ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bah63l02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ872264.1| Festuca glaucescens x Lolium multiflorum microsa... 143 6e-31
2dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 101 2e-18
3dbj|AP005750.3| Oryza sativa (japonica cultivar-group) genomic D... 101 2e-18
4gb|BT013854.1| Lycopersicon esculentum clone 132814F, mRNA sequence 58 3e-05
5ref|NM_122218.2| Arabidopsis thaliana HCF136 AT5G23120 (HCF136) ... 56 1e-04
6dbj|AK221097.1| Arabidopsis thaliana mRNA for photosystem II sta... 56 1e-04
7gb|AY045691.1| Arabidopsis thaliana AT5g23120/MYJ24_11 mRNA, com... 56 1e-04
8emb|BX830635.1|CNS0A01H Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
9dbj|AB006708.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 56 1e-04
10emb|Y15628.1|ATHCF136 Arabidopsis thaliana mRNA for nuclear prot... 56 1e-04
11gb|BT004549.1| Arabidopsis thaliana At5g23120/MYJ24_11 gene, com... 52 0.002
12emb|BX830603.1|CNS0A066 Arabidopsis thaliana Full-length cDNA Co... 48 0.027
13gb|AC131998.9| Mus musculus chromosome 1, clone RP24-164G9, comp... 42 1.7
14gb|AC166486.5| Mus musculus chromosome 1, clone RP23-187M9, comp... 42 1.7
15gb|AC091609.2| Homo sapiens chromosome 1 clone RP11-109I2, compl... 42 1.7
16gb|AC157924.6| Mus musculus chromosome 1, clone RP23-18J18, comp... 42 1.7
17gb|AC107869.15| Mus musculus chromosome 1, clone RP23-418L6, com... 42 1.7
18gb|AC131303.8| Mus musculus chromosome 1, clone RP24-119O19, com... 40 6.6
19gb|AC144383.2| Pan troglodytes BAC clone CH251-321N7 from X, com... 40 6.6
20gb|AC144776.2| Mus musculus BAC clone RP23-357B5 from chromosome... 40 6.6
21emb|BX901914.13| Zebrafish DNA sequence from clone DKEY-27F18 in... 40 6.6
22gb|AC123556.4| Mus musculus BAC clone RP23-176M9 from 1, complet... 40 6.6
23emb|AL645948.10| Mouse DNA sequence from clone RP23-298M7 on chr... 40 6.6
24emb|BX004862.9| Zebrafish DNA sequence from clone DKEY-200M9 in ... 40 6.6
25gb|AC154448.2| Mus musculus BAC clone RP23-185F24 from chromosom... 40 6.6
26gb|AC154421.2| Mus musculus BAC clone RP24-217C15 from 16, compl... 40 6.6

>emb|AJ872264.1| Festuca glaucescens x Lolium multiflorum microsatellite DNA, clone
           B5-D12
          Length = 620

 Score =  143 bits (72), Expect = 6e-31
 Identities = 108/120 (90%)
 Strand = Plus / Plus

                                                                       
Query: 85  aggatgaggcgtgggcagccggtgggagcggcgtcctgctgaaaacaaccaatggcggca 144
           |||||||||||||||| |||||||| ||||||||||||||||||||||  || |||||||
Sbjct: 474 aggatgaggcgtgggctgccggtggaagcggcgtcctgctgaaaacaaaaaacggcggca 533

                                                                       
Query: 145 agacctgggtgcgcgacagggctgccgataacatccctgggaacctctactccgtaaagt 204
           |  ||||||||||||||| ||| ||||| |||||||| |||||||||||||| |||||||
Sbjct: 534 aatcctgggtgcgcgacaaggccgccgacaacatccccgggaacctctactctgtaaagt 593



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 68/76 (89%)
 Strand = Plus / Plus

                                                                       
Query: 12  atagttgaagactttgaggaagcgtcggtacaaagccgggggtttggaattctggacgtg 71
           ||||||||||||||||||||||| ||||| || ||| |||| |||||||| || || |||
Sbjct: 314 atagttgaagactttgaggaagcttcggtgcagagcaggggatttggaatcctcgatgtg 373

                           
Query: 72  ggctaccgctcaaagg 87
           ||||||||||||||||
Sbjct: 374 ggctaccgctcaaagg 389



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  101 bits (51), Expect = 2e-18
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                            
Query: 17       tgaagactttgaggaagcgtcggtacaaagccgggggtttggaattctggacgtgggcta 76
                ||||||||||||||||||||| || ||||||||||||||||||||||| || || |||||
Sbjct: 30574997 tgaagactttgaggaagcgtcagtgcaaagccgggggtttggaattcttgatgttggcta 30574938

                           
Query: 77       ccgctcaaagg 87
                |||||||||||
Sbjct: 30574937 ccgctcaaagg 30574927



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 102/120 (85%)
 Strand = Plus / Minus

                                                                            
Query: 85       aggatgaggcgtgggcagccggtgggagcggcgtcctgctgaaaacaaccaatggcggca 144
                ||||||| || ||||| |||||||| || || |||||||| |||||||| |||||||| |
Sbjct: 30574847 aggatgaagcatgggccgccggtggaagtggtgtcctgctaaaaacaacaaatggcggga 30574788

                                                                            
Query: 145      agacctgggtgcgcgacagggctgccgataacatccctgggaacctctactccgtaaagt 204
                ||||||||||||||||||  ||||| ||||||||| | |  || |||||||| |||||||
Sbjct: 30574787 agacctgggtgcgcgacaaagctgctgataacatcgcagccaatctctactctgtaaagt 30574728



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                            
Query: 203      gttcattggggacaaccaaggttttgtgctcgggaacgacggcgtcttgctccgatacgt 262
                |||| |||| |||||| |||| |  ||||| |||||||||||||||||||| ||||| ||
Sbjct: 30574605 gttccttggtgacaacaaaggatacgtgcttgggaacgacggcgtcttgcttcgatatgt 30574546

                       
Query: 263      tggctga 269
                |||||||
Sbjct: 30574545 tggctga 30574539



to top

>dbj|AP005750.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0069C14
          Length = 150579

 Score =  101 bits (51), Expect = 2e-18
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                         
Query: 17    tgaagactttgaggaagcgtcggtacaaagccgggggtttggaattctggacgtgggcta 76
             ||||||||||||||||||||| || ||||||||||||||||||||||| || || |||||
Sbjct: 73560 tgaagactttgaggaagcgtcagtgcaaagccgggggtttggaattcttgatgttggcta 73501

                        
Query: 77    ccgctcaaagg 87
             |||||||||||
Sbjct: 73500 ccgctcaaagg 73490



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 102/120 (85%)
 Strand = Plus / Minus

                                                                         
Query: 85    aggatgaggcgtgggcagccggtgggagcggcgtcctgctgaaaacaaccaatggcggca 144
             ||||||| || ||||| |||||||| || || |||||||| |||||||| |||||||| |
Sbjct: 73410 aggatgaagcatgggccgccggtggaagtggtgtcctgctaaaaacaacaaatggcggga 73351

                                                                         
Query: 145   agacctgggtgcgcgacagggctgccgataacatccctgggaacctctactccgtaaagt 204
             ||||||||||||||||||  ||||| ||||||||| | |  || |||||||| |||||||
Sbjct: 73350 agacctgggtgcgcgacaaagctgctgataacatcgcagccaatctctactctgtaaagt 73291



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                         
Query: 203   gttcattggggacaaccaaggttttgtgctcgggaacgacggcgtcttgctccgatacgt 262
             |||| |||| |||||| |||| |  ||||| |||||||||||||||||||| ||||| ||
Sbjct: 73168 gttccttggtgacaacaaaggatacgtgcttgggaacgacggcgtcttgcttcgatatgt 73109

                    
Query: 263   tggctga 269
             |||||||
Sbjct: 73108 tggctga 73102



to top

>gb|BT013854.1| Lycopersicon esculentum clone 132814F, mRNA sequence
          Length = 1511

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                        
Query: 21   gactttgaggaagcgtcggtacaaagccgggggtttggaattctggacgtgggctaccgc 80
            |||||||| ||||  || ||||||||||| || ||||| ||||| || || |||||||| 
Sbjct: 1004 gactttgaagaagtttcagtacaaagccgtggttttggcattcttgatgttggctaccgt 1063

                                         
Query: 81   tcaaaggatgaggcgtgggcagccggtgg 109
            ||| |||||||||| ||||| || |||||
Sbjct: 1064 tcacaggatgaggcctgggctgctggtgg 1092



to top

>ref|NM_122218.2| Arabidopsis thaliana HCF136 AT5G23120 (HCF136) mRNA, complete cds
          Length = 1410

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                
Query: 220  aaggttttgtgctcgggaacgacggcgtcttgctccgatacgttggctgaag 271
            |||| |||||||| || ||||| || |||||||||||||| |||||||||||
Sbjct: 1196 aaggatttgtgcttggcaacgatggagtcttgctccgatatgttggctgaag 1247



to top

>dbj|AK221097.1| Arabidopsis thaliana mRNA for photosystem II stability/assembly
           factor HCF136, partial cds, clone: RAFL22-84-H16
          Length = 370

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 220 aaggttttgtgctcgggaacgacggcgtcttgctccgatacgttggctgaag 271
           |||| |||||||| || ||||| || |||||||||||||| |||||||||||
Sbjct: 168 aaggatttgtgcttggcaacgatggagtcttgctccgatatgttggctgaag 219



to top

>gb|AY045691.1| Arabidopsis thaliana AT5g23120/MYJ24_11 mRNA, complete cds
          Length = 1386

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                
Query: 220  aaggttttgtgctcgggaacgacggcgtcttgctccgatacgttggctgaag 271
            |||| |||||||| || ||||| || |||||||||||||| |||||||||||
Sbjct: 1194 aaggatttgtgcttggcaacgatggagtcttgctccgatatgttggctgaag 1245



to top

>emb|BX830635.1|CNS0A01H Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB95ZC08 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1343

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                
Query: 220  aaggttttgtgctcgggaacgacggcgtcttgctccgatacgttggctgaag 271
            |||| |||||||| || ||||| || |||||||||||||| |||||||||||
Sbjct: 1193 aaggatttgtgcttggcaacgatggagtcttgctccgatatgttggctgaag 1244



to top

>dbj|AB006708.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYJ24
          Length = 78844

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                 
Query: 220   aaggttttgtgctcgggaacgacggcgtcttgctccgatacgttggctgaag 271
             |||| |||||||| || ||||| || |||||||||||||| |||||||||||
Sbjct: 70387 aaggatttgtgcttggcaacgatggagtcttgctccgatatgttggctgaag 70438



to top

>emb|Y15628.1|ATHCF136 Arabidopsis thaliana mRNA for nuclear protein HCF136
          Length = 1404

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                
Query: 220  aaggttttgtgctcgggaacgacggcgtcttgctccgatacgttggctgaag 271
            |||| |||||||| || ||||| || |||||||||||||| |||||||||||
Sbjct: 1192 aaggatttgtgcttggcaacgatggagtcttgctccgatatgttggctgaag 1243



to top

>gb|BT004549.1| Arabidopsis thaliana At5g23120/MYJ24_11 gene, complete cds
          Length = 1212

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                              
Query: 220  aaggttttgtgctcgggaacgacggcgtcttgctccgatacgttggctga 269
            |||| |||||||| || ||||| || |||||||||||||| |||||||||
Sbjct: 1163 aaggatttgtgcttggcaacgatggagtcttgctccgatatgttggctga 1212



to top

>emb|BX830603.1|CNS0A066 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB93ZE05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 306

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 220 aaggttttgtgctcgggaacgacggcgtcttgctccgatacgttggctgaag 271
           |||| ||||||||  | ||||| || |||||||||||||| |||||||||||
Sbjct: 122 aaggatttgtgcttcgcaacgatggagtcttgctccgatatgttggctgaag 173



to top

>gb|AC131998.9| Mus musculus chromosome 1, clone RP24-164G9, complete sequence
          Length = 152462

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 455  gtactaagtgagcacacacat 475
            |||||||||||||||||||||
Sbjct: 2433 gtactaagtgagcacacacat 2413



to top

>gb|AC166486.5| Mus musculus chromosome 1, clone RP23-187M9, complete sequence
          Length = 187098

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 388   aatcttacctgtcttttactg 408
             |||||||||||||||||||||
Sbjct: 41195 aatcttacctgtcttttactg 41175



to top

>gb|AC091609.2| Homo sapiens chromosome 1 clone RP11-109I2, complete sequence
          Length = 183521

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 449    ggtacagtactaagtgagcac 469
              |||||||||||||||||||||
Sbjct: 149874 ggtacagtactaagtgagcac 149854



to top

>gb|AC157924.6| Mus musculus chromosome 1, clone RP23-18J18, complete sequence
          Length = 206156

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 455    gtactaagtgagcacacacat 475
              |||||||||||||||||||||
Sbjct: 100650 gtactaagtgagcacacacat 100670



to top

>gb|AC107869.15| Mus musculus chromosome 1, clone RP23-418L6, complete sequence
          Length = 182061

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 455    gtactaagtgagcacacacat 475
              |||||||||||||||||||||
Sbjct: 120003 gtactaagtgagcacacacat 120023



to top

>gb|AC131303.8| Mus musculus chromosome 1, clone RP24-119O19, complete sequence
          Length = 187110

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 428   ttcaaatattcagaggcata 447
             ||||||||||||||||||||
Sbjct: 68612 ttcaaatattcagaggcata 68593



to top

>gb|AC144383.2| Pan troglodytes BAC clone CH251-321N7 from X, complete sequence
          Length = 149315

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   caagagagtgtaaatcttacctgt 399
             ||||||||||||||| ||||||||
Sbjct: 81558 caagagagtgtaaatgttacctgt 81581



to top

>gb|AC144776.2| Mus musculus BAC clone RP23-357B5 from chromosome 16, complete sequence
          Length = 190860

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 15    gttgaagactttgaggaagc 34
             ||||||||||||||||||||
Sbjct: 52763 gttgaagactttgaggaagc 52782



to top

>emb|BX901914.13| Zebrafish DNA sequence from clone DKEY-27F18 in linkage group 4,
             complete sequence
          Length = 149383

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 335   catgtgaaaggctgctgatt 354
             ||||||||||||||||||||
Sbjct: 16867 catgtgaaaggctgctgatt 16886



to top

>gb|AC123556.4| Mus musculus BAC clone RP23-176M9 from 1, complete sequence
          Length = 198900

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 428   ttcaaatattcagaggcata 447
             ||||||||||||||||||||
Sbjct: 53217 ttcaaatattcagaggcata 53236



to top

>emb|AL645948.10| Mouse DNA sequence from clone RP23-298M7 on chromosome 11 Contains an H+
              transporting ATP synthase mitochondrial F0 complex subunit
              g (Atp5l) pseudogene, a ferritin light chain 1 (Ftl1)
              pseudogene, three novel genes, the gene for a novel ENTH
              domain containing protein, the 5' end of the Sox30 gene for
              SRY-box containing gene 30 and three Cpg islands, complete
              sequence
          Length = 207877

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 462    gtgagcacacacatttgtgt 481
              ||||||||||||||||||||
Sbjct: 152138 gtgagcacacacatttgtgt 152157



to top

>emb|BX004862.9| Zebrafish DNA sequence from clone DKEY-200M9 in linkage group 4
             Contains the gene for a novel protein similar to
             vertebrate TAFA protein 5 (TAFA5) and a CpG island,
             complete sequence
          Length = 174359

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 335   catgtgaaaggctgctgatt 354
             ||||||||||||||||||||
Sbjct: 91128 catgtgaaaggctgctgatt 91109



to top

>gb|AC154448.2| Mus musculus BAC clone RP23-185F24 from chromosome 16, complete
             sequence
          Length = 203269

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 395   cctgtcttttactgttattt 414
             ||||||||||||||||||||
Sbjct: 89768 cctgtcttttactgttattt 89749



to top

>gb|AC154421.2| Mus musculus BAC clone RP24-217C15 from 16, complete sequence
          Length = 188761

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 395    cctgtcttttactgttattt 414
              ||||||||||||||||||||
Sbjct: 150781 cctgtcttttactgttattt 150762


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,528,414
Number of Sequences: 3902068
Number of extensions: 3528414
Number of successful extensions: 62401
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62350
Number of HSP's gapped (non-prelim): 51
length of query: 491
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 469
effective length of database: 17,147,199,772
effective search space: 8042036693068
effective search space used: 8042036693068
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top