phytoene synthase	52	0.002
177	gb|AY300454.1| Zea mays strain W-7 phytoene synthase (Y1) gene, ...	52	0.002
178	gb|AY300440.1| Zea mays strain PI595539 phytoene synthase (Y1) g...	52	0.002
179	gb|AY300438.1| Zea mays strain PI595531 phytoene synthase (Y1) g...	52	0.002
180	gb|AY300578.1| Zea mays strain PI340836 phytoene synthase 2 (psy...	52	0.002
181	gb|AY300576.1| Zea mays strain PI221733 phytoene synthase 2 (psy...	52	0.002
182	emb|X78814.1|NPPSY N.pseudonarcissus mRNA for phytoene synthase	52	0.002
183	gb|L23424.1|TOMPSY2A Lycopersicon esculentum phytoene synthase (...	52	0.002
184	gb|DQ229827.1| Daucus carota chloroplast phytoene synthase mRNA,...	50	0.008
185	gb|AY601075.1| Dunaliella salina phytoene synthase mRNA, complet...	50	0.008
186	gb|AY547325.1| Dunaliella salina phytoene synthase gene, complet...	50	0.008
187	gb|AY669084.1| Citrus sinensis PSY mRNA, partial cds	50	0.008
188	gb|AY300455.1| Zea mays strain W-8 phytoene synthase (Y1) gene, ...	50	0.008
189	gb|AY300453.1| Zea mays strain W-6 phytoene synthase (Y1) gene, ...	50	0.008
190	gb|AY300452.1| Zea mays strain W-50 phytoene synthase (Y1) gene,...	50	0.008
191	gb|AY300451.1| Zea mays strain W-45 phytoene synthase (Y1) gene,...	50	0.008
192	gb|AY300450.1| Zea mays strain W-37 phytoene synthase (Y1) gene,...	50	0.008
193	gb|AY300449.1| Zea mays strain W-28 phytoene synthase (Y1) gene,...	50	0.008
194	gb|AY300448.1| Zea mays strain W-21 phytoene synthase (Y1) gene,...	50	0.008
195	gb|AY300447.1| Zea mays strain W-20 phytoene synthase (Y1) gene,...	50	0.008
196	gb|AY300446.1| Zea mays strain W-2 phytoene synthase (Y1) gene, ...	50	0.008
197	gb|AY300445.1| Zea mays strain W-17 phytoene synthase (Y1) gene,...	50	0.008
198	gb|AY300444.1| Zea mays strain W-16 phytoene synthase (Y1) gene,...	50	0.008
199	gb|AY300443.1| Zea mays strain Stock6 phytoene synthase (Y1) gen...	50	0.008
200	gb|AY300442.1| Zea mays strain PI595547 phytoene synthase (Y1) g...	50	0.008
201	gb|AY300441.1| Zea mays strain PI595546 phytoene synthase (Y1) g...	50	0.008
202	gb|AY300439.1| Zea mays strain PI595532 phytoene synthase (Y1) g...	50	0.008
203	gb|AY300437.1| Zea mays strain PI583846 phytoene synthase (Y1) g...	50	0.008
204	gb|AY300436.1| Zea mays strain PI561605 phytoene synthase (Y1) g...	50	0.008
205	gb|AY300435.1| Zea mays strain PI550545 phytoene synthase (Y1) g...	50	0.008
206	gb|AY300434.1| Zea mays strain PI550442 phytoene synthase (Y1) g...	50	0.008
207	gb|AY300433.1| Zea mays strain PI406108 phytoene synthase (Y1) g...	50	0.008
208	gb|AY300432.1| Zea mays strain PI340838 phytoene synthase (Y1) g...	50	0.008
209	gb|AY300431.1| Zea mays strain PI340836 phytoene synthase (Y1) g...	50	0.008
210	gb|AY300430.1| Zea mays strain PI221738 phytoene synthase (Y1) g...	50	0.008
211	gb|AY300429.1| Zea mays strain PI221733 phytoene synthase (Y1) g...	50	0.008
212	gb|AY300428.1| Zea mays strain NC296 phytoene synthase (Y1) gene...	50	0.008
213	gb|AY300427.1| Zea mays strain CIze127 phytoene synthase (Y1) ge...	50	0.008
214	gb|AY300426.1| Zea mays strain Ames23418 phytoene synthase (Y1) ...	50	0.008
215	gb|AY300425.1| Zea mays strain Ames22758 phytoene synthase (Y1) ...	50	0.008
216	gb|AY300424.1| Zea mays strain Ames22754 phytoene synthase (Y1) ...	50	0.008
217	gb|AY300423.1| Zea mays strain Ames22443 phytoene synthase (Y1) ...	50	0.008
218	gb|AY300422.1| Zea mays strain Ames22026 phytoene synthase (Y1) ...	50	0.008
219	gb|AY300421.1| Zea mays strain Y-14 phytoene synthase (Y1) gene,...	50	0.008
220	gb|AY300420.1| Zea mays strain Y-13 phytoene synthase (Y1) gene,...	50	0.008
221	gb|AY300419.1| Zea mays strain Y-12 phytoene synthase (Y1) gene,...	50	0.008
222	gb|AY300418.1| Zea mays strain SC60 phytoene synthase (Y1) gene,...	50	0.008
223	gb|AY300417.1| Zea mays strain Y-11 phytoene synthase (Y1) gene,...	50	0.008
224	gb|AY300416.1| Zea mays strain PI595566 phytoene synthase (Y1) g...	50	0.008
225	gb|AY300415.1| Zea mays strain PI595562 phytoene synthase (Y1) g...	50	0.008
226	gb|AY300414.1| Zea mays strain PI595559 phytoene synthase (Y1) g...	50	0.008
227	gb|AY300413.1| Zea mays strain PI595554 phytoene synthase (Y1) g...	50	0.008
228	gb|AY300412.1| Zea mays strain PI595553 phytoene synthase (Y1) g...	50	0.008
229	gb|AY300411.1| Zea mays strain PI593015 phytoene synthase (Y1) g...	50	0.008
230	gb|AY300410.1| Zea mays strain PI587132 phytoene synthase (Y1) g...	50	0.008
231	gb|AY300409.1| Zea mays strain PI583352 phytoene synthase (Y1) g...	50	0.008
232	gb|AY300408.1| Zea mays strain PI583351 phytoene synthase (Y1) g...	50	0.008
233	gb|AY300407.1| Zea mays strain PI583350 phytoene synthase (Y1) g...	50	0.008
234	gb|AY300406.1| Zea mays strain PI542777 phytoene synthase (Y1) g...	50	0.008
235	gb|AY300405.1| Zea mays strain PI340837 phytoene synthase (Y1) g...	50	0.008
236	gb|AY300404.1| Zea mays strain PI221788 phytoene synthase (Y1) g...	50	0.008
237	gb|AY300403.1| Zea mays strain PI221785 phytoene synthase (Y1) g...	50	0.008
238	gb|AY300402.1| Zea mays strain Mo17 phytoene synthase (Y1) gene,...	50	0.008
239	gb|AY300401.1| Zea mays strain Y-10 phytoene synthase (Y1) gene,...	50	0.008
240	gb|AY300400.1| Zea mays strain InbredLo32 phytoene synthase (Y1)...	50	0.008
241	gb|AY300399.1| Zea mays strain Y-9 phytoene synthase (Y1) gene, ...	50	0.008
242	gb|AY300398.1| Zea mays strain H60 phytoene synthase (Y1) gene, ...	50	0.008
243	gb|AY300397.1| Zea mays strain Y-8 phytoene synthase (Y1) gene, ...	50	0.008
244	gb|AY300396.1| Zea mays strain Y-7 phytoene synthase (Y1) gene, ...	50	0.008
245	gb|AY300395.1| Zea mays strain Y-6 phytoene synthase (Y1) gene, ...	50	0.008
246	gb|AY300394.1| Zea mays strain Y-5 phytoene synthase (Y1) gene, ...	50	0.008
247	gb|AY300393.1| Zea mays strain Y-4 phytoene synthase (Y1) gene, ...	50	0.008
248	gb|AY300392.1| Zea mays strain B73 phytoene synthase (Y1) gene, ...	50	0.008
249	gb|AY300391.1| Zea mays strain Y-3 phytoene synthase (Y1) gene, ...	50	0.008
250	gb|AY300390.1| Zea mays strain Ames24575 phytoene synthase (Y1) ...	50	0.008
251	gb|AY300389.1| Zea mays strain Ames23476 phytoene synthase (Y1) ...	50	0.008
252	gb|AY300388.1| Zea mays strain Ames23427 phytoene synthase (Y1) ...	50	0.008
253	gb|AY300387.1| Zea mays strain Ames12734 phytoene synthase (Y1) ...	50	0.008
254	gb|AY300386.1| Zea mays strain Y-2 phytoene synthase (Y1) gene, ...	50	0.008
255	gb|AY300385.1| Zea mays strain Y-1 phytoene synthase (Y1) gene, ...	50	0.008
256	gb|AY300384.1| Zea mays strain 66a42 phytoene synthase (Y1) gene...	50	0.008
257	gb|AY300383.1| Zea mays strain PI270297 phytoene synthase (Y1) g...	50	0.008
258	gb|AY300382.1| Zea mays strain PI186217 phytoene synthase (Y1) g...	50	0.008
259	gb|AY300381.1| Zea mays strain 1033aCatsul phytoene synthase (Y1...	50	0.008
260	gb|AY300547.1| Zea mays strain Y-10 phytoene synthase 2 (psy2) g...	50	0.008
261	gb|AY296458.1| Zea mays strain PI221738 phytoene synthase (Y1) g...	50	0.008
262	gb|DQ109038.1| Citrus clementina phytoene synthase (psy) mRNA, p...	50	0.008
263	gb|AF152892.2|AF152892 Citrus x paradisi phytoene synthase mRNA,...	50	0.008
264	gb|DQ235260.1| Citrus sinensis phytoene synthase mRNA, complete cds	50	0.008
265	gb|AY204550.1| Citrus sinensis phytoene synthase (psy) mRNA, par...	50	0.008
266	gb|AF220218.1|AF220218 Citrus unshiu phytoene synthase (Psy1) mR...	50	0.008
267	gb|AY111032.1| Zea mays CL1906_1 mRNA sequence	50	0.008
268	gb|DQ192186.1| Daucus carota subsp. sativus putative phytoene sy...	50	0.008
269	dbj|AB037975.1| Citrus unshiu mRNA for phytoene synthase, comple...	50	0.008
270	dbj|AB032797.1| Daucus carota PSY mRNA for phytoene synthase, co...	50	0.008
271	gb|AF251015.1|AF251015 Tagetes erecta phytoene synthase mRNA, pa...	48	0.032
272	emb|Z37543.1|CMPSY1MR C.melo PSY1 mRNA for phytoene synthase	48	0.032
273	ref|NM_121729.2| Arabidopsis thaliana PSY (PHYTOENE SYNTHASE); g...	46	0.12
274	ref|NM_001036818.1| Arabidopsis thaliana PSY (PHYTOENE SYNTHASE)...	46	0.12
275	emb|AJ888514.1| Crocus sativus partial mRNA for phytoene synthas...	46	0.12
276	gb|AY056287.1| Arabidopsis thaliana At5g17230 mRNA, complete seq...	46	0.12
277	gb|BT000450.1| Arabidopsis thaliana phytoene synthase (At5g17230...	46	0.12
278	dbj|AB011013.1| Gentiana lutea GENPSY3 mRNA for Phytoene synthas...	46	0.12
279	dbj|AB011011.1| Gentiana lutea GENPSY1 mRNA for phytoene synthas...	46	0.12
280	emb|BX828266.1|CNS0A2HP Arabidopsis thaliana Full-length cDNA Co...	46	0.12
281	emb|BX830903.1|CNS09YX9 Arabidopsis thaliana Full-length cDNA Co...	46	0.12
282	gb|AF196963.1|AF196963 Bixa orellana phytoene synthase (PSY) pse...	46	0.12
283	gb|AY085565.1| Arabidopsis thaliana clone 15761 mRNA, complete s...	46	0.12
284	gb|AF158024.1|AF158024 Tagetes erecta phytoene synthase mRNA, pa...	46	0.12
285	dbj|AB005238.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	46	0.12
286	gb|BT002084.1| Arabidopsis thaliana phytoene synthase (At5g17230...	46	0.12
287	gb|AF009954.1|AF009954 Arabidopsis thaliana phytoene synthase (P...	46	0.12
288	gb|AY613925.1| Bixa orellana phytoene synthase-like mRNA, partia...	46	0.12
289	gb|L25812.1|ATHPHYSYN Arabidopsis thaliana phytoene synthase mRN...	46	0.12
290	gb|AY494789.1| Momordica charantia var. abbreviata phytoene synt...	44	0.49
291	gb|DQ463306.1| Dunaliella sp. 336 phytoene synthase gene, comple...	44	0.49
292	gb|DQ463305.1| Dunaliella sp. 336 phytoene synthase mRNA, comple...	44	0.49
293	gb|AY300584.1| Zea mays strain PI583846 phytoene synthase 2 (psy...	44	0.49
294	gb|AY300553.1| Zea mays strain PI340837 phytoene synthase 2 (psy...	44	0.49
295	gb|AE004692.1| Pseudomonas aeruginosa PAO1, section 253 of 529 o...	44	0.49
296	gb|AY822067.1| Prunus armeniaca phytoene synthase 1 mRNA, partia...	44	0.49
297	emb|X60440.1|LEPSPS L.esculentum phytoene synthase pseudogene	44	0.49
298	gb|AY835634.1| Haematococcus pluvialis phytoene synthase (PSY) g...	42	1.9
299	gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome	42	1.9
300	gb|AC150551.1| Drosophila melanogaster clone BACR16A12, complete...	42	1.9
301	ref|XM_461421.1| Debaryomyces hansenii CBS767 hypothetical prote...	42	1.9
302	emb|Y11548.1|SPSNBCDE S.pristinaespiralis snbC gene & snbDE gene	42	1.9
303	emb|X98690.1|SPSNBCGEN S.pristinaespiralis snbC and snbDE genes	42	1.9
304	emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS...	42	1.9
305	gb|AC108141.4| Homo sapiens BAC clone RP11-400H15 from 4, comple...	42	1.9
306	dbj|AB011012.1| Gentiana lutea GENPSY2 mRNA for phytoene synthas...	42	1.9
307	ref|NM_134681.2| Drosophila melanogaster CG4164-RA (CG4164), mRNA	42	1.9
308	gb|AC115482.2| Drosophila melanogaster, chromosome 2L, region 21...	42	1.9
309	gb|AC093699.5| Homo sapiens BAC clone RP11-810C20 from 4, comple...	42	1.9
310	gb|AY051778.1| Drosophila melanogaster LD30318 full length cDNA	42	1.9
311	gb|DQ057355.1| Haematococcus pluvialis phytoene synthase mRNA, c...	42	1.9
312	gb|AE003589.4| Drosophila melanogaster chromosome 2L, section 2 ...	42	1.9
313	gb|AC005269.1|AC005269 Drosophila melanogaster DNA sequence (P1s...	42	1.9
314	gb|AF305430.1| Haematococcus pluvialis phytoene synthase mRNA, p...	42	1.9
315	gb|CP000111.1| Prochlorococcus marinus str. MIT 9312, complete g...	40	7.7
316	gb|BT023946.1| Drosophila melanogaster LD32003 full insert cDNA	40	7.7
317	gb|CP000110.1| Synechococcus sp. CC9605, complete genome	40	7.7
318	gb|AC007581.6| Drosophila melanogaster clone BACR03I24, complete...	40	7.7
319	gb|AC112143.5| Mus musculus BAC clone RP23-29E2 from chromosome ...	40	7.7
320	ref|XM_658321.1| Aspergillus nidulans FGSC A4 hypothetical prote...	40	7.7
321	gb|AF484556.1| Streptomyces atroolivaceus leinamycin biosyntheti...	40	7.7
322	gb|AC138457.3| Mus musculus BAC clone RP23-358E1 from chromosome...	40	7.7
323	gb|AC146227.2| Pan troglodytes BAC clone RP43-32J19 from 7, comp...	40	7.7
324	gb|AY300676.1| Zea mays strain W-8 phytoene synthase 2 (psy2) ge...	40	7.7
325	gb|AY300675.1| Zea mays strain W-7 phytoene synthase 2 (psy2) ge...	40	7.7
326	gb|AY300673.1| Zea mays strain W-50 phytoene synthase 2 (psy2) g...	40	7.7
327	gb|AY300672.1| Zea mays strain W-45 phytoene synthase 2 (psy2) g...	40	7.7
328	gb|AY300670.1| Zea mays strain W-28 phytoene synthase 2 (psy2) g...	40	7.7
329	gb|AY300668.1| Zea mays strain W-20 phytoene synthase 2 (psy2) g...	40	7.7
330	gb|AY300666.1| Zea mays strain W-17 phytoene synthase 2 (psy2) g...	40	7.7
331	gb|AY300648.1| Zea mays strain CIze127 phytoene synthase 2 (psy2...	40	7.7
332	gb|AY300646.1| Zea mays strain Ames22758 phytoene synthase 2 (ps...	40	7.7
333	gb|AY300642.1| Zea mays strain Y-14 phytoene synthase 2 (psy2) g...	40	7.7
334	gb|AY300640.1| Zea mays strain Y-12 phytoene synthase 2 (psy2) g...	40	7.7
335	gb|AY300638.1| Zea mays strain Y-11 phytoene synthase 2 (psy2) g...	40	7.7
336	gb|AY300636.1| Zea mays strain PI595562 phytoene synthase 2 (psy...	40	7.7
337	gb|AY300631.1| Zea mays strain PI587132 phytoene synthase 2 (psy...	40	7.7
338	gb|AY300621.1| Zea mays strain Y-10 phytoene synthase 2 (psy2) g...	40	7.7
339	gb|AY300620.1| Zea mays strain InbredLo32 phytoene synthase 2 (p...	40	7.7
340	gb|AY300617.1| Zea mays strain Y-8 phytoene synthase 2 (psy2) ge...	40	7.7
341	gb|AY300615.1| Zea mays strain Y-6 phytoene synthase 2 (psy2) ge...	40	7.7
342	gb|AY300614.1| Zea mays strain Y-5 phytoene synthase 2 (psy2) ge...	40	7.7
343	gb|AY300611.1| Zea mays strain Ames24575 phytoene synthase 2 (ps...	40	7.7
344	gb|AY300605.1| Zea mays strain 1033A Catsul phytoene synthase 2 ...	40	7.7
345	gb|CP000088.1| Thermobifida fusca YX, complete genome	40	7.7
346	gb|BT023795.1| Drosophila melanogaster GH08786 full insert cDNA	40	7.7
347	gb|BT024961.1| Drosophila melanogaster IP15272 full insert cDNA	40	7.7
348	ref|NM_169205.1| Drosophila melanogaster CG2747-RB, transcript v...	40	7.7
349	dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g...	40	7.7
350	ref|NM_141504.1| Drosophila melanogaster CG2747-RA, transcript v...	40	7.7
351	ref|NM_138097.2| Drosophila melanogaster CG3548-RA (CG3548), mRNA	40	7.7
352	gb|AY050235.1| Drosophila melanogaster SD02086 full length cDNA	40	7.7
353	gb|AC008093.4|AC008093 Drosophila melanogaster, chromosome 3R, r...	40	7.7
354	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	40	7.7
355	gb|AC007574.6|AC007574 Drosophila melanogaster, chromosome 2R, r...	40	7.7
356	ref|XM_218397.3| PREDICTED: Rattus norvegicus hypothetical LOC30...	40	7.7
357	dbj|AP005830.4| Oryza sativa (japonica cultivar-group) genomic D...	40	7.7
358	dbj|AP005258.4| Oryza sativa (japonica cultivar-group) genomic D...	40	7.7
359	emb|X63873.1|S7942PYS Synechococcus PCC7942 pys gene for phytoen...	40	7.7
360	emb|CR974423.21| Mouse DNA sequence from clone RP23-182F9 on chr...	40	7.7
361	gb|AE003677.3| Drosophila melanogaster chromosome 3R, section 15...	40	7.7
362	gb|AE003464.2| Drosophila melanogaster chromosome 2R, section 71...	40	7.7
363	gb|AC151478.1| Mus musculus BAC clone RP23-83K12 from 19, comple...	40	7.7
364	emb|AL928583.10| Mouse DNA sequence from clone RP23-287C12 on ch...	40	7.7
365	gb|AC153803.1| Mus musculus 6 BAC RP24-276E19 (Roswell Park Canc...	40	7.7
366	gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome	40	7.7

---

>gb|BT009537.1| Triticum aestivum clone wr1.pk0139.g3:fis, full insert mRNA
           sequence
          Length = 1021

 Score =  607 bits (306), Expect = e-170
 Identities = 360/378 (95%)
 Strand = Plus / Plus

                                                                       
Query: 190 aggaggaccgatgagttagtggatggccctaacgcgtcttacatcacacccaaggcgctc 249
           ||||| || |||||| ||||||||||||||||| | ||||||||||| ||||||||||||
Sbjct: 7   aggagaactgatgagctagtggatggccctaactcatcttacatcacgcccaaggcgctc 66

                                                                       
Query: 250 gatcggtgggagaagagattagaggatctcttcgaaggccgcccatatgacatgtacgac 309
           |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || 
Sbjct: 67  gatcggtgggagaagagattagaggatctcttcgaaggccgcccatatgatatgtatgat 126

                                                                       
Query: 310 gcggccctctcagacacagcgtcaaagtttccaattgatatccagccattcagagatatg 369
           || ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 127 gcagccctctcagatacagcgtcaaagtttccaattgatatccagccattcagagacatg 186

                                                                       
Query: 370 attgaagggatgaggcttgacctgtggaaatcgaggtataggacctttgacgagctttac 429
           ||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 187 attgaagggatgaggctcgacctttggaaatcgaggtataggacctttgacgagctctac 246

                                                                       
Query: 430 ctctactgctattacgtcgctggcaccgtcggtctcatgacggtaccggtgatggggatt 489
           ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 247 ctctactgctactacgtcgctggcactgtcggtctcatgacggtaccggtgatggggatt 306

                                                                       
Query: 490 gctccggactcaaaggcctcagcagagagcgtgtacaatgccgcactggcccttggcatt 549
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 307 gctccggactcaaaggcctcagcagagagcgtgtacaatgccgcactggcccttggcatt 366

                             
Query: 550 gccaaccagctgacaaac 567
           ||||||||||| ||||||
Sbjct: 367 gccaaccagctcacaaac 384

---

>gb|AY452768.1| Oryza sativa (japonica cultivar-group) phytoene synthase 2 mRNA,
           partial cds
          Length = 1176

 Score =  565 bits (285), Expect = e-158
 Identities = 447/501 (89%)
 Strand = Plus / Plus

                                                                       
Query: 63  cctcctcggcgacgcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacatt 122
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||
Sbjct: 46  cctcctcggcgacgcctaccaccgctgcggcgaggtctgcgccgagtacgccaagacctt 105

                                                                       
Query: 123 ctacctcggcacacagcttatgactcctgaaaggcgcaaagctgtttgggcaatctatgt 182
           |||||| || || |||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 106 ctacctaggtactcagcttatgactcctgaaaggcgcaaagctgtctgggcaatctatgt 165

                                                                       
Query: 183 atggtgcaggaggaccgatgagttagtggatggccctaacgcgtcttacatcacacccaa 242
           ||||||||| || || |||||  | || |||||||||||| |||||||||| ||||| ||
Sbjct: 166 atggtgcagaagaactgatgaactggtagatggccctaactcgtcttacattacaccaaa 225

                                                                       
Query: 243 ggcgctcgatcggtgggagaagagattagaggatctcttcgaaggccgcccatatgacat 302
           ||| || ||||| ||||||||||||||||| ||||||||||||||| | |||||||| ||
Sbjct: 226 ggcacttgatcgatgggagaagagattagaagatctcttcgaaggcaggccatatgatat 285

                                                                       
Query: 303 gtacgacgcggccctctcagacacagcgtcaaagtttccaattgatatccagccattcag 362
           ||| || || |||||||| ||||||| ||||||||||||| | |||||||||||||||| 
Sbjct: 286 gtatgatgcagccctctcggacacagtgtcaaagtttccagtagatatccagccattcaa 345

                                                                       
Query: 363 agatatgattgaagggatgaggcttgacctgtggaaatcgaggtataggacctttgacga 422
           ||| ||||||||||| ||||||||||||||||||||||| |||||||||| |||||| ||
Sbjct: 346 agacatgattgaaggaatgaggcttgacctgtggaaatcaaggtataggagctttgatga 405

                                                                       
Query: 423 gctttacctctactgctattacgtcgctggcaccgtcggtctcatgacggtaccggtgat 482
           ||| |||||||||||||| ||||| |||||||| || ||||||||||| |||||||||||
Sbjct: 406 gctctacctctactgctactacgttgctggcacggttggtctcatgacagtaccggtgat 465

                                                                       
Query: 483 ggggattgctccggactcaaaggcctcagcagagagcgtgtacaatgccgcactggccct 542
           ||||||||| || ||||| ||||||||| | |||||||||||||| || || || || ||
Sbjct: 466 ggggattgcccccgactcgaaggcctcaaccgagagcgtgtacaacgctgcgctagctct 525

                                
Query: 543 tggcattgccaaccagctgac 563
           ||| || ||||||||||||||
Sbjct: 526 tgggatcgccaaccagctgac 546

---

>dbj|AK073290.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033025L21, full
           insert sequence
          Length = 1486

 Score =  565 bits (285), Expect = e-158
 Identities = 447/501 (89%)
 Strand = Plus / Plus

                                                                       
Query: 63  cctcctcggcgacgcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacatt 122
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||
Sbjct: 383 cctcctcggcgacgcctaccaccgctgcggcgaggtctgcgccgagtacgccaagacctt 442

                                                                       
Query: 123 ctacctcggcacacagcttatgactcctgaaaggcgcaaagctgtttgggcaatctatgt 182
           |||||| || || |||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 443 ctacctaggtactcagcttatgactcctgaaaggcgcaaagctgtctgggcaatctatgt 502

                                                                       
Query: 183 atggtgcaggaggaccgatgagttagtggatggccctaacgcgtcttacatcacacccaa 242
           ||||||||| || || |||||  | || |||||||||||| |||||||||| ||||| ||
Sbjct: 503 atggtgcagaagaactgatgaactggtagatggccctaactcgtcttacattacaccaaa 562

                                                                       
Query: 243 ggcgctcgatcggtgggagaagagattagaggatctcttcgaaggccgcccatatgacat 302
           ||| || ||||| ||||||||||||||||| ||||||||||||||| | |||||||| ||
Sbjct: 563 ggcacttgatcgatgggagaagagattagaagatctcttcgaaggcaggccatatgatat 622

                                                                       
Query: 303 gtacgacgcggccctctcagacacagcgtcaaagtttccaattgatatccagccattcag 362
           ||| || || |||||||| ||||||| ||||||||||||| | |||||||||||||||| 
Sbjct: 623 gtatgatgcagccctctcggacacagtgtcaaagtttccagtagatatccagccattcaa 682

                                                                       
Query: 363 agatatgattgaagggatgaggcttgacctgtggaaatcgaggtataggacctttgacga 422
           ||| ||||||||||| ||||||||||||||||||||||| |||||||||| |||||| ||
Sbjct: 683 agacatgattgaaggaatgaggcttgacctgtggaaatcaaggtataggagctttgatga 742

                                                                       
Query: 423 gctttacctctactgctattacgtcgctggcaccgtcggtctcatgacggtaccggtgat 482
           ||| |||||||||||||| ||||| |||||||| || ||||||||||| |||||||||||
Sbjct: 743 gctctacctctactgctactacgttgctggcacggttggtctcatgacagtaccggtgat 802

                                                                       
Query: 483 ggggattgctccggactcaaaggcctcagcagagagcgtgtacaatgccgcactggccct 542
           ||||||||| || ||||| ||||||||| | |||||||||||||| || || || || ||
Sbjct: 803 ggggattgcccccgactcgaaggcctcaaccgagagcgtgtacaacgctgcgctagctct 862

                                
Query: 543 tggcattgccaaccagctgac 563
           ||| || ||||||||||||||
Sbjct: 863 tgggatcgccaaccagctgac 883

---

>gb|AY024350.1| Oryza sativa (japonica cultivar-group) phytoene synthase mRNA,
           partial cds
          Length = 1060

 Score =  470 bits (237), Expect = e-129
 Identities = 396/449 (88%)
 Strand = Plus / Plus

                                                                       
Query: 115 aagacattctacctcggcacacagcttatgactcctgaaaggcgcaaagctgtttgggca 174
           ||||| |||||||| || || |||||||||||||||||||||||||||||||| ||||||
Sbjct: 1   aagaccttctacctaggtactcagcttatgactcctgaaaggcgcaaagctgtctgggca 60

                                                                       
Query: 175 atctatgtatggtgcaggaggaccgatgagttagtggatggccctaacgcgtcttacatc 234
           ||||||||||||||||| || || |||||  | || |||||||||||| |||||||||| 
Sbjct: 61  atctatgtatggtgcagaagaactgatgaactggtagatggccctaactcgtcttacatt 120

                                                                       
Query: 235 acacccaaggcgctcgatcggtgggagaagagattagaggatctcttcgaaggccgccca 294
           ||||| ||||| || ||||| ||||||||||||||||| ||||||||||||||| | |||
Sbjct: 121 acaccaaaggcacttgatcgatgggagaagagattagaagatctcttcgaaggcaggcca 180

                                                                       
Query: 295 tatgacatgtacgacgcggccctctcagacacagcgtcaaagtttccaattgatatccag 354
           ||||| ||||| || || |||||||| ||||||| ||||||||||||| | |||||||||
Sbjct: 181 tatgatatgtatgatgcagccctctcggacacagtgtcaaagtttccagtagatatccag 240

                                                                       
Query: 355 ccattcagagatatgattgaagggatgaggcttgacctgtggaaatcgaggtataggacc 414
           ||||||| ||| ||||||||||| ||||||||||||||||||||||| |||||||||| |
Sbjct: 241 ccattcaaagacatgattgaaggaatgaggcttgacctgtggaaatcaaggtataggagc 300

                                                                       
Query: 415 tttgacgagctttacctctactgctattacgtcgctggcaccgtcggtctcatgacggta 474
           ||||| ||||| |||||||||||||| ||||| |||||||| || ||||||||||| |||
Sbjct: 301 tttgatgagctctacctctactgctactacgttgctggcacggttggtctcatgacagta 360

                                                                       
Query: 475 ccggtgatggggattgctccggactcaaaggcctcagcagagagcgtgtacaatgccgca 534
           ||||||||||||||||| || ||||| ||||||||| | |||||||||||||| || || 
Sbjct: 361 ccggtgatggggattgcccccgactcgaaggcctcaaccgagagcgtgtacaacgctgcg 420

                                        
Query: 535 ctggcccttggcattgccaaccagctgac 563
           || || ||||| || ||||||||||||||
Sbjct: 421 ctagctcttgggatcgccaaccagctgac 449

---

>dbj|AK063967.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-124-A11, full
           insert sequence
          Length = 1334

 Score =  470 bits (237), Expect = e-129
 Identities = 396/449 (88%)
 Strand = Plus / Plus

                                                                       
Query: 115 aagacattctacctcggcacacagcttatgactcctgaaaggcgcaaagctgtttgggca 174
           ||||| |||||||| || || |||||||||||||||||||||||||||||||| ||||||
Sbjct: 274 aagaccttctacctaggtactcagcttatgactcctgaaaggcgcaaagctgtctgggca 333

                                                                       
Query: 175 atctatgtatggtgcaggaggaccgatgagttagtggatggccctaacgcgtcttacatc 234
           ||||||||||||||||| || || |||||  | || |||||||||||| |||||||||| 
Sbjct: 334 atctatgtatggtgcagaagaactgatgaactggtagatggccctaactcgtcttacatt 393

                                                                       
Query: 235 acacccaaggcgctcgatcggtgggagaagagattagaggatctcttcgaaggccgccca 294
           ||||| ||||| || ||||| ||||||||||||||||| ||||||||||||||| | |||
Sbjct: 394 acaccaaaggcacttgatcgatgggagaagagattagaagatctcttcgaaggcaggcca 453

                                                                       
Query: 295 tatgacatgtacgacgcggccctctcagacacagcgtcaaagtttccaattgatatccag 354
           ||||| ||||| || || |||||||| ||||||| ||||||||||||| | |||||||||
Sbjct: 454 tatgatatgtatgatgcagccctctcggacacagtgtcaaagtttccagtagatatccag 513

                                                                       
Query: 355 ccattcagagatatgattgaagggatgaggcttgacctgtggaaatcgaggtataggacc 414
           ||||||| ||| ||||||||||| ||||||||||||||||||||||| |||||||||| |
Sbjct: 514 ccattcaaagacatgattgaaggaatgaggcttgacctgtggaaatcaaggtataggagc 573

                                                                       
Query: 415 tttgacgagctttacctctactgctattacgtcgctggcaccgtcggtctcatgacggta 474
           ||||| ||||| |||||||||||||| ||||| |||||||| || ||||||||||| |||
Sbjct: 574 tttgatgagctctacctctactgctactacgttgctggcacggttggtctcatgacagta 633

                                                                       
Query: 475 ccggtgatggggattgctccggactcaaaggcctcagcagagagcgtgtacaatgccgca 534
           ||||||||||||||||| || ||||| ||||||||| | |||||||||||||| || || 
Sbjct: 634 ccggtgatggggattgcccccgactcgaaggcctcaaccgagagcgtgtacaacgctgcg 693

                                        
Query: 535 ctggcccttggcattgccaaccagctgac 563
           || || ||||| || ||||||||||||||
Sbjct: 694 ctagctcttgggatcgccaaccagctgac 722

---

>gb|AY450646.1| Zea mays phytoene synthase 2 mRNA, partial cds
          Length = 1403

 Score =  412 bits (208), Expect = e-112
 Identities = 436/512 (85%)
 Strand = Plus / Plus

                                                                       
Query: 52  ctcggctggggcctcctcggcgacgcctacgaccgctgcggcgaggtctgcgccgagtac 111
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 305 ctcggctggggcctcctcggcgacgcctacgaccgctgcggcgaggtctgcgccgagtac 364

                                                                       
Query: 112 gccaagacattctacctcggcacacagcttatgactcctgaaaggcgcaaagctgtttgg 171
           |||||||| |||||||||||||| ||||| |||||||||||  |||||||||| || |||
Sbjct: 365 gccaagaccttctacctcggcacgcagctcatgactcctgagcggcgcaaagccgtctgg 424

                                                                       
Query: 172 gcaatctatgtatggtgcaggaggaccgatgagttagtggatggccctaacgcgtcttac 231
           || ||||| || |||||||| || || || ||| ||||||| || || |||||||| |||
Sbjct: 425 gcgatctacgtgtggtgcagaagaactgacgagctagtggacggtcccaacgcgtcctac 484

                                                                       
Query: 232 atcacacccaaggcgctcgatcggtgggagaagagattagaggatctcttcgaaggccgc 291
           ||||| || |  || ||||| || ||||||||| |  | ||||||||||| || ||||||
Sbjct: 485 atcacgccgaccgctctcgaccgctgggagaagcggctggaggatctctttgagggccgc 544

                                                                       
Query: 292 ccatatgacatgtacgacgcggccctctcagacacagcgtcaaagtttccaattgatatc 351
           || || |||||||||||||| || ||||| ||||| | ||| ||||| ||  | ||||||
Sbjct: 545 ccgtacgacatgtacgacgccgcgctctcggacaccgtgtccaagttccccgtcgatatc 604

                                                                       
Query: 352 cagccattcagagatatgattgaagggatgaggcttgacctgtggaaatcgaggtatagg 411
           ||||| |||| ||| ||| |  |||| |||||||| ||||||||||| |||||||| | |
Sbjct: 605 cagccgttcaaagacatggtccaaggaatgaggctggacctgtggaagtcgaggtacatg 664

                                                                       
Query: 412 acctttgacgagctttacctctactgctattacgtcgctggcaccgtcggtctcatgacg 471
           ||||| |||||||| |||||||||||||| |||||||| ||||||||||| |||||||||
Sbjct: 665 accttcgacgagctctacctctactgctactacgtcgccggcaccgtcggcctcatgacg 724

                                                                       
Query: 472 gtaccggtgatggggattgctccggactcaaaggcctcagcagagagcgtgtacaatgcc 531
           || || || ||||| || ||||| ||||| ||||||||  | ||||||||||||||||| 
Sbjct: 725 gtgcctgtcatgggcatcgctcccgactccaaggcctcgaccgagagcgtgtacaatgct 784

                                           
Query: 532 gcactggcccttggcattgccaaccagctgac 563
           || ||||| || ||||| || |||||||||||
Sbjct: 785 gctctggctctcggcatcgctaaccagctgac 816

---

>gb|AY108547.1| Zea mays PCO131047 mRNA sequence
          Length = 1201

 Score =  266 bits (134), Expect = 7e-68
 Identities = 359/434 (82%)
 Strand = Plus / Plus

                                                                       
Query: 130 ggcacacagcttatgactcctgaaaggcgcaaagctgtttgggcaatctatgtatggtgc 189
           ||||| ||||| |||||||||||  |||||||||| || ||||| ||||| || ||||||
Sbjct: 179 ggcacgcagctcatgactcctgagcggcgcaaagccgtctgggcgatctacgtgtggtgc 238

                                                                       
Query: 190 aggaggaccgatgagttagtggatggccctaacgcgtcttacatcacacccaaggcgctc 249
           || || || || ||| ||||||| || || |||||||| |||||||| || |  || |||
Sbjct: 239 agaagaactgacgagctagtggacggtcccaacgcgtcctacatcacgccgaccgctctc 298

                                                                       
Query: 250 gatcggtgggagaagagattagaggatctcttcgaaggccgcccatatgacatgtacgac 309
           || || ||||||||| |  | ||||||||||| || |||||||| || ||||||||||||
Sbjct: 299 gaccgctgggagaagcggctggaggatctctttgagggccgcccgtacgacatgtacgac 358

                                                                       
Query: 310 gcggccctctcagacacagcgtcaaagtttccaattgatatccagccattcagagatatg 369
           || || ||||| ||||| | ||| ||||| ||  | ||||||||||| |||| ||| |||
Sbjct: 359 gccgcgctctcggacactgtgtccaagttccccgtcgatatccagccgttcaaagacatg 418

                                                                       
Query: 370 attgaagggatgaggcttgacctgtggaaatcgaggtataggacctttgacgagctttac 429
            |  |||| |||||||| ||||||||||| |||||||| | |||||| |||||||| |||
Sbjct: 419 gtccaaggaatgaggctggacctgtggaagtcgaggtacatgaccttcgacgagctctac 478

                                                                       
Query: 430 ctctactgctattacgtcgctggcaccgtcggtctcatgacggtaccggtgatggggatt 489
           ||||||||||| |||||||| ||||||||||| ||||||||||| || || ||||| || 
Sbjct: 479 ctctactgctactacgtcgccggcaccgtcggcctcatgacggtgcctgtcatgggcatc 538

                                                                       
Query: 490 gctccggactcaaaggcctcagcagagagcgtgtacaatgccgcactggcccttggcatt 549
           ||||| ||||| ||||||||  | ||||||||||||||||| || ||||| || ||||| 
Sbjct: 539 gctcccgactccaaggcctcgaccgagagcgtgtacaatgctgctctggctctcggcatc 598

                         
Query: 550 gccaaccagctgac 563
           || |||||||||||
Sbjct: 599 gctaaccagctgac 612

---

>gb|AY024351.1| Oryza sativa (japonica cultivar-group) phytoene synthase gene,
            complete cds
          Length = 3222

 Score =  230 bits (116), Expect = 4e-57
 Identities = 188/212 (88%)
 Strand = Plus / Plus

                                                                        
Query: 352  cagccattcagagatatgattgaagggatgaggcttgacctgtggaaatcgaggtatagg 411
            |||||||||| ||| ||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 2031 cagccattcaaagacatgattgaaggaatgaggcttgacctgtggaaatcaaggtatagg 2090

                                                                        
Query: 412  acctttgacgagctttacctctactgctattacgtcgctggcaccgtcggtctcatgacg 471
            | |||||| ||||| |||||||||||||| ||||| |||||||| || ||||||||||| 
Sbjct: 2091 agctttgatgagctctacctctactgctactacgttgctggcacggttggtctcatgaca 2150

                                                                        
Query: 472  gtaccggtgatggggattgctccggactcaaaggcctcagcagagagcgtgtacaatgcc 531
            |||||||||||||||||||| || ||||| ||||||||| | |||||||||||||| || 
Sbjct: 2151 gtaccggtgatggggattgcccccgactcgaaggcctcaaccgagagcgtgtacaacgct 2210

                                            
Query: 532  gcactggcccttggcattgccaaccagctgac 563
            || || || ||||| || ||||||||||||||
Sbjct: 2211 gcgctagctcttgggatcgccaaccagctgac 2242



 Score =  155 bits (78), Expect = 2e-34
 Identities = 150/174 (86%)
 Strand = Plus / Plus

                                                                        
Query: 181  gtatggtgcaggaggaccgatgagttagtggatggccctaacgcgtcttacatcacaccc 240
            ||||||||||| || || |||||  | || |||||||||||| |||||||||| ||||| 
Sbjct: 1731 gtatggtgcagaagaactgatgaactggtagatggccctaactcgtcttacattacacca 1790

                                                                        
Query: 241  aaggcgctcgatcggtgggagaagagattagaggatctcttcgaaggccgcccatatgac 300
            ||||| || ||||| ||||||||||||||||| ||||||||||||||| | |||||||| 
Sbjct: 1791 aaggcacttgatcgatgggagaagagattagaagatctcttcgaaggcaggccatatgat 1850

                                                                  
Query: 301  atgtacgacgcggccctctcagacacagcgtcaaagtttccaattgatatccag 354
            ||||| || || |||||||| ||||||| ||||||||||||| | |||||||||
Sbjct: 1851 atgtatgatgcagccctctcggacacagtgtcaaagtttccagtagatatccag 1904



 Score =  115 bits (58), Expect = 2e-22
 Identities = 64/66 (96%)
 Strand = Plus / Plus

                                                                       
Query: 63  cctcctcggcgacgcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacatt 122
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||
Sbjct: 514 cctcctcggcgacgcctaccaccgctgcggcgaggtctgcgccgagtacgccaagacctt 573

                 
Query: 123 ctacct 128
           ||||||
Sbjct: 574 ctacct 579



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 45/46 (97%)
 Strand = Plus / Plus

                                                          
Query: 136  cagcttatgactcctgaaaggcgcaaagctgtttgggcaatctatg 181
            |||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 1571 cagcttatgactcctgaaaggcgcaaagctgtctgggcaatctatg 1616

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  230 bits (116), Expect = 4e-57
 Identities = 188/212 (88%)
 Strand = Plus / Minus

                                                                            
Query: 352      cagccattcagagatatgattgaagggatgaggcttgacctgtggaaatcgaggtatagg 411
                |||||||||| ||| ||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 26815236 cagccattcaaagacatgattgaaggaatgaggcttgacctgtggaaatcaaggtatagg 26815177

                                                                            
Query: 412      acctttgacgagctttacctctactgctattacgtcgctggcaccgtcggtctcatgacg 471
                | |||||| ||||| |||||||||||||| ||||| |||||||| || ||||||||||| 
Sbjct: 26815176 agctttgatgagctctacctctactgctactacgttgctggcacggttggtctcatgaca 26815117

                                                                            
Query: 472      gtaccggtgatggggattgctccggactcaaaggcctcagcagagagcgtgtacaatgcc 531
                |||||||||||||||||||| || ||||| ||||||||| | |||||||||||||| || 
Sbjct: 26815116 gtaccggtgatggggattgcccccgactcgaaggcctcaaccgagagcgtgtacaacgct 26815057

                                                
Query: 532      gcactggcccttggcattgccaaccagctgac 563
                || || || ||||| || ||||||||||||||
Sbjct: 26815056 gcgctagctcttgggatcgccaaccagctgac 26815025



 Score =  155 bits (78), Expect = 2e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                            
Query: 181      gtatggtgcaggaggaccgatgagttagtggatggccctaacgcgtcttacatcacaccc 240
                ||||||||||| || || |||||  | || |||||||||||| |||||||||| ||||| 
Sbjct: 26815536 gtatggtgcagaagaactgatgaactggtagatggccctaactcgtcttacattacacca 26815477

                                                                            
Query: 241      aaggcgctcgatcggtgggagaagagattagaggatctcttcgaaggccgcccatatgac 300
                ||||| || ||||| ||||||||||||||||| ||||||||||||||| | |||||||| 
Sbjct: 26815476 aaggcacttgatcgatgggagaagagattagaagatctcttcgaaggcaggccatatgat 26815417

                                                                      
Query: 301      atgtacgacgcggccctctcagacacagcgtcaaagtttccaattgatatccag 354
                ||||| || || |||||||| ||||||| ||||||||||||| | |||||||||
Sbjct: 26815416 atgtatgatgcagccctctcggacacagtgtcaaagtttccagtagatatccag 26815363



 Score =  115 bits (58), Expect = 2e-22
 Identities = 64/66 (96%)
 Strand = Plus / Minus

                                                                            
Query: 63       cctcctcggcgacgcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacatt 122
                ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||
Sbjct: 26816753 cctcctcggcgacgcctaccaccgctgcggcgaggtctgcgccgagtacgccaagacctt 26816694

                      
Query: 123      ctacct 128
                ||||||
Sbjct: 26816693 ctacct 26816688



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 45/46 (97%)
 Strand = Plus / Minus

                                                              
Query: 136      cagcttatgactcctgaaaggcgcaaagctgtttgggcaatctatg 181
                |||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 26815696 cagcttatgactcctgaaaggcgcaaagctgtctgggcaatctatg 26815651

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  230 bits (116), Expect = 4e-57
 Identities = 188/212 (88%)
 Strand = Plus / Minus

                                                                            
Query: 352      cagccattcagagatatgattgaagggatgaggcttgacctgtggaaatcgaggtatagg 411
                |||||||||| ||| ||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 26743406 cagccattcaaagacatgattgaaggaatgaggcttgacctgtggaaatcaaggtatagg 26743347

                                                                            
Query: 412      acctttgacgagctttacctctactgctattacgtcgctggcaccgtcggtctcatgacg 471
                | |||||| ||||| |||||||||||||| ||||| |||||||| || ||||||||||| 
Sbjct: 26743346 agctttgatgagctctacctctactgctactacgttgctggcacggttggtctcatgaca 26743287

                                                                            
Query: 472      gtaccggtgatggggattgctccggactcaaaggcctcagcagagagcgtgtacaatgcc 531
                |||||||||||||||||||| || ||||| ||||||||| | |||||||||||||| || 
Sbjct: 26743286 gtaccggtgatggggattgcccccgactcgaaggcctcaaccgagagcgtgtacaacgct 26743227

                                                
Query: 532      gcactggcccttggcattgccaaccagctgac 563
                || || || ||||| || ||||||||||||||
Sbjct: 26743226 gcgctagctcttgggatcgccaaccagctgac 26743195



 Score =  155 bits (78), Expect = 2e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                            
Query: 181      gtatggtgcaggaggaccgatgagttagtggatggccctaacgcgtcttacatcacaccc 240
                ||||||||||| || || |||||  | || |||||||||||| |||||||||| ||||| 
Sbjct: 26743706 gtatggtgcagaagaactgatgaactggtagatggccctaactcgtcttacattacacca 26743647

                                                                            
Query: 241      aaggcgctcgatcggtgggagaagagattagaggatctcttcgaaggccgcccatatgac 300
                ||||| || ||||| ||||||||||||||||| ||||||||||||||| | |||||||| 
Sbjct: 26743646 aaggcacttgatcgatgggagaagagattagaagatctcttcgaaggcaggccatatgat 26743587

                                                                      
Query: 301      atgtacgacgcggccctctcagacacagcgtcaaagtttccaattgatatccag 354
                ||||| || || |||||||| ||||||| ||||||||||||| | |||||||||
Sbjct: 26743586 atgtatgatgcagccctctcggacacagtgtcaaagtttccagtagatatccag 26743533



 Score =  115 bits (58), Expect = 2e-22
 Identities = 64/66 (96%)
 Strand = Plus / Minus

                                                                            
Query: 63       cctcctcggcgacgcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacatt 122
                ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||
Sbjct: 26744923 cctcctcggcgacgcctaccaccgctgcggcgaggtctgcgccgagtacgccaagacctt 26744864

                      
Query: 123      ctacct 128
                ||||||
Sbjct: 26744863 ctacct 26744858



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 45/46 (97%)
 Strand = Plus / Minus

                                                              
Query: 136      cagcttatgactcctgaaaggcgcaaagctgtttgggcaatctatg 181
                |||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 26743866 cagcttatgactcctgaaaggcgcaaagctgtctgggcaatctatg 26743821

---

>emb|AL831803.4|CNS08CAG Oryza sativa chromosome 12, . BAC OSJNBb0016P08 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 142370

 Score =  230 bits (116), Expect = 4e-57
 Identities = 188/212 (88%)
 Strand = Plus / Minus

                                                                         
Query: 352   cagccattcagagatatgattgaagggatgaggcttgacctgtggaaatcgaggtatagg 411
             |||||||||| ||| ||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 19203 cagccattcaaagacatgattgaaggaatgaggcttgacctgtggaaatcaaggtatagg 19144

                                                                         
Query: 412   acctttgacgagctttacctctactgctattacgtcgctggcaccgtcggtctcatgacg 471
             | |||||| ||||| |||||||||||||| ||||| |||||||| || ||||||||||| 
Sbjct: 19143 agctttgatgagctctacctctactgctactacgttgctggcacggttggtctcatgaca 19084

                                                                         
Query: 472   gtaccggtgatggggattgctccggactcaaaggcctcagcagagagcgtgtacaatgcc 531
             |||||||||||||||||||| || ||||| ||||||||| | |||||||||||||| || 
Sbjct: 19083 gtaccggtgatggggattgcccccgactcgaaggcctcaaccgagagcgtgtacaacgct 19024

                                             
Query: 532   gcactggcccttggcattgccaaccagctgac 563
             || || || ||||| || ||||||||||||||
Sbjct: 19023 gcgctagctcttgggatcgccaaccagctgac 18992



 Score =  155 bits (78), Expect = 2e-34
 Identities = 150/174 (86%)
 Strand = Plus / Minus

                                                                         
Query: 181   gtatggtgcaggaggaccgatgagttagtggatggccctaacgcgtcttacatcacaccc 240
             ||||||||||| || || |||||  | || |||||||||||| |||||||||| ||||| 
Sbjct: 19503 gtatggtgcagaagaactgatgaactggtagatggccctaactcgtcttacattacacca 19444

                                                                         
Query: 241   aaggcgctcgatcggtgggagaagagattagaggatctcttcgaaggccgcccatatgac 300
             ||||| || ||||| ||||||||||||||||| ||||||||||||||| | |||||||| 
Sbjct: 19443 aaggcacttgatcgatgggagaagagattagaagatctcttcgaaggcaggccatatgat 19384

                                                                   
Query: 301   atgtacgacgcggccctctcagacacagcgtcaaagtttccaattgatatccag 354
             ||||| || || |||||||| ||||||| ||||||||||||| | |||||||||
Sbjct: 19383 atgtatgatgcagccctctcggacacagtgtcaaagtttccagtagatatccag 19330



 Score =  115 bits (58), Expect = 2e-22
 Identities = 64/66 (96%)
 Strand = Plus / Minus

                                                                         
Query: 63    cctcctcggcgacgcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacatt 122
             ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||
Sbjct: 20720 cctcctcggcgacgcctaccaccgctgcggcgaggtctgcgccgagtacgccaagacctt 20661

                   
Query: 123   ctacct 128
             ||||||
Sbjct: 20660 ctacct 20655



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 45/46 (97%)
 Strand = Plus / Minus

                                                           
Query: 136   cagcttatgactcctgaaaggcgcaaagctgtttgggcaatctatg 181
             |||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 19663 cagcttatgactcctgaaaggcgcaaagctgtctgggcaatctatg 19618

---

>gb|AY325302.1| Zea mays B73 phytoene synthase 2 (PSY2) gene, complete cds
          Length = 4839

 Score =  170 bits (86), Expect = 3e-39
 Identities = 164/190 (86%)
 Strand = Plus / Plus

                                                                        
Query: 374  aagggatgaggcttgacctgtggaaatcgaggtataggacctttgacgagctttacctct 433
            |||| |||||||| ||||||||||| |||||||| | |||||| |||||||| |||||||
Sbjct: 3031 aaggaatgaggctggacctgtggaagtcgaggtacatgaccttcgacgagctctacctct 3090

                                                                        
Query: 434  actgctattacgtcgctggcaccgtcggtctcatgacggtaccggtgatggggattgctc 493
            ||||||| |||||||| ||||||||||| ||||||||||| || || ||||| || ||||
Sbjct: 3091 actgctactacgtcgccggcaccgtcggcctcatgacggtgcctgtcatgggcatcgctc 3150

                                                                        
Query: 494  cggactcaaaggcctcagcagagagcgtgtacaatgccgcactggcccttggcattgcca 553
            | ||||| ||||||||  | ||||||||||||||||| || ||||| || ||||| || |
Sbjct: 3151 ccgactccaaggcctcgaccgagagcgtgtacaatgctgctctggctctcggcatcgcta 3210

                      
Query: 554  accagctgac 563
            ||||||||||
Sbjct: 3211 accagctgac 3220



 Score =  143 bits (72), Expect = 7e-31
 Identities = 78/80 (97%)
 Strand = Plus / Plus

                                                                        
Query: 52   ctcggctggggcctcctcggcgacgcctacgaccgctgcggcgaggtctgcgccgagtac 111
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1747 ctcggctggggcctcctcggcgacgcctacgaccgctgcggcgaggtctgcgccgagtac 1806

                                
Query: 112  gccaagacattctacctcgg 131
            |||||||| || ||||||||
Sbjct: 1807 gccaagaccttttacctcgg 1826



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                        
Query: 184  tggtgcaggaggaccgatgagttagtggatggccctaacgcgtcttacatcacacccaag 243
            |||||||| || || || ||| ||||||| || || |||||||| |||||||| || |  
Sbjct: 2695 tggtgcagaagaactgacgagctagtggacggtcccaacgcgtcctacatcacgccgacc 2754

                                                                        
Query: 244  gcgctcgatcggtgggagaagagattagaggatctcttcgaaggccgcccatatgacatg 303
            || ||||| || ||||||||| |  | ||||||||||| || |||||||| || ||||||
Sbjct: 2755 gctctcgaccgctgggagaagcggctggaggatctctttgagggccgcccgtacgacatg 2814

                                   
Query: 304  tacgacgcggccctctcagacac 326
            |||||||| || ||||| |||||
Sbjct: 2815 tacgacgccgcgctctcggacac 2837



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 130  ggcacacagcttatgactcctgaaaggcgcaaagctgtttgggcaatcta 179
            ||||| ||||| |||||||||||  |||||||||| || ||||| |||||
Sbjct: 2541 ggcacgcagctcatgactcctgagcggcgcaaagccgtctgggcgatcta 2590

---

>gb|AY266046.1| Zea mays phytoene synthase 2 gene, partial cds
          Length = 1262

 Score =  170 bits (86), Expect = 3e-39
 Identities = 164/190 (86%)
 Strand = Plus / Plus

                                                                       
Query: 374 aagggatgaggcttgacctgtggaaatcgaggtataggacctttgacgagctttacctct 433
           |||| |||||||| ||||||||||| |||||||| | |||||| |||||||| |||||||
Sbjct: 241 aaggaatgaggctggacctgtggaagtcgaggtacatgaccttcgacgagctctacctct 300

                                                                       
Query: 434 actgctattacgtcgctggcaccgtcggtctcatgacggtaccggtgatggggattgctc 493
           ||||||| |||||||| ||||||||||| ||||||||||| || || ||||| || ||||
Sbjct: 301 actgctactacgtcgccggcaccgtcggcctcatgacggtgcctgtcatgggcatcgctc 360

                                                                       
Query: 494 cggactcaaaggcctcagcagagagcgtgtacaatgccgcactggcccttggcattgcca 553
           | ||||| ||||||||  | ||||||||||||||||| || ||||| || ||||| || |
Sbjct: 361 ccgactccaaggcctcgaccgagagcgtgtacaatgctgctctggctctcggcatcgcta 420

                     
Query: 554 accagctgac 563
           ||||||||||
Sbjct: 421 accagctgac 430



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AC137593.2| Oryza sativa (Japonica cultiva-group) chromosome 9 BAC clone
             OSJNBa0043I04, complete sequence
          Length = 145191

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 75/86 (87%)
 Strand = Plus / Minus

                                                                         
Query: 400   tcgaggtataggacctttgacgagctttacctctactgctattacgtcgctggcaccgtc 459
             |||||||| |||| ||| |||||||| |||||||||||||| |||||||| || || |||
Sbjct: 87762 tcgaggtacaggagcttcgacgagctctacctctactgctactacgtcgccggaacggtc 87703

                                       
Query: 460   ggtctcatgacggtaccggtgatggg 485
             || ||||||||||| ||||| |||||
Sbjct: 87702 gggctcatgacggtgccggtcatggg 87677



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                      
Query: 75    cgcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
             ||||| ||| ||||||||||||||||||   ||||||||||||||||||||||||||
Sbjct: 89354 cgccttcgatcgctgcggcgaggtctgcaaggagtacgccaagacattctacctcgg 89298

---

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 75/86 (87%)
 Strand = Plus / Minus

                                                                            
Query: 400      tcgaggtataggacctttgacgagctttacctctactgctattacgtcgctggcaccgtc 459
                |||||||| |||| ||| |||||||| |||||||||||||| |||||||| || || |||
Sbjct: 21741742 tcgaggtacaggagcttcgacgagctctacctctactgctactacgtcgccggaacggtc 21741683

                                          
Query: 460      ggtctcatgacggtaccggtgatggg 485
                || ||||||||||| ||||| |||||
Sbjct: 21741682 gggctcatgacggtgccggtcatggg 21741657



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                         
Query: 75       cgcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
                ||||| ||| ||||||||||||||||||   ||||||||||||||||||||||||||
Sbjct: 21743334 cgccttcgatcgctgcggcgaggtctgcaaggagtacgccaagacattctacctcgg 21743278

---

>dbj|AK108154.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-G05, full
           insert sequence
          Length = 1485

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 75/86 (87%)
 Strand = Plus / Plus

                                                                       
Query: 400 tcgaggtataggacctttgacgagctttacctctactgctattacgtcgctggcaccgtc 459
           |||||||| |||| ||| |||||||| |||||||||||||| |||||||| || || |||
Sbjct: 647 tcgaggtacaggagcttcgacgagctctacctctactgctactacgtcgccggaacggtc 706

                                     
Query: 460 ggtctcatgacggtaccggtgatggg 485
           || ||||||||||| ||||| |||||
Sbjct: 707 gggctcatgacggtgccggtcatggg 732



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 75  cgcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||| ||| ||||||||||||||||||   |||||||||||||||||||||||||
Sbjct: 322 cgccttcgatcgctgcggcgaggtctgcaaggagtacgccaagacattctacctcg 377

---

>gb|AY078162.1| Oryza sativa (indica cultivar-group) phytoene synthase radicle
           isoform mRNA, partial cds
          Length = 629

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Plus

                                                                       
Query: 400 tcgaggtataggacctttgacgagctttacctctactgctattacgtcgctggcaccgtc 459
           |||||||| |||| ||| |||||| | |||||||||||||| |||||||| || || |||
Sbjct: 48  tcgaggtacaggagcttcgacgaggtctacctctactgctactacgtcgccggaacggtc 107

                                     
Query: 460 ggtctcatgacggtaccggtgatggg 485
           || ||||||||||| ||||| |||||
Sbjct: 108 gggctcatgacggtgccggtcatggg 133

---

>gb|DQ494214.1| Citrullus lanatus phytoene synthase (psy) mRNA, partial cds
          Length = 747

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 334 aagtttccaattgatatccagccattcagagatatgattgaagggatgagg 384
           ||||||||| ||||||| ||||| |||||||||||||| ||||||||||||
Sbjct: 292 aagtttccagttgatattcagccgttcagagatatgatcgaagggatgagg 342



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 142 atgactcctgaaaggcgcaaagctgtttgggcaatctatgtatggtgcaggaggaccgat 201
           ||||||||||| ||||  || ||| |||||||||| ||||||||||| |||||||| |||
Sbjct: 100 atgactcctgagaggcaaaaggctatttgggcaatttatgtatggtgtaggaggacagat 159

             
Query: 202 ga 203
           ||
Sbjct: 160 ga 161

---

>gb|AY661705.1| Adonis palaestina phytoene synthase (Psy) mRNA, partial cds
          Length = 1336

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 123/153 (80%)
 Strand = Plus / Plus

                                                                       
Query: 151 gaaaggcgcaaagctgtttgggcaatctatgtatggtgcaggaggaccgatgagttagtg 210
           |||||||| |||||| ||||||| || || ||||||||||||||||| |||||| | || 
Sbjct: 395 gaaaggcgaaaagctatttgggctatatacgtatggtgcaggaggacagatgagcttgta 454

                                                                       
Query: 211 gatggccctaacgcgtcttacatcacacccaaggcgctcgatcggtgggagaagagatta 270
           ||||| || || || | | |||| ||||| | |||  | ||| |||||||   ||| |||
Sbjct: 455 gatgggccgaatgcttgtcacataacaccaatggctttggataggtgggaatcgaggtta 514

                                            
Query: 271 gaggatctcttcgaaggccgcccatatgacatg 303
           ||||||||||||  ||| ||||| |||||||||
Sbjct: 515 gaggatctcttccgaggtcgcccgtatgacatg 547

---

>gb|BT012712.1| Lycopersicon esculentum clone 113593R, mRNA sequence
          Length = 1863

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 337 tttccaattgatatccagccattcagagatatgattgaagg 377
           |||||| ||||||| ||||||||||||||||||||||||||
Sbjct: 932 tttccagttgatattcagccattcagagatatgattgaagg 972



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 169 tgggcaatctatgtatggtgcaggaggaccgatgagttagtggatggccctaacgc 224
           |||||||| |||||||||||||| || || |||||  | || |||||||| |||||
Sbjct: 764 tgggcaatatatgtatggtgcagaagaacagatgaacttgttgatggcccaaacgc 819

---

>emb|Y00521.1|LERIPE Tomato fruit ripening specific mRNA
          Length = 1614

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 337 tttccaattgatatccagccattcagagatatgattgaagg 377
           |||||| ||||||| ||||||||||||||||||||||||||
Sbjct: 819 tttccagttgatattcagccattcagagatatgattgaagg 859



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 169 tgggcaatctatgtatggtgcaggaggaccgatgagttagtggatggccctaacgc 224
           |||||||| |||||||||||||| || || |||||  | || |||||||| |||||
Sbjct: 651 tgggcaatatatgtatggtgcagaagaacagatgaacttgttgatggcccaaacgc 706

---

>emb|X68017.1|CAPSY1 C.annuum psy1 mRNA for phytoene synthase
          Length = 1295

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 337 tttccaattgatatccagccattcagagatatgattgaagg 377
           |||||| ||||||| ||||||||||||||||||||||||||
Sbjct: 655 tttccagttgatattcagccattcagagatatgattgaagg 695

---

>emb|X67144.1|LERYGTOM5 L.esculentum (rY mutant) GTOM5 mRNA for mutant phytoene synthase
          Length = 1355

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 337 tttccaattgatatccagccattcagagatatgattgaagg 377
           |||||| ||||||| ||||||||||||||||||||||||||
Sbjct: 627 tttccagttgatattcagccattcagagatatgattgaagg 667



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 169 tgggcaatctatgtatggtgcaggaggaccgatgagttagtggatggccctaacgc 224
           |||||||| |||||||||||||| || || |||||  | || |||||||| |||||
Sbjct: 459 tgggcaatatatgtatggtgcagaagaacagatgaacttgttgatggcccaaacgc 514

---

>gb|M84744.1|TOMCBPE Tomato phytoene synthetase mRNA, complete cds
          Length = 1786

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 337 tttccaattgatatccagccattcagagatatgattgaagg 377
           |||||| ||||||| ||||||||||||||||||||||||||
Sbjct: 932 tttccagttgatattcagccattcagagatatgattgaagg 972



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 169 tgggcaatctatgtatggtgcaggaggaccgatgagttagtggatggccctaacgc 224
           |||||||| |||||||||||||| || || |||||  | || |||||||| |||||
Sbjct: 764 tgggcaatatatgtatggtgcagaagaacagatgaacttgttgatggcccaaacgc 819

---

>gb|DQ192187.1| Daucus carota subsp. sativus putative phytoene synthase (PSY2) mRNA,
            complete cds
          Length = 1939

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 334  aagtttccaattgatatccagccattcagagatatgattgaagggatgagg 384
            ||||||||  |||| ||||| ||||||| ||||||||||||||||||||||
Sbjct: 1044 aagtttcctgttgacatccaaccattcaaagatatgattgaagggatgagg 1094

---

>gb|DQ335097.1| Lycopersicon esculentum phytoene synthase mRNA, complete cds
          Length = 1476

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 337 tttccaattgatatccagccattcagagatatgattgaagg 377
           |||||| ||||||| | ||||||||||||||||||||||||
Sbjct: 619 tttccagttgatattctgccattcagagatatgattgaagg 659



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 353 agccattcagagatatgattgaagg 377
           |||||||||||||||||||||||||
Sbjct: 872 agccattcagagatatgattgaagg 896



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 169 tgggcaatctatgtatggtgcaggaggaccgatgagttagtggatggccctaacgc 224
           |||||||| |||||||||||||| || || |||||  | || |||||||| |||||
Sbjct: 451 tgggcaatatatgtatggtgcagaagaacagatgaacttgttgatggcccaaacgc 506

---

>gb|AY324431.1| Zea mays chloroplast phytoene synthase 1 (PSY1) gene, complete cds;
            nuclear gene for chloroplast product
          Length = 4945

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 76   gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
            ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 1544 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 1599



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                             
Query: 352  cagccattcagagatatgattgaagggatgagg 384
            ||||||||||| || ||||||||||||||||||
Sbjct: 3416 cagccattcagggacatgattgaagggatgagg 3448

---

>gb|AY455286.1| Zea mays chloroplast phytoene synthase (Y1) gene, complete cds; nuclear
             gene for chloroplast product
          Length = 94829

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                     
Query: 76    gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
             ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 41940 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 41995



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 352   cagccattcagagatatgattgaagggatgagg 384
             ||||||||||| || ||||||||||||||||||
Sbjct: 43812 cagccattcagggacatgattgaagggatgagg 43844

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                    
Query: 52       ctcggctggggcctcctcggcgacgcctacgaccgctgcggcgaggtctgcg 103
                |||| |||||||||| | ||||||||| | ||||||||||||||| ||||||
Sbjct: 25737713 ctcgactggggcctctttggcgacgccaatgaccgctgcggcgagctctgcg 25737764

---

>gb|AC137991.3| Oryza sativa chromosome 3 BAC OSJNBa0034D21 genomic sequence, complete
              sequence
          Length = 190834

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                  
Query: 52     ctcggctggggcctcctcggcgacgcctacgaccgctgcggcgaggtctgcg 103
              |||| |||||||||| | ||||||||| | ||||||||||||||| ||||||
Sbjct: 107183 ctcgactggggcctctttggcgacgccaatgaccgctgcggcgagctctgcg 107132

---

>gb|AY496865.1| Oncidium cv. 'Gower Ramsey' phytoene synthase (PSY) mRNA, complete
           cds
          Length = 1576

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 169 tgggcaatctatgtatggtgcaggaggaccgatgagttagtggatggccctaacgc 224
           |||||||||||||||||||||||||| || |||||  | |||||||| || |||||
Sbjct: 547 tgggcaatctatgtatggtgcaggagaacagatgaacttgtggatggtcccaacgc 602



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 344 ttgatatccagccattcagagatatgattgaagggatgag 383
           |||| |||||||||||||  || ||||||||||| |||||
Sbjct: 722 ttgacatccagccattcaaggacatgattgaaggaatgag 761

---

>emb|AJ889824.1| Populus alba x Populus tremula partial mRNA for putative phytoene
           synthase (psy gene)
          Length = 549

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 106/132 (80%)
 Strand = Plus / Plus

                                                                       
Query: 414 ctttgacgagctttacctctactgctattacgtcgctggcaccgtcggtctcatgacggt 473
           |||||| ||||||||||| ||||||||||| || || || || || || || ||||  ||
Sbjct: 238 ctttgatgagctttacctgtactgctattatgttgccgggacagtggggctaatgagtgt 297

                                                                       
Query: 474 accggtgatggggattgctccggactcaaaggcctcagcagagagcgtgtacaatgccgc 533
            || |||||||| || || ||||| || ||||||||| |||| ||||| ||||| || ||
Sbjct: 298 tccagtgatgggaatagcaccggaatccaaggcctcaacagaaagcgtctacaacgcggc 357

                       
Query: 534 actggcccttgg 545
            || ||||||||
Sbjct: 358 tctagcccttgg 369



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 178 tatgtatggtgcaggaggaccgatgagttagtggatggccctaacgcgtcttacatcaca 237
           ||||| ||||||||||| || |||||| | |||||||||||||| || ||  | ||||||
Sbjct: 2   tatgtgtggtgcaggagaactgatgagcttgtggatggccctaatgcatcacatatcaca 61

                
Query: 238 cccaa 242
           |||||
Sbjct: 62  cccaa 66

---

>gb|AY300602.1| Zea mays strain W-8 phytoene synthase 2 (psy2) gene, partial cds
          Length = 215

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300601.1| Zea mays strain W-7 phytoene synthase 2 (psy2) gene, partial cds
          Length = 211

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300600.1| Zea mays strain W-6 phytoene synthase 2 (psy2) gene, partial cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300598.1| Zea mays strain W-45 phytoene synthase 2 (psy2) gene, partial cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300597.1| Zea mays strain W-37 phytoene synthase 2 (psy2) gene, partial cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300596.1| Zea mays strain W-28 phytoene synthase 2 (psy2) gene, partial cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300595.1| Zea mays strain W-21 phytoene synthase 2 (psy2) gene, partial cds
          Length = 223

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300594.1| Zea mays strain W-20 phytoene synthase 2 (psy2) gene, partial cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300593.1| Zea mays strain W-2 phytoene synthase 2 (psy2) gene, partial cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300591.1| Zea mays strain W-16 phytoene synthase 2 (psy2) gene, partial cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300590.1| Zea mays strain Stock6 phytoene synthase 2 (psy2) gene, partial cds
          Length = 212

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300589.1| Zea mays strain PI595547 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300588.1| Zea mays strain PI595546 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300587.1| Zea mays strain PI595539 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300586.1| Zea mays strain PI595532 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300585.1| Zea mays strain PI595531 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300583.1| Zea mays strain PI561605 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 211

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300582.1| Zea mays strain PI550545 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300581.1| Zea mays strain PI550442 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300580.1| Zea mays strain PI406108 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300579.1| Zea mays strain PI340838 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300577.1| Zea mays strain PI221738 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 212

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 1   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 56

---

>gb|AY300575.1| Zea mays strain NC296 phytoene synthase 2 (psy2) gene, partial cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300574.1| Zea mays strain CIze127 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 203

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300573.1| Zea mays strain Ames23418 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300572.1| Zea mays strain Ames22758 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300571.1| Zea mays strain Ames22754 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300570.1| Zea mays strain Ames22443 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300569.1| Zea mays strain Ames22026 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 227

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300567.1| Zea mays strain Y-13 phytoene synthase 2 (psy2) gene, partial cds
          Length = 223

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300566.1| Zea mays strain Y-12 phytoene synthase 2 (psy2) gene, partial cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300565.1| Zea mays strain SC60 phytoene synthase 2 (psy2) gene, partial cds
          Length = 212

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300564.1| Zea mays strain Y-11 phytoene synthase 2 (psy2) gene, partial cds
          Length = 215

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300563.1| Zea mays strain PI595566 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300562.1| Zea mays strain PI595562 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300561.1| Zea mays strain PI595554 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300560.1| Zea mays strain PI595553 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300559.1| Zea mays strain PI593015 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 215

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300557.1| Zea mays strain PI583352 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300556.1| Zea mays strain PI583351 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300555.1| Zea mays strain PI583350 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300554.1| Zea mays strain PI542777 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300552.1| Zea mays strain PI270297 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 223

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300549.1| Zea mays strain PI186217 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300548.1| Zea mays strain Mo17 phytoene synthase 2 (psy2) gene, partial cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300546.1| Zea mays strain InbredLo32 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300545.1| Zea mays strain Y-9 phytoene synthase 2 (psy2) gene, partial cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300544.1| Zea mays strain H60 phytoene synthase 2 (psy2) gene, partial cds
          Length = 212

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300543.1| Zea mays strain Y-8 phytoene synthase 2 (psy2) gene, partial cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300542.1| Zea mays strain Y-7 phytoene synthase 2 (psy2) gene, partial cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300541.1| Zea mays strain Y-6 phytoene synthase 2 (psy2) gene, partial cds
          Length = 215

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300540.1| Zea mays strain Y-5 phytoene synthase 2 (psy2) gene, partial cds
          Length = 215

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300539.1| Zea mays strain B73 phytoene synthase 2 (psy2) gene, partial cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300538.1| Zea mays strain Y-3 phytoene synthase 2 (psy2) gene, partial cds
          Length = 208

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300537.1| Zea mays strain Ames24575 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300536.1| Zea mays strain Ames23476 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300535.1| Zea mays strain Ames23427 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 215

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300534.1| Zea mays strain Ames12734 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300533.1| Zea mays strain Y-2 phytoene synthase 2 (psy2) gene, partial cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300532.1| Zea mays strain 66a4-2 phytoene synthase 2 (psy2) gene, partial cds
          Length = 227

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300531.1| Zea mays strain 1033A Catsul phytoene synthase 2 (psy2) gene,
           partial cds
          Length = 207

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY300530.1| Zea mays strain Y-1 phytoene synthase 2 (psy2) gene, partial cds
          Length = 219

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 271 gaggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 4   gaggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 59

---

>gb|AY296472.1| Zea mays strain W-16 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 575

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 517 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 572

---

>gb|AY296471.1| Zea mays strain Stock6 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 575

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 517 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 572

---

>gb|AY296470.1| Zea mays strain PI595547 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 561

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 505 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 560

---

>gb|AY296469.1| Zea mays strain PI595546 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 578

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 520 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 575

---

>gb|AY296468.1| Zea mays strain PI595539 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 566

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 508 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 563

---

>gb|AY296467.1| Zea mays strain PI595532 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 563

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 505 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 560

---

>gb|AY296466.1| Zea mays strain PI595531 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 575

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 517 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 572

---

>gb|AY296465.1| Zea mays strain PI583846 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 563

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 505 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 560

---

>gb|AY296464.1| Zea mays strain PI561605 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 566

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 508 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 563

---

>gb|AY296463.1| Zea mays strain PI550545 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 563

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 505 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 560

---

>gb|AY296462.1| Zea mays strain PI550442 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 563

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 505 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 560

---

>gb|AY296461.1| Zea mays strain PI406108 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 572

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 514 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 569

---

>gb|AY296460.1| Zea mays strain PI340838 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 563

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 505 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 560

---

>gb|AY296459.1| Zea mays strain PI340836 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 566

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 508 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 563

---

>gb|AY296457.1| Zea mays strain PI221733 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 575

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 517 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 572

---

>gb|AY296456.1| Zea mays strain NC296 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 563

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 505 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 560

---

>gb|AY296455.1| Zea mays strain CIze127 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 566

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 508 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 563

---

>gb|AY296454.1| Zea mays strain Ames23418 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 566

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 508 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 563

---

>gb|AY296453.1| Zea mays strain Ames22758 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 566

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 508 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 563

---

>gb|AY296452.1| Zea mays strain Ames22754 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 566

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 508 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 563

---

>gb|AY296451.1| Zea mays strain Ames22443 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 566

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 508 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 563

---

>gb|AY296450.1| Zea mays strain Ames22026 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 575

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 517 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 572

---

>gb|AY296447.1| Zea mays strain Y-12 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 988

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 930 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 985

---

>gb|AY296446.1| Zea mays strain SC60 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 979

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 921 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 976

---

>gb|AY296444.1| Zea mays strain PI595566 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 968

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 910 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 965

---

>gb|AY296442.1| Zea mays strain PI595559 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 970

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 912 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 967

---

>gb|AY296441.1| Zea mays strain PI595554 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 991

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 933 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 988

---

>gb|AY296440.1| Zea mays strain PI595553 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 979

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 921 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 976

---

>gb|AY296439.1| Zea mays strain PI593015 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 976

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 918 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 973

---

>gb|AY296438.1| Zea mays strain PI587132 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 908 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 963

---

>gb|AY296437.1| Zea mays strain PI583352 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 979

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 921 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 976

---

>gb|AY296436.1| Zea mays strain PI583351 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 908 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 963

---

>gb|AY296435.1| Zea mays strain PI583350 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 979

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 921 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 976

---

>gb|AY296434.1| Zea mays strain PI542777 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 908 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 963

---

>gb|AY296433.1| Zea mays strain PI340837 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 908 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 963

---

>gb|AY296432.1| Zea mays strain PI221788 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 979

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 921 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 976

---

>gb|AY296431.1| Zea mays strain PI221785 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 908 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 963

---

>gb|AY296429.1| Zea mays strain Y-10 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 979

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 921 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 976

---

>gb|AY296428.1| Zea mays strain InbredLo32 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 572

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 514 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 569

---

>gb|AY296418.1| Zea mays strain Ames24575 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 908 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 963

---

>gb|AY296417.1| Zea mays strain Ames23476 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 908 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 963

---

>gb|AY296416.1| Zea mays strain Ames23427 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 979

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 921 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 976

---

>gb|AY296415.1| Zea mays strain Ames12734 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 979

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 921 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 976

---

>gb|AY296412.1| Zea mays strain 66a42 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 962

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 904 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 959

---

>gb|AY296411.1| Zea mays strain PI270297 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 908 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 963

---

>gb|AY296410.1| Zea mays strain PI186217 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 908 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 963

---

>gb|AY296409.1| Zea mays strain 1033aCatsul phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 976

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
           ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 918 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 973

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                    
Query: 52       ctcggctggggcctcctcggcgacgcctacgaccgctgcggcgaggtctgcg 103
                |||| |||||||||| | ||||||||| | ||||||||||||||| ||||||
Sbjct: 25829022 ctcgactggggcctctttggcgacgccaatgaccgctgcggcgagctctgcg 25829073

---

>gb|U32636.1|ZMU32636 Zea mays phytoene synthase (Y1) gene, complete cds
          Length = 5995

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 76   gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcgg 131
            ||||||||||||||||||||| |||| |  ||||| |||||||| || ||||||||
Sbjct: 2285 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcgg 2340



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                             
Query: 352  cagccattcagagatatgattgaagggatgagg 384
            ||||||||||| || ||||||||||||||||||
Sbjct: 4160 cagccattcagggacatgattgaagggatgagg 4192

---

>gb|AY973631.1| Oncidium Gower Ramsey phytoene synthase mRNA, complete cds
          Length = 1383

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 169 tgggcaatctatgtatggtgcaggaggaccgatgagttagtggatggccctaacgcgtc 227
           |||||||||||||| ||||||||||| || |||||  | |||||||| || ||||||||
Sbjct: 503 tgggcaatctatgtgtggtgcaggagaacagatgaacttgtggatggtcccaacgcgtc 561



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 344 ttgatatccagccattcagagatatgattgaagggatgag 383
           |||| |||||||||||||  || ||||||||||| |||||
Sbjct: 678 ttgacatccagccattcaaggacatgattgaaggaatgag 717

---

>gb|AY300551.1| Zea mays strain PI221788 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 211

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 272 aggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           |||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 1   aggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 55

---

>gb|AY296483.1| Zea mays strain W-8 phytoene synthase (Y1) gene, exon 1 and partial
           cds
          Length = 562

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 508 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 562

---

>gb|AY296482.1| Zea mays strain W-7 phytoene synthase (Y1) gene, exon 1 and partial
           cds
          Length = 559

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 505 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 559

---

>gb|AY296481.1| Zea mays strain W-6 phytoene synthase (Y1) gene, exon 1 and partial
           cds
          Length = 559

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 505 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 559

---

>gb|AY296480.1| Zea mays strain W-50 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 562

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 508 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 562

---

>gb|AY296479.1| Zea mays strain W-45 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 562

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 508 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 562

---

>gb|AY296478.1| Zea mays strain W-37 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 571

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 517 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 571

---

>gb|AY296477.1| Zea mays strain W-28 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 559

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 505 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 559

---

>gb|AY296476.1| Zea mays strain W-21 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 559

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 505 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 559

---

>gb|AY296475.1| Zea mays strain W-20 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 562

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 508 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 562

---

>gb|AY296474.1| Zea mays strain W-2 phytoene synthase (Y1) gene, exon 1 and partial
           cds
          Length = 559

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 505 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 559

---

>gb|AY296473.1| Zea mays strain W-17 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 559

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 505 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 559

---

>gb|AY296449.1| Zea mays strain Y-14 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 975

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 921 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 975

---

>gb|AY296448.1| Zea mays strain Y-13 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 975

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 921 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 975

---

>gb|AY296445.1| Zea mays strain Y-11 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 975

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 921 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 975

---

>gb|AY296443.1| Zea mays strain PI595562 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 990

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 936 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 990

---

>gb|AY296430.1| Zea mays strain Mo17 phytoene synthase (Y1) gene, exon 1 and
           partial cds
          Length = 975

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 921 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 975

---

>gb|AY296427.1| Zea mays strain Y-9 phytoene synthase (Y1) gene, exon 1 and partial
           cds
          Length = 975

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 921 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 975

---

>gb|AY296426.1| Zea mays strain H60 phytoene synthase (Y1) gene, exon 1 and partial
           cds
          Length = 975

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 921 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 975

---

>gb|AY296425.1| Zea mays strain Y-8 phytoene synthase (Y1) gene, exon 1 and partial
           cds
          Length = 958

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 904 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 958

---

>gb|AY296424.1| Zea mays strain Y-7 phytoene synthase (Y1) gene, exon 1 and partial
           cds
          Length = 969

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 915 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 969

---

>gb|AY296423.1| Zea mays strain Y-6 phytoene synthase (Y1) gene, exon 1 and partial
           cds
          Length = 975

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 921 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 975

---

>gb|AY296422.1| Zea mays strain Y-5 phytoene synthase (Y1) gene, exon 1 and partial
           cds
          Length = 958

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 904 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 958

---

>gb|AY296421.1| Zea mays strain Y-4 phytoene synthase (Y1) gene, exon 1 and partial
           cds
          Length = 975

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 921 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 975

---

>gb|AY296420.1| Zea mays strain B73 phytoene synthase (Y1) gene, exon 1 and partial
           cds
          Length = 958

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 904 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 958

---

>gb|AY296419.1| Zea mays strain Y-3 phytoene synthase (Y1) gene, exon 1 and partial
           cds
          Length = 962

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 908 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 962

---

>gb|AY296414.1| Zea mays strain Y-2 phytoene synthase (Y1) gene, exon 1 and partial
           cds
          Length = 958

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 904 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 958

---

>gb|AY296413.1| Zea mays strain Y-1 phytoene synthase (Y1) gene, exon 1 and partial
           cds
          Length = 975

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 76  gcctacgaccgctgcggcgaggtctgcgccgagtacgccaagacattctacctcg 130
           ||||||||||||||||||||| |||| |  ||||| |||||||| || |||||||
Sbjct: 921 gcctacgaccgctgcggcgagatctgtgaggagtatgccaagacgttttacctcg 975

---

>dbj|AB011014.1| Gentiana lutea GENPSY4 mRNA for phytoene synthase, complete cds
          Length = 2851

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 169 tgggcaatctatgtatggtgcaggaggaccgatgagttagtggatggccctaacgcgtc 227
           ||||| || ||||||||||| |||||||| |||||| | || ||||| |||||||||||
Sbjct: 901 tgggcgatatatgtatggtgtaggaggacagatgagcttgttgatgggcctaacgcgtc 959



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 349  atccagccattcagagatatgattgaagg 377
            ||||||||||| ||||||||||| |||||
Sbjct: 1081 atccagccatttagagatatgatagaagg 1109

---

>gb|AY986508.1| Mespilus germanica PSY mRNA, complete cds
          Length = 1292

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 169 tgggcaatctatgtatggtgcaggaggaccgatgagttagtggatggccctaacgcgtc 227
           ||||| || ||||||||||| |||||||| |||||| | || ||||| |||||||||||
Sbjct: 508 tgggcgatatatgtatggtgtaggaggacagatgagcttgttgatgggcctaacgcgtc 566



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 349 atccagccattcagagatatgattgaagg 377
           ||||||||||| ||||||||||| |||||
Sbjct: 688 atccagccatttagagatatgatagaagg 716

---

>gb|AY920918.1| Lycium barbarum phytoene synthase mRNA, complete cds
          Length = 1278

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 169 tgggcaatctatgtatggtgcaggaggaccgatgagttagtggatggccctaacgcgtc 227
           ||||| || ||||||||||| |||||||| |||||| | || ||||| |||||||||||
Sbjct: 502 tgggcgatatatgtatggtgtaggaggacagatgagcttgttgatgggcctaacgcgtc 560



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 349 atccagccattcagagatatgattgaagg 377
           ||||||||||| ||||||||||| |||||
Sbjct: 682 atccagccatttagagatatgatagaagg 710

---

>emb|X60441.1|LEGTOM5 L.esculentum GTom5 gene for phytoene synthase
          Length = 3707

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 352  cagccattcagagatatgattgaagg 377
            ||||||||||||||||||||||||||
Sbjct: 1696 cagccattcagagatatgattgaagg 1721

---

>gb|AY300454.1| Zea mays strain W-7 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 899

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 89/110 (80%)
 Strand = Plus / Plus

                                                                       
Query: 352 cagccattcagagatatgattgaagggatgaggcttgacctgtggaaatcgaggtatagg 411
           ||||||||||| || ||||||||||||||||||  ||| ||  ||||  | |||||||  
Sbjct: 271 cagccattcagggacatgattgaagggatgaggagtgatcttaggaagacaaggtataac 330

                                                             
Query: 412 acctttgacgagctttacctctactgctattacgtcgctggcaccgtcgg 461
           | ||| |||||||| ||| | |||||||| || |||||||| || |||||
Sbjct: 331 aacttcgacgagctctacatgtactgctactatgtcgctggaactgtcgg 380

---

>gb|AY300440.1| Zea mays strain PI595539 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 899

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 89/110 (80%)
 Strand = Plus / Plus

                                                                       
Query: 352 cagccattcagagatatgattgaagggatgaggcttgacctgtggaaatcgaggtatagg 411
           ||||||||||| || ||||||||||||||||||  ||| ||  ||||  | |||||||  
Sbjct: 271 cagccattcagggacatgattgaagggatgaggagtgatcttaggaagacaaggtataac 330

                                                             
Query: 412 acctttgacgagctttacctctactgctattacgtcgctggcaccgtcgg 461
           | ||| |||||||| ||| | |||||||| || |||||||| || |||||
Sbjct: 331 aacttcgacgagctctacatgtactgctactatgtcgctggaactgtcgg 380

---

>gb|AY300438.1| Zea mays strain PI595531 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 899

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 89/110 (80%)
 Strand = Plus / Plus

                                                                       
Query: 352 cagccattcagagatatgattgaagggatgaggcttgacctgtggaaatcgaggtatagg 411
           ||||||||||| || ||||||||||||||||||  ||| ||  ||||  | |||||||  
Sbjct: 271 cagccattcagggacatgattgaagggatgaggagtgatcttaggaagacaaggtataac 330

                                                             
Query: 412 acctttgacgagctttacctctactgctattacgtcgctggcaccgtcgg 461
           | ||| |||||||| ||| | |||||||| || |||||||| || |||||
Sbjct: 331 aacttcgacgagctctacatgtactgctactatgtcgctggaactgtcgg 380

---

>gb|AY300578.1| Zea mays strain PI340836 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 210

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 273 ggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 1   ggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 54

---

>gb|AY300576.1| Zea mays strain PI221733 phytoene synthase 2 (psy2) gene, partial
           cds
          Length = 210

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 273 ggatctcttcgaaggccgcccatatgacatgtacgacgcggccctctcagacac 326
           ||||||||| || |||||||| || |||||||||||||| || ||||| |||||
Sbjct: 1   ggatctctttgagggccgcccgtacgacatgtacgacgccgcgctctcggacac 54

---

>emb|X78814.1|NPPSY N.pseudonarcissus mRNA for phytoene synthase
          Length = 1548

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 167 tttgggcaatctatgtatggtgcaggaggaccgatgag 204
           |||||||||| ||||| ||||||||||| |||||||||
Sbjct: 569 tttgggcaatttatgtttggtgcaggagaaccgatgag 606



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 414 ctttgacgagctttacctctactgctattacgt 446
           |||||||||||| |||||||| |||||||||||
Sbjct: 816 ctttgacgagctctacctctattgctattacgt 848

---

>gb|L23424.1|TOMPSY2A Lycopersicon esculentum phytoene synthase (PSY2) mRNA, complete cds
          Length = 1119

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 344 ttgatatccagccattcagagatatgattgaagg 377
           ||||||| |||||||||||||||||| |||||||
Sbjct: 315 ttgatattcagccattcagagatatggttgaagg 348



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 169 tgggcaatctatgtatggtgcaggaggaccgatgagttagtggatggccctaa 221
           |||||||| ||||| ||||||||||| || |||||| | || |||||||||||
Sbjct: 140 tgggcaatatatgtgtggtgcaggagaactgatgagcttgttgatggccctaa 192

---

>gb|DQ229827.1| Daucus carota chloroplast phytoene synthase mRNA, partial cds;
           nuclear gene for chloroplast product
          Length = 769

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 76/93 (81%)
 Strand = Plus / Plus

                                                                       
Query: 415 tttgacgagctttacctctactgctattacgtcgctggcaccgtcggtctcatgacggta 474
           ||||| ||||| |||||||||||||| || || ||||| || || || || ||||  || 
Sbjct: 328 tttgatgagctctacctctactgctactatgttgctggaacagttggactgatgagtgtt 387

                                            
Query: 475 ccggtgatggggattgctccggactcaaaggcc 507
           || || ||||||||||| ||||| |||||||||
Sbjct: 388 ccagttatggggattgccccggaatcaaaggcc 420



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 85/105 (80%)
 Strand = Plus / Plus

                                                                       
Query: 162 agctgtttgggcaatctatgtatggtgcaggaggaccgatgagttagtggatggccctaa 221
           ||||||||||||||||||||| ||||| || ||||| || ||| |||| || || |||||
Sbjct: 75  agctgtttgggcaatctatgtgtggtgtagaaggactgacgagctagtagacgggcctaa 134

                                                        
Query: 222 cgcgtcttacatcacacccaaggcgctcgatcggtgggagaagag 266
            || ||  | ||||| |||||||| || ||  | |||||||||||
Sbjct: 135 tgcctcccatatcacgcccaaggctcttgacagatgggagaagag 179

---

>gb|AY601075.1| Dunaliella salina phytoene synthase mRNA, complete cds
          Length = 1260

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 106 gagtacgccaagacattctacctcggcacacagcttatgac 146
           |||||||||||||| |||||||| ||||| ||||| |||||
Sbjct: 400 gagtacgccaagaccttctacctgggcacgcagctcatgac 440



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 169 tgggcaatctatgtatggtgcaggaggaccgatgagttagtggatggccctaa 221
           ||||| ||||| || ||||||||| | || |||||| | ||||||||||||||
Sbjct: 463 tgggccatctacgtgtggtgcaggcgcacggatgagctggtggatggccctaa 515

---

>gb|AY547325.1| Dunaliella salina phytoene synthase gene, complete cds
          Length = 2983

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 106 gagtacgccaagacattctacctcggcacacagcttatgac 146
           |||||||||||||| |||||||| ||||| ||||| |||||
Sbjct: 400 gagtacgccaagaccttctacctgggcacgcagctcatgac 440



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 169 tgggcaatctatgtatggtgcaggaggaccgatgagttagtggatggccctaa 221
           ||||| ||||| || ||||||||| | || |||||| | ||||||||||||||
Sbjct: 463 tgggccatctacgtgtggtgcaggcgcacggatgagctggtggatggccctaa 515

---

>gb|AY669084.1| Citrus sinensis PSY mRNA, partial cds
          Length = 898

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           |||||||||||||||||||| ||||| ||||||
Sbjct: 496 cagccattcagagatatgatagaaggaatgagg 528

---

>gb|AY300455.1| Zea mays strain W-8 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 905

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 277 cagccattcagggacatgattgaagggatgagg 309

---

>gb|AY300453.1| Zea mays strain W-6 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300452.1| Zea mays strain W-50 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 885

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 257 cagccattcagggacatgattgaagggatgagg 289

---

>gb|AY300451.1| Zea mays strain W-45 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 905

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 277 cagccattcagggacatgattgaagggatgagg 309

---

>gb|AY300450.1| Zea mays strain W-37 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 740

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 112 cagccattcagggacatgattgaagggatgagg 144

---

>gb|AY300449.1| Zea mays strain W-28 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 885

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 257 cagccattcagggacatgattgaagggatgagg 289

---

>gb|AY300448.1| Zea mays strain W-21 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 905

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 277 cagccattcagggacatgattgaagggatgagg 309

---

>gb|AY300447.1| Zea mays strain W-20 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 885

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 257 cagccattcagggacatgattgaagggatgagg 289

---

>gb|AY300446.1| Zea mays strain W-2 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300445.1| Zea mays strain W-17 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 905

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 277 cagccattcagggacatgattgaagggatgagg 309

---

>gb|AY300444.1| Zea mays strain W-16 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300443.1| Zea mays strain Stock6 phytoene synthase (Y1) gene, exons 4, 5, and
           6 and partial cds
          Length = 740

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 112 cagccattcagggacatgattgaagggatgagg 144

---

>gb|AY300442.1| Zea mays strain PI595547 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 880

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 252 cagccattcagggacatgattgaagggatgagg 284

---

>gb|AY300441.1| Zea mays strain PI595546 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300439.1| Zea mays strain PI595532 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 905

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 277 cagccattcagggacatgattgaagggatgagg 309

---

>gb|AY300437.1| Zea mays strain PI583846 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 905

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 277 cagccattcagggacatgattgaagggatgagg 309

---

>gb|AY300436.1| Zea mays strain PI561605 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 905

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 277 cagccattcagggacatgattgaagggatgagg 309

---

>gb|AY300435.1| Zea mays strain PI550545 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 885

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 257 cagccattcagggacatgattgaagggatgagg 289

---

>gb|AY300434.1| Zea mays strain PI550442 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 885

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 257 cagccattcagggacatgattgaagggatgagg 289

---

>gb|AY300433.1| Zea mays strain PI406108 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 905

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 277 cagccattcagggacatgattgaagggatgagg 309

---

>gb|AY300432.1| Zea mays strain PI340838 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300431.1| Zea mays strain PI340836 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 891

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 263 cagccattcagggacatgattgaagggatgagg 295

---

>gb|AY300430.1| Zea mays strain PI221738 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 891

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 263 cagccattcagggacatgattgaagggatgagg 295

---

>gb|AY300429.1| Zea mays strain PI221733 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300428.1| Zea mays strain NC296 phytoene synthase (Y1) gene, exons 4, 5, and
           6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300427.1| Zea mays strain CIze127 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 885

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 257 cagccattcagggacatgattgaagggatgagg 289

---

>gb|AY300426.1| Zea mays strain Ames23418 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 891

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 263 cagccattcagggacatgattgaagggatgagg 295

---

>gb|AY300425.1| Zea mays strain Ames22758 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300424.1| Zea mays strain Ames22754 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300423.1| Zea mays strain Ames22443 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 891

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 263 cagccattcagggacatgattgaagggatgagg 295

---

>gb|AY300422.1| Zea mays strain Ames22026 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 740

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 112 cagccattcagggacatgattgaagggatgagg 144

---

>gb|AY300421.1| Zea mays strain Y-14 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300420.1| Zea mays strain Y-13 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300419.1| Zea mays strain Y-12 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300418.1| Zea mays strain SC60 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300417.1| Zea mays strain Y-11 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300416.1| Zea mays strain PI595566 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300415.1| Zea mays strain PI595562 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300414.1| Zea mays strain PI595559 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300413.1| Zea mays strain PI595554 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300412.1| Zea mays strain PI595553 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300411.1| Zea mays strain PI593015 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300410.1| Zea mays strain PI587132 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300409.1| Zea mays strain PI583352 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300408.1| Zea mays strain PI583351 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300407.1| Zea mays strain PI583350 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300406.1| Zea mays strain PI542777 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300405.1| Zea mays strain PI340837 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300404.1| Zea mays strain PI221788 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300403.1| Zea mays strain PI221785 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300402.1| Zea mays strain Mo17 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300401.1| Zea mays strain Y-10 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300400.1| Zea mays strain InbredLo32 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 912

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 284 cagccattcagggacatgattgaagggatgagg 316

---

>gb|AY300399.1| Zea mays strain Y-9 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300398.1| Zea mays strain H60 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300397.1| Zea mays strain Y-8 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300396.1| Zea mays strain Y-7 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 885

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 257 cagccattcagggacatgattgaagggatgagg 289

---

>gb|AY300395.1| Zea mays strain Y-6 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300394.1| Zea mays strain Y-5 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300393.1| Zea mays strain Y-4 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300392.1| Zea mays strain B73 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300391.1| Zea mays strain Y-3 phytoene synthase (Y1) gene, exons 4, 5, and 6
           and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290

---

>gb|AY300390.1| Zea mays strain Ames24575 phytoene synthase (Y1) gene, exons 4, 5,
           and 6 and partial cds
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 352 cagccattcagagatatgattgaagggatgagg 384
           ||||||||||| || ||||||||||||||||||
Sbjct: 258 cagccattcagggacatgattgaagggatgagg 290


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,431,105
Number of Sequences: 3902068
Number of extensions: 3431105
Number of successful extensions: 67381
Number of sequences better than 10.0: 366
Number of HSP's better than 10.0 without gapping: 366
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 66659
Number of HSP's gapped (non-prelim): 717
length of query: 567
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 544
effective length of database: 17,143,297,704
effective search space: 9325953950976
effective search space used: 9325953950976
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---