Clone Name	bah63l10
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	ref|XM_483589.1| Oryza sativa (japonica cultivar-group), mRNA	414	e-112
2	ref|XM_507312.1| PREDICTED Oryza sativa (japonica cultivar-group...	414	e-112
3	dbj|AK101416.1| Oryza sativa (japonica cultivar-group) cDNA clon...	414	e-112
4	dbj|AK058490.1| Oryza sativa (japonica cultivar-group) cDNA clon...	414	e-112
5	gb|AY104606.1| Zea mays PCO071007 mRNA sequence	155	2e-34
6	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	153	9e-34
7	dbj|AP003914.3| Oryza sativa (japonica cultivar-group) genomic D...	153	9e-34
8	dbj|AP003948.2| Oryza sativa (japonica cultivar-group) genomic D...	153	9e-34
9	gb|AY111978.1| Zea mays CL45039_-2 mRNA sequence	127	5e-26
10	ref|XM_483591.1| Oryza sativa (japonica cultivar-group), mRNA	94	7e-16
11	emb|BX065427.1|CNS09MNB Single read from an extremity of a full-...	60	9e-06
12	emb|BX036885.1|CNS090MH Single read from an extremity of a full-...	60	9e-06
13	emb|BX062168.1|CNS09K4S Single read from an extremity of a full-...	56	1e-04
14	emb|BX029473.1|CNS08UWL Single read from an extremity of a full-...	56	1e-04
15	emb|BX019031.1|CNS08MUJ Single read from an extremity of a full-...	56	1e-04
16	emb|BX017181.1|CNS08LF5 Single read from an extremity of a full-...	56	1e-04
17	emb|BX049251.1|CNS09A5Z Single read from an extremity of a full-...	54	6e-04
18	gb|AC135599.3| Oryza sativa (japonica cultivar-group) chromosome...	52	0.002
19	gb|AC136447.4| Oryza sativa (japonica cultivar-group) chromosome...	52	0.002
20	emb|BX053396.1|CNS09DD4 Single read from an extremity of a full-...	52	0.002
21	emb|BX072064.1|CNS09RRO Single read from an extremity of a full-...	52	0.002
22	emb|BX071791.1|CNS09RK3 Single read from an extremity of a full-...	52	0.002
23	emb|BX071790.1|CNS09RK2 Single read from an extremity of a full-...	52	0.002
24	emb|BX071653.1|CNS09RG9 Single read from an extremity of a full-...	52	0.002
25	emb|BX071652.1|CNS09RG8 Single read from an extremity of a full-...	52	0.002
26	emb|BX071452.1|CNS09RAO Single read from an extremity of a full-...	52	0.002
27	emb|BX071451.1|CNS09RAN Single read from an extremity of a full-...	52	0.002
28	emb|BX071396.1|CNS09R94 Single read from an extremity of a full-...	52	0.002
29	emb|BX071298.1|CNS09R6E Single read from an extremity of a full-...	52	0.002
30	emb|BX071259.1|CNS09R5B Single read from an extremity of a full-...	52	0.002
31	emb|BX071258.1|CNS09R5A Single read from an extremity of a full-...	52	0.002
32	emb|BX071034.1|CNS09QZ2 Single read from an extremity of a full-...	52	0.002
33	emb|BX071033.1|CNS09QZ1 Single read from an extremity of a full-...	52	0.002
34	emb|BX070988.1|CNS09QXS Single read from an extremity of a full-...	52	0.002
35	emb|BX070987.1|CNS09QXR Single read from an extremity of a full-...	52	0.002
36	emb|BX070913.1|CNS09QVP Single read from an extremity of a full-...	52	0.002
37	emb|BX070912.1|CNS09QVO Single read from an extremity of a full-...	52	0.002
38	emb|BX070805.1|CNS09QSP Single read from an extremity of a full-...	52	0.002
39	emb|BX070804.1|CNS09QSO Single read from an extremity of a full-...	52	0.002
40	emb|BX070631.1|CNS09QNV Single read from an extremity of a full-...	52	0.002
41	emb|BX070630.1|CNS09QNU Single read from an extremity of a full-...	52	0.002
42	emb|BX070560.1|CNS09QLW Single read from an extremity of a full-...	52	0.002
43	emb|BX070494.1|CNS09QK2 Single read from an extremity of a full-...	52	0.002
44	emb|BX070493.1|CNS09QK1 Single read from an extremity of a full-...	52	0.002
45	emb|BX070258.1|CNS09QDI Single read from an extremity of a full-...	52	0.002
46	emb|BX070053.1|CNS09Q7T Single read from an extremity of a full-...	52	0.002
47	emb|BX070052.1|CNS09Q7S Single read from an extremity of a full-...	52	0.002
48	emb|BX070015.1|CNS09Q6R Single read from an extremity of a full-...	52	0.002
49	emb|BX070014.1|CNS09Q6Q Single read from an extremity of a full-...	52	0.002
50	emb|BX069981.1|CNS09Q5T Single read from an extremity of a full-...	52	0.002
51	emb|BX069946.1|CNS09Q4U Single read from an extremity of a full-...	52	0.002
52	emb|BX069852.1|CNS09Q28 Single read from an extremity of a full-...	52	0.002
53	emb|BX069851.1|CNS09Q27 Single read from an extremity of a full-...	52	0.002
54	emb|BX069725.1|CNS09PYP Single read from an extremity of a full-...	52	0.002
55	emb|BX069724.1|CNS09PYO Single read from an extremity of a full-...	52	0.002
56	emb|BX069627.1|CNS09PVZ Single read from an extremity of a full-...	52	0.002
57	emb|BX069626.1|CNS09PVY Single read from an extremity of a full-...	52	0.002
58	emb|BX069444.1|CNS09PQW Single read from an extremity of a full-...	52	0.002
59	emb|BX069443.1|CNS09PQV Single read from an extremity of a full-...	52	0.002
60	emb|BX069442.1|CNS09PQU Single read from an extremity of a full-...	52	0.002
61	emb|BX069441.1|CNS09PQT Single read from an extremity of a full-...	52	0.002
62	emb|BX069361.1|CNS09POL Single read from an extremity of a full-...	52	0.002
63	emb|BX069360.1|CNS09POK Single read from an extremity of a full-...	52	0.002
64	emb|BX069131.1|CNS09PI7 Single read from an extremity of a full-...	52	0.002
65	emb|BX069130.1|CNS09PI6 Single read from an extremity of a full-...	52	0.002
66	emb|BX069121.1|CNS09PHX Single read from an extremity of a full-...	52	0.002
67	emb|BX069029.1|CNS09PFD Single read from an extremity of a full-...	52	0.002
68	emb|BX069028.1|CNS09PFC Single read from an extremity of a full-...	52	0.002
69	emb|BX068969.1|CNS09PDP Single read from an extremity of a full-...	52	0.002
70	emb|BX068968.1|CNS09PDO Single read from an extremity of a full-...	52	0.002
71	emb|BX068913.1|CNS09PC5 Single read from an extremity of a full-...	52	0.002
72	emb|BX068796.1|CNS09P8W Single read from an extremity of a full-...	52	0.002
73	emb|BX068679.1|CNS09P5N Single read from an extremity of a full-...	52	0.002
74	emb|BX068678.1|CNS09P5M Single read from an extremity of a full-...	52	0.002
75	emb|BX068669.1|CNS09P5D Single read from an extremity of a full-...	52	0.002
76	emb|BX068455.1|CNS09OZF Single read from an extremity of a full-...	52	0.002
77	emb|BX068359.1|CNS09OWR Single read from an extremity of a full-...	52	0.002
78	emb|BX068150.1|CNS09OQY Single read from an extremity of a full-...	52	0.002
79	emb|BX068136.1|CNS09OQK Single read from an extremity of a full-...	52	0.002
80	emb|BX068135.1|CNS09OQJ Single read from an extremity of a full-...	52	0.002
81	emb|BX067770.1|CNS09OGE Single read from an extremity of a full-...	52	0.002
82	emb|BX067769.1|CNS09OGD Single read from an extremity of a full-...	52	0.002
83	emb|BX067575.1|CNS09OAZ Single read from an extremity of a full-...	52	0.002
84	emb|BX067574.1|CNS09OAY Single read from an extremity of a full-...	52	0.002
85	emb|BX067534.1|CNS09O9U Single read from an extremity of a full-...	52	0.002
86	emb|BX067533.1|CNS09O9T Single read from an extremity of a full-...	52	0.002
87	emb|BX067446.1|CNS09O7E Single read from an extremity of a full-...	52	0.002
88	emb|BX067445.1|CNS09O7D Single read from an extremity of a full-...	52	0.002
89	emb|BX067333.1|CNS09O49 Single read from an extremity of a full-...	52	0.002
90	emb|BX067064.1|CNS09NWS Single read from an extremity of a full-...	52	0.002
91	emb|BX067063.1|CNS09NWR Single read from an extremity of a full-...	52	0.002
92	emb|BX067001.1|CNS09NV1 Single read from an extremity of a full-...	52	0.002
93	emb|BX067000.1|CNS09NV0 Single read from an extremity of a full-...	52	0.002
94	emb|BX067241.1|CNS09O1P Single read from an extremity of a full-...	52	0.002
95	emb|BX067240.1|CNS09O1O Single read from an extremity of a full-...	52	0.002
96	emb|BX067178.1|CNS09NZY Single read from an extremity of a full-...	52	0.002
97	emb|BX067177.1|CNS09NZX Single read from an extremity of a full-...	52	0.002
98	emb|BX067146.1|CNS09NZ2 Single read from an extremity of a full-...	52	0.002
99	emb|BX067145.1|CNS09NZ1 Single read from an extremity of a full-...	52	0.002
100	emb|BX066849.1|CNS09NQT Single read from an extremity of a full-...	52	0.002
101	emb|BX066848.1|CNS09NQS Single read from an extremity of a full-...	52	0.002
102	emb|BX066768.1|CNS09NOK Single read from an extremity of a full-...	52	0.002
103	emb|BX066767.1|CNS09NOJ Single read from an extremity of a full-...	52	0.002
104	emb|BX066726.1|CNS09NNE Single read from an extremity of a full-...	52	0.002
105	emb|BX066725.1|CNS09NND Single read from an extremity of a full-...	52	0.002
106	emb|BX066633.1|CNS09NKT Single read from an extremity of a full-...	52	0.002
107	emb|BX066558.1|CNS09NIQ Single read from an extremity of a full-...	52	0.002
108	emb|BX066557.1|CNS09NIP Single read from an extremity of a full-...	52	0.002
109	emb|BX066512.1|CNS09NHG Single read from an extremity of a full-...	52	0.002
110	emb|BX066511.1|CNS09NHF Single read from an extremity of a full-...	52	0.002
111	emb|BX066367.1|CNS09NDF Single read from an extremity of a full-...	52	0.002
112	emb|BX066366.1|CNS09NDE Single read from an extremity of a full-...	52	0.002
113	emb|BX066303.1|CNS09NBN Single read from an extremity of a full-...	52	0.002
114	emb|BX066302.1|CNS09NBM Single read from an extremity of a full-...	52	0.002
115	emb|BX066297.1|CNS09NBH Single read from an extremity of a full-...	52	0.002
116	emb|BX066296.1|CNS09NBG Single read from an extremity of a full-...	52	0.002
117	emb|BX066130.1|CNS09N6U Single read from an extremity of a full-...	52	0.002
118	emb|BX066129.1|CNS09N6T Single read from an extremity of a full-...	52	0.002
119	emb|BX065912.1|CNS09N0S Single read from an extremity of a full-...	52	0.002
120	emb|BX065603.1|CNS09MS7 Single read from an extremity of a full-...	52	0.002
121	emb|BX065559.1|CNS09MQZ Single read from an extremity of a full-...	52	0.002
122	emb|BX065558.1|CNS09MQY Single read from an extremity of a full-...	52	0.002
123	emb|BX065426.1|CNS09MNA Single read from an extremity of a full-...	52	0.002
124	emb|BX065421.1|CNS09MN5 Single read from an extremity of a full-...	52	0.002
125	emb|BX065420.1|CNS09MN4 Single read from an extremity of a full-...	52	0.002
126	emb|BX065376.1|CNS09MLW Single read from an extremity of a full-...	52	0.002
127	emb|BX065375.1|CNS09MLV Single read from an extremity of a full-...	52	0.002
128	emb|BX065329.1|CNS09MKL Single read from an extremity of a full-...	52	0.002
129	emb|BX065312.1|CNS09MK4 Single read from an extremity of a full-...	52	0.002
130	emb|BX065118.1|CNS09MEQ Single read from an extremity of a full-...	52	0.002
131	emb|BX065105.1|CNS09MED Single read from an extremity of a full-...	52	0.002
132	emb|BX064707.1|CNS09M3B Single read from an extremity of a full-...	52	0.002
133	emb|BX064706.1|CNS09M3A Single read from an extremity of a full-...	52	0.002
134	emb|BX064243.1|CNS09LQF Single read from an extremity of a full-...	52	0.002
135	emb|BX064242.1|CNS09LQE Single read from an extremity of a full-...	52	0.002
136	emb|BX064203.1|CNS09LPB Single read from an extremity of a full-...	52	0.002
137	emb|BX064173.1|CNS09LOH Single read from an extremity of a full-...	52	0.002
138	emb|BX064172.1|CNS09LOG Single read from an extremity of a full-...	52	0.002
139	emb|BX064030.1|CNS09LKI Single read from an extremity of a full-...	52	0.002
140	emb|BX064029.1|CNS09LKH Single read from an extremity of a full-...	52	0.002
141	emb|BX063864.1|CNS09LFW Single read from an extremity of a full-...	52	0.002
142	emb|BX063860.1|CNS09LFS Single read from an extremity of a full-...	52	0.002
143	emb|BX063859.1|CNS09LFR Single read from an extremity of a full-...	52	0.002
144	emb|BX063580.1|CNS09L80 Single read from an extremity of a full-...	52	0.002
145	emb|BX063579.1|CNS09L7Z Single read from an extremity of a full-...	52	0.002
146	emb|BX063193.1|CNS09KX9 Single read from an extremity of a full-...	52	0.002
147	emb|BX063192.1|CNS09KX8 Single read from an extremity of a full-...	52	0.002
148	emb|BX062982.1|CNS09KRE Single read from an extremity of a full-...	52	0.002
149	emb|BX062974.1|CNS09KR6 Single read from an extremity of a full-...	52	0.002
150	emb|BX062973.1|CNS09KR5 Single read from an extremity of a full-...	52	0.002
151	emb|BX062925.1|CNS09KPT Single read from an extremity of a full-...	52	0.002
152	emb|BX062924.1|CNS09KPS Single read from an extremity of a full-...	52	0.002
153	emb|BX062896.1|CNS09KP0 Single read from an extremity of a full-...	52	0.002
154	emb|BX062641.1|CNS09KHX Single read from an extremity of a full-...	52	0.002
155	emb|BX062575.1|CNS09KG3 Single read from an extremity of a full-...	52	0.002
156	emb|BX062574.1|CNS09KG2 Single read from an extremity of a full-...	52	0.002
157	emb|BX062497.1|CNS09KDX Single read from an extremity of a full-...	52	0.002
158	emb|BX062308.1|CNS09K8O Single read from an extremity of a full-...	52	0.002
159	emb|BX062215.1|CNS09K63 Single read from an extremity of a full-...	52	0.002
160	emb|BX062214.1|CNS09K62 Single read from an extremity of a full-...	52	0.002
161	emb|BX062069.1|CNS09K21 Single read from an extremity of a full-...	52	0.002
162	emb|BX062068.1|CNS09K20 Single read from an extremity of a full-...	52	0.002
163	emb|BX062040.1|CNS09K18 Single read from an extremity of a full-...	52	0.002
164	emb|BX062039.1|CNS09K17 Single read from an extremity of a full-...	52	0.002
165	emb|BX061714.1|CNS09JS6 Single read from an extremity of a full-...	52	0.002
166	emb|BX061713.1|CNS09JS5 Single read from an extremity of a full-...	52	0.002
167	emb|BX061678.1|CNS09JR6 Single read from an extremity of a full-...	52	0.002
168	emb|BX061619.1|CNS09JPJ Single read from an extremity of a full-...	52	0.002
169	emb|BX061618.1|CNS09JPI Single read from an extremity of a full-...	52	0.002
170	emb|BX061538.1|CNS09JNA Single read from an extremity of a full-...	52	0.002
171	emb|BX061537.1|CNS09JN9 Single read from an extremity of a full-...	52	0.002
172	emb|BX061485.1|CNS09JLT Single read from an extremity of a full-...	52	0.002
173	emb|BX061484.1|CNS09JLS Single read from an extremity of a full-...	52	0.002
174	emb|BX061264.1|CNS09JFO Single read from an extremity of a full-...	52	0.002
175	emb|BX061263.1|CNS09JFN Single read from an extremity of a full-...	52	0.002
176	emb|BX061104.1|CNS09JB8 Single read from an extremity of a full-...	52	0.002
177	emb|BX060853.1|CNS09J49 Single read from an extremity of a full-...	52	0.002
178	emb|BX060852.1|CNS09J48 Single read from an extremity of a full-...	52	0.002
179	emb|BX060835.1|CNS09J3R Single read from an extremity of a full-...	52	0.002
180	emb|BX060421.1|CNS09IS9 Single read from an extremity of a full-...	52	0.002
181	emb|BX060334.1|CNS09IPU Single read from an extremity of a full-...	52	0.002
182	emb|BX060333.1|CNS09IPT Single read from an extremity of a full-...	52	0.002
183	emb|BX059972.1|CNS09IFS Single read from an extremity of a full-...	52	0.002
184	emb|BX059971.1|CNS09IFR Single read from an extremity of a full-...	52	0.002
185	emb|BX059904.1|CNS09IDW Single read from an extremity of a full-...	52	0.002
186	emb|BX059765.1|CNS09IA1 Single read from an extremity of a full-...	52	0.002
187	emb|BX059761.1|CNS09I9X Single read from an extremity of a full-...	52	0.002
188	emb|BX059760.1|CNS09I9W Single read from an extremity of a full-...	52	0.002
189	emb|BX059674.1|CNS09I7I Single read from an extremity of a full-...	52	0.002
190	emb|BX059626.1|CNS09I66 Single read from an extremity of a full-...	52	0.002
191	emb|BX059625.1|CNS09I65 Single read from an extremity of a full-...	52	0.002
192	emb|BX059607.1|CNS09I5N Single read from an extremity of a full-...	52	0.002
193	emb|BX059606.1|CNS09I5M Single read from an extremity of a full-...	52	0.002
194	emb|BX059417.1|CNS09I0D Single read from an extremity of a full-...	52	0.002
195	emb|BX059393.1|CNS09HZP Single read from an extremity of a full-...	52	0.002
196	emb|BX059392.1|CNS09HZO Single read from an extremity of a full-...	52	0.002
197	emb|BX059211.1|CNS09HUN Single read from an extremity of a full-...	52	0.002
198	emb|BX059210.1|CNS09HUM Single read from an extremity of a full-...	52	0.002
199	emb|BX059153.1|CNS09HT1 Single read from an extremity of a full-...	52	0.002
200	emb|BX059152.1|CNS09HT0 Single read from an extremity of a full-...	52	0.002
201	emb|BX059116.1|CNS09HS0 Single read from an extremity of a full-...	52	0.002
202	emb|BX059115.1|CNS09HRZ Single read from an extremity of a full-...	52	0.002
203	emb|BX058758.1|CNS09HI2 Single read from an extremity of a full-...	52	0.002
204	emb|BX058710.1|CNS09HGQ Single read from an extremity of a full-...	52	0.002
205	emb|BX058709.1|CNS09HGP Single read from an extremity of a full-...	52	0.002
206	emb|BX058537.1|CNS09HBX Single read from an extremity of a full-...	52	0.002
207	emb|BX058436.1|CNS09H94 Single read from an extremity of a full-...	52	0.002
208	emb|BX058409.1|CNS09H8D Single read from an extremity of a full-...	52	0.002
209	emb|BX056661.1|CNS09FVT Single read from an extremity of a full-...	52	0.002
210	emb|BX056611.1|CNS09FUF Single read from an extremity of a full-...	52	0.002
211	emb|BX056610.1|CNS09FUE Single read from an extremity of a full-...	52	0.002
212	emb|BX057874.1|CNS09GTI Single read from an extremity of a full-...	52	0.002
213	emb|BX057873.1|CNS09GTH Single read from an extremity of a full-...	52	0.002
214	emb|BX057794.1|CNS09GRA Single read from an extremity of a full-...	52	0.002
215	emb|BX057529.1|CNS09GJX Single read from an extremity of a full-...	52	0.002
216	emb|BX057073.1|CNS09G79 Single read from an extremity of a full-...	52	0.002
217	emb|BX056977.1|CNS09G4L Single read from an extremity of a full-...	52	0.002
218	emb|BX056976.1|CNS09G4K Single read from an extremity of a full-...	52	0.002
219	emb|BX056850.1|CNS09G12 Single read from an extremity of a full-...	52	0.002
220	emb|BX056819.1|CNS09G07 Single read from an extremity of a full-...	52	0.002
221	emb|BX056466.1|CNS09FQE Single read from an extremity of a full-...	52	0.002
222	emb|BX056465.1|CNS09FQD Single read from an extremity of a full-...	52	0.002
223	emb|BX056335.1|CNS09FMR Single read from an extremity of a full-...	52	0.002
224	emb|BX056260.1|CNS09FKO Single read from an extremity of a full-...	52	0.002
225	emb|BX055500.1|CNS09EZK Single read from an extremity of a full-...	52	0.002
226	emb|BX055499.1|CNS09EZJ Single read from an extremity of a full-...	52	0.002
227	emb|BX055379.1|CNS09EW7 Single read from an extremity of a full-...	52	0.002
228	emb|BX055259.1|CNS09ESV Single read from an extremity of a full-...	52	0.002
229	emb|BX053250.1|CNS09D92 Single read from an extremity of a full-...	52	0.002
230	emb|BX053249.1|CNS09D91 Single read from an extremity of a full-...	52	0.002
231	emb|BX053171.1|CNS09D6V Single read from an extremity of a full-...	52	0.002
232	emb|BX053153.1|CNS09D6D Single read from an extremity of a full-...	52	0.002
233	emb|BX054879.1|CNS09EIB Single read from an extremity of a full-...	52	0.002
234	emb|BX054878.1|CNS09EIA Single read from an extremity of a full-...	52	0.002
235	emb|BX054828.1|CNS09EGW Single read from an extremity of a full-...	52	0.002
236	emb|BX052909.1|CNS09CZL Single read from an extremity of a full-...	52	0.002
237	emb|BX052908.1|CNS09CZK Single read from an extremity of a full-...	52	0.002
238	emb|BX054730.1|CNS09EE6 Single read from an extremity of a full-...	52	0.002
239	emb|BX054702.1|CNS09EDE Single read from an extremity of a full-...	52	0.002
240	emb|BX054649.1|CNS09EBX Single read from an extremity of a full-...	52	0.002
241	emb|BX054648.1|CNS09EBW Single read from an extremity of a full-...	52	0.002
242	emb|BX054626.1|CNS09EBA Single read from an extremity of a full-...	52	0.002
243	emb|BX054625.1|CNS09EB9 Single read from an extremity of a full-...	52	0.002
244	emb|BX054462.1|CNS09E6Q Single read from an extremity of a full-...	52	0.002
245	emb|BX054461.1|CNS09E6P Single read from an extremity of a full-...	52	0.002
246	emb|BX054393.1|CNS09E4T Single read from an extremity of a full-...	52	0.002
247	emb|BX054392.1|CNS09E4S Single read from an extremity of a full-...	52	0.002
248	emb|BX054176.1|CNS09DYS Single read from an extremity of a full-...	52	0.002
249	emb|BX054175.1|CNS09DYR Single read from an extremity of a full-...	52	0.002
250	emb|BX054174.1|CNS09DYQ Single read from an extremity of a full-...	52	0.002
251	emb|BX053953.1|CNS09DSL Single read from an extremity of a full-...	52	0.002
252	emb|BX053952.1|CNS09DSK Single read from an extremity of a full-...	52	0.002
253	emb|BX053920.1|CNS09DRO Single read from an extremity of a full-...	52	0.002
254	emb|BX053912.1|CNS09DRG Single read from an extremity of a full-...	52	0.002
255	emb|BX053911.1|CNS09DRF Single read from an extremity of a full-...	52	0.002
256	emb|BX053818.1|CNS09DOU Single read from an extremity of a full-...	52	0.002
257	emb|BX053817.1|CNS09DOT Single read from an extremity of a full-...	52	0.002
258	emb|BX052788.1|CNS09CW8 Single read from an extremity of a full-...	52	0.002
259	emb|BX052695.1|CNS09CTN Single read from an extremity of a full-...	52	0.002
260	emb|BX052693.1|CNS09CTL Single read from an extremity of a full-...	52	0.002
261	emb|BX052621.1|CNS09CRL Single read from an extremity of a full-...	52	0.002
262	emb|BX052620.1|CNS09CRK Single read from an extremity of a full-...	52	0.002
263	emb|BX052419.1|CNS09CLZ Single read from an extremity of a full-...	52	0.002
264	emb|BX052418.1|CNS09CLY Single read from an extremity of a full-...	52	0.002
265	emb|BX052393.1|CNS09CL9 Single read from an extremity of a full-...	52	0.002
266	emb|BX052362.1|CNS09CKE Single read from an extremity of a full-...	52	0.002
267	emb|BX052356.1|CNS09CK8 Single read from an extremity of a full-...	52	0.002
268	emb|BX052355.1|CNS09CK7 Single read from an extremity of a full-...	52	0.002
269	emb|BX052342.1|CNS09CJU Single read from an extremity of a full-...	52	0.002
270	emb|BX051896.1|CNS09C7G Single read from an extremity of a full-...	52	0.002
271	emb|BX051895.1|CNS09C7F Single read from an extremity of a full-...	52	0.002
272	emb|BX051873.1|CNS09C6T Single read from an extremity of a full-...	52	0.002
273	emb|BX051872.1|CNS09C6S Single read from an extremity of a full-...	52	0.002
274	emb|BX051690.1|CNS09C1Q Single read from an extremity of a full-...	52	0.002
275	emb|BX051689.1|CNS09C1P Single read from an extremity of a full-...	52	0.002
276	emb|BX051513.1|CNS09BWT Single read from an extremity of a full-...	52	0.002
277	emb|BX051488.1|CNS09BW4 Single read from an extremity of a full-...	52	0.002
278	emb|BX051487.1|CNS09BW3 Single read from an extremity of a full-...	52	0.002
279	emb|BX051019.1|CNS09BJ3 Single read from an extremity of a full-...	52	0.002
280	emb|BX050866.1|CNS09BEU Single read from an extremity of a full-...	52	0.002
281	emb|BX050391.1|CNS09B1N Single read from an extremity of a full-...	52	0.002
282	emb|BX050351.1|CNS09B0J Single read from an extremity of a full-...	52	0.002
283	emb|BX050350.1|CNS09B0I Single read from an extremity of a full-...	52	0.002
284	emb|BX049980.1|CNS09AQ8 Single read from an extremity of a full-...	52	0.002
285	emb|BX049958.1|CNS09APM Single read from an extremity of a full-...	52	0.002
286	emb|BX049739.1|CNS09AJJ Single read from an extremity of a full-...	52	0.002
287	emb|BX049738.1|CNS09AJI Single read from an extremity of a full-...	52	0.002
288	emb|BX049727.1|CNS09AJ7 Single read from an extremity of a full-...	52	0.002
289	emb|BX049726.1|CNS09AJ6 Single read from an extremity of a full-...	52	0.002
290	emb|BX049691.1|CNS09AI7 Single read from an extremity of a full-...	52	0.002
291	emb|BX049690.1|CNS09AI6 Single read from an extremity of a full-...	52	0.002
292	emb|BX031049.1|CNS08W4D Single read from an extremity of a full-...	52	0.002
293	emb|BX031048.1|CNS08W4C Single read from an extremity of a full-...	52	0.002
294	emb|BX030983.1|CNS08W2J Single read from an extremity of a full-...	52	0.002
295	emb|BX030982.1|CNS08W2I Single read from an extremity of a full-...	52	0.002
296	emb|BX049587.1|CNS09AFB Single read from an extremity of a full-...	52	0.002
297	emb|BX049539.1|CNS09ADZ Single read from an extremity of a full-...	52	0.002
298	emb|BX049521.1|CNS09ADH Single read from an extremity of a full-...	52	0.002
299	emb|BX049314.1|CNS09A7Q Single read from an extremity of a full-...	52	0.002
300	emb|BX049154.1|CNS09A3A Single read from an extremity of a full-...	52	0.002
301	emb|BX048996.1|CNS099YW Single read from an extremity of a full-...	52	0.002
302	emb|BX048502.1|CNS099L6 Single read from an extremity of a full-...	52	0.002
303	emb|BX048501.1|CNS099L5 Single read from an extremity of a full-...	52	0.002
304	emb|BX048464.1|CNS099K4 Single read from an extremity of a full-...	52	0.002
305	emb|BX048463.1|CNS099K3 Single read from an extremity of a full-...	52	0.002
306	emb|BX048446.1|CNS099JM Single read from an extremity of a full-...	52	0.002
307	emb|BX048445.1|CNS099JL Single read from an extremity of a full-...	52	0.002
308	emb|BX046467.1|CNS0980N Single read from an extremity of a full-...	52	0.002
309	emb|BX046466.1|CNS0980M Single read from an extremity of a full-...	52	0.002
310	emb|BX046459.1|CNS0980F Single read from an extremity of a full-...	52	0.002
311	emb|BX048383.1|CNS099HV Single read from an extremity of a full-...	52	0.002
312	emb|BX048248.1|CNS099E4 Single read from an extremity of a full-...	52	0.002
313	emb|BX048218.1|CNS099DA Single read from an extremity of a full-...	52	0.002
314	emb|BX048047.1|CNS0998J Single read from an extremity of a full-...	52	0.002
315	emb|BX047941.1|CNS0995L Single read from an extremity of a full-...	52	0.002
316	emb|BX047940.1|CNS0995K Single read from an extremity of a full-...	52	0.002
317	emb|BX047916.1|CNS0994W Single read from an extremity of a full-...	52	0.002
318	emb|BX047915.1|CNS0994V Single read from an extremity of a full-...	52	0.002
319	emb|BX047819.1|CNS09927 Single read from an extremity of a full-...	52	0.002
320	emb|BX047818.1|CNS09926 Single read from an extremity of a full-...	52	0.002
321	emb|BX047435.1|CNS098RJ Single read from an extremity of a full-...	52	0.002
322	emb|BX047372.1|CNS098PS Single read from an extremity of a full-...	52	0.002
323	emb|BX047345.1|CNS098P1 Single read from an extremity of a full-...	52	0.002
324	emb|BX047325.1|CNS098OH Single read from an extremity of a full-...	52	0.002
325	emb|BX047324.1|CNS098OG Single read from an extremity of a full-...	52	0.002
326	emb|BX047179.1|CNS098KF Single read from an extremity of a full-...	52	0.002
327	emb|BX047178.1|CNS098KE Single read from an extremity of a full-...	52	0.002
328	emb|BX047172.1|CNS098K8 Single read from an extremity of a full-...	52	0.002
329	emb|BX047171.1|CNS098K7 Single read from an extremity of a full-...	52	0.002
330	emb|BX047166.1|CNS098K2 Single read from an extremity of a full-...	52	0.002
331	emb|BX047165.1|CNS098K1 Single read from an extremity of a full-...	52	0.002
332	emb|BX046896.1|CNS098CK Single read from an extremity of a full-...	52	0.002
333	emb|BX046895.1|CNS098CJ Single read from an extremity of a full-...	52	0.002
334	emb|BX046884.1|CNS098C8 Single read from an extremity of a full-...	52	0.002
335	emb|BX046883.1|CNS098C7 Single read from an extremity of a full-...	52	0.002
336	emb|BX046708.1|CNS0987C Single read from an extremity of a full-...	52	0.002
337	emb|BX046707.1|CNS0987B Single read from an extremity of a full-...	52	0.002
338	emb|BX046609.1|CNS0984L Single read from an extremity of a full-...	52	0.002
339	emb|BX046608.1|CNS0984K Single read from an extremity of a full-...	52	0.002
340	emb|BX046323.1|CNS097WN Single read from an extremity of a full-...	52	0.002
341	emb|BX046322.1|CNS097WM Single read from an extremity of a full-...	52	0.002
342	emb|BX046319.1|CNS097WJ Single read from an extremity of a full-...	52	0.002
343	emb|BX046318.1|CNS097WI Single read from an extremity of a full-...	52	0.002
344	emb|BX046134.1|CNS097RE Single read from an extremity of a full-...	52	0.002
345	emb|BX046112.1|CNS097QS Single read from an extremity of a full-...	52	0.002
346	emb|BX046093.1|CNS097Q9 Single read from an extremity of a full-...	52	0.002
347	emb|BX046092.1|CNS097Q8 Single read from an extremity of a full-...	52	0.002
348	emb|BX045967.1|CNS097MR Single read from an extremity of a full-...	52	0.002
349	emb|BX045966.1|CNS097MQ Single read from an extremity of a full-...	52	0.002
350	emb|BX045804.1|CNS097I8 Single read from an extremity of a full-...	52	0.002
351	emb|BX045797.1|CNS097I1 Single read from an extremity of a full-...	52	0.002
352	emb|BX045796.1|CNS097I0 Single read from an extremity of a full-...	52	0.002
353	emb|BX045626.1|CNS097DA Single read from an extremity of a full-...	52	0.002
354	emb|BX045539.1|CNS097AV Single read from an extremity of a full-...	52	0.002
355	emb|BX045538.1|CNS097AU Single read from an extremity of a full-...	52	0.002
356	emb|BX045485.1|CNS0979D Single read from an extremity of a full-...	52	0.002
357	emb|BX045024.1|CNS096WK Single read from an extremity of a full-...	52	0.002
358	emb|BX045023.1|CNS096WJ Single read from an extremity of a full-...	52	0.002
359	emb|BX045316.1|CNS0974O Single read from an extremity of a full-...	52	0.002
360	emb|BX044837.1|CNS096RD Single read from an extremity of a full-...	52	0.002
361	emb|BX042938.1|CNS095AM Single read from an extremity of a full-...	52	0.002
362	emb|BX044634.1|CNS096LQ Single read from an extremity of a full-...	52	0.002
363	emb|BX044628.1|CNS096LK Single read from an extremity of a full-...	52	0.002
364	emb|BX044426.1|CNS096FY Single read from an extremity of a full-...	52	0.002
365	emb|BX044425.1|CNS096FX Single read from an extremity of a full-...	52	0.002
366	emb|BX044403.1|CNS096FB Single read from an extremity of a full-...	52	0.002
367	emb|BX044402.1|CNS096FA Single read from an extremity of a full-...	52	0.002
368	emb|BX044342.1|CNS096DM Single read from an extremity of a full-...	52	0.002
369	emb|BX044340.1|CNS096DK Single read from an extremity of a full-...	52	0.002
370	emb|BX044069.1|CNS09661 Single read from an extremity of a full-...	52	0.002
371	emb|BX043944.1|CNS0962K Single read from an extremity of a full-...	52	0.002
372	emb|BX043943.1|CNS0962J Single read from an extremity of a full-...	52	0.002
373	emb|BX043818.1|CNS095Z2 Single read from an extremity of a full-...	52	0.002
374	emb|BX043787.1|CNS095Y7 Single read from an extremity of a full-...	52	0.002
375	emb|BX043786.1|CNS095Y6 Single read from an extremity of a full-...	52	0.002
376	emb|BX043712.1|CNS095W4 Single read from an extremity of a full-...	52	0.002
377	emb|BX043711.1|CNS095W3 Single read from an extremity of a full-...	52	0.002
378	emb|BX043329.1|CNS095LH Single read from an extremity of a full-...	52	0.002
379	emb|BX043621.1|CNS095TL Single read from an extremity of a full-...	52	0.002
380	emb|BX043282.1|CNS095K6 Single read from an extremity of a full-...	52	0.002
381	emb|BX043266.1|CNS095JQ Single read from an extremity of a full-...	52	0.002
382	emb|BX043265.1|CNS095JP Single read from an extremity of a full-...	52	0.002
383	emb|BX043174.1|CNS095H6 Single read from an extremity of a full-...	52	0.002
384	emb|BX042820.1|CNS0957C Single read from an extremity of a full-...	52	0.002
385	emb|BX042733.1|CNS0954X Single read from an extremity of a full-...	52	0.002
386	emb|BX042732.1|CNS0954W Single read from an extremity of a full-...	52	0.002
387	emb|BX042596.1|CNS09514 Single read from an extremity of a full-...	52	0.002
388	emb|BX042595.1|CNS09513 Single read from an extremity of a full-...	52	0.002
389	emb|BX042559.1|CNS09503 Single read from an extremity of a full-...	52	0.002
390	emb|BX042367.1|CNS094UR Single read from an extremity of a full-...	52	0.002
391	emb|BX042366.1|CNS094UQ Single read from an extremity of a full-...	52	0.002
392	emb|BX042199.1|CNS094Q3 Single read from an extremity of a full-...	52	0.002
393	emb|BX042131.1|CNS094O7 Single read from an extremity of a full-...	52	0.002
394	emb|BX042130.1|CNS094O6 Single read from an extremity of a full-...	52	0.002
395	emb|BX041755.1|CNS094DR Single read from an extremity of a full-...	52	0.002
396	emb|BX041754.1|CNS094DQ Single read from an extremity of a full-...	52	0.002
397	emb|BX042008.1|CNS094KS Single read from an extremity of a full-...	52	0.002
398	emb|BX041902.1|CNS094HU Single read from an extremity of a full-...	52	0.002
399	emb|BX041901.1|CNS094HT Single read from an extremity of a full-...	52	0.002
400	emb|BX041545.1|CNS0947X Single read from an extremity of a full-...	52	0.002
401	emb|BX041544.1|CNS0947W Single read from an extremity of a full-...	52	0.002
402	emb|BX041477.1|CNS09461 Single read from an extremity of a full-...	52	0.002
403	emb|BX041103.1|CNS093VN Single read from an extremity of a full-...	52	0.002
404	emb|BX041102.1|CNS093VM Single read from an extremity of a full-...	52	0.002
405	emb|BX040797.1|CNS093N5 Single read from an extremity of a full-...	52	0.002
406	emb|BX040742.1|CNS093LM Single read from an extremity of a full-...	52	0.002
407	emb|BX040741.1|CNS093LL Single read from an extremity of a full-...	52	0.002
408	emb|BX040675.1|CNS093JR Single read from an extremity of a full-...	52	0.002
409	emb|BX040496.1|CNS093ES Single read from an extremity of a full-...	52	0.002
410	emb|BX040136.1|CNS0934S Single read from an extremity of a full-...	52	0.002
411	emb|BX039576.1|CNS092P8 Single read from an extremity of a full-...	52	0.002
412	emb|BX039575.1|CNS092P7 Single read from an extremity of a full-...	52	0.002
413	emb|BX039533.1|CNS092O1 Single read from an extremity of a full-...	52	0.002
414	emb|BX039261.1|CNS092GH Single read from an extremity of a full-...	52	0.002
415	emb|BX039260.1|CNS092GG Single read from an extremity of a full-...	52	0.002
416	emb|BX039143.1|CNS092D7 Single read from an extremity of a full-...	52	0.002
417	emb|BX037453.1|CNS09129 Single read from an extremity of a full-...	52	0.002
418	emb|BX037434.1|CNS0911Q Single read from an extremity of a full-...	52	0.002
419	emb|BX037433.1|CNS0911P Single read from an extremity of a full-...	52	0.002
420	emb|BX036970.1|CNS090OU Single read from an extremity of a full-...	52	0.002
421	emb|BX036969.1|CNS090OT Single read from an extremity of a full-...	52	0.002
422	emb|BX036482.1|CNS090BA Single read from an extremity of a full-...	52	0.002
423	emb|BX036481.1|CNS090B9 Single read from an extremity of a full-...	52	0.002
424	emb|BX036217.1|CNS0903X Single read from an extremity of a full-...	52	0.002
425	emb|BX036216.1|CNS0903W Single read from an extremity of a full-...	52	0.002
426	emb|BX036197.1|CNS0903D Single read from an extremity of a full-...	52	0.002
427	emb|BX036196.1|CNS0903C Single read from an extremity of a full-...	52	0.002
428	emb|BX036099.1|CNS0900N Single read from an extremity of a full-...	52	0.002
429	emb|BX036098.1|CNS0900M Single read from an extremity of a full-...	52	0.002
430	emb|BX035700.1|CNS08ZPK Single read from an extremity of a full-...	52	0.002
431	emb|BX035668.1|CNS08ZOO Single read from an extremity of a full-...	52	0.002
432	emb|BX035667.1|CNS08ZON Single read from an extremity of a full-...	52	0.002
433	emb|BX035566.1|CNS08ZLU Single read from an extremity of a full-...	52	0.002
434	emb|BX034802.1|CNS08Z0M Single read from an extremity of a full-...	52	0.002
435	emb|BX034801.1|CNS08Z0L Single read from an extremity of a full-...	52	0.002
436	emb|BX034329.1|CNS08YNH Single read from an extremity of a full-...	52	0.002
437	emb|BX034088.1|CNS08YGS Single read from an extremity of a full-...	52	0.002
438	emb|BX034087.1|CNS08YGR Single read from an extremity of a full-...	52	0.002
439	emb|BX033987.1|CNS08YDZ Single read from an extremity of a full-...	52	0.002
440	emb|BX032612.1|CNS08XBS Single read from an extremity of a full-...	52	0.002
441	emb|BX032477.1|CNS08X81 Single read from an extremity of a full-...	52	0.002
442	emb|BX032476.1|CNS08X80 Single read from an extremity of a full-...	52	0.002
443	emb|BX032360.1|CNS08X4S Single read from an extremity of a full-...	52	0.002
444	emb|BX032359.1|CNS08X4R Single read from an extremity of a full-...	52	0.002
445	emb|BX032294.1|CNS08X2Y Single read from an extremity of a full-...	52	0.002
446	emb|BX032293.1|CNS08X2X Single read from an extremity of a full-...	52	0.002
447	emb|BX032199.1|CNS08X0B Single read from an extremity of a full-...	52	0.002
448	emb|BX031887.1|CNS08WRN Single read from an extremity of a full-...	52	0.002
449	emb|BX031886.1|CNS08WRM Single read from an extremity of a full-...	52	0.002
450	emb|BX031841.1|CNS08WQD Single read from an extremity of a full-...	52	0.002
451	emb|BX031840.1|CNS08WQC Single read from an extremity of a full-...	52	0.002
452	emb|BX031779.1|CNS08WON Single read from an extremity of a full-...	52	0.002
453	emb|BX031778.1|CNS08WOM Single read from an extremity of a full-...	52	0.002
454	emb|BX031478.1|CNS08WGA Single read from an extremity of a full-...	52	0.002
455	emb|BX031467.1|CNS08WFZ Single read from an extremity of a full-...	52	0.002
456	emb|BX031466.1|CNS08WFY Single read from an extremity of a full-...	52	0.002
457	emb|BX031429.1|CNS08WEX Single read from an extremity of a full-...	52	0.002
458	emb|BX029472.1|CNS08UWK Single read from an extremity of a full-...	52	0.002
459	emb|BX029434.1|CNS08UVI Single read from an extremity of a full-...	52	0.002
460	emb|BX029433.1|CNS08UVH Single read from an extremity of a full-...	52	0.002
461	emb|BX029400.1|CNS08UUK Single read from an extremity of a full-...	52	0.002
462	emb|BX029399.1|CNS08UUJ Single read from an extremity of a full-...	52	0.002
463	emb|BX029680.1|CNS08V2C Single read from an extremity of a full-...	52	0.002
464	emb|BX029679.1|CNS08V2B Single read from an extremity of a full-...	52	0.002
465	emb|BX029634.1|CNS08V12 Single read from an extremity of a full-...	52	0.002
466	emb|BX028961.1|CNS08UID Single read from an extremity of a full-...	52	0.002
467	emb|BX028778.1|CNS08UDA Single read from an extremity of a full-...	52	0.002
468	emb|BX028777.1|CNS08UD9 Single read from an extremity of a full-...	52	0.002
469	emb|BX028647.1|CNS08U9N Single read from an extremity of a full-...	52	0.002
470	emb|BX028646.1|CNS08U9M Single read from an extremity of a full-...	52	0.002
471	emb|BX028589.1|CNS08U81 Single read from an extremity of a full-...	52	0.002
472	emb|BX028588.1|CNS08U80 Single read from an extremity of a full-...	52	0.002
473	emb|BX028456.1|CNS08U4C Single read from an extremity of a full-...	52	0.002
474	emb|BX028432.1|CNS08U3O Single read from an extremity of a full-...	52	0.002
475	emb|BX028431.1|CNS08U3N Single read from an extremity of a full-...	52	0.002
476	emb|BX028413.1|CNS08U35 Single read from an extremity of a full-...	52	0.002
477	emb|BX028367.1|CNS08U1V Single read from an extremity of a full-...	52	0.002
478	emb|BX028366.1|CNS08U1U Single read from an extremity of a full-...	52	0.002
479	emb|BX028266.1|CNS08TZ2 Single read from an extremity of a full-...	52	0.002
480	emb|BX028265.1|CNS08TZ1 Single read from an extremity of a full-...	52	0.002
481	emb|BX028083.1|CNS08TTZ Single read from an extremity of a full-...	52	0.002
482	emb|BX028025.1|CNS08TSD Single read from an extremity of a full-...	52	0.002
483	emb|BX027952.1|CNS08TQC Single read from an extremity of a full-...	52	0.002
484	emb|BX027951.1|CNS08TQB Single read from an extremity of a full-...	52	0.002
485	emb|BX027857.1|CNS08TNP Single read from an extremity of a full-...	52	0.002
486	emb|BX027779.1|CNS08TLJ Single read from an extremity of a full-...	52	0.002
487	emb|BX027696.1|CNS08TJ8 Single read from an extremity of a full-...	52	0.002
488	emb|BX027695.1|CNS08TJ7 Single read from an extremity of a full-...	52	0.002
489	emb|BX027677.1|CNS08TIP Single read from an extremity of a full-...	52	0.002
490	emb|BX027635.1|CNS08THJ Single read from an extremity of a full-...	52	0.002
491	emb|BX027634.1|CNS08THI Single read from an extremity of a full-...	52	0.002
492	emb|BX027566.1|CNS08TFM Single read from an extremity of a full-...	52	0.002
493	emb|BX027562.1|CNS08TFI Single read from an extremity of a full-...	52	0.002
494	emb|BX026986.1|CNS08SZI Single read from an extremity of a full-...	52	0.002
495	emb|BX026985.1|CNS08SZH Single read from an extremity of a full-...	52	0.002
496	emb|BX026939.1|CNS08SY7 Single read from an extremity of a full-...	52	0.002
497	emb|BX026938.1|CNS08SY6 Single read from an extremity of a full-...	52	0.002
498	emb|BX026768.1|CNS08STG Single read from an extremity of a full-...	52	0.002
499	emb|BX026767.1|CNS08STF Single read from an extremity of a full-...	52	0.002
500	emb|BX026049.1|CNS08S9H Single read from an extremity of a full-...	52	0.002

---

>ref|XM_483589.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 980

 Score =  414 bits (209), Expect = e-112
 Identities = 491/585 (83%)
 Strand = Plus / Plus

                                                                       
Query: 2   gccgccacgacgccaagggcgccatcaagcgccccgaggacttcgtcagggagttccgca 61
           ||||| |||||| |||||||||||||||| | ||||||||||||||||||||||||||||
Sbjct: 206 gccgcgacgacggcaagggcgccatcaagaggcccgaggacttcgtcagggagttccgca 265

                                                                       
Query: 62  acaaggagctcgacttcctgcggatgcgcacgcgcctcaaggtccgcaagctgcgccccg 121
           ||||||||||||||||| | ||||||   || |||||||||||||||||||| | |||||
Sbjct: 266 acaaggagctcgacttcgtccggatgaagacccgcctcaaggtccgcaagctcccccccg 325

                                                                       
Query: 122 ccgagcccgtacacgccaacctgctcttcgccatccgcatcccaggcactgccgacttgc 181
           ||||| || |  || |||| ||  ||||||| || |||||||| |||||    |||||||
Sbjct: 326 ccgagaccctcaactccaagctcgtcttcgcgattcgcatccctggcacaatggacttgc 385

                                                                       
Query: 182 acccgcaaatcaggaagatcttggccaggctgcggctgacccaggtcctcacaggagtct 241
           | || || || |||| ||| |||  || |||||||||||| ||||||||||| || || |
Sbjct: 386 atccacacatgaggaggattttgcgcaagctgcggctgacgcaggtcctcaccggcgtgt 445

                                                                       
Query: 242 tcctcaaggccaccgaggcaaacctcaagaggcttgctgctgttgggccgtttgtcacct 301
           ||||||||||||| || || |   | |||||||||  || ||| | ||||||| |||| |
Sbjct: 446 tcctcaaggccactgacgctactatgaagaggcttcttgttgtggagccgtttatcactt 505

                                                                       
Query: 302 atgggttccccaatttgaagaatgtgaaggagcttatctacaagaagggtcgcgggtatt 361
           |||||||||| |||||||||||||||||||| ||||| ||||||||||| || ||||   
Sbjct: 506 atgggttcccaaatttgaagaatgtgaaggatcttatttacaagaagggccgtgggttcc 565

                                                                       
Query: 362 tcgacaaggagcctttcccccttaccagcaatgatctaatcgagaaggctcttggagaac 421
           | |||||||| |||||||| ||||||||||||||||| || ||||||||||| |||||| 
Sbjct: 566 tggacaaggaacctttccctcttaccagcaatgatctcattgagaaggctctgggagaat 625

                                                                       
Query: 422 acggcgtcatatgtttagaagatgtcgtgcacgaaatctccacggtcgggccgcacttca 481
           | ||| |||||||||| |||||| | ||||| |||||| |  | || || || |||||||
Sbjct: 626 atggcatcatatgtttggaagatcttgtgcatgaaatcgcatcagttggcccacacttca 685

                                                                       
Query: 482 gggaaacggcgagctttctcatgcccttcaagctcaagtgtccggagaggaggttgcaga 541
           | ||| |  | |  || |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 686 gagaagcttcaaatttcctcatgcccttcaagctcaagtgtccagagaggaggttgcaga 745

                                                        
Query: 542 tgaagaagaaacccttcaaggatggtggcgactcgggcaaccgcg 586
           |||||||||||||||||||||||||||| ||||| || |||||||
Sbjct: 746 tgaagaagaaacccttcaaggatggtggtgactcagggaaccgcg 790

---

>ref|XM_507312.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1211_G06.30
           mRNA
          Length = 984

 Score =  414 bits (209), Expect = e-112
 Identities = 491/585 (83%)
 Strand = Plus / Plus

                                                                       
Query: 2   gccgccacgacgccaagggcgccatcaagcgccccgaggacttcgtcagggagttccgca 61
           ||||| |||||| |||||||||||||||| | ||||||||||||||||||||||||||||
Sbjct: 206 gccgcgacgacggcaagggcgccatcaagaggcccgaggacttcgtcagggagttccgca 265

                                                                       
Query: 62  acaaggagctcgacttcctgcggatgcgcacgcgcctcaaggtccgcaagctgcgccccg 121
           ||||||||||||||||| | ||||||   || |||||||||||||||||||| | |||||
Sbjct: 266 acaaggagctcgacttcgtccggatgaagacccgcctcaaggtccgcaagctcccccccg 325

                                                                       
Query: 122 ccgagcccgtacacgccaacctgctcttcgccatccgcatcccaggcactgccgacttgc 181
           ||||| || |  || |||| ||  ||||||| || |||||||| |||||    |||||||
Sbjct: 326 ccgagaccctcaactccaagctcgtcttcgcgattcgcatccctggcacaatggacttgc 385

                                                                       
Query: 182 acccgcaaatcaggaagatcttggccaggctgcggctgacccaggtcctcacaggagtct 241
           | || || || |||| ||| |||  || |||||||||||| ||||||||||| || || |
Sbjct: 386 atccacacatgaggaggattttgcgcaagctgcggctgacgcaggtcctcaccggcgtgt 445

                                                                       
Query: 242 tcctcaaggccaccgaggcaaacctcaagaggcttgctgctgttgggccgtttgtcacct 301
           ||||||||||||| || || |   | |||||||||  || ||| | ||||||| |||| |
Sbjct: 446 tcctcaaggccactgacgctactatgaagaggcttcttgttgtggagccgtttatcactt 505

                                                                       
Query: 302 atgggttccccaatttgaagaatgtgaaggagcttatctacaagaagggtcgcgggtatt 361
           |||||||||| |||||||||||||||||||| ||||| ||||||||||| || ||||   
Sbjct: 506 atgggttcccaaatttgaagaatgtgaaggatcttatttacaagaagggccgtgggttcc 565

                                                                       
Query: 362 tcgacaaggagcctttcccccttaccagcaatgatctaatcgagaaggctcttggagaac 421
           | |||||||| |||||||| ||||||||||||||||| || ||||||||||| |||||| 
Sbjct: 566 tggacaaggaacctttccctcttaccagcaatgatctcattgagaaggctctgggagaat 625

                                                                       
Query: 422 acggcgtcatatgtttagaagatgtcgtgcacgaaatctccacggtcgggccgcacttca 481
           | ||| |||||||||| |||||| | ||||| |||||| |  | || || || |||||||
Sbjct: 626 atggcatcatatgtttggaagatcttgtgcatgaaatcgcatcagttggcccacacttca 685

                                                                       
Query: 482 gggaaacggcgagctttctcatgcccttcaagctcaagtgtccggagaggaggttgcaga 541
           | ||| |  | |  || |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 686 gagaagcttcaaatttcctcatgcccttcaagctcaagtgtccagagaggaggttgcaga 745

                                                        
Query: 542 tgaagaagaaacccttcaaggatggtggcgactcgggcaaccgcg 586
           |||||||||||||||||||||||||||| ||||| || |||||||
Sbjct: 746 tgaagaagaaacccttcaaggatggtggtgactcagggaaccgcg 790

---

>dbj|AK101416.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033037N08, full
           insert sequence
          Length = 981

 Score =  414 bits (209), Expect = e-112
 Identities = 491/585 (83%)
 Strand = Plus / Plus

                                                                       
Query: 2   gccgccacgacgccaagggcgccatcaagcgccccgaggacttcgtcagggagttccgca 61
           ||||| |||||| |||||||||||||||| | ||||||||||||||||||||||||||||
Sbjct: 206 gccgcgacgacggcaagggcgccatcaagaggcccgaggacttcgtcagggagttccgca 265

                                                                       
Query: 62  acaaggagctcgacttcctgcggatgcgcacgcgcctcaaggtccgcaagctgcgccccg 121
           ||||||||||||||||| | ||||||   || |||||||||||||||||||| | |||||
Sbjct: 266 acaaggagctcgacttcgtccggatgaagacccgcctcaaggtccgcaagctcccccccg 325

                                                                       
Query: 122 ccgagcccgtacacgccaacctgctcttcgccatccgcatcccaggcactgccgacttgc 181
           ||||| || |  || |||| ||  ||||||| || |||||||| |||||    |||||||
Sbjct: 326 ccgagaccctcaactccaagctcgtcttcgcgattcgcatccctggcacaatggacttgc 385

                                                                       
Query: 182 acccgcaaatcaggaagatcttggccaggctgcggctgacccaggtcctcacaggagtct 241
           | || || || |||| ||| |||  || |||||||||||| ||||||||||| || || |
Sbjct: 386 atccacacatgaggaggattttgcgcaagctgcggctgacgcaggtcctcaccggcgtgt 445

                                                                       
Query: 242 tcctcaaggccaccgaggcaaacctcaagaggcttgctgctgttgggccgtttgtcacct 301
           ||||||||||||| || || |   | |||||||||  || ||| | ||||||| |||| |
Sbjct: 446 tcctcaaggccactgacgctactatgaagaggcttcttgttgtggagccgtttatcactt 505

                                                                       
Query: 302 atgggttccccaatttgaagaatgtgaaggagcttatctacaagaagggtcgcgggtatt 361
           |||||||||| |||||||||||||||||||| ||||| ||||||||||| || ||||   
Sbjct: 506 atgggttcccaaatttgaagaatgtgaaggatcttatttacaagaagggccgtgggttcc 565

                                                                       
Query: 362 tcgacaaggagcctttcccccttaccagcaatgatctaatcgagaaggctcttggagaac 421
           | |||||||| |||||||| ||||||||||||||||| || ||||||||||| |||||| 
Sbjct: 566 tggacaaggaacctttccctcttaccagcaatgatctcattgagaaggctctgggagaat 625

                                                                       
Query: 422 acggcgtcatatgtttagaagatgtcgtgcacgaaatctccacggtcgggccgcacttca 481
           | ||| |||||||||| |||||| | ||||| |||||| |  | || || || |||||||
Sbjct: 626 atggcatcatatgtttggaagatcttgtgcatgaaatcgcatcagttggcccacacttca 685

                                                                       
Query: 482 gggaaacggcgagctttctcatgcccttcaagctcaagtgtccggagaggaggttgcaga 541
           | ||| |  | |  || |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 686 gagaagcttcaaatttcctcatgcccttcaagctcaagtgtccagagaggaggttgcaga 745

                                                        
Query: 542 tgaagaagaaacccttcaaggatggtggcgactcgggcaaccgcg 586
           |||||||||||||||||||||||||||| ||||| || |||||||
Sbjct: 746 tgaagaagaaacccttcaaggatggtggtgactcagggaaccgcg 790

---

>dbj|AK058490.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-E01, full
           insert sequence
          Length = 984

 Score =  414 bits (209), Expect = e-112
 Identities = 491/585 (83%)
 Strand = Plus / Plus

                                                                       
Query: 2   gccgccacgacgccaagggcgccatcaagcgccccgaggacttcgtcagggagttccgca 61
           ||||| |||||| |||||||||||||||| | ||||||||||||||||||||||||||||
Sbjct: 206 gccgcgacgacggcaagggcgccatcaagaggcccgaggacttcgtcagggagttccgca 265

                                                                       
Query: 62  acaaggagctcgacttcctgcggatgcgcacgcgcctcaaggtccgcaagctgcgccccg 121
           ||||||||||||||||| | ||||||   || |||||||||||||||||||| | |||||
Sbjct: 266 acaaggagctcgacttcgtccggatgaagacccgcctcaaggtccgcaagctcccccccg 325

                                                                       
Query: 122 ccgagcccgtacacgccaacctgctcttcgccatccgcatcccaggcactgccgacttgc 181
           ||||| || |  || |||| ||  ||||||| || |||||||| |||||    |||||||
Sbjct: 326 ccgagaccctcaactccaagctcgtcttcgcgattcgcatccctggcacaatggacttgc 385

                                                                       
Query: 182 acccgcaaatcaggaagatcttggccaggctgcggctgacccaggtcctcacaggagtct 241
           | || || || |||| ||| |||  || |||||||||||| ||||||||||| || || |
Sbjct: 386 atccacacatgaggaggattttgcgcaagctgcggctgacgcaggtcctcaccggcgtgt 445

                                                                       
Query: 242 tcctcaaggccaccgaggcaaacctcaagaggcttgctgctgttgggccgtttgtcacct 301
           ||||||||||||| || || |   | |||||||||  || ||| | ||||||| |||| |
Sbjct: 446 tcctcaaggccactgacgctactatgaagaggcttcttgttgtggagccgtttatcactt 505

                                                                       
Query: 302 atgggttccccaatttgaagaatgtgaaggagcttatctacaagaagggtcgcgggtatt 361
           |||||||||| |||||||||||||||||||| ||||| ||||||||||| || ||||   
Sbjct: 506 atgggttcccaaatttgaagaatgtgaaggatcttatttacaagaagggccgtgggttcc 565

                                                                       
Query: 362 tcgacaaggagcctttcccccttaccagcaatgatctaatcgagaaggctcttggagaac 421
           | |||||||| |||||||| ||||||||||||||||| || ||||||||||| |||||| 
Sbjct: 566 tggacaaggaacctttccctcttaccagcaatgatctcattgagaaggctctgggagaat 625

                                                                       
Query: 422 acggcgtcatatgtttagaagatgtcgtgcacgaaatctccacggtcgggccgcacttca 481
           | ||| |||||||||| |||||| | ||||| |||||| |  | || || || |||||||
Sbjct: 626 atggcatcatatgtttggaagatcttgtgcatgaaatcgcatcagttggcccacacttca 685

                                                                       
Query: 482 gggaaacggcgagctttctcatgcccttcaagctcaagtgtccggagaggaggttgcaga 541
           | ||| |  | |  || |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 686 gagaagcttcaaatttcctcatgcccttcaagctcaagtgtccagagaggaggttgcaga 745

                                                        
Query: 542 tgaagaagaaacccttcaaggatggtggcgactcgggcaaccgcg 586
           |||||||||||||||||||||||||||| ||||| || |||||||
Sbjct: 746 tgaagaagaaacccttcaaggatggtggtgactcagggaaccgcg 790

---

>gb|AY104606.1| Zea mays PCO071007 mRNA sequence
          Length = 785

 Score =  155 bits (78), Expect = 2e-34
 Identities = 322/401 (80%), Gaps = 2/401 (0%)
 Strand = Plus / Plus

                                                                       
Query: 34  cccgaggacttcgtcagggagttccgcaacaaggagctcgacttcctgcggatgcgcacg 93
           ||||||||||||||   || |||||| |||||||| | |||||||||||||||| | || 
Sbjct: 375 cccgaggacttcgttgcggcgttccggaacaaggaacgcgacttcctgcggatgaggacc 434

                                                                       
Query: 94  cgcctcaaggtccgcaagctgcgccccgccgagcccgtacacgccaacctgctcttcgcc 153
           ||||||||||||||||||| ||  ||||||||| |  |   | |||| ||  ||||||| 
Sbjct: 435 cgcctcaaggtccgcaagcagccgcccgccgaggcgctcagctccaagctcgtcttcgca 494

                                                                       
Query: 154 atccgcatcccaggcactgccgacttgcacccgcaaatcaggaagatcttggccaggctg 213
           || |||||||| ||| | |  |||||||| ||||| ||||||||| |||||   | ||| 
Sbjct: 495 attcgcatccctggctccgtggacttgcatccgcacatcaggaaggtcttgaggaagcta 554

                                                                       
Query: 214 cggctgacccaggtcctcacaggagtcttcctcaaggccaccgaggcaaacctcaagagg 273
           ||||||||   ||||||||| || || ||||||| ||||||||||   |  || ||||||
Sbjct: 555 cggctgacgacggtcctcaccggcgtattcctcagggccaccgagctgacgctgaagagg 614

                                                                       
Query: 274 cttgctgctgttgggccgtttgtcacctatgggttccccaatttgaagaatgtgaaggag 333
           |||  ||  || |  || ||||||||||| ||||| || || |||||||| ||||| |||
Sbjct: 615 cttcttgtggtcgaaccctttgtcacctacgggtttccaaacttgaagaacgtgaaagag 674

                                                                       
Query: 334 cttatctacaagaagggtcgcgggtatttcgacaaggagcctttcccccttaccagcaat 393
           ||||| ||||||||||| || |||| ||||||||| || |||||||| |||||||| || 
Sbjct: 675 cttatttacaagaagggccgtgggtttttcgacaaaga-cctttccctcttaccagtaac 733

                                                    
Query: 394 gatctaatcgagaaggctcttggagaacacggcgtcatatg 434
           |||||||| ||||| ||||||||| | |||||| |||||||
Sbjct: 734 gatctaattgagaa-gctcttgganatcacggcatcatatg 773

---

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  153 bits (77), Expect = 9e-34
 Identities = 113/125 (90%)
 Strand = Plus / Plus

                                                                            
Query: 2        gccgccacgacgccaagggcgccatcaagcgccccgaggacttcgtcagggagttccgca 61
                ||||| |||||| |||||||||||||||| | ||||||||||||||||||||||||||||
Sbjct: 27120725 gccgcgacgacggcaagggcgccatcaagaggcccgaggacttcgtcagggagttccgca 27120784

                                                                            
Query: 62       acaaggagctcgacttcctgcggatgcgcacgcgcctcaaggtccgcaagctgcgccccg 121
                ||||||||||||||||| | ||||||   || |||||||||||||||||||| | |||||
Sbjct: 27120785 acaaggagctcgacttcgtccggatgaagacccgcctcaaggtccgcaagctcccccccg 27120844

                     
Query: 122      ccgag 126
                |||||
Sbjct: 27120845 ccgag 27120849



 Score =  143 bits (72), Expect = 8e-31
 Identities = 84/88 (95%)
 Strand = Plus / Plus

                                                                            
Query: 499      ctcatgcccttcaagctcaagtgtccggagaggaggttgcagatgaagaagaaacccttc 558
                |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 27121967 ctcatgcccttcaagctcaagtgtccagagaggaggttgcagatgaagaagaaacccttc 27122026

                                            
Query: 559      aaggatggtggcgactcgggcaaccgcg 586
                ||||||||||| ||||| || |||||||
Sbjct: 27122027 aaggatggtggtgactcagggaaccgcg 27122054



 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                            
Query: 305      ggttccccaatttgaagaatgtgaaggagcttatctacaagaagggtcgcgggtatttcg 364
                ||||||| |||||||||||||||||||| ||||| ||||||||||| || ||||   | |
Sbjct: 27121279 ggttcccaaatttgaagaatgtgaaggatcttatttacaagaagggccgtgggttcctgg 27121338

                                                             
Query: 365      acaaggagcctttcccccttaccagcaatgatctaatcgagaagg 409
                ||||||| |||||||| ||||||||||||||||| || |||||||
Sbjct: 27121339 acaaggaacctttccctcttaccagcaatgatctcattgagaagg 27121383



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 136/163 (83%), Gaps = 4/163 (2%)
 Strand = Plus / Plus

                                                                            
Query: 407      aggctcttggagaacacggcgtcatatgtttagaagatgtcgtgcacgaaatctccacgg 466
                ||||||| |||||||| ||| |||||||||| |||||||    ||| |||||| | || |
Sbjct: 27128824 aggctctaggagaacatggcatcatatgtttggaagatga---gcatgaaatcgcaacag 27128880

                                                                            
Query: 467      tcgggccgcacttcagggaaacggcgagctttctcatgcccttcaagctcaagtgtccgg 526
                |||| || ||||||||  || |  | | ||| |||||||||||||||||||||||||  |
Sbjct: 27128881 tcggtccacacttcagacaagcttcaaacttcctcatgcccttcaagctcaagtgtcaag 27128940

                                                           
Query: 527      agaggaggttgcagatgaagaagaaacccttcaaggatggtgg 569
                | |||||||| ||||||||||||||||||| ||||||||||||
Sbjct: 27128941 a-aggaggttacagatgaagaagaaaccctacaaggatggtgg 27128982



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                             
Query: 210      gctgcggctgacccaggtcctcacaggagtcttcctcaaggccac 254
                |||||||||||| ||||||||||| || || ||||||||||||||
Sbjct: 27121071 gctgcggctgacgcaggtcctcaccggcgtgttcctcaaggccac 27121115

---

>dbj|AP003914.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1521_G02
          Length = 117964

 Score =  153 bits (77), Expect = 9e-34
 Identities = 113/125 (90%)
 Strand = Plus / Plus

                                                                         
Query: 2     gccgccacgacgccaagggcgccatcaagcgccccgaggacttcgtcagggagttccgca 61
             ||||| |||||| |||||||||||||||| | ||||||||||||||||||||||||||||
Sbjct: 21758 gccgcgacgacggcaagggcgccatcaagaggcccgaggacttcgtcagggagttccgca 21817

                                                                         
Query: 62    acaaggagctcgacttcctgcggatgcgcacgcgcctcaaggtccgcaagctgcgccccg 121
             ||||||||||||||||| | ||||||   || |||||||||||||||||||| | |||||
Sbjct: 21818 acaaggagctcgacttcgtccggatgaagacccgcctcaaggtccgcaagctcccccccg 21877

                  
Query: 122   ccgag 126
             |||||
Sbjct: 21878 ccgag 21882



 Score =  143 bits (72), Expect = 8e-31
 Identities = 84/88 (95%)
 Strand = Plus / Plus

                                                                         
Query: 499   ctcatgcccttcaagctcaagtgtccggagaggaggttgcagatgaagaagaaacccttc 558
             |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 23000 ctcatgcccttcaagctcaagtgtccagagaggaggttgcagatgaagaagaaacccttc 23059

                                         
Query: 559   aaggatggtggcgactcgggcaaccgcg 586
             ||||||||||| ||||| || |||||||
Sbjct: 23060 aaggatggtggtgactcagggaaccgcg 23087



 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                         
Query: 305   ggttccccaatttgaagaatgtgaaggagcttatctacaagaagggtcgcgggtatttcg 364
             ||||||| |||||||||||||||||||| ||||| ||||||||||| || ||||   | |
Sbjct: 22312 ggttcccaaatttgaagaatgtgaaggatcttatttacaagaagggccgtgggttcctgg 22371

                                                          
Query: 365   acaaggagcctttcccccttaccagcaatgatctaatcgagaagg 409
             ||||||| |||||||| ||||||||||||||||| || |||||||
Sbjct: 22372 acaaggaacctttccctcttaccagcaatgatctcattgagaagg 22416



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 136/163 (83%), Gaps = 4/163 (2%)
 Strand = Plus / Plus

                                                                         
Query: 407   aggctcttggagaacacggcgtcatatgtttagaagatgtcgtgcacgaaatctccacgg 466
             ||||||| |||||||| ||| |||||||||| |||||||    ||| |||||| | || |
Sbjct: 29857 aggctctaggagaacatggcatcatatgtttggaagatga---gcatgaaatcgcaacag 29913

                                                                         
Query: 467   tcgggccgcacttcagggaaacggcgagctttctcatgcccttcaagctcaagtgtccgg 526
             |||| || ||||||||  || |  | | ||| |||||||||||||||||||||||||  |
Sbjct: 29914 tcggtccacacttcagacaagcttcaaacttcctcatgcccttcaagctcaagtgtcaag 29973

                                                        
Query: 527   agaggaggttgcagatgaagaagaaacccttcaaggatggtgg 569
             | |||||||| ||||||||||||||||||| ||||||||||||
Sbjct: 29974 a-aggaggttacagatgaagaagaaaccctacaaggatggtgg 30015



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                          
Query: 210   gctgcggctgacccaggtcctcacaggagtcttcctcaaggccac 254
             |||||||||||| ||||||||||| || || ||||||||||||||
Sbjct: 22104 gctgcggctgacgcaggtcctcaccggcgtgttcctcaaggccac 22148

---

>dbj|AP003948.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1211_G06
          Length = 96421

 Score =  153 bits (77), Expect = 9e-34
 Identities = 113/125 (90%)
 Strand = Plus / Plus

                                                                         
Query: 2     gccgccacgacgccaagggcgccatcaagcgccccgaggacttcgtcagggagttccgca 61
             ||||| |||||| |||||||||||||||| | ||||||||||||||||||||||||||||
Sbjct: 91812 gccgcgacgacggcaagggcgccatcaagaggcccgaggacttcgtcagggagttccgca 91871

                                                                         
Query: 62    acaaggagctcgacttcctgcggatgcgcacgcgcctcaaggtccgcaagctgcgccccg 121
             ||||||||||||||||| | ||||||   || |||||||||||||||||||| | |||||
Sbjct: 91872 acaaggagctcgacttcgtccggatgaagacccgcctcaaggtccgcaagctcccccccg 91931

                  
Query: 122   ccgag 126
             |||||
Sbjct: 91932 ccgag 91936



 Score =  143 bits (72), Expect = 8e-31
 Identities = 84/88 (95%)
 Strand = Plus / Plus

                                                                         
Query: 499   ctcatgcccttcaagctcaagtgtccggagaggaggttgcagatgaagaagaaacccttc 558
             |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 93054 ctcatgcccttcaagctcaagtgtccagagaggaggttgcagatgaagaagaaacccttc 93113

                                         
Query: 559   aaggatggtggcgactcgggcaaccgcg 586
             ||||||||||| ||||| || |||||||
Sbjct: 93114 aaggatggtggtgactcagggaaccgcg 93141



 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                         
Query: 305   ggttccccaatttgaagaatgtgaaggagcttatctacaagaagggtcgcgggtatttcg 364
             ||||||| |||||||||||||||||||| ||||| ||||||||||| || ||||   | |
Sbjct: 92366 ggttcccaaatttgaagaatgtgaaggatcttatttacaagaagggccgtgggttcctgg 92425

                                                          
Query: 365   acaaggagcctttcccccttaccagcaatgatctaatcgagaagg 409
             ||||||| |||||||| ||||||||||||||||| || |||||||
Sbjct: 92426 acaaggaacctttccctcttaccagcaatgatctcattgagaagg 92470



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                          
Query: 210   gctgcggctgacccaggtcctcacaggagtcttcctcaaggccac 254
             |||||||||||| ||||||||||| || || ||||||||||||||
Sbjct: 92158 gctgcggctgacgcaggtcctcaccggcgtgttcctcaaggccac 92202

---

>gb|AY111978.1| Zea mays CL45039_-2 mRNA sequence
          Length = 623

 Score =  127 bits (64), Expect = 5e-26
 Identities = 160/192 (83%)
 Strand = Plus / Minus

                                                                       
Query: 411 tcttggagaacacggcgtcatatgtttagaagatgtcgtgcacgaaatctccacggtcgg 470
           ||||||||| || ||| ||||||| || |||||  | |||||||| ||| |||| || ||
Sbjct: 441 tcttggagatcatggcatcatatgcttggaagaccttgtgcacgagatcgccactgtagg 382

                                                                       
Query: 471 gccgcacttcagggaaacggcgagctttctcatgcccttcaagctcaagtgtccggagag 530
            ||||||||| | ||| |  |||| || |||||||||||| |||||||||||||||||||
Sbjct: 381 cccgcacttccgagaagcatcgaggttcctcatgcccttccagctcaagtgtccggagag 322

                                                                       
Query: 531 gaggttgcagatgaagaagaaacccttcaaggatggtggcgactcgggcaaccgcgggga 590
           |||| |||||||||||| |||||| | ||||||||| ||||| || |||||||| || ||
Sbjct: 321 gaggctgcagatgaagaggaaaccgtacaaggatggcggcgattcaggcaaccgtggcga 262

                       
Query: 591 caagatcaacga 602
           |||  |||||||
Sbjct: 261 caaagtcaacga 250



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 319 aagaatgtgaaggagcttatctacaagaagggtcgcgggt 358
           |||| |||||| ||||||||||||||||| || |||||||
Sbjct: 533 aagagtgtgaaagagcttatctacaagaaaggccgcgggt 494

---

>ref|XM_483591.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 207

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 66/71 (92%), Gaps = 1/71 (1%)
 Strand = Plus / Plus

                                                                       
Query: 499 ctcatgcccttcaagctcaagtgtccggagaggaggttgcagatgaagaagaaacccttc 558
           |||||||||||||||||||||||||  || |||||||| ||||||||||||||||||| |
Sbjct: 75  ctcatgcccttcaagctcaagtgtcaaga-aggaggttacagatgaagaagaaaccctac 133

                      
Query: 559 aaggatggtgg 569
           |||||||||||
Sbjct: 134 aaggatggtgg 144

---

>emb|BX065427.1|CNS09MNB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 197

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||||||||||||||||||||||
Sbjct: 152 ggcgacttcggcaaccgcggggacaagatcaacgagct 115

---

>emb|BX036885.1|CNS090MH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||||||||||||||||||||||
Sbjct: 792 ggcgacttcggcaaccgcggggacaagatcaacgagct 829

---

>emb|BX062168.1|CNS09K4S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 559

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 574 tcgggcaaccgcggggacaagatcaacgagct 605
           ||||||||||||| ||||||||||||||||||
Sbjct: 213 tcgggcaaccgcgaggacaagatcaacgagct 182

---

>emb|BX029473.1|CNS08UWL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 574 tcgggcaaccgcggggacaagatcaacgagct 605
           ||||||||||||| ||||||||||||||||||
Sbjct: 246 tcgggcaaccgcgaggacaagatcaacgagct 215

---

>emb|BX019031.1|CNS08MUJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 240

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 574 tcgggcaaccgcggggacaagatcaacgagct 605
           ||||||||||||| ||||||||||||||||||
Sbjct: 216 tcgggcaaccgcgaggacaagatcaacgagct 185

---

>emb|BX017181.1|CNS08LF5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 545

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 574 tcgggcaaccgcggggacaagatcaacgagct 605
           ||||||||||||| ||||||||||||||||||
Sbjct: 241 tcgggcaaccgcgaggacaagatcaacgagct 210

---

>emb|BX049251.1|CNS09A5Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 560

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 575 cgggcaaccgcggggacaagatcaacgagct 605
           |||||||||||| ||||||||||||||||||
Sbjct: 249 cgggcaaccgcgaggacaagatcaacgagct 219

---

>gb|AC135599.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0045P14,
              complete sequence
          Length = 121894

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                            
Query: 38     aggacttcgtcagggagttccgcaacaagg 67
              |||||||||||||||||||| |||||||||
Sbjct: 113134 aggacttcgtcagggagttctgcaacaagg 113163

---

>gb|AC136447.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0056F11, complete sequence
          Length = 89986

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                           
Query: 38    aggacttcgtcagggagttccgcaacaagg 67
             |||||||||||||||||||| |||||||||
Sbjct: 83551 aggacttcgtcagggagttctgcaacaagg 83522

---

>emb|BX053396.1|CNS09DD4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 678

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 245 ggcgacttcggcaaccgcgaggacaagatcaacgagct 208

---

>emb|BX072064.1|CNS09RRO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 780 ggcgacttcggcaaccgcgaggacaagatcaacgagct 817

---

>emb|BX071791.1|CNS09RK3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 239 ggcgacttcggcaaccgcgaggacaagatcaacgagct 202

---

>emb|BX071790.1|CNS09RK2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 792 ggcgacttcggcaaccgcgaggacaagatcaacgagct 829

---

>emb|BX071653.1|CNS09RG9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 808

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 236 ggcgacttcggcaaccgcgaggacaagatcaacgagct 199

---

>emb|BX071652.1|CNS09RG8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 767 ggcgacttcggcaaccgcgaggacaagatcaacgagct 804

---

>emb|BX071452.1|CNS09RAO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 227 ggcgacttcggcaaccgcgaggacaagatcaacgagct 190

---

>emb|BX071451.1|CNS09RAN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 729 ggcgacttcggcaaccgcgaggacaagatcaacgagct 766

---

>emb|BX071396.1|CNS09R94 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 786 ggcgacttcggcaaccgcgaggacaagatcaacgagct 823

---

>emb|BX071298.1|CNS09R6E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 681 ggcgacttcggcaaccgcgaggacaagatcaacgagct 718

---

>emb|BX071259.1|CNS09R5B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8CH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 349

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 241 ggcgacttcggcaaccgcgaggacaagatcaacgagct 204

---

>emb|BX071258.1|CNS09R5A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 787 ggcgacttcggcaaccgcgaggacaagatcaacgagct 824

---

>emb|BX071034.1|CNS09QZ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 219 ggcgacttcggcaaccgcgaggacaagatcaacgagct 182

---

>emb|BX071033.1|CNS09QZ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 804 ggcgacttcggcaaccgcgaggacaagatcaacgagct 841

---

>emb|BX070988.1|CNS09QXS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 714

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 257 ggcgacttcggcaaccgcgaggacaagatcaacgagct 220

---

>emb|BX070987.1|CNS09QXR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 702 ggcgacttcggcaaccgcgaggacaagatcaacgagct 739

---

>emb|BX070913.1|CNS09QVP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 243 ggcgacttcggcaaccgcgaggacaagatcaacgagct 206

---

>emb|BX070912.1|CNS09QVO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 805 ggcgacttcggcaaccgcgaggacaagatcaacgagct 842

---

>emb|BX070805.1|CNS09QSP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 499

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 205 ggcgacttcggcaaccgcgaggacaagatcaacgagct 168

---

>emb|BX070804.1|CNS09QSO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 755 ggcgacttcggcaaccgcgaggacaagatcaacgagct 792

---

>emb|BX070631.1|CNS09QNV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 550

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 247 ggcgacttcggcaaccgcgaggacaagatcaacgagct 210

---

>emb|BX070630.1|CNS09QNU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 775 ggcgacttcggcaaccgcgaggacaagatcaacgagct 812

---

>emb|BX070560.1|CNS09QLW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 363

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 230 ggcgacttcggcaaccgcgaggacaagatcaacgagct 193

---

>emb|BX070494.1|CNS09QK2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 841

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 226 ggcgacttcggcaaccgcgaggacaagatcaacgagct 189

---

>emb|BX070493.1|CNS09QK1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 709 ggcgacttcggcaaccgcgaggacaagatcaacgagct 746

---

>emb|BX070258.1|CNS09QDI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 455

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 259 ggcgacttcggcaaccgcgaggacaagatcaacgagct 222

---

>emb|BX070053.1|CNS09Q7T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 301

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 251 ggcgacttcggcaaccgcgaggacaagatcaacgagct 214

---

>emb|BX070052.1|CNS09Q7S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 806 ggcgacttcggcaaccgcgaggacaagatcaacgagct 843

---

>emb|BX070015.1|CNS09Q6R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 546

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 248 ggcgacttcggcaaccgcgaggacaagatcaacgagct 211

---

>emb|BX070014.1|CNS09Q6Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 798 ggcgacttcggcaaccgcgaggacaagatcaacgagct 835

---

>emb|BX069981.1|CNS09Q5T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 791 ggcgacttcggcaaccgcgaggacaagatcaacgagct 828

---

>emb|BX069946.1|CNS09Q4U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 801 ggcgacttcggcaaccgcgaggacaagatcaacgagct 838

---

>emb|BX069852.1|CNS09Q28 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 242 ggcgacttcggcaaccgcgaggacaagatcaacgagct 205

---

>emb|BX069851.1|CNS09Q27 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 863 ggcgacttcggcaaccgcgaggacaagatcaacgagct 900

---

>emb|BX069725.1|CNS09PYP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 244 ggcgacttcggcaaccgcgaggacaagatcaacgagct 207

---

>emb|BX069724.1|CNS09PYO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 797 ggcgacttcggcaaccgcgaggacaagatcaacgagct 834

---

>emb|BX069627.1|CNS09PVZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 760

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 240 ggcgacttcggcaaccgcgaggacaagatcaacgagct 203

---

>emb|BX069626.1|CNS09PVY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 792 ggcgacttcggcaaccgcgaggacaagatcaacgagct 829

---

>emb|BX069444.1|CNS09PQW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 801

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 235 ggcgacttcggcaaccgcgaggacaagatcaacgagct 198

---

>emb|BX069443.1|CNS09PQV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 789 ggcgacttcggcaaccgcgaggacaagatcaacgagct 826

---

>emb|BX069442.1|CNS09PQU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 790

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 252 ggcgacttcggcaaccgcgaggacaagatcaacgagct 215

---

>emb|BX069441.1|CNS09PQT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 787 ggcgacttcggcaaccgcgaggacaagatcaacgagct 824

---

>emb|BX069361.1|CNS09POL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6AA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 785

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 243 ggcgacttcggcaaccgcgaggacaagatcaacgagct 206

---

>emb|BX069360.1|CNS09POK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 903

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 806 ggcgacttcggcaaccgcgaggacaagatcaacgagct 843

---

>emb|BX069131.1|CNS09PI7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 241 ggcgacttcggcaaccgcgaggacaagatcaacgagct 204

---

>emb|BX069130.1|CNS09PI6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1050

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 811 ggcgacttcggcaaccgcgaggacaagatcaacgagct 848

---

>emb|BX069121.1|CNS09PHX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 452

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 263 ggcgacttcggcaaccgcgaggacaagatcaacgagct 226

---

>emb|BX069029.1|CNS09PFD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 321

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 280 ggcgacttcggcaaccgcgaggacaagatcaacgagct 243

---

>emb|BX069028.1|CNS09PFC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 745 ggcgacttcggcaaccgcgaggacaagatcaacgagct 782

---

>emb|BX068969.1|CNS09PDP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53BG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 477

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 265 ggcgacttcggcaaccgcgaggacaagatcaacgagct 228

---

>emb|BX068968.1|CNS09PDO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 767 ggcgacttcggcaaccgcgaggacaagatcaacgagct 804

---

>emb|BX068913.1|CNS09PC5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1021

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 810 ggcgacttcggcaaccgcgaggacaagatcaacgagct 847

---

>emb|BX068796.1|CNS09P8W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 689 ggcgacttcggcaaccgcgaggacaagatcaacgagct 726

---

>emb|BX068679.1|CNS09P5N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 245 ggcgacttcggcaaccgcgaggacaagatcaacgagct 208

---

>emb|BX068678.1|CNS09P5M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1045

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 805 ggcgacttcggcaaccgcgaggacaagatcaacgagct 842

---

>emb|BX068669.1|CNS09P5D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 502

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 233 ggcgacttcggcaaccgcgaggacaagatcaacgagct 196

---

>emb|BX068455.1|CNS09OZF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1043

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 814 ggcgacttcggcaaccgcgaggacaagatcaacgagct 851

---

>emb|BX068359.1|CNS09OWR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 802 ggcgacttcggcaaccgcgaggacaagatcaacgagct 839

---

>emb|BX068150.1|CNS09OQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 794 ggcgacttcggcaaccgcgaggacaagatcaacgagct 831

---

>emb|BX068136.1|CNS09OQK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 822

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 247 ggcgacttcggcaaccgcgaggacaagatcaacgagct 210

---

>emb|BX068135.1|CNS09OQJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 806 ggcgacttcggcaaccgcgaggacaagatcaacgagct 843

---

>emb|BX067770.1|CNS09OGE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 763

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 232 ggcgacttcggcaaccgcgaggacaagatcaacgagct 195

---

>emb|BX067769.1|CNS09OGD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 890

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 781 ggcgacttcggcaaccgcgaggacaagatcaacgagct 818

---

>emb|BX067575.1|CNS09OAZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 812

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 244 ggcgacttcggcaaccgcgaggacaagatcaacgagct 207

---

>emb|BX067574.1|CNS09OAY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 768 ggcgacttcggcaaccgcgaggacaagatcaacgagct 805

---

>emb|BX067534.1|CNS09O9U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 289

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 103 ggcgacttcggcaaccgcgaggacaagatcaacgagct 66

---

>emb|BX067533.1|CNS09O9T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 781 ggcgacttcggcaaccgcgaggacaagatcaacgagct 818

---

>emb|BX067446.1|CNS09O7E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 574

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 234 ggcgacttcggcaaccgcgaggacaagatcaacgagct 197

---

>emb|BX067445.1|CNS09O7D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 844

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 757 ggcgacttcggcaaccgcgaggacaagatcaacgagct 794

---

>emb|BX067333.1|CNS09O49 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 777 ggcgacttcggcaaccgcgaggacaagatcaacgagct 814

---

>emb|BX067064.1|CNS09NWS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 264

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 223 ggcgacttcggcaaccgcgaggacaagatcaacgagct 186

---

>emb|BX067063.1|CNS09NWR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1041

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 753 ggcgacttcggcaaccgcgaggacaagatcaacgagct 790

---

>emb|BX067001.1|CNS09NV1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 431

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 255 ggcgacttcggcaaccgcgaggacaagatcaacgagct 218

---

>emb|BX067000.1|CNS09NV0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 720 ggcgacttcggcaaccgcgaggacaagatcaacgagct 757

---

>emb|BX067241.1|CNS09O1P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 812

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 236 ggcgacttcggcaaccgcgaggacaagatcaacgagct 199

---

>emb|BX067240.1|CNS09O1O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 879 ggcgacttcggcaaccgcgaggacaagatcaacgagct 916

---

>emb|BX067178.1|CNS09NZY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 235 ggcgacttcggcaaccgcgaggacaagatcaacgagct 198

---

>emb|BX067177.1|CNS09NZX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 693

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 565 ggcgacttcggcaaccgcgaggacaagatcaacgagct 602

---

>emb|BX067146.1|CNS09NZ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 822

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 262 ggcgacttcggcaaccgcgaggacaagatcaacgagct 225

---

>emb|BX067145.1|CNS09NZ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 807 ggcgacttcggcaaccgcgaggacaagatcaacgagct 844

---

>emb|BX066849.1|CNS09NQT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 246 ggcgacttcggcaaccgcgaggacaagatcaacgagct 209

---

>emb|BX066848.1|CNS09NQS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 796 ggcgacttcggcaaccgcgaggacaagatcaacgagct 833

---

>emb|BX066768.1|CNS09NOK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 593

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 241 ggcgacttcggcaaccgcgaggacaagatcaacgagct 204

---

>emb|BX066767.1|CNS09NOJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 775 ggcgacttcggcaaccgcgaggacaagatcaacgagct 812

---

>emb|BX066726.1|CNS09NNE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 802

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 229 ggcgacttcggcaaccgcgaggacaagatcaacgagct 192

---

>emb|BX066725.1|CNS09NND Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1017

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 790 ggcgacttcggcaaccgcgaggacaagatcaacgagct 827

---

>emb|BX066633.1|CNS09NKT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 801 ggcgacttcggcaaccgcgaggacaagatcaacgagct 838

---

>emb|BX066558.1|CNS09NIQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 679

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 103 ggcgacttcggcaaccgcgaggacaagatcaacgagct 66

---

>emb|BX066557.1|CNS09NIP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 788 ggcgacttcggcaaccgcgaggacaagatcaacgagct 825

---

>emb|BX066512.1|CNS09NHG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 238 ggcgacttcggcaaccgcgaggacaagatcaacgagct 201

---

>emb|BX066511.1|CNS09NHF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 788 ggcgacttcggcaaccgcgaggacaagatcaacgagct 825

---

>emb|BX066367.1|CNS09NDF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 537

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 228 ggcgacttcggcaaccgcgaggacaagatcaacgagct 191

---

>emb|BX066366.1|CNS09NDE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 597 ggcgacttcggcaaccgcgaggacaagatcaacgagct 634

---

>emb|BX066303.1|CNS09NBN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 596

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 235 ggcgacttcggcaaccgcgaggacaagatcaacgagct 198

---

>emb|BX066302.1|CNS09NBM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 792 ggcgacttcggcaaccgcgaggacaagatcaacgagct 829

---

>emb|BX066297.1|CNS09NBH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 213 ggcgacttcggcaaccgcgaggacaagatcaacgagct 176

---

>emb|BX066296.1|CNS09NBG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 777 ggcgacttcggcaaccgcgaggacaagatcaacgagct 814

---

>emb|BX066130.1|CNS09N6U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 237 ggcgacttcggcaaccgcgaggacaagatcaacgagct 200

---

>emb|BX066129.1|CNS09N6T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 878 ggcgacttcggcaaccgcgaggacaagatcaacgagct 915

---

>emb|BX065912.1|CNS09N0S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 700

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 233 ggcgacttcggcaaccgcgaggacaagatcaacgagct 196

---

>emb|BX065603.1|CNS09MS7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 497

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 214 ggcgacttcggcaaccgcgaggacaagatcaacgagct 177

---

>emb|BX065559.1|CNS09MQZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 782

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 226 ggcgacttcggcaaccgcgaggacaagatcaacgagct 189

---

>emb|BX065558.1|CNS09MQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1015

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 784 ggcgacttcggcaaccgcgaggacaagatcaacgagct 821

---

>emb|BX065426.1|CNS09MNA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 765 ggcgacttcggcaaccgcgaggacaagatcaacgagct 802

---

>emb|BX065421.1|CNS09MN5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 204 ggcgacttcggcaaccgcgaggacaagatcaacgagct 167

---

>emb|BX065420.1|CNS09MN4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 806 ggcgacttcggcaaccgcgaggacaagatcaacgagct 843

---

>emb|BX065376.1|CNS09MLW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 800

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 223 ggcgacttcggcaaccgcgaggacaagatcaacgagct 186

---

>emb|BX065375.1|CNS09MLV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 778 ggcgacttcggcaaccgcgaggacaagatcaacgagct 815

---

>emb|BX065329.1|CNS09MKL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 467

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 235 ggcgacttcggcaaccgcgaggacaagatcaacgagct 198

---

>emb|BX065312.1|CNS09MK4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 791 ggcgacttcggcaaccgcgaggacaagatcaacgagct 828

---

>emb|BX065118.1|CNS09MEQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 800 ggcgacttcggcaaccgcgaggacaagatcaacgagct 837

---

>emb|BX065105.1|CNS09MED Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 865

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 759 ggcgacttcggcaaccgcgaggacaagatcaacgagct 796

---

>emb|BX064707.1|CNS09M3B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 364

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 225 ggcgacttcggcaaccgcgaggacaagatcaacgagct 188

---

>emb|BX064706.1|CNS09M3A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 747 ggcgacttcggcaaccgcgaggacaagatcaacgagct 784

---

>emb|BX064243.1|CNS09LQF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 207

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 160 ggcgacttcggcaaccgcgaggacaagatcaacgagct 123

---

>emb|BX064242.1|CNS09LQE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 781 ggcgacttcggcaaccgcgaggacaagatcaacgagct 818

---

>emb|BX064203.1|CNS09LPB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 286

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 241 ggcgacttcggcaaccgcgaggacaagatcaacgagct 204

---

>emb|BX064173.1|CNS09LOH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 289

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 241 ggcgacttcggcaaccgcgaggacaagatcaacgagct 204

---

>emb|BX064172.1|CNS09LOG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1054

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 775 ggcgacttcggcaaccgcgaggacaagatcaacgagct 812

---

>emb|BX064030.1|CNS09LKI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 550

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 230 ggcgacttcggcaaccgcgaggacaagatcaacgagct 193

---

>emb|BX064029.1|CNS09LKH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 764 ggcgacttcggcaaccgcgaggacaagatcaacgagct 801

---

>emb|BX063864.1|CNS09LFW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 506

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 255 ggcgacttcggcaaccgcgaggacaagatcaacgagct 218

---

>emb|BX063860.1|CNS09LFS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 260

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 242 ggcgacttcggcaaccgcgaggacaagatcaacgagct 205

---

>emb|BX063859.1|CNS09LFR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 687 ggcgacttcggcaaccgcgaggacaagatcaacgagct 724

---

>emb|BX063580.1|CNS09L80 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 839

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 226 ggcgacttcggcaaccgcgaggacaagatcaacgagct 189

---

>emb|BX063579.1|CNS09L7Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 790 ggcgacttcggcaaccgcgaggacaagatcaacgagct 827

---

>emb|BX063193.1|CNS09KX9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 835

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 239 ggcgacttcggcaaccgcgaggacaagatcaacgagct 202

---

>emb|BX063192.1|CNS09KX8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 800 ggcgacttcggcaaccgcgaggacaagatcaacgagct 837

---

>emb|BX062982.1|CNS09KRE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 783 ggcgacttcggcaaccgcgaggacaagatcaacgagct 820

---

>emb|BX062974.1|CNS09KR6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 776

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 257 ggcgacttcggcaaccgcgaggacaagatcaacgagct 220

---

>emb|BX062973.1|CNS09KR5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 786 ggcgacttcggcaaccgcgaggacaagatcaacgagct 823

---

>emb|BX062925.1|CNS09KPT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 814

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 227 ggcgacttcggcaaccgcgaggacaagatcaacgagct 190

---

>emb|BX062924.1|CNS09KPS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 773 ggcgacttcggcaaccgcgaggacaagatcaacgagct 810

---

>emb|BX062896.1|CNS09KP0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 348

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 221 ggcgacttcggcaaccgcgaggacaagatcaacgagct 184

---

>emb|BX062641.1|CNS09KHX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 711 ggcgacttcggcaaccgcgaggacaagatcaacgagct 748

---

>emb|BX062575.1|CNS09KG3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 290

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 240 ggcgacttcggcaaccgcgaggacaagatcaacgagct 203

---

>emb|BX062574.1|CNS09KG2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 782 ggcgacttcggcaaccgcgaggacaagatcaacgagct 819

---

>emb|BX062497.1|CNS09KDX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 783 ggcgacttcggcaaccgcgaggacaagatcaacgagct 820

---

>emb|BX062308.1|CNS09K8O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 426

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 238 ggcgacttcggcaaccgcgaggacaagatcaacgagct 201

---

>emb|BX062215.1|CNS09K63 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 814

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 241 ggcgacttcggcaaccgcgaggacaagatcaacgagct 204

---

>emb|BX062214.1|CNS09K62 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1031

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 786 ggcgacttcggcaaccgcgaggacaagatcaacgagct 823

---

>emb|BX062069.1|CNS09K21 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 815

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 232 ggcgacttcggcaaccgcgaggacaagatcaacgagct 195

---

>emb|BX062068.1|CNS09K20 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 646 ggcgacttcggcaaccgcgaggacaagatcaacgagct 683

---

>emb|BX062040.1|CNS09K18 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 227 ggcgacttcggcaaccgcgaggacaagatcaacgagct 190

---

>emb|BX062039.1|CNS09K17 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 848

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 783 ggcgacttcggcaaccgcgaggacaagatcaacgagct 820

---

>emb|BX061714.1|CNS09JS6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 251 ggcgacttcggcaaccgcgaggacaagatcaacgagct 214

---

>emb|BX061713.1|CNS09JS5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 834 ggcgacttcggcaaccgcgaggacaagatcaacgagct 871

---

>emb|BX061678.1|CNS09JR6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 791 ggcgacttcggcaaccgcgaggacaagatcaacgagct 828

---

>emb|BX061619.1|CNS09JPJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 251 ggcgacttcggcaaccgcgaggacaagatcaacgagct 214

---

>emb|BX061618.1|CNS09JPI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1039

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 806 ggcgacttcggcaaccgcgaggacaagatcaacgagct 843

---

>emb|BX061538.1|CNS09JNA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 515

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 196 ggcgacttcggcaaccgcgaggacaagatcaacgagct 159

---

>emb|BX061537.1|CNS09JN9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 801 ggcgacttcggcaaccgcgaggacaagatcaacgagct 838

---

>emb|BX061485.1|CNS09JLT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 242 ggcgacttcggcaaccgcgaggacaagatcaacgagct 205

---

>emb|BX061484.1|CNS09JLS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 796 ggcgacttcggcaaccgcgaggacaagatcaacgagct 833

---

>emb|BX061264.1|CNS09JFO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 391

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 229 ggcgacttcggcaaccgcgaggacaagatcaacgagct 192

---

>emb|BX061263.1|CNS09JFN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 651 ggcgacttcggcaaccgcgaggacaagatcaacgagct 688

---

>emb|BX061104.1|CNS09JB8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 673 ggcgacttcggcaaccgcgaggacaagatcaacgagct 710

---

>emb|BX060853.1|CNS09J49 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41BF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 810

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 239 ggcgacttcggcaaccgcgaggacaagatcaacgagct 202

---

>emb|BX060852.1|CNS09J48 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 805 ggcgacttcggcaaccgcgaggacaagatcaacgagct 842

---

>emb|BX060835.1|CNS09J3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 238 ggcgacttcggcaaccgcgaggacaagatcaacgagct 201

---

>emb|BX060421.1|CNS09IS9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1074

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 792 ggcgacttcggcaaccgcgaggacaagatcaacgagct 829

---

>emb|BX060334.1|CNS09IPU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 238 ggcgacttcggcaaccgcgaggacaagatcaacgagct 201

---

>emb|BX060333.1|CNS09IPT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 793 ggcgacttcggcaaccgcgaggacaagatcaacgagct 830

---

>emb|BX059972.1|CNS09IFS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 493

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 262 ggcgacttcggcaaccgcgaggacaagatcaacgagct 225

---

>emb|BX059971.1|CNS09IFR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 785 ggcgacttcggcaaccgcgaggacaagatcaacgagct 822

---

>emb|BX059904.1|CNS09IDW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 757

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 250 ggcgacttcggcaaccgcgaggacaagatcaacgagct 213

---

>emb|BX059765.1|CNS09IA1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 327

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 226 ggcgacttcggcaaccgcgaggacaagatcaacgagct 189

---

>emb|BX059761.1|CNS09I9X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 205

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 184 ggcgacttcggcaaccgcgaggacaagatcaacgagct 147

---

>emb|BX059760.1|CNS09I9W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 766 ggcgacttcggcaaccgcgaggacaagatcaacgagct 803

---

>emb|BX059674.1|CNS09I7I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 692 ggcgacttcggcaaccgcgaggacaagatcaacgagct 729

---

>emb|BX059626.1|CNS09I66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 309

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 259 ggcgacttcggcaaccgcgaggacaagatcaacgagct 222

---

>emb|BX059625.1|CNS09I65 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 798 ggcgacttcggcaaccgcgaggacaagatcaacgagct 835

---

>emb|BX059607.1|CNS09I5N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 245 ggcgacttcggcaaccgcgaggacaagatcaacgagct 208

---

>emb|BX059606.1|CNS09I5M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 874

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 744 ggcgacttcggcaaccgcgaggacaagatcaacgagct 781

---

>emb|BX059417.1|CNS09I0D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 237 ggcgacttcggcaaccgcgaggacaagatcaacgagct 200

---

>emb|BX059393.1|CNS09HZP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 717

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 259 ggcgacttcggcaaccgcgaggacaagatcaacgagct 222

---

>emb|BX059392.1|CNS09HZO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 800 ggcgacttcggcaaccgcgaggacaagatcaacgagct 837

---

>emb|BX059211.1|CNS09HUN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 237 ggcgacttcggcaaccgcgaggacaagatcaacgagct 200

---

>emb|BX059210.1|CNS09HUM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 722 ggcgacttcggcaaccgcgaggacaagatcaacgagct 759

---

>emb|BX059153.1|CNS09HT1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 810

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 233 ggcgacttcggcaaccgcgaggacaagatcaacgagct 196

---

>emb|BX059152.1|CNS09HT0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 785 ggcgacttcggcaaccgcgaggacaagatcaacgagct 822

---

>emb|BX059116.1|CNS09HS0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 793

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 217 ggcgacttcggcaaccgcgaggacaagatcaacgagct 180

---

>emb|BX059115.1|CNS09HRZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 784 ggcgacttcggcaaccgcgaggacaagatcaacgagct 821

---

>emb|BX058758.1|CNS09HI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 742 ggcgacttcggcaaccgcgaggacaagatcaacgagct 779

---

>emb|BX058710.1|CNS09HGQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 565

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 209 ggcgacttcggcaaccgcgaggacaagatcaacgagct 172

---

>emb|BX058709.1|CNS09HGP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 763 ggcgacttcggcaaccgcgaggacaagatcaacgagct 800

---

>emb|BX058537.1|CNS09HBX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 780 ggcgacttcggcaaccgcgaggacaagatcaacgagct 817

---

>emb|BX058436.1|CNS09H94 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38DD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 571

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 243 ggcgacttcggcaaccgcgaggacaagatcaacgagct 206

---

>emb|BX058409.1|CNS09H8D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 440

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 262 ggcgacttcggcaaccgcgaggacaagatcaacgagct 225

---

>emb|BX056661.1|CNS09FVT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 242 ggcgacttcggcaaccgcgaggacaagatcaacgagct 205

---

>emb|BX056611.1|CNS09FUF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 776

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 193 ggcgacttcggcaaccgcgaggacaagatcaacgagct 156

---

>emb|BX056610.1|CNS09FUE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 791 ggcgacttcggcaaccgcgaggacaagatcaacgagct 828

---

>emb|BX057874.1|CNS09GTI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 727

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 152 ggcgacttcggcaaccgcgaggacaagatcaacgagct 115

---

>emb|BX057873.1|CNS09GTH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 768 ggcgacttcggcaaccgcgaggacaagatcaacgagct 805

---

>emb|BX057794.1|CNS09GRA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 782

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 744 ggcgacttcggcaaccgcgaggacaagatcaacgagct 781

---

>emb|BX057529.1|CNS09GJX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 484

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 250 ggcgacttcggcaaccgcgaggacaagatcaacgagct 213

---

>emb|BX057073.1|CNS09G79 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 102

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 91  ggcgacttcggcaaccgcgaggacaagatcaacgagct 54

---

>emb|BX056977.1|CNS09G4L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 611

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 254 ggcgacttcggcaaccgcgaggacaagatcaacgagct 217

---

>emb|BX056976.1|CNS09G4K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 814 ggcgacttcggcaaccgcgaggacaagatcaacgagct 851

---

>emb|BX056850.1|CNS09G12 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36BH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 321

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 221 ggcgacttcggcaaccgcgaggacaagatcaacgagct 184

---

>emb|BX056819.1|CNS09G07 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36BF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 316

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 228 ggcgacttcggcaaccgcgaggacaagatcaacgagct 191

---

>emb|BX056466.1|CNS09FQE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 226 ggcgacttcggcaaccgcgaggacaagatcaacgagct 189

---

>emb|BX056465.1|CNS09FQD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 780 ggcgacttcggcaaccgcgaggacaagatcaacgagct 817

---

>emb|BX056335.1|CNS09FMR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 811 ggcgacttcggcaaccgcgaggacaagatcaacgagct 848

---

>emb|BX056260.1|CNS09FKO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 296

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 239 ggcgacttcggcaaccgcgaggacaagatcaacgagct 202

---

>emb|BX055500.1|CNS09EZK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 240 ggcgacttcggcaaccgcgaggacaagatcaacgagct 203

---

>emb|BX055499.1|CNS09EZJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 773 ggcgacttcggcaaccgcgaggacaagatcaacgagct 810

---

>emb|BX055379.1|CNS09EW7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33DH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 194

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 116 ggcgacttcggcaaccgcgaggacaagatcaacgagct 79

---

>emb|BX055259.1|CNS09ESV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 717 ggcgacttcggcaaccgcgaggacaagatcaacgagct 754

---

>emb|BX053250.1|CNS09D92 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 247 ggcgacttcggcaaccgcgaggacaagatcaacgagct 210

---

>emb|BX053249.1|CNS09D91 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 798 ggcgacttcggcaaccgcgaggacaagatcaacgagct 835

---

>emb|BX053171.1|CNS09D6V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 398

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 245 ggcgacttcggcaaccgcgaggacaagatcaacgagct 208

---

>emb|BX053153.1|CNS09D6D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 309

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 227 ggcgacttcggcaaccgcgaggacaagatcaacgagct 190

---

>emb|BX054879.1|CNS09EIB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 780

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 239 ggcgacttcggcaaccgcgaggacaagatcaacgagct 202

---

>emb|BX054878.1|CNS09EIA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 781 ggcgacttcggcaaccgcgaggacaagatcaacgagct 818

---

>emb|BX054828.1|CNS09EGW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 779 ggcgacttcggcaaccgcgaggacaagatcaacgagct 816

---

>emb|BX052909.1|CNS09CZL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 236 ggcgacttcggcaaccgcgaggacaagatcaacgagct 199

---

>emb|BX052908.1|CNS09CZK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 779 ggcgacttcggcaaccgcgaggacaagatcaacgagct 816

---

>emb|BX054730.1|CNS09EE6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 225 ggcgacttcggcaaccgcgaggacaagatcaacgagct 188

---

>emb|BX054702.1|CNS09EDE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 634

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 215 ggcgacttcggcaaccgcgaggacaagatcaacgagct 178

---

>emb|BX054649.1|CNS09EBX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 807

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 242 ggcgacttcggcaaccgcgaggacaagatcaacgagct 205

---

>emb|BX054648.1|CNS09EBW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 836

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 797 ggcgacttcggcaaccgcgaggacaagatcaacgagct 834

---

>emb|BX054626.1|CNS09EBA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 251 ggcgacttcggcaaccgcgaggacaagatcaacgagct 214

---

>emb|BX054625.1|CNS09EB9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 841

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 777 ggcgacttcggcaaccgcgaggacaagatcaacgagct 814

---

>emb|BX054462.1|CNS09E6Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 867

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 255 ggcgacttcggcaaccgcgaggacaagatcaacgagct 218

---

>emb|BX054461.1|CNS09E6P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 745 ggcgacttcggcaaccgcgaggacaagatcaacgagct 782

---

>emb|BX054393.1|CNS09E4T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 252 ggcgacttcggcaaccgcgaggacaagatcaacgagct 215

---

>emb|BX054392.1|CNS09E4S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 803 ggcgacttcggcaaccgcgaggacaagatcaacgagct 840

---

>emb|BX054176.1|CNS09DYS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 298

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 251 ggcgacttcggcaaccgcgaggacaagatcaacgagct 214

---

>emb|BX054175.1|CNS09DYR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 790 ggcgacttcggcaaccgcgaggacaagatcaacgagct 827

---

>emb|BX054174.1|CNS09DYQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 568 ggcgactcgggcaaccgcggggacaagatcaacgagct 605
           |||||||  |||||||||| ||||||||||||||||||
Sbjct: 783 ggcgacttcggcaaccgcgaggacaagatcaacgagct 820


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,209,602
Number of Sequences: 3902068
Number of extensions: 5209602
Number of successful extensions: 124571
Number of sequences better than 10.0: 1024
Number of HSP's better than 10.0 without gapping: 1023
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 122767
Number of HSP's gapped (non-prelim): 1794
length of query: 645
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 622
effective length of database: 17,143,297,704
effective search space: 10663131171888
effective search space used: 10663131171888
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---