ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bah63k20
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009457.1| Triticum aestivum clone wlp1c.pk007.f6:fis, full ... 1043 0.0
2dbj|AK065019.1| Oryza sativa (japonica cultivar-group) cDNA clon... 535 e-149
3dbj|AK061771.1| Oryza sativa (japonica cultivar-group) cDNA clon... 529 e-147
4gb|AY103957.1| Zea mays PCO116832 mRNA sequence 450 e-123
5gb|BT009148.1| Triticum aestivum clone wl1n.pk0059.g7:fis, full ... 307 2e-80
6dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 272 1e-69
7dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic D... 272 1e-69
8ref|NM_103909.3| Arabidopsis thaliana FTSH1; ATP-dependent pepti... 214 2e-52
9gb|AY123034.1| Arabidopsis thaliana putative chloroplast FtsH pr... 214 2e-52
10gb|AY091095.1| Arabidopsis thaliana putative chloroplast FtsH pr... 214 2e-52
11emb|X99808.1|ATFTSH A.thaliana mRNA for chloroplast FtsH protease 206 6e-50
12emb|BX815046.1|CNS0AE0R Arabidopsis thaliana Full-length cDNA Co... 206 6e-50
13emb|Y12780.1|ATAAAA A.thaliana mRNA for ATPase, partial 194 2e-46
14gb|DQ339462.1| Vitis pseudoreticulata ATPase mRNA, complete cds 188 1e-44
15gb|AC007980.1| Arabidopsis thaliana chromosome I BAC F14I3 genom... 184 2e-43
16emb|X90472.1|CAATPASE C.annuum mRNA for ATPase protein 176 5e-41
17dbj|AB017480.2| Nicotiana tabacum mRNA for chloroplast FtsH prot... 141 3e-30
18ref|NM_123592.2| Arabidopsis thaliana VAR1 (VARIEGATED 1); ATP-d... 139 1e-29
19gb|AY126987.1| Arabidopsis thaliana AT5g42270/K5J14_7 mRNA, comp... 139 1e-29
20dbj|AB023032.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 123 7e-25
21dbj|AP003569.3| Oryza sativa (japonica cultivar-group) genomic D... 115 2e-22
22dbj|AP003509.3| Oryza sativa (japonica cultivar-group) genomic D... 115 2e-22
23emb|BX569692.1| Synechococcus sp. WH8102 complete genome; segmen... 105 2e-19
24dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g... 94 6e-16
25dbj|AB032368.1| Thermus thermophilus clpB, dafA, dnaJ, grpE, dna... 94 6e-16
26gb|AF332134.1| Medicago sativa FtsH protease (FtsH) mRNA, comple... 92 2e-15
27gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome 90 9e-15
28gb|AE017221.1| Thermus thermophilus HB27, complete genome 86 1e-13
29emb|BX572096.1| Prochlorococcus marinus MIT9313 complete genome;... 72 2e-09
30gb|CP000110.1| Synechococcus sp. CC9605, complete genome 70 9e-09
31gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 68 3e-08
32gb|CP000284.1| Methylobacillus flagellatus KT, complete genome 68 3e-08
33gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome 68 3e-08
34emb|AJ488199.1|PVI488199 Uncultured bacterium gene for putative ... 68 3e-08
35dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp... 66 1e-07
36gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome 64 5e-07
37gb|CP000097.1| Synechococcus sp. CC9902, complete genome 62 2e-06
38dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome 62 2e-06
39gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome 60 8e-06
40gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 compl... 58 3e-05
41emb|CR931997.1| Corynebacterium jeikeium K411 complete genome 58 3e-05
42gb|AE005986.1| Caulobacter crescentus CB15 section 312 of 359 of... 58 3e-05
43gb|AE006470.1| Chlorobium tepidum TLS, complete genome 58 3e-05
44gb|AE004888.1| Pseudomonas aeruginosa PAO1, section 449 of 529 o... 58 3e-05
45dbj|AK110158.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
46gb|AC175197.2| Sporobolomyces roseus clone JGIBAIF-21O18, comple... 56 1e-04
47emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 56 1e-04
48emb|BX569689.1| Synechococcus sp. WH8102 complete genome; segmen... 54 5e-04
49emb|AL939124.1|SCO939124 Streptomyces coelicolor A3(2) complete ... 54 5e-04
50gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 54 5e-04
51dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g... 54 5e-04
52gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome 54 5e-04
53gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 54 5e-04
54gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 54 5e-04
55gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome 54 5e-04
56gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ... 52 0.002
57gb|CP000352.1| Ralstonia metallidurans CH34, complete genome 52 0.002
58emb|CR555306.1| Azoarcus sp. EbN1 complete genome 52 0.002
59emb|BX248359.1| Corynebacterium diphtheriae gravis NCTC13129, co... 52 0.002
60emb|AL162754.2|NMA3Z2491 Neisseria meningitidis serogroup A stra... 52 0.002
61dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 52 0.002
62gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome 52 0.002
63gb|AE002098.2| Neisseria meningitidis MC58, complete genome 52 0.002
64gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome 52 0.002
65dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 52 0.002
66emb|BX014465.1|CNS08JBP Single read from an extremity of a full-... 50 0.008
67emb|BX014464.1|CNS08JBO Single read from an extremity of a full-... 50 0.008
68gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 50 0.008
69gb|CP000133.1| Rhizobium etli CFN 42, complete genome 50 0.008
70emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 50 0.008
71gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome 50 0.008
72gb|AE010377.1| Methanopyrus kandleri AV19 section 76 of 157 of t... 48 0.032
73gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr... 48 0.032
74gb|AF037269.1| Mycobacterium smegmatis cell division protein (Ft... 48 0.032
75gb|AY540192.1| Oreochromis mossambicus proteasome 26S ATPase sub... 48 0.032
76ref|XM_570849.1| Cryptococcus neoformans var. neoformans JEC21 e... 48 0.032
77emb|CR727756.2|CNS0GOHE Tetraodon nigroviridis full-length cDNA 48 0.032
78emb|CR719511.2|CNS0GI4D Tetraodon nigroviridis full-length cDNA 48 0.032
79emb|CR708630.2|CNS0G9QA Tetraodon nigroviridis full-length cDNA 48 0.032
80emb|CR695652.2|CNS0FZPS Tetraodon nigroviridis full-length cDNA 48 0.032
81emb|CR689180.2|CNS0FUQ0 Tetraodon nigroviridis full-length cDNA 48 0.032
82emb|CR661563.2|CNS0F9FL Tetraodon nigroviridis full-length cDNA 48 0.032
83emb|CR650415.2|CNS0F0TX Tetraodon nigroviridis full-length cDNA 48 0.032
84emb|CR649796.2|CNS0F0CQ Tetraodon nigroviridis full-length cDNA 48 0.032
85emb|CR646015.2|CNS0EXFP Tetraodon nigroviridis full-length cDNA 48 0.032
86gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome 48 0.032
87gb|BC044464.1| Danio rerio nuclear VCP-like, mRNA (cDNA clone MG... 48 0.032
88ref|NM_213484.1| Danio rerio nuclear VCP-like (nvl), mRNA 48 0.032
89dbj|AB236774.1| Trifolium pratense RNA for putative zinc depende... 48 0.032
90gb|AF319040.1|AF319040 Leishmania donovani ATP-dependent zinc me... 48 0.032
91gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 46 0.13
92gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 46 0.13
93gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome 46 0.13
94ref|XM_482385.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.13
95gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 46 0.13
96gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 46 0.13
97gb|AE009302.1| Agrobacterium tumefaciens str. C58 linear chromos... 46 0.13
98gb|AE008312.1| Agrobacterium tumefaciens str. C58 linear chromos... 46 0.13
99ref|XM_765222.1| Giardia lamblia ATCC 50803 AAA ATPase (GLP_80_6... 46 0.13
100ref|XM_766189.1| Giardia lamblia ATCC 50803 AAA ATPase (GLP_306_... 46 0.13
101ref|XM_782306.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.13
102emb|Z83338.1|MTZ83338 M.tuberculosis H37Ra ftsH gene, partial 46 0.13
103emb|BX842583.1| Mycobacterium tuberculosis H37Rv complete genome... 46 0.13
104emb|BX572092.1| Prochlorococcus marinus MED4 complete genome; se... 46 0.13
105emb|BX248346.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 46 0.13
106gb|AF456414.1| Giardia intestinalis endosomal AAA ATPase-like pr... 46 0.13
107ref|XM_697576.1| PREDICTED: Danio rerio hypothetical protein LOC... 46 0.13
108gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, comple... 46 0.13
109dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.13
110dbj|BA000002.2| Aeropyrum pernix K1 DNA, complete genome 46 0.13
111gb|AE005094.1| Halobacterium sp. NRC-1 section 125 of 170 of the... 46 0.13
112dbj|AP005158.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.13
113ref|XM_316268.2| Anopheles gambiae str. PEST ENSANGP00000020514 ... 46 0.13
114gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome 46 0.13
115gb|AE010343.1| Methanopyrus kandleri AV19 section 42 of 157 of t... 44 0.50
116gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence 44 0.50
117gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 44 0.50
118gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome 44 0.50
119ref|XM_359584.1| Magnaporthe grisea 70-15 hypothetical protein (... 44 0.50
120gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 44 0.50
121gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 44 0.50
122emb|AL591791.1|SME591791 Sinorhizobium meliloti 1021 complete ch... 44 0.50
123emb|AJ243808.1|BJA243808 Bradyrhizobium japonicum yaeN and ftsH ... 44 0.50
124gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 44 0.50
125emb|BX572090.1| Prochlorococcus marinus MED4 complete genome; se... 44 0.50
126emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 44 0.50
127emb|BX321857.1| Nitrosomonas europaea ATCC 19718, complete genom... 44 0.50
128emb|AL939116.1|SCO939116 Streptomyces coelicolor A3(2) complete ... 44 0.50
129gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 44 0.50
130dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome 44 0.50
131gb|AE009637.1| Brucella melitensis 16M chromosome I, section 194... 44 0.50
132gb|AE004918.1| Pseudomonas aeruginosa PAO1, section 479 of 529 o... 44 0.50
133dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 44 0.50
134dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome 44 0.50
135gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I... 44 0.50
136dbj|AK110513.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.50
137gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 44 0.50
138emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,... 44 0.50
139dbj|AB018433.1| Pyrococcus kodakaraensis Pk-cdcA gene, complete cds 44 0.50
140gb|AC002511.1| Homo sapiens chromosome 19 clone PC28130, complet... 42 2.0
141gb|DQ214550.1| Taeniopygia guttata clone 0061P0013A02 26S ATPase... 42 2.0
142gb|DQ214549.1| Taeniopygia guttata clone 0063P0013D05 26S ATPase... 42 2.0
143gb|AY639765.1| Hordeum vulgare subsp. spontaneum cultivar PI 560... 42 2.0
144gb|AY639764.1| Aegilops tauschii cultivar KU2156 FtsH-like prote... 42 2.0
145gb|AY639763.1| Triticum urartu cultivar IG45487 FtsH-like protei... 42 2.0
146gb|AY639762.1| Hordeum vulgare subsp. spontaneum cultivar PI 220... 42 2.0
147gb|AY639761.1| Aegilops tauschii cultivar KU2160 FtsH-like prote... 42 2.0
148gb|AY639760.1| Aegilops tauschii cultivar KU2065 FtsH-like prote... 42 2.0
149gb|AY639759.1| Triticum monococcum cultivar G4913 FtsH-like prot... 42 2.0
150gb|AY639756.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 42 2.0
151gb|AY639755.1| Triticum urartu cultivar IG45633 FtsH-like protei... 42 2.0
152gb|AY639754.1| Hordeum vulgare subsp. spontaneum cultivar PI 560... 42 2.0
153gb|AY639751.1| Hordeum vulgare subsp. spontaneum cultivar PI 227... 42 2.0
154gb|AY639750.1| Aegilops tauschii cultivar KU2801 FtsH-like prote... 42 2.0
155gb|AY639749.1| Triticum urartu cultivar IG113243 FtsH-like prote... 42 2.0
156gb|AY639748.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 42 2.0
157gb|AY639747.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 42 2.0
158gb|AY639746.1| Hordeum vulgare subsp. spontaneum cultivar PI 420... 42 2.0
159gb|AY639745.1| Hordeum vulgare subsp. spontaneum cultivar PI 254... 42 2.0
160gb|AY639744.1| Aegilops tauschii cultivar KU2146 FtsH-like prote... 42 2.0
161gb|AY639743.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 42 2.0
162gb|AY639742.1| Hordeum vulgare subsp. spontaneum cultivar PI 282... 42 2.0
163gb|AY639741.1| Triticum urartu cultivar IG45470 FtsH-like protei... 42 2.0
164gb|AY639740.1| Hordeum vulgare subsp. spontaneum cultivar PI 420... 42 2.0
165gb|AY639739.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 42 2.0
166gb|AY639738.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 42 2.0
167gb|AY639737.1| Triticum urartu cultivar IG45218 FtsH-like protei... 42 2.0
168gb|AY639735.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 42 2.0
169gb|AY639734.1| Aegilops tauschii cultivar KU2030 FtsH-like prote... 42 2.0
170gb|AY639733.1| Lophopyrum elongatum FtsH-like protein gene, part... 42 2.0
171gb|AY639732.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 42 2.0
172ref|XM_751952.1| Ustilago maydis 521 hypothetical protein (UM008... 42 2.0
173gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl... 42 2.0
174gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete ... 42 2.0
175gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 42 2.0
176emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 42 2.0
177dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, co... 42 2.0
178dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, compl... 42 2.0
179gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 42 2.0
180dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete... 42 2.0
181gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 42 2.0
182gb|AE015924.1| Porphyromonas gingivalis W83, complete genome 42 2.0
183gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 42 2.0
184ref|NM_115254.3| Arabidopsis thaliana binding / transporter AT3G... 40 7.7
185gb|CP000109.1| Thiomicrospira crunogena XCL-2, complete genome 40 7.7
186ref|XM_511168.1| PREDICTED: Pan troglodytes similar to paraplegi... 40 7.7
187gb|CP000108.1| Chlorobium chlorochromatii CaD3, complete genome 40 7.7
188gb|CP000141.1| Carboxydothermus hydrogenoformans Z-2901, complet... 40 7.7
189gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, c... 40 7.7
190gb|BC007692.1| Homo sapiens spastic paraplegia 7, paraplegin (pu... 40 7.7
191gb|BC071538.1| Danio rerio proteasome (prosome, macropain) 26S s... 40 7.7
192gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome 40 7.7
193ref|NM_003119.2| Homo sapiens spastic paraplegia 7, paraplegin (... 40 7.7
194ref|NM_199367.1| Homo sapiens spastic paraplegia 7, paraplegin (... 40 7.7
195gb|AC091324.10| Mus musculus chromosome 7, clone RP23-7G1, compl... 40 7.7
196gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, comple... 40 7.7
197gb|BT011963.1| Arabidopsis thaliana At3g53940 mRNA sequence 40 7.7
198gb|AC092123.4| Homo sapiens chromosome 16 clone RP11-104N10, com... 40 7.7
199ref|XM_842897.1| Leishmania major strain Friedlin ATPase (LMJ_02... 40 7.7
200ref|XM_390945.1| Gibberella zeae PH-1 chromosome 3 PRS6_ASPNG 26... 40 7.7
201ref|XM_385706.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 40 7.7
202emb|AL591788.1|SME591788 Sinorhizobium meliloti 1021 complete ch... 40 7.7
203gb|BC035929.2| Homo sapiens spastic paraplegia 7, paraplegin (pu... 40 7.7
204ref|XM_499951.1| Yarrowia lipolytica CLIB122, YALI0A10615g predi... 40 7.7
205ref|XM_500430.1| Yarrowia lipolytica CLIB122, YALI0B02574g predi... 40 7.7
206gb|AC010538.9| Homo sapiens chromosome 16 clone RP11-368I7, comp... 40 7.7
207gb|AF259761.1| Ovis aries microsatellite MNS-89 sequence 40 7.7
208emb|Y16610.1|HSPARAPLE Homo sapiens mRNA for paraplegin 40 7.7
209gb|AE008912.1| Salmonella typhimurium LT2, section 216 of 220 of... 40 7.7
210emb|BX294138.1| Pirellula sp. strain 1 complete genome; segment ... 40 7.7
211gb|BC036104.1| Homo sapiens spastic paraplegia 7, paraplegin (pu... 40 7.7
212emb|AL627284.1| Salmonella enterica serovar Typhi (Salmonella ty... 40 7.7
213emb|AL132960.2|ATF5K20 Arabidopsis thaliana DNA chromosome 3, BA... 40 7.7
214ref|NM_001002091.1| Danio rerio proteasome (prosome, macropain) ... 40 7.7
215gb|AC114900.26| Ustilago hordei strain 4875-4 clone uhobac-2b7, ... 40 7.7
216emb|CR609511.1| full-length cDNA clone CS0DL005YD01 of B cells (... 40 7.7
217gb|AF236051.1| California sea lion herpesvirus terminase gene, p... 40 7.7
218gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 40 7.7
219gb|AY093262.1| Arabidopsis thaliana putative protein (F5K20.24) ... 40 7.7
220gb|AY062478.1| Arabidopsis thaliana putative protein (F5K20.24) ... 40 7.7
221gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 7.7
222gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 7.7
223gb|AF080518.1|HSSPGSC08 Homo sapiens paraplegin (SPG7) gene, exo... 40 7.7
224gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete g... 40 7.7
225gb|AF193618.1|AF193618 California sea lion herpesvirus terminase... 40 7.7
226emb|BX822250.1|CNS0A70P Arabidopsis thaliana Full-length cDNA Co... 40 7.7
227emb|BX824565.1|CNS0A4VO Arabidopsis thaliana Full-length cDNA Co... 40 7.7
228gb|AE004548.1| Pseudomonas aeruginosa PAO1, section 109 of 529 o... 40 7.7
229ref|XM_345541.2| PREDICTED: Rattus norvegicus similar to Ubiquit... 40 7.7
230dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome 40 7.7
231ref|NM_210204.1| Eremothecium gossypii AEL011Wp (AEL011W), mRNA 40 7.7
232ref|NM_210381.1| Eremothecium gossypii AER169Cp (AER169C), mRNA 40 7.7
233emb|AL935145.12| Zebrafish DNA sequence from clone CH211-173B9 i... 40 7.7
234gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi... 40 7.7
235emb|AM118080.1| Ustilago hordei mating type region MAT-1, strain... 40 7.7
236gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole... 40 7.7
237gb|AE015451.1| Pseudomonas putida KT2440 complete genome 40 7.7
238gb|AY627304.1| Haloferax volcanii DS2 proteasome-activating nucl... 40 7.7
239gb|BC110530.1| Homo sapiens spastic paraplegia 7, paraplegin (pu... 40 7.7
240gb|BC110531.1| Homo sapiens spastic paraplegia 7, paraplegin (pu... 40 7.7
241emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB1... 40 7.7
242emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1... 40 7.7
243dbj|AB023310.1| Cyanidioschyzon merolae gene for FtsH2, complete... 40 7.7

>gb|BT009457.1| Triticum aestivum clone wlp1c.pk007.f6:fis, full insert mRNA
           sequence
          Length = 1556

 Score = 1043 bits (526), Expect = 0.0
 Identities = 553/562 (98%)
 Strand = Plus / Plus

                                                                       
Query: 9   aggcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgg 68
           ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
Sbjct: 269 aggcgccctgcatcgtcttcatcgatgagattgacgccgtcgggaggcagcgtggtgccg 328

                                                                       
Query: 69  gaatgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatgg 128
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329 gaatgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatgg 388

                                                                       
Query: 129 acggcttctccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgtgc 188
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 389 acggcttctccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgtgc 448

                                                                       
Query: 189 ttgactccgcgcttctgcggccagggcggttcgatcggcaggtcaccgtcgaccgtccgg 248
           | ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 449 tcgactcggcgcttctgcggccagggcggtttgatcggcaggtcaccgtcgaccgtccgg 508

                                                                       
Query: 249 atgtagccggccgtgtcaggatccttgaggttcactccagaggaaaggcattggcgaagg 308
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 509 atgtcgccggccgtgtcaggatccttgaggttcactccagaggaaaggcattggcgaagg 568

                                                                       
Query: 309 atgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcaga 368
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 569 atgtagactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcaga 628

                                                                       
Query: 369 acttgatgaatgaggctgccatccttgccgcccgtcgtgatctgaaggagataagcaagg 428
           |||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||
Sbjct: 629 acttgatgaatgaggctgccatccttgctgctcgtcgtgatctgaaggagataagcaagg 688

                                                                       
Query: 429 acgagatctctgatgctctggagaggatcattgctgggcctgagaagaagaatgcagttg 488
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 689 acgagatctctgatgctctggagaggatcattgctgggcctgagaagaagaatgcagttg 748

                                                                       
Query: 489 tttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcggtg 548
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 749 tttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcggtg 808

                                 
Query: 549 ccctgatgcctgaatatgaccc 570
           ||||||||||||||||||||||
Sbjct: 809 ccctgatgcctgaatatgaccc 830



to top

>dbj|AK065019.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001F19, full
            insert sequence
          Length = 2378

 Score =  535 bits (270), Expect = e-149
 Identities = 483/554 (87%)
 Strand = Plus / Plus

                                                                        
Query: 17   tgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggt 76
            |||||||||||||| || || ||||| ||||||||||||||||||||||| ||  | || 
Sbjct: 1012 tgcatcgtcttcattgatgaaattgatgccgtcgggaggcagcgtggtgctgggctcgga 1071

                                                                        
Query: 77   ggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggcttc 136
            ||||| || |||||||||||||||||||||||||||||  | || |||||||| || || 
Sbjct: 1072 gggggaaatgatgagagggagcagaccattaaccagctcttgactgagatggatggattt 1131

                                                                        
Query: 137  tccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgtgcttgactcc 196
             |||| || ||||||||||| |||||||||||||| |||||||| |||||||| ||| | 
Sbjct: 1132 gccggcaatagcggtgtcattgtgctcgccgcgacaaacaggcctgatgtgctcgacgcg 1191

                                                                        
Query: 197  gcgcttctgcggccagggcggttcgatcggcaggtcaccgtcgaccgtccggatgtagcc 256
            || ||||| || || ||| |||||||||||||||||||||| ||| | |||||||| |||
Sbjct: 1192 gctcttcttcgccctgggaggttcgatcggcaggtcaccgtagacaggccggatgtcgcc 1251

                                                                        
Query: 257  ggccgtgtcaggatccttgaggttcactccagaggaaaggcattggcgaaggatgtggac 316
            || ||||||| ||| |||||||||||||| |||||||||||  |||| || ||||| |||
Sbjct: 1252 gggcgtgtcaagattcttgaggttcactcgagaggaaaggctctggcaaaagatgtcgac 1311

                                                                        
Query: 317  tttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcagaacttgatg 376
            ||||| ||  ||||| | || || ||||||||||| || ||||||||||| |||||||||
Sbjct: 1312 tttgagaaaattgcccggagaacccctggtttcactggagctgatcttcaaaacttgatg 1371

                                                                        
Query: 377  aatgaggctgccatccttgccgcccgtcgtgatctgaaggagataagcaaggacgagatc 436
            ||||||||||| || ||||| || |||||||||||||||||||| |||||||| ||||||
Sbjct: 1372 aatgaggctgctattcttgctgctcgtcgtgatctgaaggagattagcaaggatgagatc 1431

                                                                        
Query: 437  tctgatgctctggagaggatcattgctgggcctgagaagaagaatgcagttgtttcagaa 496
            ||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 1432 tctgatgctttggagaggatcattgctgggcctgagaagaaaaatgctgttgtttcagaa 1491

                                                                        
Query: 497  cagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcggtgccctgatg 556
             |||||||||  ||||||||||||||||||||||| |||||||| || |||||||| |||
Sbjct: 1492 gagaagaggagacttgtggcttaccatgaggctggtcatgcccttgttggtgccctcatg 1551

                          
Query: 557  cctgaatatgaccc 570
            ||||||||||||||
Sbjct: 1552 cctgaatatgaccc 1565



to top

>dbj|AK061771.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C10, full
           insert sequence
          Length = 1325

 Score =  529 bits (267), Expect = e-147
 Identities = 483/554 (87%), Gaps = 2/554 (0%)
 Strand = Plus / Plus

                                                                       
Query: 17  tgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggt 76
           |||||||||||||| || || ||||| ||||||||||||||||||||||| ||  | || 
Sbjct: 70  tgcatcgtcttcattgatgaaattgatgccgtcgggaggcagcgtggtgctgggctcgga 129

                                                                       
Query: 77  ggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggcttc 136
           ||||| || |||||||||||||||||||||||||||||  | || |||||||| || || 
Sbjct: 130 gggggaaatgatgagagggagcagaccattaaccagctcttgactgagatggatggattt 189

                                                                       
Query: 137 tccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgtgcttgactcc 196
            |||| || ||||||||||| |||||||||||||| |||||||| |||||||| ||| | 
Sbjct: 190 gccggcaatagcggtgtcattgtgctcgccgcgacaaacaggcctgatgtgctcgacgcg 249

                                                                       
Query: 197 gcgcttctgcggccagggcggttcgatcggcaggtcaccgtcgaccgtccggatgtagcc 256
           || ||||| || || ||| |||||||||||||||||||||| ||| | |||||||| |||
Sbjct: 250 gctcttcttcgccctgggaggttcgatcggcaggtcaccgtagacaggccggatgtcgcc 309

                                                                       
Query: 257 ggccgtgtcaggatccttgaggttcactccagaggaaaggcattggcgaaggatgtggac 316
           || ||||||| ||| |||||||||||||| |||||||||||  |||| || ||||| |||
Sbjct: 310 gggcgtgtcaagattcttgaggttcactcgagaggaaaggc--tggcaaaagatgtcgac 367

                                                                       
Query: 317 tttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcagaacttgatg 376
           ||||| ||  ||||| | || || ||||||||||| || ||||||||||| |||||||||
Sbjct: 368 tttgagaaaattgcccggagaacccctggtttcactggagctgatcttcaaaacttgatg 427

                                                                       
Query: 377 aatgaggctgccatccttgccgcccgtcgtgatctgaaggagataagcaaggacgagatc 436
           ||||||||||| || ||||| || |||||||||||||||||||| |||||||| ||||||
Sbjct: 428 aatgaggctgctattcttgctgctcgtcgtgatctgaaggagattagcaaggatgagatc 487

                                                                       
Query: 437 tctgatgctctggagaggatcattgctgggcctgagaagaagaatgcagttgtttcagaa 496
           ||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 488 tctgatgctttggagaggatcattgctgggcctgagaagaaaaatgctgttgtttcagaa 547

                                                                       
Query: 497 cagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcggtgccctgatg 556
            |||||||||  ||||||||||||||||||||||| |||||||| || |||||||| |||
Sbjct: 548 gagaagaggagacttgtggcttaccatgaggctggtcatgcccttgttggtgccctcatg 607

                         
Query: 557 cctgaatatgaccc 570
           ||||||||||||||
Sbjct: 608 cctgaatatgaccc 621



to top

>gb|AY103957.1| Zea mays PCO116832 mRNA sequence
          Length = 1820

 Score =  450 bits (227), Expect = e-123
 Identities = 476/559 (85%)
 Strand = Plus / Plus

                                                                       
Query: 9   aggcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgg 68
           ||||||||||||| |||||||| || |||||||| ||||| || |||||||| ||||| |
Sbjct: 356 aggcgccctgcattgtcttcattgatgagattgatgccgttggaaggcagcgcggtgccg 415

                                                                       
Query: 69  gaatgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatgg 128
           || | |||||||| || || ||||| ||||||||||||||||||||  | ||||||||||
Sbjct: 416 gacttggtgggggtaatgacgagagagagcagaccattaaccagctcttgacggagatgg 475

                                                                       
Query: 129 acggcttctccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgtgc 188
           | |||||| | || |||||||||||||| ||||| ||||| ||||||||||| |||||||
Sbjct: 476 atggcttcgctggcaacagcggtgtcattgtgcttgccgccaccaacaggcccgatgtgc 535

                                                                       
Query: 189 ttgactccgcgcttctgcggccagggcggttcgatcggcaggtcaccgtcgaccgtccgg 248
           | ||||||||||| || || |||||| | || ||| ||||||||||||| ||| | || |
Sbjct: 536 tggactccgcgctcctacgaccagggagatttgataggcaggtcaccgttgacaggccag 595

                                                                       
Query: 249 atgtagccggccgtgtcaggatccttgaggttcactccagaggaaaggcattggcgaagg 308
           |||| ||||| || |||| ||| |||||||| |||||| |||||||||| |||||||| |
Sbjct: 596 atgttgccggacgcgtcaagattcttgaggtccactcccgaggaaaggctttggcgaaag 655

                                                                       
Query: 309 atgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcaga 368
           |||| || ||||||||  |||| |||||||| ||||||||||| |||||||| || || |
Sbjct: 656 atgttgattttgataaaattgctagaaggacccctggtttcactggtgctgacctccaaa 715

                                                                       
Query: 369 acttgatgaatgaggctgccatccttgccgcccgtcgtgatctgaaggagataagcaagg 428
           || | ||||||||||||||||||||||| || || |||||||| ||||| || |||||||
Sbjct: 716 acctcatgaatgaggctgccatccttgctgctcgccgtgatcttaaggaaattagcaagg 775

                                                                       
Query: 429 acgagatctctgatgctctggagaggatcattgctgggcctgagaagaagaatgcagttg 488
           | ||||||||||||||||| ||||| ||||||||||| ||||||||||| ||||| ||||
Sbjct: 776 atgagatctctgatgctcttgagagaatcattgctggccctgagaagaaaaatgctgttg 835

                                                                       
Query: 489 tttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcggtg 548
           |||| ||  |||||| || ||| || ||||||||||||||||| |||||||| ||||| |
Sbjct: 836 tttccgaggagaagaagaggctcgtcgcttaccatgaggctggccatgcccttgtcggcg 895

                              
Query: 549 ccctgatgcctgaatatga 567
           |||| ||||| || |||||
Sbjct: 896 ccctcatgccagagtatga 914



to top

>gb|BT009148.1| Triticum aestivum clone wl1n.pk0059.g7:fis, full insert mRNA
           sequence
          Length = 890

 Score =  307 bits (155), Expect = 2e-80
 Identities = 158/159 (99%)
 Strand = Plus / Plus

                                                                       
Query: 412 gaaggagataagcaaggacgagatctctgatgctctggagaggatcattgctgggcctga 471
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 8   gaaggagataagcaaggacgagatctctgatgctctggagaggatcattgctgggcccga 67

                                                                       
Query: 472 gaagaagaatgcagttgtttcagaacagaagaggaagcttgtggcttaccatgaggctgg 531
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 68  gaagaagaatgcagttgtttcagaacagaagaggaagcttgtggcttaccatgaggctgg 127

                                                  
Query: 532 acatgccctcgtcggtgccctgatgcctgaatatgaccc 570
           |||||||||||||||||||||||||||||||||||||||
Sbjct: 128 acatgccctcgtcggtgccctgatgcctgaatatgaccc 166



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  272 bits (137), Expect = 1e-69
 Identities = 221/249 (88%)
 Strand = Plus / Minus

                                                                            
Query: 276      aggttcactccagaggaaaggcattggcgaaggatgtggactttgataaggttgccagaa 335
                |||||||||| |||||||||||  |||| || ||||| |||||||| ||  ||||| | |
Sbjct: 30360113 aggttcactcgagaggaaaggctctggcaaaagatgtcgactttgagaaaattgcccgga 30360054

                                                                            
Query: 336      ggacacctggtttcaccggtgctgatcttcagaacttgatgaatgaggctgccatccttg 395
                | || ||||||||||| || ||||||||||| |||||||||||||||||||| || ||||
Sbjct: 30360053 gaacccctggtttcactggagctgatcttcaaaacttgatgaatgaggctgctattcttg 30359994

                                                                            
Query: 396      ccgcccgtcgtgatctgaaggagataagcaaggacgagatctctgatgctctggagagga 455
                | || |||||||||||||||||||| |||||||| ||||||||||||||| |||||||||
Sbjct: 30359993 ctgctcgtcgtgatctgaaggagattagcaaggatgagatctctgatgctttggagagga 30359934

                                                                            
Query: 456      tcattgctgggcctgagaagaagaatgcagttgtttcagaacagaagaggaagcttgtgg 515
                |||||||||||||||||||||| ||||| |||||||||||| |||||||||  |||||||
Sbjct: 30359933 tcattgctgggcctgagaagaaaaatgctgttgtttcagaagagaagaggagacttgtgg 30359874

                         
Query: 516      cttaccatg 524
                |||||||||
Sbjct: 30359873 cttaccatg 30359865



 Score =  212 bits (107), Expect = 9e-52
 Identities = 224/263 (85%)
 Strand = Plus / Minus

                                                                            
Query: 17       tgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggt 76
                |||||||||||||| || || ||||| ||||||||||||||||||||||| ||  | || 
Sbjct: 30361077 tgcatcgtcttcattgatgaaattgatgccgtcgggaggcagcgtggtgctgggctcgga 30361018

                                                                            
Query: 77       ggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggcttc 136
                ||||| || |||||||||||||||||||||||||||||  | || |||||||| || || 
Sbjct: 30361017 gggggaaatgatgagagggagcagaccattaaccagctcttgactgagatggatggattt 30360958

                                                                            
Query: 137      tccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgtgcttgactcc 196
                 |||| || ||||||||||| |||||||||||||| |||||||| |||||||| ||| | 
Sbjct: 30360957 gccggcaatagcggtgtcattgtgctcgccgcgacaaacaggcctgatgtgctcgacgcg 30360898

                                                                            
Query: 197      gcgcttctgcggccagggcggttcgatcggcaggtcaccgtcgaccgtccggatgtagcc 256
                || ||||| || || ||| |||||||||||||||||||||| ||| | |||||||| |||
Sbjct: 30360897 gctcttcttcgccctgggaggttcgatcggcaggtcaccgtagacaggccggatgtcgcc 30360838

                                       
Query: 257      ggccgtgtcaggatccttgaggt 279
                || ||||||| ||| ||||||||
Sbjct: 30360837 gggcgtgtcaagattcttgaggt 30360815



 Score =  115 bits (58), Expect = 2e-22
 Identities = 106/122 (86%)
 Strand = Plus / Minus

                                                                           
Query: 11      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 70
               ||||| ||| ||||||||||||||||||| |||||||| ||| ||||||| || ||||| 
Sbjct: 6714312 gcgccgtgcctcgtcttcatcgacgagatcgacgccgtggggcggcagcgcggcgcgggg 6714253

                                                                           
Query: 71      atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 130
               || || || |||||||| ||||||||||||||  | |||||||||||||| |||||||||
Sbjct: 6714252 atcggcggcgggaacgacgagagggagcagacgctgaaccagctgctcaccgagatggac 6714193

                 
Query: 131     gg 132
               ||
Sbjct: 6714192 gg 6714191



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                               
Query: 524      gaggctggacatgccctcgtcggtgccctgatgcctgaatatgaccc 570
                |||||||| |||||||| || |||||||| |||||||||||||||||
Sbjct: 30359771 gaggctggtcatgcccttgttggtgccctcatgcctgaatatgaccc 30359725



to top

>dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0548E04
          Length = 138037

 Score =  272 bits (137), Expect = 1e-69
 Identities = 221/249 (88%)
 Strand = Plus / Minus

                                                                          
Query: 276    aggttcactccagaggaaaggcattggcgaaggatgtggactttgataaggttgccagaa 335
              |||||||||| |||||||||||  |||| || ||||| |||||||| ||  ||||| | |
Sbjct: 106708 aggttcactcgagaggaaaggctctggcaaaagatgtcgactttgagaaaattgcccgga 106649

                                                                          
Query: 336    ggacacctggtttcaccggtgctgatcttcagaacttgatgaatgaggctgccatccttg 395
              | || ||||||||||| || ||||||||||| |||||||||||||||||||| || ||||
Sbjct: 106648 gaacccctggtttcactggagctgatcttcaaaacttgatgaatgaggctgctattcttg 106589

                                                                          
Query: 396    ccgcccgtcgtgatctgaaggagataagcaaggacgagatctctgatgctctggagagga 455
              | || |||||||||||||||||||| |||||||| ||||||||||||||| |||||||||
Sbjct: 106588 ctgctcgtcgtgatctgaaggagattagcaaggatgagatctctgatgctttggagagga 106529

                                                                          
Query: 456    tcattgctgggcctgagaagaagaatgcagttgtttcagaacagaagaggaagcttgtgg 515
              |||||||||||||||||||||| ||||| |||||||||||| |||||||||  |||||||
Sbjct: 106528 tcattgctgggcctgagaagaaaaatgctgttgtttcagaagagaagaggagacttgtgg 106469

                       
Query: 516    cttaccatg 524
              |||||||||
Sbjct: 106468 cttaccatg 106460



 Score =  212 bits (107), Expect = 9e-52
 Identities = 224/263 (85%)
 Strand = Plus / Minus

                                                                          
Query: 17     tgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggt 76
              |||||||||||||| || || ||||| ||||||||||||||||||||||| ||  | || 
Sbjct: 107672 tgcatcgtcttcattgatgaaattgatgccgtcgggaggcagcgtggtgctgggctcgga 107613

                                                                          
Query: 77     ggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggcttc 136
              ||||| || |||||||||||||||||||||||||||||  | || |||||||| || || 
Sbjct: 107612 gggggaaatgatgagagggagcagaccattaaccagctcttgactgagatggatggattt 107553

                                                                          
Query: 137    tccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgtgcttgactcc 196
               |||| || ||||||||||| |||||||||||||| |||||||| |||||||| ||| | 
Sbjct: 107552 gccggcaatagcggtgtcattgtgctcgccgcgacaaacaggcctgatgtgctcgacgcg 107493

                                                                          
Query: 197    gcgcttctgcggccagggcggttcgatcggcaggtcaccgtcgaccgtccggatgtagcc 256
              || ||||| || || ||| |||||||||||||||||||||| ||| | |||||||| |||
Sbjct: 107492 gctcttcttcgccctgggaggttcgatcggcaggtcaccgtagacaggccggatgtcgcc 107433

                                     
Query: 257    ggccgtgtcaggatccttgaggt 279
              || ||||||| ||| ||||||||
Sbjct: 107432 gggcgtgtcaagattcttgaggt 107410



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                             
Query: 524    gaggctggacatgccctcgtcggtgccctgatgcctgaatatgaccc 570
              |||||||| |||||||| || |||||||| |||||||||||||||||
Sbjct: 106366 gaggctggtcatgcccttgttggtgccctcatgcctgaatatgaccc 106320



to top

>ref|NM_103909.3| Arabidopsis thaliana FTSH1; ATP-dependent peptidase/ ATPase/
            metallopeptidase AT1G50250 (FTSH1) mRNA, complete cds
          Length = 2473

 Score =  214 bits (108), Expect = 2e-52
 Identities = 222/260 (85%)
 Strand = Plus / Plus

                                                                        
Query: 308  gatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcag 367
            |||||||||||||| ||||||||||||||||| ||||||||||| ||||||||  | || 
Sbjct: 1490 gatgtggactttgacaaggttgccagaaggacccctggtttcacgggtgctgacttacaa 1549

                                                                        
Query: 368  aacttgatgaatgaggctgccatccttgccgcccgtcgtgatctgaaggagataagcaag 427
            ||| |||||||||| || || || ||||| ||  | ||||| || ||||| |||||||||
Sbjct: 1550 aacctgatgaatgaagcggcgattcttgcggctaggcgtgagcttaaggaaataagcaag 1609

                                                                        
Query: 428  gacgagatctctgatgctctggagaggatcattgctgggcctgagaagaagaatgcagtt 487
            || || |||||||||||||| ||||||||||||||||| |||||||||||||||||||||
Sbjct: 1610 gatgaaatctctgatgctcttgagaggatcattgctggacctgagaagaagaatgcagtt 1669

                                                                        
Query: 488  gtttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcggt 547
            || || ||| |||||| ||  ||||| || |||||||||||||| ||||| || || |||
Sbjct: 1670 gtctctgaagagaagaagagacttgttgcataccatgaggctggtcatgctctagtgggt 1729

                                
Query: 548  gccctgatgcctgaatatga 567
            || || ||||| ||||||||
Sbjct: 1730 gctcttatgccagaatatga 1749



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 83/104 (79%)
 Strand = Plus / Plus

                                                                        
Query: 26   ttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggtggggggaac 85
            ||||| || ||||||||||| || || |||||| | || || || ||||| || || || 
Sbjct: 1208 ttcattgatgagattgacgctgtgggtaggcagagaggagctgggatgggaggaggaaat 1267

                                                        
Query: 86   gatgagagggagcagaccattaaccagctgctcacggagatgga 129
            |||||||| || ||||| ||||| |||||| | || ||||||||
Sbjct: 1268 gatgagagagaacagactattaatcagctgttgacagagatgga 1311



to top

>gb|AY123034.1| Arabidopsis thaliana putative chloroplast FtsH protease (At1g50250)
            mRNA, complete cds
          Length = 2182

 Score =  214 bits (108), Expect = 2e-52
 Identities = 222/260 (85%)
 Strand = Plus / Plus

                                                                        
Query: 308  gatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcag 367
            |||||||||||||| ||||||||||||||||| ||||||||||| ||||||||  | || 
Sbjct: 1357 gatgtggactttgacaaggttgccagaaggacccctggtttcacgggtgctgacttacaa 1416

                                                                        
Query: 368  aacttgatgaatgaggctgccatccttgccgcccgtcgtgatctgaaggagataagcaag 427
            ||| |||||||||| || || || ||||| ||  | ||||| || ||||| |||||||||
Sbjct: 1417 aacctgatgaatgaagcggcgattcttgcggctaggcgtgagcttaaggaaataagcaag 1476

                                                                        
Query: 428  gacgagatctctgatgctctggagaggatcattgctgggcctgagaagaagaatgcagtt 487
            || || |||||||||||||| ||||||||||||||||| |||||||||||||||||||||
Sbjct: 1477 gatgaaatctctgatgctcttgagaggatcattgctggacctgagaagaagaatgcagtt 1536

                                                                        
Query: 488  gtttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcggt 547
            || || ||| |||||| ||  ||||| || |||||||||||||| ||||| || || |||
Sbjct: 1537 gtctctgaagagaagaagagacttgttgcataccatgaggctggtcatgctctagtgggt 1596

                                
Query: 548  gccctgatgcctgaatatga 567
            || || ||||| ||||||||
Sbjct: 1597 gctcttatgccagaatatga 1616



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 83/104 (79%)
 Strand = Plus / Plus

                                                                        
Query: 26   ttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggtggggggaac 85
            ||||| || ||||||||||| || || |||||| | || || || ||||| || || || 
Sbjct: 1075 ttcattgatgagattgacgctgtgggtaggcagagaggagctgggatgggaggaggaaat 1134

                                                        
Query: 86   gatgagagggagcagaccattaaccagctgctcacggagatgga 129
            |||||||| || ||||| ||||| |||||| | || ||||||||
Sbjct: 1135 gatgagagagaacagactattaatcagctgttgacagagatgga 1178



to top

>gb|AY091095.1| Arabidopsis thaliana putative chloroplast FtsH protease (At1g50250)
            mRNA, complete cds
          Length = 2452

 Score =  214 bits (108), Expect = 2e-52
 Identities = 222/260 (85%)
 Strand = Plus / Plus

                                                                        
Query: 308  gatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcag 367
            |||||||||||||| ||||||||||||||||| ||||||||||| ||||||||  | || 
Sbjct: 1453 gatgtggactttgacaaggttgccagaaggacccctggtttcacgggtgctgacttacaa 1512

                                                                        
Query: 368  aacttgatgaatgaggctgccatccttgccgcccgtcgtgatctgaaggagataagcaag 427
            ||| |||||||||| || || || ||||| ||  | ||||| || ||||| |||||||||
Sbjct: 1513 aacctgatgaatgaagcggcgattcttgcggctaggcgtgagcttaaggaaataagcaag 1572

                                                                        
Query: 428  gacgagatctctgatgctctggagaggatcattgctgggcctgagaagaagaatgcagtt 487
            || || |||||||||||||| ||||||||||||||||| |||||||||||||||||||||
Sbjct: 1573 gatgaaatctctgatgctcttgagaggatcattgctggacctgagaagaagaatgcagtt 1632

                                                                        
Query: 488  gtttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcggt 547
            || || ||| |||||| ||  ||||| || |||||||||||||| ||||| || || |||
Sbjct: 1633 gtctctgaagagaagaagagacttgttgcataccatgaggctggtcatgctctagtgggt 1692

                                
Query: 548  gccctgatgcctgaatatga 567
            || || ||||| ||||||||
Sbjct: 1693 gctcttatgccagaatatga 1712



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 83/104 (79%)
 Strand = Plus / Plus

                                                                        
Query: 26   ttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggtggggggaac 85
            ||||| || ||||||||||| || || |||||| | || || || ||||| || || || 
Sbjct: 1171 ttcattgatgagattgacgctgtgggtaggcagagaggagctgggatgggaggaggaaat 1230

                                                        
Query: 86   gatgagagggagcagaccattaaccagctgctcacggagatgga 129
            |||||||| || ||||| ||||| |||||| | || ||||||||
Sbjct: 1231 gatgagagagaacagactattaatcagctgttgacagagatgga 1274



to top

>emb|X99808.1|ATFTSH A.thaliana mRNA for chloroplast FtsH protease
          Length = 2447

 Score =  206 bits (104), Expect = 6e-50
 Identities = 221/260 (85%)
 Strand = Plus / Plus

                                                                        
Query: 308  gatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcag 367
            |||||||||||||| ||||||||||||||||| ||||||||||| ||||||||  | || 
Sbjct: 1488 gatgtggactttgacaaggttgccagaaggacccctggtttcacgggtgctgacttacaa 1547

                                                                        
Query: 368  aacttgatgaatgaggctgccatccttgccgcccgtcgtgatctgaaggagataagcaag 427
            ||| |||||||||| || || || ||||| ||  | |||||  | ||||| |||||||||
Sbjct: 1548 aacctgatgaatgaagcggcgattcttgcggctaggcgtgacgttaaggaaataagcaag 1607

                                                                        
Query: 428  gacgagatctctgatgctctggagaggatcattgctgggcctgagaagaagaatgcagtt 487
            || || |||||||||||||| ||||||||||||||||| |||||||||||||||||||||
Sbjct: 1608 gatgaaatctctgatgctcttgagaggatcattgctggacctgagaagaagaatgcagtt 1667

                                                                        
Query: 488  gtttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcggt 547
            || || ||| |||||| ||  ||||| || |||||||||||||| ||||| || || |||
Sbjct: 1668 gtctctgaagagaagaagagacttgttgcataccatgaggctggtcatgctctagtgggt 1727

                                
Query: 548  gccctgatgcctgaatatga 567
            || || ||||| ||||||||
Sbjct: 1728 gctcttatgccagaatatga 1747



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 83/104 (79%)
 Strand = Plus / Plus

                                                                        
Query: 26   ttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggtggggggaac 85
            ||||| || ||||||||||| || || |||||| | || || || ||||| || || || 
Sbjct: 1206 ttcattgatgagattgacgctgtgggtaggcagagaggagctgggatgggaggaggaaat 1265

                                                        
Query: 86   gatgagagggagcagaccattaaccagctgctcacggagatgga 129
            |||||||| || ||||| ||||| |||||| | || ||||||||
Sbjct: 1266 gatgagagagaacagactattaatcagctgttgacagagatgga 1309



to top

>emb|BX815046.1|CNS0AE0R Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS28ZC04 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 2428

 Score =  206 bits (104), Expect = 6e-50
 Identities = 221/260 (85%)
 Strand = Plus / Plus

                                                                        
Query: 308  gatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcag 367
            |||||||||||||| ||||||||||||||||| ||||||||||| ||||||||  | || 
Sbjct: 1489 gatgtggactttgacaaggttgccagaaggacccctggtttcacgggtgctgacttacaa 1548

                                                                        
Query: 368  aacttgatgaatgaggctgccatccttgccgcccgtcgtgatctgaaggagataagcaag 427
            ||| |||||||||| || || || ||||| ||  | ||||| || ||||| |||||||||
Sbjct: 1549 aacctgatgaatgaagcggcgattcttgcggctaggcgtgagcttaaggaaataagcaag 1608

                                                                        
Query: 428  gacgagatctctgatgctctggagaggatcattgctgggcctgagaagaagaatgcagtt 487
            || || |||||||||||||| ||||||||||||||||| |||||||||||||||||||||
Sbjct: 1609 gatgaaatctctgatgctcttgagaggatcattgctggacctgagaagaagaatgcagtt 1668

                                                                        
Query: 488  gtttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtcggt 547
            || || ||| |||||| ||  ||||| ||  ||||||||||||| ||||| || || |||
Sbjct: 1669 gtctctgaagagaagaagagacttgttgcacaccatgaggctggtcatgctctagtgggt 1728

                                
Query: 548  gccctgatgcctgaatatga 567
            || || ||||| ||||||||
Sbjct: 1729 gctcttatgccagaatatga 1748



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 83/104 (79%)
 Strand = Plus / Plus

                                                                        
Query: 26   ttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggtggggggaac 85
            ||||| || ||||||||||| || || |||||| | || || || ||||| || || || 
Sbjct: 1207 ttcattgatgagattgacgctgtgggtaggcagagaggagctgggatgggaggaggaaat 1266

                                                        
Query: 86   gatgagagggagcagaccattaaccagctgctcacggagatgga 129
            |||||||| || ||||| ||||| |||||| | || ||||||||
Sbjct: 1267 gatgagagagaacagactattaatcagctgttgacagagatgga 1310



to top

>emb|Y12780.1|ATAAAA A.thaliana mRNA for ATPase, partial
          Length = 2190

 Score =  194 bits (98), Expect = 2e-46
 Identities = 197/230 (85%)
 Strand = Plus / Plus

                                                                        
Query: 308  gatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcag 367
            |||||||||||||| ||||||||||||||| | ||||||||||| ||||||||  | || 
Sbjct: 1153 gatgtggactttgacaaggttgccagaaggtcccctggtttcacgggtgctgacttacaa 1212

                                                                        
Query: 368  aacttgatgaatgaggctgccatccttgccgcccgtcgtgatctgaaggagataagcaag 427
            ||| |||||||||| || || || ||||| ||  | ||||| || ||||| |||||||||
Sbjct: 1213 aacctgatgaatgaagcggcgattcttgcggctaggcgtgagcttaaggaaataagcaag 1272

                                                                        
Query: 428  gacgagatctctgatgctctggagaggatcattgctgggcctgagaagaagaatgcagtt 487
            || || |||||||||||||| ||||||||||||||||| |||||||||||||||||||||
Sbjct: 1273 gatgaaatctctgatgctcttgagaggatcattgctggacctgagaagaagaatgcagtt 1332

                                                              
Query: 488  gtttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgc 537
            || || ||| |||||| ||  ||||| || |||||||||||||| |||||
Sbjct: 1333 gtctctgaagagaagaagagacttgttgcataccatgaggctggtcatgc 1382



to top

>gb|DQ339462.1| Vitis pseudoreticulata ATPase mRNA, complete cds
          Length = 600

 Score =  188 bits (95), Expect = 1e-44
 Identities = 251/303 (82%)
 Strand = Plus / Plus

                                                                       
Query: 268 gatccttgaggttcactccagaggaaaggcattggcgaaggatgtggactttgataaggt 327
           ||||||| |||| ||||| ||||| |||||| | || |||||||| |||||||| ||| |
Sbjct: 144 gatccttcaggtgcactcaagagggaaggcactagccaaggatgtagactttgaaaagat 203

                                                                       
Query: 328 tgccagaaggacacctggtttcaccggtgctgatcttcagaacttgatgaatgaggctgc 387
           ||| |||||||| || || ||||| || |||||  | |||||| ||||||||||||| ||
Sbjct: 204 tgcgagaaggaccccaggcttcacaggggctgacttgcagaacctgatgaatgaggcagc 263

                                                                       
Query: 388 catccttgccgcccgtcgtgatctgaaggagataagcaaggacgagatctctgatgctct 447
           |||||| || ||  | ||||| || ||||||||||||||||| ||||| |||||||| ||
Sbjct: 264 catcctcgcagctaggcgtgacctcaaggagataagcaaggatgagatatctgatgccct 323

                                                                       
Query: 448 ggagaggatcattgctgggcctgagaagaagaatgcagttgtttcagaacagaagaggaa 507
           ||||||||| ||||||||||| |||||||| ||||| || || |||||  |||||| |||
Sbjct: 324 ggagaggataattgctgggccagagaagaaaaatgctgtggtctcagacgagaagaagaa 383

                                                                       
Query: 508 gcttgtggcttaccatgaggctggacatgccctcgtcggtgccctgatgcctgaatatga 567
             | || || || ||||||||||| |||||  | |||||||| || ||||||||||||||
Sbjct: 384 attagttgcctatcatgaggctgggcatgcattggtcggtgcacttatgcctgaatatga 443

              
Query: 568 ccc 570
           |||
Sbjct: 444 ccc 446



to top

>gb|AC007980.1| Arabidopsis thaliana chromosome I BAC F14I3 genomic sequence, complete
             sequence
          Length = 100975

 Score =  184 bits (93), Expect = 2e-43
 Identities = 186/217 (85%)
 Strand = Plus / Plus

                                                                         
Query: 308   gatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatcttcag 367
             |||||||||||||| ||||||||||||||||| ||||||||||| ||||||||  | || 
Sbjct: 61377 gatgtggactttgacaaggttgccagaaggacccctggtttcacgggtgctgacttacaa 61436

                                                                         
Query: 368   aacttgatgaatgaggctgccatccttgccgcccgtcgtgatctgaaggagataagcaag 427
             ||| |||||||||| || || || ||||| ||  | ||||| || ||||| |||||||||
Sbjct: 61437 aacctgatgaatgaagcggcgattcttgcggctaggcgtgagcttaaggaaataagcaag 61496

                                                                         
Query: 428   gacgagatctctgatgctctggagaggatcattgctgggcctgagaagaagaatgcagtt 487
             || || |||||||||||||| ||||||||||||||||| |||||||||||||||||||||
Sbjct: 61497 gatgaaatctctgatgctcttgagaggatcattgctggacctgagaagaagaatgcagtt 61556

                                                  
Query: 488   gtttcagaacagaagaggaagcttgtggcttaccatg 524
             || || ||| |||||| ||  ||||| || |||||||
Sbjct: 61557 gtctctgaagagaagaagagacttgttgcataccatg 61593



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 83/104 (79%)
 Strand = Plus / Plus

                                                                         
Query: 26    ttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggtggggggaac 85
             ||||| || ||||||||||| || || |||||| | || || || ||||| || || || 
Sbjct: 60999 ttcattgatgagattgacgctgtgggtaggcagagaggagctgggatgggaggaggaaat 61058

                                                         
Query: 86    gatgagagggagcagaccattaaccagctgctcacggagatgga 129
             |||||||| || ||||| ||||| |||||| | || ||||||||
Sbjct: 61059 gatgagagagaacagactattaatcagctgttgacagagatgga 61102



to top

>emb|X90472.1|CAATPASE C.annuum mRNA for ATPase protein
          Length = 1989

 Score =  176 bits (89), Expect = 5e-41
 Identities = 251/305 (82%)
 Strand = Plus / Plus

                                                                        
Query: 263  gtcaggatccttgaggttcactccagaggaaaggcattggcgaaggatgtggactttgat 322
            |||||||| ||| |||| || || |||||||||||  | || ||||||||||||||||||
Sbjct: 1218 gtcaggattcttcaggtacattctagaggaaaggcccttgcaaaggatgtggactttgat 1277

                                                                        
Query: 323  aaggttgccagaaggacacctggtttcaccggtgctgatcttcagaacttgatgaatgag 382
            ||| ||||||| || || || |||||||| ||||| ||| | || ||||||||||| || 
Sbjct: 1278 aagattgccaggagaactccaggtttcactggtgcagatttacaaaacttgatgaacgaa 1337

                                                                        
Query: 383  gctgccatccttgccgcccgtcgtgatctgaaggagataagcaaggacgagatctctgat 442
            || ||||||||||| ||  | ||||| || ||||| ||||| || || ||||| ||||||
Sbjct: 1338 gcagccatccttgcagctaggcgtgacctaaaggaaataagtaaagatgagatatctgat 1397

                                                                        
Query: 443  gctctggagaggatcattgctgggcctgagaagaagaatgcagttgtttcagaacagaag 502
            |||||||||||||| |||||||| || |||||||| || || ||||| |||||  |||||
Sbjct: 1398 gctctggagaggataattgctggtccggagaagaaaaacgctgttgtctcagatgagaag 1457

                                                                        
Query: 503  aggaagcttgtggcttaccatgaggctggacatgccctcgtcggtgccctgatgcctgaa 562
            | |||||| || ||||| ||||||||||| |||||| | || ||||| || ||||| || 
Sbjct: 1458 aagaagctggtagcttatcatgaggctggccatgccttggttggtgcacttatgcccgag 1517

                 
Query: 563  tatga 567
            |||||
Sbjct: 1518 tatga 1522



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 84/104 (80%)
 Strand = Plus / Plus

                                                                        
Query: 11   gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 70
            ||||| ||||| || || ||||| |||||||| || || || |||||| | ||||| |||
Sbjct: 966  gcgccttgcattgtgtttatcgatgagattgatgctgtaggaaggcagagaggtgcagga 1025

                                                        
Query: 71   atgggtggggggaacgatgagagggagcagaccattaaccagct 114
             | || || || || ||||||||||||||||| ||||| |||||
Sbjct: 1026 cttggaggtggaaatgatgagagggagcagactattaatcagct 1069



to top

>dbj|AB017480.2| Nicotiana tabacum mRNA for chloroplast FtsH protease, complete cds
          Length = 2447

 Score =  141 bits (71), Expect = 3e-30
 Identities = 215/263 (81%)
 Strand = Plus / Plus

                                                                        
Query: 305  aaggatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgatctt 364
            ||||||||||||||||| ||| ||||||| || ||||| |||| ||| ||||| ||| | 
Sbjct: 1348 aaggatgtggactttgagaagattgccaggagaacaccgggttacactggtgcagatttg 1407

                                                                        
Query: 365  cagaacttgatgaatgaggctgccatccttgccgcccgtcgtgatctgaaggagataagc 424
            || ||||||||||| || || || |||||||| ||  | ||||| || ||||| ||||| 
Sbjct: 1408 caaaacttgatgaacgaagcagcaatccttgcagctaggcgtgaactaaaggaaataagt 1467

                                                                        
Query: 425  aaggacgagatctctgatgctctggagaggatcattgctgggcctgagaagaagaatgca 484
            || || ||||| |||||||||||||||||||| ||||| || || |||||||| ||||| 
Sbjct: 1468 aaagatgagatatctgatgctctggagaggataattgccggcccagagaagaaaaatgct 1527

                                                                        
Query: 485  gttgtttcagaacagaagaggaagcttgtggcttaccatgaggctggacatgccctcgtc 544
            ||||| |||||  |||||| |||||| || ||||| |||||||| || |||||| | || 
Sbjct: 1528 gttgtctcagatgagaagaagaagctggtagcttatcatgaggccggccatgccttggtt 1587

                                   
Query: 545  ggtgccctgatgcctgaatatga 567
            ||||| || ||||| || |||||
Sbjct: 1588 ggtgcacttatgcccgagtatga 1610



to top

>ref|NM_123592.2| Arabidopsis thaliana VAR1 (VARIEGATED 1); ATP-dependent peptidase/
            ATPase/ metallopeptidase AT5G42270 (VAR1) mRNA, complete
            cds
          Length = 3058

 Score =  139 bits (70), Expect = 1e-29
 Identities = 163/194 (84%)
 Strand = Plus / Plus

                                                                        
Query: 344  ggtttcaccggtgctgatcttcagaacttgatgaatgaggctgccatccttgccgcccgt 403
            |||||||| ||||||||| | |||||| |||||||||| ||||| || ||||| ||  | 
Sbjct: 1530 ggtttcactggtgctgatttgcagaacctgatgaatgaagctgcgattcttgctgctaga 1589

                                                                        
Query: 404  cgtgatctgaaggagataagcaaggacgagatctctgatgctctggagaggatcattgct 463
            ||||| || ||||||||||||||||| || || ||||||||||| |||||||||||||||
Sbjct: 1590 cgtgagcttaaggagataagcaaggatgaaatatctgatgctcttgagaggatcattgct 1649

                                                                        
Query: 464  gggcctgagaagaagaatgcagttgtttcagaacagaagaggaagcttgtggcttaccat 523
            || ||||| |||||||| || ||||| || ||  ||||||  |  ||||| |||||||||
Sbjct: 1650 ggacctgaaaagaagaacgctgttgtctctgaggagaagaaaagacttgttgcttaccat 1709

                          
Query: 524  gaggctggacatgc 537
            |||||||| |||||
Sbjct: 1710 gaggctgggcatgc 1723



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 102/129 (79%)
 Strand = Plus / Plus

                                                                        
Query: 71   atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 130
            |||||||| || || ||||||||||| ||||| ||||| |||||  | || |||||||| 
Sbjct: 1257 atgggtggtggaaatgatgagagggaacagactattaatcagcttttgactgagatggat 1316

                                                                        
Query: 131  ggcttctccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgtgctt 190
            || || || || |||   |||||||| ||| | || || || || || |||||||| |||
Sbjct: 1317 gggttttctggtaactctggtgtcattgtgttggctgccactaatagaccggatgttctt 1376

                     
Query: 191  gactccgcg 199
            |||||||||
Sbjct: 1377 gactccgcg 1385



to top

>gb|AY126987.1| Arabidopsis thaliana AT5g42270/K5J14_7 mRNA, complete cds
          Length = 2311

 Score =  139 bits (70), Expect = 1e-29
 Identities = 163/194 (84%)
 Strand = Plus / Plus

                                                                        
Query: 344  ggtttcaccggtgctgatcttcagaacttgatgaatgaggctgccatccttgccgcccgt 403
            |||||||| ||||||||| | |||||| |||||||||| ||||| || ||||| ||  | 
Sbjct: 1456 ggtttcactggtgctgatttgcagaacctgatgaatgaagctgcgattcttgctgctaga 1515

                                                                        
Query: 404  cgtgatctgaaggagataagcaaggacgagatctctgatgctctggagaggatcattgct 463
            ||||| || ||||||||||||||||| || || ||||||||||| |||||||||||||||
Sbjct: 1516 cgtgagcttaaggagataagcaaggatgaaatatctgatgctcttgagaggatcattgct 1575

                                                                        
Query: 464  gggcctgagaagaagaatgcagttgtttcagaacagaagaggaagcttgtggcttaccat 523
            || ||||| |||||||| || ||||| || ||  ||||||  |  ||||| |||||||||
Sbjct: 1576 ggacctgaaaagaagaacgctgttgtctctgaggagaagaaaagacttgttgcttaccat 1635

                          
Query: 524  gaggctggacatgc 537
            |||||||| |||||
Sbjct: 1636 gaggctgggcatgc 1649



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 102/129 (79%)
 Strand = Plus / Plus

                                                                        
Query: 71   atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 130
            |||||||| || || ||||||||||| ||||| ||||| |||||  | || |||||||| 
Sbjct: 1183 atgggtggtggaaatgatgagagggaacagactattaatcagcttttgactgagatggat 1242

                                                                        
Query: 131  ggcttctccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgtgctt 190
            || || || || |||   |||||||| ||| | || || || || || |||||||| |||
Sbjct: 1243 gggttttctggtaactctggtgtcattgtgttggctgccactaatagaccggatgttctt 1302

                     
Query: 191  gactccgcg 199
            |||||||||
Sbjct: 1303 gactccgcg 1311



to top

>dbj|AB023032.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5J14
          Length = 59762

 Score =  123 bits (62), Expect = 7e-25
 Identities = 125/146 (85%)
 Strand = Plus / Plus

                                                                         
Query: 344   ggtttcaccggtgctgatcttcagaacttgatgaatgaggctgccatccttgccgcccgt 403
             |||||||| ||||||||| | |||||| |||||||||| ||||| || ||||| ||  | 
Sbjct: 42638 ggtttcactggtgctgatttgcagaacctgatgaatgaagctgcgattcttgctgctaga 42697

                                                                         
Query: 404   cgtgatctgaaggagataagcaaggacgagatctctgatgctctggagaggatcattgct 463
             ||||| || ||||||||||||||||| || || ||||||||||| |||||||||||||||
Sbjct: 42698 cgtgagcttaaggagataagcaaggatgaaatatctgatgctcttgagaggatcattgct 42757

                                       
Query: 464   gggcctgagaagaagaatgcagttgt 489
             || ||||| |||||||| || |||||
Sbjct: 42758 ggacctgaaaagaagaacgctgttgt 42783



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 102/129 (79%)
 Strand = Plus / Plus

                                                                         
Query: 71    atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 130
             |||||||| || || ||||||||||| ||||| ||||| |||||  | || |||||||| 
Sbjct: 42286 atgggtggtggaaatgatgagagggaacagactattaatcagcttttgactgagatggat 42345

                                                                         
Query: 131   ggcttctccggaaacagcggtgtcatcgtgctcgccgcgaccaacaggccggatgtgctt 190
             || || || || |||   |||||||| ||| | || || || || || |||||||| |||
Sbjct: 42346 gggttttctggtaactctggtgtcattgtgttggctgccactaatagaccggatgttctt 42405

                      
Query: 191   gactccgcg 199
             |||||||||
Sbjct: 42406 gactccgcg 42414



to top

>dbj|AP003569.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0425F05
          Length = 162858

 Score =  115 bits (58), Expect = 2e-22
 Identities = 106/122 (86%)
 Strand = Plus / Minus

                                                                          
Query: 11     gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 70
              ||||| ||| ||||||||||||||||||| |||||||| ||| ||||||| || ||||| 
Sbjct: 148438 gcgccgtgcctcgtcttcatcgacgagatcgacgccgtggggcggcagcgcggcgcgggg 148379

                                                                          
Query: 71     atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 130
              || || || |||||||| ||||||||||||||  | |||||||||||||| |||||||||
Sbjct: 148378 atcggcggcgggaacgacgagagggagcagacgctgaaccagctgctcaccgagatggac 148319

                
Query: 131    gg 132
              ||
Sbjct: 148318 gg 148317



to top

>dbj|AP003509.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0525F01
          Length = 151668

 Score =  115 bits (58), Expect = 2e-22
 Identities = 106/122 (86%)
 Strand = Plus / Minus

                                                                         
Query: 11    gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 70
             ||||| ||| ||||||||||||||||||| |||||||| ||| ||||||| || ||||| 
Sbjct: 43991 gcgccgtgcctcgtcttcatcgacgagatcgacgccgtggggcggcagcgcggcgcgggg 43932

                                                                         
Query: 71    atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 130
             || || || |||||||| ||||||||||||||  | |||||||||||||| |||||||||
Sbjct: 43931 atcggcggcgggaacgacgagagggagcagacgctgaaccagctgctcaccgagatggac 43872

               
Query: 131   gg 132
             ||
Sbjct: 43871 gg 43870



to top

>emb|BX569692.1| Synechococcus sp. WH8102 complete genome; segment 4/7
          Length = 345997

 Score =  105 bits (53), Expect = 2e-19
 Identities = 98/113 (86%)
 Strand = Plus / Plus

                                                                          
Query: 17     tgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggt 76
              |||||||| |||||||| |||||||||||||||||  | ||||| ||||| ||||| |||
Sbjct: 154625 tgcatcgtgttcatcgatgagattgacgccgtcggtcgtcagcgcggtgccggaatcggt 154684

                                                                   
Query: 77     ggggggaacgatgagagggagcagaccattaaccagctgctcacggagatgga 129
              || ||||| || ||| ||||||||||| | ||||||||||||||||| |||||
Sbjct: 154685 ggagggaatgacgagcgggagcagaccctgaaccagctgctcacggaaatgga 154737



to top

>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome
          Length = 1849742

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 106/123 (86%), Gaps = 2/123 (1%)
 Strand = Plus / Plus

                                                                           
Query: 14      ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtgg-tgcgggaat 72
               ||||||||||||||||| ||||||||||||||||| |||||| |||| ||  |||||  |
Sbjct: 1419876 ccctgcatcgtcttcattgacgagattgacgccgtggggaggaagcggggaagcggg-gt 1419934

                                                                           
Query: 73      gggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacgg 132
               ||| || |||||||| ||| ||||||||||| | |||||||| |||  ||||||||||||
Sbjct: 1419935 ggggggcgggaacgacgagcgggagcagaccctgaaccagctcctcgtggagatggacgg 1419994

                  
Query: 133     ctt 135
               |||
Sbjct: 1419995 ctt 1419997



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 18     gcatcgtcttcatcgacgagattgac 43
              ||||||||||||| ||||||||||||
Sbjct: 601790 gcatcgtcttcattgacgagattgac 601765



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                               
Query: 84     acgatgagagggagcagaccattaaccagctgctcacggagatggacgg 132
              |||| ||| ||||||||||| | |||||| | ||| |||||||||||||
Sbjct: 382299 acgacgagcgggagcagaccctgaaccagatcctctcggagatggacgg 382251



to top

>dbj|AB032368.1| Thermus thermophilus clpB, dafA, dnaJ, grpE, dnaK, ftsH genes,
            complete cds
          Length = 9000

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 106/123 (86%), Gaps = 2/123 (1%)
 Strand = Plus / Plus

                                                                        
Query: 14   ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtgg-tgcgggaat 72
            ||||||||||||||||| ||||||||||||||||| |||||| |||| ||  |||||  |
Sbjct: 7041 ccctgcatcgtcttcattgacgagattgacgccgtggggaggaagcggggaagcggg-gt 7099

                                                                        
Query: 73   gggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacgg 132
            ||| || |||||||| ||| ||||||||||| | |||||||| |||  ||||||||||||
Sbjct: 7100 ggggggcgggaacgacgagcgggagcagaccctgaaccagctcctcgtggagatggacgg 7159

               
Query: 133  ctt 135
            |||
Sbjct: 7160 ctt 7162



to top

>gb|AF332134.1| Medicago sativa FtsH protease (FtsH) mRNA, complete cds; chloroplast
            gene for chloroplast product
          Length = 2352

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 238/302 (78%)
 Strand = Plus / Plus

                                                                        
Query: 269  atccttgaggttcactccagaggaaaggcattggcgaaggatgtggactttgataaggtt 328
            |||||| |||| || || |||||||| ||| | || |||||||| |||||||| ||  ||
Sbjct: 1343 atccttcaggtgcattctagaggaaaagcacttgcaaaggatgttgactttgacaaaatt 1402

                                                                        
Query: 329  gccagaaggacacctggtttcaccggtgctgatcttcagaacttgatgaatgaggctgcc 388
            ||||| || || || || ||||| || | |||||| |||||  ||||||| || || || 
Sbjct: 1403 gccaggagaaccccagggttcacaggagttgatctgcagaatctgatgaacgaagcagct 1462

                                                                        
Query: 389  atccttgccgcccgtcgtgatctgaaggagataagcaaggacgagatctctgatgctctg 448
            || ||||| ||| | ||||| || || || ||||| || || |||||  ||||||| || 
Sbjct: 1463 attcttgctgccaggcgtgacctcaaagaaataagtaaagatgagatagctgatgcgctt 1522

                                                                        
Query: 449  gagaggatcattgctgggcctgagaagaagaatgcagttgtttcagaacagaagaggaag 508
            || |||||||||||||| || || ||||| ||||| ||||| |||||| |||||| ||| 
Sbjct: 1523 gaaaggatcattgctggaccagaaaagaaaaatgccgttgtctcagaagagaagaagaaa 1582

                                                                        
Query: 509  cttgtggcttaccatgaggctggacatgccctcgtcggtgccctgatgcctgaatatgac 568
             | || || || ||||||||||| |||||  | || |||||  |||||||||||||||||
Sbjct: 1583 ttagtagcctatcatgaggctggccatgctttagtgggtgctttgatgcctgaatatgac 1642

              
Query: 569  cc 570
            ||
Sbjct: 1643 cc 1644



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                     
Query: 74   ggtggggggaacgatgagagggagcagaccattaaccagct 114
            ||||| ||||| ||||||||||| ||||| ||||| |||||
Sbjct: 1148 ggtggtgggaatgatgagagggaacagactattaatcagct 1188



to top

>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 105/125 (84%)
 Strand = Plus / Minus

                                                                        
Query: 11   gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 70
            ||||||||||||||||||||||||||||||||||| || ||  ||||||| || || || 
Sbjct: 4508 gcgccctgcatcgtcttcatcgacgagattgacgcggtgggccggcagcggggggccggc 4449

                                                                        
Query: 71   atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 130
            || || || || ||||| ||  | ||||| ||| | |||||| |||||||||||||||||
Sbjct: 4448 attggcggtggcaacgacgaacgcgagcaaaccctgaaccagttgctcacggagatggac 4389

                 
Query: 131  ggctt 135
            |||||
Sbjct: 4388 ggctt 4384



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                          
Query: 14     ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 73
              |||||||||||||||||||| || ||||| || |||||  | ||||| || || ||  ||
Sbjct: 640775 ccctgcatcgtcttcatcgatgaaattgatgcagtcggtcgccagcggggagctggcttg 640834

                                                                         
Query: 74     ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacgg 132
              || || || ||||| ||  ||||||||||| | |||||| ||||||| |||||||||||
Sbjct: 640835 ggaggtggcaacgacgaacgggagcagaccctgaaccagttgctcaccgagatggacgg 640893



to top

>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 105/123 (85%), Gaps = 2/123 (1%)
 Strand = Plus / Plus

                                                                           
Query: 14      ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtgg-tgcgggaat 72
               ||||||||||||||||| ||||||||||||||||| |||||| |||| ||  |||||  |
Sbjct: 1096964 ccctgcatcgtcttcattgacgagattgacgccgtggggaggaagcggggaagcggg-gt 1097022

                                                                           
Query: 73      gggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacgg 132
               ||| || || ||||| ||| ||||||||||| | |||||||| |||  ||||||||||||
Sbjct: 1097023 ggggggcggaaacgacgagcgggagcagaccctgaaccagctcctcgtggagatggacgg 1097082

                  
Query: 133     ctt 135
               |||
Sbjct: 1097083 ctt 1097085



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 18     gcatcgtcttcatcgacgagattgac 43
              ||||||||||||| ||||||||||||
Sbjct: 255573 gcatcgtcttcattgacgagattgac 255548



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                              
Query: 84    acgatgagagggagcagaccattaaccagctgctcacggagatggacgg 132
             |||| ||| ||||||||||| | |||||| | ||| |||||||||||||
Sbjct: 31951 acgacgagcgggagcagaccctgaaccagatcctctcggagatggacgg 31903



to top

>emb|BX572096.1| Prochlorococcus marinus MIT9313 complete genome; segment 2/7
          Length = 349323

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                     
Query: 83    aacgatgagagggagcagaccattaaccagctgctcacggagatggacggcttctc 138
             ||||||||| | ||||||||| ||||||||||||||||||| ||||| ||||||||
Sbjct: 78439 aacgatgagcgtgagcagacccttaaccagctgctcacggaaatggatggcttctc 78494



to top

>gb|CP000110.1| Synechococcus sp. CC9605, complete genome
          Length = 2510659

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 35/35 (100%)
 Strand = Plus / Plus

                                                 
Query: 14     ccctgcatcgtcttcatcgacgagattgacgccgt 48
              |||||||||||||||||||||||||||||||||||
Sbjct: 305033 ccctgcatcgtcttcatcgacgagattgacgccgt 305067



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                             
Query: 524    gaggctggacatgccctcgtcggtgccctgatgcctgaatatgaccc 570
              |||||||| |||||||| || ||||||||||||||||| || |||||
Sbjct: 305543 gaggctggccatgcccttgtgggtgccctgatgcctgactacgaccc 305589



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                   
Query: 93     gggagcagaccattaaccagctgctcacggagatgga 129
              ||||||||||| | |||||||||||||| ||||||||
Sbjct: 892552 gggagcagaccctcaaccagctgctcactgagatgga 892588



to top

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                     
Query: 11      gcgccctgcatcgtcttcatcgacgagattgacgccgt 48
               ||||||||||||||||||||||||||||| ||||||||
Sbjct: 2406635 gcgccctgcatcgtcttcatcgacgagatcgacgccgt 2406598



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 18     gcatcgtcttcatcgacgagat 39
              ||||||||||||||||||||||
Sbjct: 120586 gcatcgtcttcatcgacgagat 120607



to top

>gb|CP000284.1| Methylobacillus flagellatus KT, complete genome
          Length = 2971517

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                         
Query: 95      gagcagaccattaaccagctgctcacggagatggacggcttc 136
               ||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 1210312 gagcagaccctcaaccagctgctcacggagatggacggcttc 1210271



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 11     gcgccctgcatcgtcttcatcgacgagattgacgccgt 48
              ||||| |||||||||||||| ||||| ||||| |||||
Sbjct: 826074 gcgccatgcatcgtcttcattgacgaaattgatgccgt 826111



to top

>gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome
          Length = 3665893

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 100/122 (81%)
 Strand = Plus / Plus

                                                                           
Query: 11      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 70
               |||||||||||| |||| ||||||||||| || ||||| ||| | || || ||||| || 
Sbjct: 1170465 gcgccctgcatcatctttatcgacgagatcgatgccgtggggcgccatcgcggtgccggc 1170524

                                                                           
Query: 71      atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 130
                ||||||| ||| |||| ||| ||||||||||| | |||||| ||||   ||||||||||
Sbjct: 1170525 ctgggtggcgggcacgacgagcgggagcagaccctcaaccagttgctggtggagatggac 1170584

                 
Query: 131     gg 132
               ||
Sbjct: 1170585 gg 1170586



to top

>emb|AJ488199.1|PVI488199 Uncultured bacterium gene for putative zinc metallopeptidase, clone
           8
          Length = 1884

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Plus

                                                     
Query: 95  gagcagaccattaaccagctgctcacggagatggacggcttc 136
           ||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 832 gagcagaccctcaaccagctgctcacggagatggacggcttc 873



to top

>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                       
Query: 11     gcgccctgcatcgtcttcatcgacgagattgacgccgtcgg 51
              ||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 147675 gcgccgtgcatcgtcttcatcgacgagatcgacgccgtcgg 147715



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                                   
Query: 11      gcgccctgcatcgtcttcatcgacgagattgacgcc 46
               ||||||||||||||||||||||||||||| ||||||
Sbjct: 2726559 gcgccctgcatcgtcttcatcgacgagatcgacgcc 2726524



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                   
Query: 84     acgatgagagggagcagaccattaaccagctgctcacggagatggacggcttc 136
              |||| ||| ||||||||||  | |||||||||||||| |||||||||||||||
Sbjct: 147751 acgacgagcgggagcagacgctgaaccagctgctcaccgagatggacggcttc 147803



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                           
Query: 93      gggagcagaccattaaccagctgctcacggagatggacggcttc 136
               ||||||||||||| |||||||||||   ||||||||||||||||
Sbjct: 2726477 gggagcagaccatcaaccagctgctggtggagatggacggcttc 2726434



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                                 
Query: 12      cgccctgcatcgtcttcatcgacgagattgacgc 45
               ||||||||||||| |||||||||||||| |||||
Sbjct: 3408997 cgccctgcatcgtgttcatcgacgagatcgacgc 3408964



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                   
Query: 98      cagaccattaaccagctgctcacggagatggacggc 133
               |||||| | |||||||||||||| ||||||||||||
Sbjct: 1782371 cagaccctcaaccagctgctcaccgagatggacggc 1782406



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                      
Query: 84      acgatgagagggagcagaccattaaccagctgctcacggagatggacggcttctc 138
               |||| ||| ||||||||||  | |||||||||||   ||||||||||||||||||
Sbjct: 3408925 acgacgagcgggagcagacgctgaaccagctgctggtggagatggacggcttctc 3408871



to top

>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome
          Length = 2932766

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 95/116 (81%)
 Strand = Plus / Minus

                                                                        
Query: 14   ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 73
            |||||||||||||||||||||||||| ||||| || ||  ||||||| || ||||| || 
Sbjct: 4365 ccctgcatcgtcttcatcgacgagatcgacgcggtgggccggcagcggggagcgggcatt 4306

                                                                    
Query: 74   ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatgga 129
            || || || ||||| ||| | ||||| ||| | |||||| |||| ||||| |||||
Sbjct: 4305 ggcggcggcaacgacgagcgcgagcaaaccctgaaccagttgcttacggaaatgga 4250



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 97/122 (79%)
 Strand = Plus / Plus

                                                                           
Query: 14      ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 73
               ||||| || |||||||||||||| || || ||||| ||  ||||||| || || ||  | 
Sbjct: 2770316 ccctgtattgtcttcatcgacgaaatcgatgccgtgggtcggcagcggggagccggccta 2770375

                                                                           
Query: 74      ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggc 133
               || || || ||||| ||| ||||||| ||| | |||||| |||| || ||||||||||||
Sbjct: 2770376 ggaggtggcaacgacgagcgggagcaaaccctgaaccagttgctgaccgagatggacggc 2770435

                 
Query: 134     tt 135
               ||
Sbjct: 2770436 tt 2770437



to top

>gb|CP000097.1| Synechococcus sp. CC9902, complete genome
          Length = 2234828

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                          
Query: 512     gtggcttaccatgaggctggacatgccctcgtcggtgccctgatgcctgaatatgaccc 570
               |||||||| || ||||| || ||||||||||||||||| ||||||||||| || |||||
Sbjct: 1951862 gtggcttatcacgaggcaggccatgccctcgtcggtgctctgatgcctgattacgaccc 1951804



to top

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 100/123 (81%)
 Strand = Plus / Minus

                                                                           
Query: 14      ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 73
               ||||||||||| ||||||||||| || ||||| |||||  | ||||| || || || || 
Sbjct: 2732118 ccctgcatcgtgttcatcgacgaaatcgacgcggtcggccgccagcgcggcgccggtatc 2732059

                                                                           
Query: 74      ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggc 133
               || || || ||||| ||| | ||||||||| | ||||||||||||   ||||||||||||
Sbjct: 2732058 ggcggcggcaacgacgagcgcgagcagaccctcaaccagctgctcgtcgagatggacggc 2731999

                  
Query: 134     ttc 136
               |||
Sbjct: 2731998 ttc 2731996



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 100/123 (81%)
 Strand = Plus / Minus

                                                                           
Query: 14      ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 73
               ||||||||||| ||||||||||| || ||||| |||||  | ||||| ||||| ||  ||
Sbjct: 2038664 ccctgcatcgtgttcatcgacgaaatcgacgcggtcggccgccagcgcggtgccggcctg 2038605

                                                                           
Query: 74      ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggc 133
               || || || ||||| ||| | ||||||||| | |||||| |||||   ||||||||||||
Sbjct: 2038604 ggcggcggcaacgacgagcgcgagcagaccctcaaccagttgctcgtcgagatggacggc 2038545

                  
Query: 134     ttc 136
               |||
Sbjct: 2038544 ttc 2038542



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 19      catcgtcttcatcgacgagattgacgcc 46
               |||||||||||||||||| || ||||||
Sbjct: 2805382 catcgtcttcatcgacgaaatcgacgcc 2805409



to top

>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome
          Length = 2467205

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                     
Query: 11      gcgccctgcatcgtcttcatcgacgagattgacgccgt 48
               ||||||||||||||||||||||||||||| || |||||
Sbjct: 2185113 gcgccctgcatcgtcttcatcgacgagatcgatgccgt 2185076



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                     
Query: 11      gcgccctgcatcgtcttcatcgacgagattgacgccgt 48
               ||||||||||||||||||||||||||||| || |||||
Sbjct: 1945176 gcgccctgcatcgtcttcatcgacgagatcgatgccgt 1945213



to top

>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 101/125 (80%)
 Strand = Plus / Minus

                                                                           
Query: 11      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 70
               |||||||||||| ||||||||||||| || || || |||||  | || |||||||| || 
Sbjct: 5066191 gcgccctgcatcatcttcatcgacgaaatcgatgcggtcggtcgtcatcgtggtgccggc 5066132

                                                                           
Query: 71      atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 130
               |||||||| ||  |||| ||| | ||||||||| | |||||| ||||    |||||||||
Sbjct: 5066131 atgggtggtggtcacgacgagcgcgagcagaccctcaaccagttgctggtagagatggac 5066072

                    
Query: 131     ggctt 135
               |||||
Sbjct: 5066071 ggctt 5066067



to top

>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome
          Length = 2462499

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 101/125 (80%)
 Strand = Plus / Plus

                                                                          
Query: 12     cgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaa 71
              |||| |||||| ||||| |||||||||| ||||| |||||  | |||||||| || || |
Sbjct: 342159 cgccgtgcatcatcttcgtcgacgagatcgacgcggtcggccgtcagcgtggcgccggca 342218

                                                                          
Query: 72     tgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacg 131
              |||| || ||  |||| ||| | ||||||||| | |||||||||||   ||| |||||||
Sbjct: 342219 tgggcggcggccacgacgagcgtgagcagaccctgaaccagctgctggtggaaatggacg 342278

                   
Query: 132    gcttc 136
              |||||
Sbjct: 342279 gcttc 342283



to top

>gb|AE005986.1| Caulobacter crescentus CB15 section 312 of 359 of the complete genome
          Length = 14149

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 101/125 (80%)
 Strand = Plus / Minus

                                                                         
Query: 11    gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 70
             |||||||||||| ||||||||||||| || |||||||| ||  | || ||||| ||||| 
Sbjct: 13345 gcgccctgcatcatcttcatcgacgaaatcgacgccgtgggtcgccatcgtggcgcgggc 13286

                                                                         
Query: 71    atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 130
              |||| || || ||||| ||| | ||||||||  | |||||||||||    |||||||||
Sbjct: 13285 ctgggcggcggcaacgacgagcgtgagcagacgctgaaccagctgctggtcgagatggac 13226

                  
Query: 131   ggctt 135
             |||||
Sbjct: 13225 ggctt 13221



to top

>gb|AE006470.1| Chlorobium tepidum TLS, complete genome
          Length = 2154946

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                   
Query: 12     cgccctgcatcgtcttcatcgacgagattgacgccgt 48
              |||||||||||||||||||||| ||||| ||||||||
Sbjct: 308984 cgccctgcatcgtcttcatcgatgagatcgacgccgt 308948



to top

>gb|AE004888.1| Pseudomonas aeruginosa PAO1, section 449 of 529 of the complete genome
          Length = 14623

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                      
Query: 11    gcgccctgcatcgtcttcatcgacgagattgacgccgtcgg 51
             ||||| |||||| |||||||||||||||| |||||||||||
Sbjct: 13759 gcgccgtgcatcatcttcatcgacgagatcgacgccgtcgg 13719



to top

>dbj|AK110158.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-161-F02, full
            insert sequence
          Length = 2830

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 11   gcgccctgcatcgtcttcatcgacgagattgacgccgtcgg 51
            |||||||||||| |||||||||||||||| |||||| ||||
Sbjct: 1525 gcgccctgcatcatcttcatcgacgagatcgacgccatcgg 1565



to top

>gb|AC175197.2| Sporobolomyces roseus clone JGIBAIF-21O18, complete sequence
          Length = 35076

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                             
Query: 20    atcgtcttcatcgacgagattgacgccgtcgg 51
             ||||||||||||||||||||||| ||||||||
Sbjct: 33922 atcgtcttcatcgacgagattgatgccgtcgg 33953



to top

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                           
Query: 8       caggcgccctgcatcgtcttcatcgacgagattgacgccgtcgg 51
               |||||||| |||||||||||||||||||| || ||||| |||||
Sbjct: 1629573 caggcgccgtgcatcgtcttcatcgacgaaatcgacgctgtcgg 1629616



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 197   gcgcttctgcggccagggcg 216
             ||||||||||||||||||||
Sbjct: 94710 gcgcttctgcggccagggcg 94729



to top

>emb|BX569689.1| Synechococcus sp. WH8102 complete genome; segment 1/7
          Length = 348764

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 72/87 (82%)
 Strand = Plus / Plus

                                                                          
Query: 350    accggtgctgatcttcagaacttgatgaatgaggctgccatccttgccgcccgtcgtgat 409
              ||||||||||||||    ||| || ||||||||||||||||||| || |||||||| || 
Sbjct: 303834 accggtgctgatctggccaacctgctgaatgaggctgccatcctggctgcccgtcgcgaa 303893

                                         
Query: 410    ctgaaggagataagcaaggacgagatc 436
              ||||  ||| | ||||| |||||||||
Sbjct: 303894 ctgaccgaggtcagcaacgacgagatc 303920



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 90/113 (79%)
 Strand = Plus / Plus

                                                                          
Query: 17     tgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggt 76
              ||||||||||| |||||||| || || || |||||  | || ||||| || ||  | |||
Sbjct: 303501 tgcatcgtctttatcgacgaaatcgatgctgtcggccgtcaacgtggagcaggccttggt 303560

                                                                   
Query: 77     ggggggaacgatgagagggagcagaccattaaccagctgctcacggagatgga 129
              || || ||||||||| |||| || ||| | |||||||| || |||||||||||
Sbjct: 303561 ggcggtaacgatgagcgggaacaaaccctcaaccagctcctgacggagatgga 303613



to top

>emb|AL939124.1|SCO939124 Streptomyces coelicolor A3(2) complete genome; segment 21/29
          Length = 308050

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                             
Query: 95     gagcagaccattaaccagctgctcacggagatggacggcttctccgg 141
              ||||||||| | |||||| | ||||| ||||||||||||||||||||
Sbjct: 112019 gagcagaccctgaaccagatcctcaccgagatggacggcttctccgg 112065



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                                 
Query: 17     tgcatcgtcttcatcgacgagattgacgccgtcgg 51
              |||||| |||||||||||||||| |||||||||||
Sbjct: 966346 tgcatcatcttcatcgacgagatcgacgccgtcgg 966380



to top

>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                                 
Query: 17     tgcatcgtcttcatcgacgagattgacgccgtcgg 51
              ||||||||||||||||| || ||||||||||||||
Sbjct: 671758 tgcatcgtcttcatcgatgaaattgacgccgtcgg 671792



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                     
Query: 11      gcgccctgcatcgtcttcatcgacgagattgacgccgt 48
               ||||| ||||||||||||||||| ||||| ||||||||
Sbjct: 1325263 gcgccttgcatcgtcttcatcgatgagatcgacgccgt 1325226



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                          
Query: 512     gtggcttaccatgaggctggacatgccctcgtcggtgccctgatgcctgaatatgaccc 570
               ||||||||||| || ||||| || ||| | ||||||||| |||||||||| || |||||
Sbjct: 1324762 gtggcttaccacgaagctggtcacgccttggtcggtgccttgatgcctgactacgaccc 1324704



to top

>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                  
Query: 17      tgcatcgtcttcatcgacgagattgacgccgtcgg 51
               ||||||||||||||||||||||| ||||| |||||
Sbjct: 2225203 tgcatcgtcttcatcgacgagatcgacgcggtcgg 2225169



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                           
Query: 12      cgccctgcatcgtcttcatcgacgagat 39
               |||||||| |||||||||||||||||||
Sbjct: 2877512 cgccctgcgtcgtcttcatcgacgagat 2877539



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 300     tggcgaaggatgtggacttt 319
               ||||||||||||||||||||
Sbjct: 1272758 tggcgaaggatgtggacttt 1272777



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 99/123 (80%)
 Strand = Plus / Plus

                                                                           
Query: 14      ccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatg 73
               ||||||||| |||||||||||||||| ||||| |||||  | || || || || ||  ||
Sbjct: 1722036 ccctgcatcatcttcatcgacgagatcgacgcggtcggtcgccaccgcggcgccggcctg 1722095

                                                                           
Query: 74      ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggc 133
               || || ||  |||| ||| | ||||||||  | ||||||||||||  |||||||||||||
Sbjct: 1722096 ggcggcggccacgacgagcgcgagcagacgctgaaccagctgctcgtggagatggacggc 1722155

                  
Query: 134     ttc 136
               |||
Sbjct: 1722156 ttc 1722158



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                            
Query: 9       aggcgccctgcatcgtcttcatcgacgag 37
               |||||||||||||||| ||||||||||||
Sbjct: 2033052 aggcgccctgcatcgtgttcatcgacgag 2033024



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 107     aaccagctgctcacggagatggacggcttc 136
               |||||||||||| | |||||||||||||||
Sbjct: 2032954 aaccagctgctcgccgagatggacggcttc 2032925



to top

>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                 
Query: 14     ccctgcatcgtcttcatcgacgagattgacgccgt 48
              |||||||| |||||||| |||||||||||||||||
Sbjct: 596407 ccctgcattgtcttcattgacgagattgacgccgt 596373



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 17      tgcatcgtcttcatcgacgagattgacgc 45
               |||||||||||||| ||||| ||||||||
Sbjct: 1034529 tgcatcgtcttcattgacgaaattgacgc 1034501



to top

>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                 
Query: 17     tgcatcgtcttcatcgacgagattgacgccgtcgg 51
              ||||||||||||||||| || ||||||||||||||
Sbjct: 949048 tgcatcgtcttcatcgatgaaattgacgccgtcgg 949014



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                    
Query: 11     gcgccctgcatcgtcttcatcgacgagattgacgccgt 48
              ||||| ||||||||||||||||| ||||| ||||||||
Sbjct: 295619 gcgccttgcatcgtcttcatcgatgagatcgacgccgt 295656



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                         
Query: 512    gtggcttaccatgaggctggacatgccctcgtcggtgccctgatgcctgaatatgaccc 570
              ||||||||||| || ||||| || ||| | ||||||||| |||||||||| || |||||
Sbjct: 296120 gtggcttaccacgaagctggtcacgccttggtcggtgccttgatgcctgactacgaccc 296178



to top

>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 95/118 (80%)
 Strand = Plus / Minus

                                                                           
Query: 19      catcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggtgg 78
               |||| |||||||||||||||| ||||| |||||  | || || || |||||  | || ||
Sbjct: 2211653 catcatcttcatcgacgagatcgacgcggtcggccgtcaccgcggcgcgggtctcggcgg 2211594

                                                                         
Query: 79      ggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggcttc 136
                ||| |||| ||| | ||||||||  | ||||||||||||  ||||||||||||||||
Sbjct: 2211593 cgggcacgacgagcgcgagcagacgctcaaccagctgctcgtggagatggacggcttc 2211536



to top

>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 89/110 (80%)
 Strand = Plus / Minus

                                                                           
Query: 8       caggcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcg 67
               ||||| ||||||||||| ||||||||||| || ||||| |||||  | || ||||| || 
Sbjct: 2397289 caggccccctgcatcgtgttcatcgacgaaatcgacgcggtcggccgccatcgtggcgcc 2397230

                                                                 
Query: 68      ggaatgggtggggggaacgatgagagggagcagaccattaaccagctgct 117
               || ||||| || || ||||| ||| | ||||||||| | |||||| ||||
Sbjct: 2397229 ggcatgggcggcggtaacgacgagcgcgagcagaccctgaaccagatgct 2397180



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 19      catcgtcttcatcgacgagatt 40
               ||||||||||||||||||||||
Sbjct: 2134320 catcgtcttcatcgacgagatt 2134299



to top

>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Plus

                                                                           
Query: 11      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 70
               ||||| |||||| |||||||||||||||| || || |||||  | |||||||| || || 
Sbjct: 2857347 gcgccatgcatcatcttcatcgacgagatcgatgctgtcggacgtcagcgtggcgcaggc 2857406

                                                                           
Query: 71      atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 130
               ||||| || || ||||| ||| | || |||||  | |||||| |||||   |||||||||
Sbjct: 2857407 atggggggcggcaacgacgagcgcgaacagactctcaaccagttgctcgtcgagatggac 2857466

                     
Query: 131     ggcttc 136
               ||||||
Sbjct: 2857467 ggcttc 2857472



to top

>emb|BX248359.1| Corynebacterium diphtheriae gravis NCTC13129, complete genome; segment
              6/8
          Length = 349895

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 14     ccctgcatcgtcttcatcgacgagattgacgccgtcgg 51
              ||||||||| |||||||||||||||| ||||| |||||
Sbjct: 315307 ccctgcatcatcttcatcgacgagatcgacgcagtcgg 315270



to top

>emb|AL162754.2|NMA3Z2491 Neisseria meningitidis serogroup A strain Z2491 complete genome; segment
              3/7
          Length = 311321

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 14     ccctgcatcgtcttcatcgacgagattgacgccgtcgg 51
              ||||||||| |||| ||||||||||||||||| |||||
Sbjct: 282898 ccctgcatcatctttatcgacgagattgacgcagtcgg 282861



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                     
Query: 14      ccctgcatcgtcttcatcgacgagattgacgccgtcgg 51
               ||||||||| |||||||||||||||| ||||| |||||
Sbjct: 3473974 ccctgcatcatcttcatcgacgagatcgacgcggtcgg 3473937



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 18      gcatcgtcttcatcgacgagat 39
               ||||||||||||||||||||||
Sbjct: 4948172 gcatcgtcttcatcgacgagat 4948193



to top

>gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome
          Length = 2628784

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Plus

                                                                          
Query: 12     cgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaa 71
              ||||||| ||||| || || ||||||||||| ||||||||  | ||||| ||||| ||  
Sbjct: 104118 cgccctgtatcgtttttattgacgagattgatgccgtcggccgccagcgaggtgccggcc 104177

                                                            
Query: 72     tgggtggggggaacgatgagagggagcagaccattaaccagctgct 117
              |||| || ||  |||||||| | ||||||||| | |||||||||||
Sbjct: 104178 tgggcggcggccacgatgagcgcgagcagaccctgaaccagctgct 104223



to top

>gb|AE002098.2| Neisseria meningitidis MC58, complete genome
          Length = 2272360

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 14     ccctgcatcgtcttcatcgacgagattgacgccgtcgg 51
              ||||||||| |||| ||||||||||||||||| |||||
Sbjct: 825214 ccctgcatcatctttatcgacgagattgacgcagtcgg 825177



to top

>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome
          Length = 3304561

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                           
Query: 153     tcatcgtgctcgccgcgaccaacaggccggatgtgcttgactccgcgcttctgcggccag 212
               |||||||| |||||||||||||| | || || ||||| ||  ||||||| |||||||| |
Sbjct: 1984109 tcatcgtgatcgccgcgaccaaccgccccgacgtgctcgatcccgcgctgctgcggccgg 1984050

                         
Query: 213     ggcggttcga 222
               | ||||||||
Sbjct: 1984049 gccggttcga 1984040



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                        
Query: 95     gagcagaccattaaccagctgctcacggagatggacggcttc 136
              ||||||||| | ||||||||||| || |||||||||||||||
Sbjct: 897514 gagcagaccctcaaccagctgctgaccgagatggacggcttc 897473



to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                         
Query: 11      gcgccctgcatcgtcttcatcgacgagattgacgccgtcggg 52
               |||||||||||| ||||||||||||| || ||||| ||||||
Sbjct: 3121041 gcgccctgcatcatcttcatcgacgaaatcgacgcggtcggg 3121000



to top

>emb|BX014465.1|CNS08JBP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA21DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 105 ttaaccagctgctcacggagatggacggc 133
           ||||||||||||| |||||||||||||||
Sbjct: 675 ttaaccagctgctgacggagatggacggc 647



to top

>emb|BX014464.1|CNS08JBO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 105 ttaaccagctgctcacggagatggacggc 133
           ||||||||||||| |||||||||||||||
Sbjct: 807 ttaaccagctgctgacggagatggacggc 835



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                        
Query: 11      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgg 51
               |||||||||||| ||||||||||||| || ||||| |||||
Sbjct: 5308477 gcgccctgcatcatcttcatcgacgaaatcgacgcggtcgg 5308437



to top

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                        
Query: 11      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgg 51
               |||||||||||| ||||||||||||| || || ||||||||
Sbjct: 3644051 gcgccctgcatcatcttcatcgacgaaatcgatgccgtcgg 3644011



to top

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 82/101 (81%)
 Strand = Plus / Plus

                                                                          
Query: 17     tgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggt 76
              |||||| |||||||||||||||| || ||||||||  | || ||||| || || ||||||
Sbjct: 817666 tgcatcatcttcatcgacgagatcgatgccgtcggtcgtcaccgtggcgccggcatgggt 817725

                                                       
Query: 77     ggggggaacgatgagagggagcagaccattaaccagctgct 117
              || ||  |||| ||| | ||||||||| | |||||| ||||
Sbjct: 817726 ggcggtcacgacgagcgcgagcagaccctgaaccagttgct 817766



to top

>gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome
          Length = 3184243

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                          
Query: 26     ttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggtggggggaac 85
              |||||||||||||| ||||| |||||| | |||||||| |||||  | ||||| || |||
Sbjct: 540913 ttcatcgacgagatcgacgcggtcgggcgtcagcgtggcgcgggtctcggtggtggaaac 540972

                   
Query: 86     gatga 90
              |||||
Sbjct: 540973 gatga 540977



to top

>gb|AE010377.1| Methanopyrus kandleri AV19 section 76 of 157 of the complete genome
          Length = 4406

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 109  ccagctgctcacggagatggacggcttc 136
            |||||||||| |||||||||||||||||
Sbjct: 3935 ccagctgctcgcggagatggacggcttc 3962



to top

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
              sequence
          Length = 1507550

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                  
Query: 18     gcatcgtcttcatcgacgagattgacgccgtcggga 53
              |||||||||||||||| |||||||| ||| ||||||
Sbjct: 858760 gcatcgtcttcatcgatgagattgatgccatcggga 858795



to top

>gb|AF037269.1| Mycobacterium smegmatis cell division protein (FtsH) gene, complete
           cds
          Length = 2364

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 96/120 (80%)
 Strand = Plus / Plus

                                                                       
Query: 17  tgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggt 76
           |||||| ||||| |||||||||| |||||||||||  | ||||| || |||||  | || 
Sbjct: 769 tgcatcatcttcgtcgacgagatcgacgccgtcggccgtcagcgcggggcgggcctcggc 828

                                                                       
Query: 77  ggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggcttc 136
           || ||  |||| ||| | ||||||||| | |||||||||||    |||||||||||||||
Sbjct: 829 ggtggtcacgacgagcgcgagcagaccctgaaccagctgctggtcgagatggacggcttc 888



to top

>gb|AY540192.1| Oreochromis mossambicus proteasome 26S ATPase subunit 1 mRNA,
           partial cds
          Length = 770

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 20  atcgtcttcatcgacgagattgacgccgtcgg 51
           |||||||||||||| |||||||||||| ||||
Sbjct: 358 atcgtcttcatcgatgagattgacgccatcgg 389



to top

>ref|XM_570849.1| Cryptococcus neoformans var. neoformans JEC21 endopeptidase
           (CNE03020) partial mRNA
          Length = 1436

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 18  gcatcgtcttcatcgacgagattgacgccgtcggga 53
           |||||||||||||||| |||||||| ||| ||||||
Sbjct: 897 gcatcgtcttcatcgatgagattgatgccatcggga 932



to top

>emb|CR727756.2|CNS0GOHE Tetraodon nigroviridis full-length cDNA
          Length = 1397

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 11  gcgccctgcatcgtcttcatcgacgagattgacgcc 46
           ||||||| |||||| ||||| |||||||||||||||
Sbjct: 778 gcgccctccatcgttttcattgacgagattgacgcc 813



to top

>emb|CR719511.2|CNS0GI4D Tetraodon nigroviridis full-length cDNA
          Length = 1483

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 11  gcgccctgcatcgtcttcatcgacgagattgacgcc 46
           ||||||| |||||| ||||| |||||||||||||||
Sbjct: 831 gcgccctccatcgttttcattgacgagattgacgcc 866



to top

>emb|CR708630.2|CNS0G9QA Tetraodon nigroviridis full-length cDNA
          Length = 748

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 11  gcgccctgcatcgtcttcatcgacgagattgacgcc 46
           ||||||| |||||| ||||| |||||||||||||||
Sbjct: 103 gcgccctccatcgttttcattgacgagattgacgcc 138



to top

>emb|CR695652.2|CNS0FZPS Tetraodon nigroviridis full-length cDNA
          Length = 1333

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 11  gcgccctgcatcgtcttcatcgacgagattgacgcc 46
           ||||||| |||||| ||||| |||||||||||||||
Sbjct: 696 gcgccctccatcgttttcattgacgagattgacgcc 731



to top

>emb|CR689180.2|CNS0FUQ0 Tetraodon nigroviridis full-length cDNA
          Length = 1478

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 11  gcgccctgcatcgtcttcatcgacgagattgacgcc 46
           ||||||| |||||| ||||| |||||||||||||||
Sbjct: 831 gcgccctccatcgttttcattgacgagattgacgcc 866



to top

>emb|CR661563.2|CNS0F9FL Tetraodon nigroviridis full-length cDNA
          Length = 832

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 11  gcgccctgcatcgtcttcatcgacgagattgacgcc 46
           ||||||| |||||| ||||| |||||||||||||||
Sbjct: 184 gcgccctccatcgttttcattgacgagattgacgcc 219



to top

>emb|CR650415.2|CNS0F0TX Tetraodon nigroviridis full-length cDNA
          Length = 1469

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 11  gcgccctgcatcgtcttcatcgacgagattgacgcc 46
           ||||||| |||||| ||||| |||||||||||||||
Sbjct: 830 gcgccctccatcgttttcattgacgagattgacgcc 865



to top

>emb|CR649796.2|CNS0F0CQ Tetraodon nigroviridis full-length cDNA
          Length = 1461

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 11  gcgccctgcatcgtcttcatcgacgagattgacgcc 46
           ||||||| |||||| ||||| |||||||||||||||
Sbjct: 829 gcgccctccatcgttttcattgacgagattgacgcc 864



to top

>emb|CR646015.2|CNS0EXFP Tetraodon nigroviridis full-length cDNA
          Length = 1507

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 11  gcgccctgcatcgtcttcatcgacgagattgacgcc 46
           ||||||| |||||| ||||| |||||||||||||||
Sbjct: 868 gcgccctccatcgttttcattgacgagattgacgcc 903



to top

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                       
Query: 12      cgccctgcatcgtcttcatcgacgagattgacgccgtcgg 51
               ||||||||||| ||||||||||||| || ||||| |||||
Sbjct: 3857995 cgccctgcatcatcttcatcgacgaaatcgacgcggtcgg 3857956



to top

>gb|BC044464.1| Danio rerio nuclear VCP-like, mRNA (cDNA clone MGC:55732
            IMAGE:3816242), complete cds
          Length = 2657

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                
Query: 11   gcgccctgcatcgtcttcatcgacgagattgacgcc 46
            |||||||||||| |||||||||| ||||| ||||||
Sbjct: 1083 gcgccctgcatcctcttcatcgatgagatcgacgcc 1118



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 110  cagctgctcacggagatggacgg 132
            |||||||||||||||||||||||
Sbjct: 2055 cagctgctcacggagatggacgg 2077



to top

>ref|NM_213484.1| Danio rerio nuclear VCP-like (nvl), mRNA
          Length = 2657

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                
Query: 11   gcgccctgcatcgtcttcatcgacgagattgacgcc 46
            |||||||||||| |||||||||| ||||| ||||||
Sbjct: 1083 gcgccctgcatcctcttcatcgatgagatcgacgcc 1118



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 110  cagctgctcacggagatggacgg 132
            |||||||||||||||||||||||
Sbjct: 2055 cagctgctcacggagatggacgg 2077



to top

>dbj|AB236774.1| Trifolium pratense RNA for putative zinc dependent protease, complete
            cds, clone: C1597
          Length = 2290

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 68   ggaatgggtggggggaacgatgagagggagcagaccattaacca 111
            ||||| ||||| ||||||||||| ||||| |||||| |||||||
Sbjct: 1034 ggaattggtggagggaacgatgaaagggaacagacccttaacca 1077



to top

>gb|AF319040.1|AF319040 Leishmania donovani ATP-dependent zinc metallopeptidase-like
           protein gene, complete cds
          Length = 1797

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 24  tcttcatcgacgagattgacgccgtcgg 51
           |||||||||||||||| |||||||||||
Sbjct: 638 tcttcatcgacgagatcgacgccgtcgg 665



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 14      ccctgcatcgtcttcatcgacgagattgacgccgt 48
               ||||| ||||| |||||||||||||| ||||||||
Sbjct: 3317002 ccctgtatcgtgttcatcgacgagatcgacgccgt 3316968



to top

>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 17      tgcatcgtcttcatcgacgagattgacgccgtcgg 51
               |||||| |||||||||||||||| ||||| |||||
Sbjct: 2105156 tgcatcatcttcatcgacgagatcgacgctgtcgg 2105122



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                           
Query: 93      gggagcagaccattaaccagctgctcacggagatggacggcttc 136
               ||||||||||| | || ||||| ||| |||||||||| ||||||
Sbjct: 2704041 gggagcagaccctgaatcagcttctctcggagatggatggcttc 2703998



to top

>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome
          Length = 2364842

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 17      tgcatcgtcttcatcgacgagat 39
               |||||||||||||||||||||||
Sbjct: 1930904 tgcatcgtcttcatcgacgagat 1930926



to top

>ref|XM_482385.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2547

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 107  aaccagctgctcacggagatggacggc 133
            |||||||||||||| ||||||||||||
Sbjct: 1840 aaccagctgctcaccgagatggacggc 1866



to top

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 17      tgcatcgtcttcatcgacgagattgacgccgtcgg 51
               |||||| ||||| |||||||||| |||||||||||
Sbjct: 4044245 tgcatcatcttcgtcgacgagatcgacgccgtcgg 4044211



to top

>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 17      tgcatcgtcttcatcgacgagattgacgccgtcgg 51
               |||||||||||||||||||| || ||||| |||||
Sbjct: 1676431 tgcatcgtcttcatcgacgaaatcgacgcggtcgg 1676465



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 159    tgctcgccgcgaccaacaggc 179
              |||||||||||||||||||||
Sbjct: 145980 tgctcgccgcgaccaacaggc 146000



to top

>gb|AE009302.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 72 of
            187 of the complete sequence
          Length = 10906

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                        
Query: 162  tcgccgcgaccaacaggccggatgtgcttgactccgcgcttctgcggccagggcggttcg 221
            ||||||| |||||| | || ||||| |||||| ||||||||||||| || || || ||||
Sbjct: 2702 tcgccgctaccaaccgtcctgatgttcttgaccccgcgcttctgcgtcccggccgtttcg 2643

                       
Query: 222  atcggcaggtc 232
            | || ||||||
Sbjct: 2642 accgtcaggtc 2632



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 14   ccctgcatcgtcttcatcgacgagattgacgccgtcgg 51
            ||||| ||| ||||||||||||| || |||||||||||
Sbjct: 2850 ccctgtatcatcttcatcgacgaaatcgacgccgtcgg 2813



to top

>gb|AE008312.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 116 of
            187 of the complete sequence
          Length = 11049

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                        
Query: 162  tcgccgcgaccaacaggccggatgtgcttgactccgcgcttctgcggccagggcggttcg 221
            ||||||| |||||| | || ||||| |||||| ||||||||||||| || || || ||||
Sbjct: 4241 tcgccgctaccaaccgtcctgatgttcttgaccccgcgcttctgcgtcccggccgtttcg 4300

                       
Query: 222  atcggcaggtc 232
            | || ||||||
Sbjct: 4301 accgtcaggtc 4311



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 14   ccctgcatcgtcttcatcgacgagattgacgccgtcgg 51
            ||||| ||| ||||||||||||| || |||||||||||
Sbjct: 4093 ccctgtatcatcttcatcgacgaaatcgacgccgtcgg 4130



to top

>ref|XM_765222.1| Giardia lamblia ATCC 50803 AAA ATPase (GLP_80_61971_63335) partial
           mRNA
          Length = 1365

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 24  tcttcatcgacgagattgacgcc 46
           |||||||||||||||||||||||
Sbjct: 752 tcttcatcgacgagattgacgcc 774



to top

>ref|XM_766189.1| Giardia lamblia ATCC 50803 AAA ATPase (GLP_306_32875_31316) partial
           mRNA
          Length = 1560

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 24  tcttcatcgacgagattgacgcc 46
           |||||||||||||||||||||||
Sbjct: 767 tcttcatcgacgagattgacgcc 789



to top

>ref|XM_782306.1| PREDICTED: Strongylocentrotus purpuratus similar to YME1-like 1
           isoform 1 (LOC582354), mRNA
          Length = 2071

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 327 ttgccagaaggacacctggtttcaccggtgctgatcttcagaa 369
           |||||||| |||||  ||||||||| || ||||||||||||||
Sbjct: 620 ttgccagagggacagttggtttcacaggggctgatcttcagaa 662



to top

>emb|Z83338.1|MTZ83338 M.tuberculosis H37Ra ftsH gene, partial
          Length = 363

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 17  tgcatcgtcttcatcgacgagattgacgccgtcgg 51
           |||||| ||||| |||||||||| |||||||||||
Sbjct: 163 tgcatcatcttcgtcgacgagatcgacgccgtcgg 197



to top

>emb|BX842583.1| Mycobacterium tuberculosis H37Rv complete genome; segment 12/13
          Length = 349606

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 17     tgcatcgtcttcatcgacgagattgacgccgtcgg 51
              |||||| ||||| |||||||||| |||||||||||
Sbjct: 234939 tgcatcatcttcgtcgacgagatcgacgccgtcgg 234905



to top

>emb|BX572092.1| Prochlorococcus marinus MED4 complete genome; segment 3/5
          Length = 348178

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 327  ttgccagaaggacacctggtttcaccggtgctgat 361
            |||| ||||||||||||||||| ||||| ||||||
Sbjct: 5936 ttgcaagaaggacacctggttttaccggagctgat 5902



to top

>emb|BX248346.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 13/14
          Length = 316050

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 17     tgcatcgtcttcatcgacgagattgacgccgtcgg 51
              |||||| ||||| |||||||||| |||||||||||
Sbjct: 244356 tgcatcatcttcgtcgacgagatcgacgccgtcgg 244322



to top

>gb|AF456414.1| Giardia intestinalis endosomal AAA ATPase-like protein (VPS4) gene,
           complete cds
          Length = 1594

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 24  tcttcatcgacgagattgacgcc 46
           |||||||||||||||||||||||
Sbjct: 854 tcttcatcgacgagattgacgcc 876



to top

>ref|XM_697576.1| PREDICTED: Danio rerio hypothetical protein LOC554702 (LOC554702),
            mRNA
          Length = 2640

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 110  cagctgctcacggagatggacgg 132
            |||||||||||||||||||||||
Sbjct: 2055 cagctgctcacggagatggacgg 2077



to top

>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome
          Length = 3561584

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 17    tgcatcgtcttcatcgacgagattgacgccgtcgg 51
             |||||||||||||||||||| || ||||| |||||
Sbjct: 78813 tgcatcgtcttcatcgacgaaatcgacgcggtcgg 78779



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 107      aaccagctgctcacggagatggacggc 133
                |||||||||||||| ||||||||||||
Sbjct: 19750542 aaccagctgctcaccgagatggacggc 19750516



to top

>dbj|BA000002.2| Aeropyrum pernix K1 DNA, complete genome
          Length = 1669695

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 24      tcttcatcgacgagattgacgcc 46
               |||||||||||||||||||||||
Sbjct: 1574505 tcttcatcgacgagattgacgcc 1574483



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 24     tcttcatcgacgagattgacgc 45
              ||||||||||||||||||||||
Sbjct: 870483 tcttcatcgacgagattgacgc 870504



to top

>gb|AE005094.1| Halobacterium sp. NRC-1 section 125 of 170 of the complete genome
          Length = 15065

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 24   tcttcatcgacgagattgacgccgtcg 50
            |||||||||||||||| ||||||||||
Sbjct: 7822 tcttcatcgacgagatcgacgccgtcg 7796



to top

>dbj|AP005158.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBa0007M04
          Length = 176293

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 107   aaccagctgctcacggagatggacggc 133
             |||||||||||||| ||||||||||||
Sbjct: 79493 aaccagctgctcaccgagatggacggc 79467



to top

>ref|XM_316268.2| Anopheles gambiae str. PEST ENSANGP00000020514
           (ENSANGG00000018025), mRNA
          Length = 1456

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 107 aaccagctgctcacggagatggacggc 133
           ||||||||||| |||||||||||||||
Sbjct: 808 aaccagctgctgacggagatggacggc 834



to top

>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome
          Length = 3551823

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                      
Query: 14      ccctgcatcgtcttcatcgacgagattgacgccgtcggg 52
               ||||||||| |||||||||||||| | |||||| |||||
Sbjct: 1313170 ccctgcatcatcttcatcgacgaggtggacgccatcggg 1313208



to top

>gb|AE010343.1| Methanopyrus kandleri AV19 section 42 of 157 of the complete genome
          Length = 7856

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 107  aaccagctgctcacggagatggacgg 132
            ||||||||||| ||||||||||||||
Sbjct: 3294 aaccagctgctgacggagatggacgg 3319



to top

>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence
          Length = 2107794

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 18      gcatcgtcttcatcgacgagattgac 43
               |||||||||||||||| |||||||||
Sbjct: 2003943 gcatcgtcttcatcgatgagattgac 2003918



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 100/126 (79%)
 Strand = Plus / Plus

                                                                          
Query: 11     gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 70
              ||||| |||||||| ||||||||||| || ||||| |||||  | || || || || || 
Sbjct: 810499 gcgccttgcatcgtgttcatcgacgaaatcgacgcggtcggccgtcatcgcggcgccggc 810558

                                                                          
Query: 71     atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 130
              ||||| || || ||||| ||| | ||||||||  | |||||| |||||   |||||||||
Sbjct: 810559 atgggcggcggcaacgacgagcgcgagcagacgctgaaccagatgctcgtcgagatggac 810618

                    
Query: 131    ggcttc 136
              ||||||
Sbjct: 810619 ggcttc 810624



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 20      atcgtcttcatcgacgagat 39
               ||||||||||||||||||||
Sbjct: 1435767 atcgtcttcatcgacgagat 1435748



to top

>gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome
          Length = 2560265

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 94/118 (79%)
 Strand = Plus / Plus

                                                                          
Query: 19     catcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcgggaatgggtgg 78
              |||| ||||||| || ||||||||||| || ||  | || |||||||| || ||||| ||
Sbjct: 314186 catcatcttcattgatgagattgacgctgttggtcgtcatcgtggtgccggtatgggcgg 314245

                                                                        
Query: 79     ggggaacgatgagagggagcagaccattaaccagctgctcacggagatggacggcttc 136
               ||  |||| ||| | ||||||||| | |||||| |||||   |||||||||||||||
Sbjct: 314246 tggccacgacgagcgtgagcagaccttgaaccagttgctcgttgagatggacggcttc 314303



to top

>ref|XM_359584.1| Magnaporthe grisea 70-15 hypothetical protein (MG05193.4) partial
            mRNA
          Length = 2463

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 107  aaccagctgctcacggagatggacgg 132
            ||||||||||| ||||||||||||||
Sbjct: 1861 aaccagctgctgacggagatggacgg 1886



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 100/126 (79%)
 Strand = Plus / Plus

                                                                           
Query: 11      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 70
               ||||| |||||||| ||||||||||| || ||||| |||||  | || || || || || 
Sbjct: 1697218 gcgccttgcatcgtgttcatcgacgaaatcgacgcggtcggccgtcatcgcggcgccggc 1697277

                                                                           
Query: 71      atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 130
               ||||| || || ||||| ||| | ||||||||  | |||||| |||||   |||||||||
Sbjct: 1697278 atgggcggcggcaacgacgagcgcgagcagacgctgaaccagatgctcgtcgagatggac 1697337

                     
Query: 131     ggcttc 136
               ||||||
Sbjct: 1697338 ggcttc 1697343



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 20      atcgtcttcatcgacgagat 39
               ||||||||||||||||||||
Sbjct: 2661898 atcgtcttcatcgacgagat 2661879



to top

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 11      gcgccctgcatcgtcttcatcgacga 36
               |||||||||||| |||||||||||||
Sbjct: 2944763 gcgccctgcatcatcttcatcgacga 2944738



to top

>emb|AL591791.1|SME591791 Sinorhizobium meliloti 1021 complete chromosome; segment 10/12
          Length = 340900

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 11     gcgccctgcatcgtcttcatcgacga 36
              |||||||||||| |||||||||||||
Sbjct: 237622 gcgccctgcatcatcttcatcgacga 237597



to top

>emb|AJ243808.1|BJA243808 Bradyrhizobium japonicum yaeN and ftsH genes
          Length = 3715

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 14   ccctgcatcgtcttcatcgacgagattgacgccgtcgg 51
            ||||||||| ||||||||||||| || ||||| |||||
Sbjct: 2188 ccctgcatcatcttcatcgacgaaatcgacgctgtcgg 2225



to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 100/126 (79%)
 Strand = Plus / Minus

                                                                           
Query: 11      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 70
               ||||| |||||| ||||||||||||| || ||||| |||||  | || ||||| || || 
Sbjct: 4610905 gcgccgtgcatcatcttcatcgacgaaatcgacgcggtcggccgtcatcgtggcgccggt 4610846

                                                                           
Query: 71      atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 130
                | || || || ||||| ||| | ||||||||| | |||||||||||    |||||||||
Sbjct: 4610845 cttggcggcggtaacgacgagcgcgagcagaccctcaaccagctgctggtcgagatggac 4610786

                     
Query: 131     ggcttc 136
               ||||||
Sbjct: 4610785 ggcttc 4610780



to top

>emb|BX572090.1| Prochlorococcus marinus MED4 complete genome; segment 1/5
          Length = 349742

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                    
Query: 308    gatgtggactttgataaggttgccagaaggacacctggtttcaccggtgctgat 361
              ||||| ||| ||||||||||||| ||||| || ||||| || || |||||||||
Sbjct: 220557 gatgtagaccttgataaggttgcgagaagaactcctgggtttacaggtgctgat 220504



to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 100/126 (79%)
 Strand = Plus / Plus

                                                                           
Query: 11      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 70
               ||||| |||||||| ||||||||||| || ||||| |||||  | || || || || || 
Sbjct: 1583931 gcgccttgcatcgtgttcatcgacgaaatcgacgcggtcggccgtcatcgcggcgccggc 1583990

                                                                           
Query: 71      atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 130
               ||||| || || ||||| ||| | ||||||||  | |||||| |||||   |||||||||
Sbjct: 1583991 atgggcggcggcaacgacgagcgcgagcagacgctgaaccagatgctcgtcgagatggac 1584050

                     
Query: 131     ggcttc 136
               ||||||
Sbjct: 1584051 ggcttc 1584056



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 20      atcgtcttcatcgacgagat 39
               ||||||||||||||||||||
Sbjct: 1721579 atcgtcttcatcgacgagat 1721598



to top

>emb|BX321857.1| Nitrosomonas europaea ATCC 19718, complete genome; segment 2/10
          Length = 313050

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 14     ccctgcatcgtcttcatcgacgagat 39
              ||||||||| ||||||||||||||||
Sbjct: 262666 ccctgcatcatcttcatcgacgagat 262691



to top

>emb|AL939116.1|SCO939116 Streptomyces coelicolor A3(2) complete genome; segment 13/29
          Length = 293050

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                        
Query: 95     gagcagaccattaaccagctgctcacggagatggacggcttc 136
              ||||||||| | ||||||||||||   |||||||||||||||
Sbjct: 144312 gagcagaccctgaaccagctgctcgtcgagatggacggcttc 144271



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                     
Query: 14      ccctgcatcgtcttcatcgacgagattgacgccgtcgg 51
               ||||||||| ||||||||||||| || ||||| |||||
Sbjct: 2080424 ccctgcatcatcttcatcgacgaaatcgacgcggtcgg 2080461



to top

>dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome
          Length = 2088737

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 107     aaccagctgctcacggagatggacgg 132
               |||||||||||||| |||||||||||
Sbjct: 1016697 aaccagctgctcactgagatggacgg 1016722



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 107    aaccagctgctcacggagatggacgg 132
              |||||||||||||| |||||||||||
Sbjct: 572668 aaccagctgctcaccgagatggacgg 572643



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 26      ttcatcgacgagattgacgcc 46
               |||||||||||||||||||||
Sbjct: 1016625 ttcatcgacgagattgacgcc 1016645



to top

>gb|AE009637.1| Brucella melitensis 16M chromosome I, section 194 of 195 of the
            complete sequence
          Length = 10552

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 18   gcatcgtcttcatcgacgagattgac 43
            |||||||||||||||| |||||||||
Sbjct: 5140 gcatcgtcttcatcgatgagattgac 5165



to top

>gb|AE004918.1| Pseudomonas aeruginosa PAO1, section 479 of 529 of the complete genome
          Length = 11170

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 18    gcatcgtcttcatcgacgagat 39
             ||||||||||||||||||||||
Sbjct: 10501 gcatcgtcttcatcgacgagat 10522



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                     
Query: 14      ccctgcatcgtcttcatcgacgagattgacgccgtcgg 51
               ||||||||| ||||||||||||| || ||||| |||||
Sbjct: 7867517 ccctgcatcatcttcatcgacgaaatcgacgctgtcgg 7867480



to top

>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome
          Length = 6413771

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 8       caggcgccctgcatcgtcttcatcga 33
               ||||| ||||||||||||||||||||
Sbjct: 5893128 caggctccctgcatcgtcttcatcga 5893103



to top

>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence
          Length = 2124241

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 18      gcatcgtcttcatcgacgagattgac 43
               |||||||||||||||| |||||||||
Sbjct: 2020604 gcatcgtcttcatcgatgagattgac 2020579



to top

>dbj|AK110513.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-167-G06, full
            insert sequence
          Length = 4062

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                          
Query: 6    gccaggcgccctgcatcgtcttcatcgacgagattgacgccgtcgg 51
            ||||||||||| ||||| |||| || ||||||||||| ||| ||||
Sbjct: 1455 gccaggcgcccagcatcatctttattgacgagattgatgccatcgg 1500



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 100/126 (79%)
 Strand = Plus / Minus

                                                                           
Query: 11      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcggga 70
               ||||| |||||||| ||||||||||| || ||||| |||||  | || || || || || 
Sbjct: 3189706 gcgccttgcatcgtgttcatcgacgaaatcgacgcggtcggccgtcatcgcggcgccggc 3189647

                                                                           
Query: 71      atgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatggac 130
               ||||| || || ||||| ||| | ||||||||  | |||||| |||||   |||||||||
Sbjct: 3189646 atgggcggcggcaacgacgagcgcgagcagacgctgaaccagatgctcgtcgagatggac 3189587

                     
Query: 131     ggcttc 136
               ||||||
Sbjct: 3189586 ggcttc 3189581



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 20      atcgtcttcatcgacgagatt 40
               |||||||||||||||||||||
Sbjct: 2481065 atcgtcttcatcgacgagatt 2481085



to top

>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence, strain
               2308
          Length = 2121359

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 18      gcatcgtcttcatcgacgagattgac 43
               |||||||||||||||| |||||||||
Sbjct: 2017723 gcatcgtcttcatcgatgagattgac 2017698



to top

>dbj|AB018433.1| Pyrococcus kodakaraensis Pk-cdcA gene, complete cds
          Length = 2880

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 107  aaccagctgctcacggagatggacgg 132
            |||||||||||||| |||||||||||
Sbjct: 2134 aaccagctgctcaccgagatggacgg 2159



to top

>gb|AC002511.1| Homo sapiens chromosome 19 clone PC28130, complete sequence
          Length = 98713

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 508   gcttgtggcttaccatgaggc 528
             |||||||||||||||||||||
Sbjct: 55731 gcttgtggcttaccatgaggc 55711



to top

>gb|DQ214550.1| Taeniopygia guttata clone 0061P0013A02 26S ATPase complex subunit
           4-like mRNA, complete sequence
          Length = 1532

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 19  catcgtcttcatcgacgagat 39
           |||||||||||||||||||||
Sbjct: 873 catcgtcttcatcgacgagat 893



to top

>gb|DQ214549.1| Taeniopygia guttata clone 0063P0013D05 26S ATPase complex subunit
           4-like mRNA, complete sequence
          Length = 1542

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 19  catcgtcttcatcgacgagat 39
           |||||||||||||||||||||
Sbjct: 874 catcgtcttcatcgacgagat 894



to top

>gb|AY639765.1| Hordeum vulgare subsp. spontaneum cultivar PI 560558 FtsH-like
           protein gene, partial cds
          Length = 456

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 398 ggtggtgggaacgatgaaagggagcagac 426



to top

>gb|AY639764.1| Aegilops tauschii cultivar KU2156 FtsH-like protein gene, partial
           cds
          Length = 457

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 402 ggtggtgggaacgatgaaagggagcagac 430



to top

>gb|AY639763.1| Triticum urartu cultivar IG45487 FtsH-like protein gene, partial
           cds
          Length = 455

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 399 ggtggtgggaacgatgaaagggagcagac 427



to top

>gb|AY639762.1| Hordeum vulgare subsp. spontaneum cultivar PI 220341 FtsH-like
           protein gene, partial cds
          Length = 454

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 399 ggtggtgggaacgatgaaagggagcagac 427



to top

>gb|AY639761.1| Aegilops tauschii cultivar KU2160 FtsH-like protein gene, partial
           cds
          Length = 454

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 400 ggtggtgggaacgatgaaagggagcagac 428



to top

>gb|AY639760.1| Aegilops tauschii cultivar KU2065 FtsH-like protein gene, partial
           cds
          Length = 452

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 398 ggtggtgggaacgatgaaagggagcagac 426



to top

>gb|AY639759.1| Triticum monococcum cultivar G4913 FtsH-like protein gene, partial
           cds
          Length = 455

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 402 ggtggtgggaacgatgaaagggagcagac 430



to top

>gb|AY639756.1| Hordeum vulgare subsp. spontaneum cultivar PI 466619 FtsH-like
           protein gene, partial cds
          Length = 454

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 399 ggtggtgggaacgatgaaagggagcagac 427



to top

>gb|AY639755.1| Triticum urartu cultivar IG45633 FtsH-like protein gene, partial
           cds
          Length = 450

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 397 ggtggtgggaacgatgaaagggagcagac 425



to top

>gb|AY639754.1| Hordeum vulgare subsp. spontaneum cultivar PI 560560 FtsH-like
           protein gene, partial cds
          Length = 461

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 403 ggtggtgggaacgatgaaagggagcagac 431



to top

>gb|AY639751.1| Hordeum vulgare subsp. spontaneum cultivar PI 227301 FtsH-like
           protein gene, partial cds
          Length = 455

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 400 ggtggtgggaacgatgaaagggagcagac 428



to top

>gb|AY639750.1| Aegilops tauschii cultivar KU2801 FtsH-like protein gene, partial
           cds
          Length = 455

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 400 ggtggtgggaacgatgaaagggagcagac 428



to top

>gb|AY639749.1| Triticum urartu cultivar IG113243 FtsH-like protein gene, partial
           cds
          Length = 454

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 400 ggtggtgggaacgatgaaagggagcagac 428



to top

>gb|AY639748.1| Hordeum vulgare subsp. spontaneum cultivar PI 466233 FtsH-like
           protein gene, partial cds
          Length = 462

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 402 ggtggtgggaacgatgaaagggagcagac 430



to top

>gb|AY639747.1| Hordeum vulgare subsp. spontaneum cultivar PI 466631 FtsH-like
           protein gene, partial cds
          Length = 454

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 399 ggtggtgggaacgatgaaagggagcagac 427



to top

>gb|AY639746.1| Hordeum vulgare subsp. spontaneum cultivar PI 420915 FtsH-like
           protein gene, partial cds
          Length = 454

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 399 ggtggtgggaacgatgaaagggagcagac 427



to top

>gb|AY639745.1| Hordeum vulgare subsp. spontaneum cultivar PI 254894 FtsH-like
           protein gene, partial cds
          Length = 455

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 398 ggtggtgggaacgatgaaagggagcagac 426



to top

>gb|AY639744.1| Aegilops tauschii cultivar KU2146 FtsH-like protein gene, partial
           cds
          Length = 454

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 399 ggtggtgggaacgatgaaagggagcagac 427



to top

>gb|AY639743.1| Hordeum vulgare subsp. spontaneum cultivar PI 466265 FtsH-like
           protein gene, partial cds
          Length = 458

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 402 ggtggtgggaacgatgaaagggagcagac 430



to top

>gb|AY639742.1| Hordeum vulgare subsp. spontaneum cultivar PI 282591 FtsH-like
           protein gene, partial cds
          Length = 457

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 398 ggtggtgggaacgatgaaagggagcagac 426



to top

>gb|AY639741.1| Triticum urartu cultivar IG45470 FtsH-like protein gene, partial
           cds
          Length = 454

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 400 ggtggtgggaacgatgaaagggagcagac 428



to top

>gb|AY639740.1| Hordeum vulgare subsp. spontaneum cultivar PI 420914 FtsH-like
           protein gene, partial cds
          Length = 458

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 399 ggtggtgggaacgatgaaagggagcagac 427



to top

>gb|AY639739.1| Hordeum vulgare subsp. spontaneum cultivar PI 466529 FtsH-like
           protein gene, partial cds
          Length = 457

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 399 ggtggtgggaacgatgaaagggagcagac 427



to top

>gb|AY639738.1| Hordeum vulgare subsp. spontaneum cultivar PI 466625 FtsH-like
           protein gene, partial cds
          Length = 455

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 398 ggtggtgggaacgatgaaagggagcagac 426



to top

>gb|AY639737.1| Triticum urartu cultivar IG45218 FtsH-like protein gene, partial
           cds
          Length = 452

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 399 ggtggtgggaacgatgaaagggagcagac 427



to top

>gb|AY639735.1| Hordeum vulgare subsp. spontaneum cultivar PI 466252 FtsH-like
           protein gene, partial cds
          Length = 459

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 402 ggtggtgggaacgatgaaagggagcagac 430



to top

>gb|AY639734.1| Aegilops tauschii cultivar KU2030 FtsH-like protein gene, partial
           cds
          Length = 454

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 398 ggtggtgggaacgatgaaagggagcagac 426



to top

>gb|AY639733.1| Lophopyrum elongatum FtsH-like protein gene, partial cds
          Length = 456

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 401 ggtggtgggaacgatgaaagggagcagac 429



to top

>gb|AY639732.1| Hordeum vulgare subsp. spontaneum cultivar PI 466684 FtsH-like
           protein gene, partial cds
          Length = 457

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 74  ggtggggggaacgatgagagggagcagac 102
           ||||| ||||||||||| |||||||||||
Sbjct: 398 ggtggtgggaacgatgaaagggagcagac 426



to top

>ref|XM_751952.1| Ustilago maydis 521 hypothetical protein (UM00898.1) partial mRNA
          Length = 2583

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 11   gcgccctgcatcgtcttcatcgacgagat 39
            |||||||| ||| ||||||||||||||||
Sbjct: 1384 gcgccctgtatcatcttcatcgacgagat 1412



to top

>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence
          Length = 4895836

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                        
Query: 11      gcgccctgcatcgtcttcatcgacgagattgacgccgtcgg 51
               ||||| |||||||| ||||||||||| || ||||| |||||
Sbjct: 3525795 gcgccgtgcatcgtgttcatcgacgaaatcgacgcggtcgg 3525755



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 9       aggcgccctgcatcgtcttcatcgacga 36
               ||||||| ||||||||||| ||||||||
Sbjct: 2827169 aggcgccgtgcatcgtctttatcgacga 2827142



to top

>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence
          Length = 2726152

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 9       aggcgccctgcatcgtcttcatcgacgag 37
               |||| ||||||||| ||||||||||||||
Sbjct: 1940487 aggcaccctgcatcatcttcatcgacgag 1940515



to top

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 102/129 (79%)
 Strand = Plus / Minus

                                                                           
Query: 8       caggcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgcg 67
               |||||||| |||||||| |||||||| || || ||||| || ||  | || ||||| || 
Sbjct: 2394591 caggcgccgtgcatcgtgttcatcgatgaaatcgacgcggtgggccgtcatcgtggcgcc 2394532

                                                                           
Query: 68      ggaatgggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatg 127
               || ||||| || || ||||| ||| | ||||||||| | |||||| ||||    ||||||
Sbjct: 2394531 ggcatgggcggcggcaacgacgagcgcgagcagaccctgaaccagatgctggtcgagatg 2394472

                        
Query: 128     gacggcttc 136
               |||||||||
Sbjct: 2394471 gacggcttc 2394463



to top

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 9       aggcgccctgcatcgtcttcatcgacgag 37
               ||||||| |||||| ||||||||||||||
Sbjct: 1494912 aggcgccgtgcatcatcttcatcgacgag 1494884



to top

>dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, complete genome
          Length = 5727534

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 14      ccctgcatcgtcttcatcgacgagattga 42
               ||||||||||| || ||||||||||||||
Sbjct: 4654830 ccctgcatcgtttttatcgacgagattga 4654802



to top

>dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, complete genome
          Length = 4171146

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                       
Query: 10     ggcgccctgcatcgtcttcatcgacgagattgacgccgtcgggaggcagcgtggtgc 66
              ||||||||||||  |||| ||||| || || |||||||||||| | ||||| |||||
Sbjct: 667209 ggcgccctgcattatctttatcgatgaaatcgacgccgtcgggcgtcagcgcggtgc 667265



to top

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 9       aggcgccctgcatcgtcttcatcgacgag 37
               ||||||| |||||| ||||||||||||||
Sbjct: 1078833 aggcgccgtgcatcatcttcatcgacgag 1078805



to top

>dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete genome
          Length = 2593857

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                       
Query: 518    taccatgaggctggacatgccctcgtcggtgccctgatgcc 558
              ||||||||||| || |||||||| || || |||||||||||
Sbjct: 111477 taccatgaggcgggtcatgcccttgtgggcgccctgatgcc 111437



to top

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 21      tcgtcttcatcgacgagattgacgc 45
               ||||||||||||||||||| |||||
Sbjct: 3127159 tcgtcttcatcgacgagatcgacgc 3127183



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 113     ctgctcacggagatggacggcttc 136
               |||||| |||||||||||||||||
Sbjct: 2821080 ctgctctcggagatggacggcttc 2821103



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 20     atcgtcttcatcgacgagat 39
              ||||||||||||||||||||
Sbjct: 684380 atcgtcttcatcgacgagat 684399



to top

>gb|AE015924.1| Porphyromonas gingivalis W83, complete genome
          Length = 2343476

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 24    tcttcatcgacgagattgacgccgt 48
             |||||||||||||||| ||||||||
Sbjct: 58475 tcttcatcgacgagatcgacgccgt 58451



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 9       aggcgccctgcatcgtcttcatcgacgag 37
               ||||||| |||||| ||||||||||||||
Sbjct: 1547638 aggcgccgtgcatcatcttcatcgacgag 1547666



to top

>ref|NM_115254.3| Arabidopsis thaliana binding / transporter AT3G53940 mRNA, complete
            cds
          Length = 1542

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 469  tgagaagaagaatgcagttg 488
            ||||||||||||||||||||
Sbjct: 1089 tgagaagaagaatgcagttg 1108



to top

>gb|CP000109.1| Thiomicrospira crunogena XCL-2, complete genome
          Length = 2427734

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 59     cgtggtgcgggaatgggtggggggaacgatga 90
              |||||||| ||||||||||| || ||||||||
Sbjct: 884766 cgtggtgccggaatgggtggcggtaacgatga 884797



to top

>ref|XM_511168.1| PREDICTED: Pan troglodytes similar to paraplegin isoform 2; cell
            adhesion regulator; cell matrix adhesion regulator
            (LOC454315), mRNA
          Length = 7059

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 14   ccctgcatcgtcttcatcgacgagattgacgc 45
            ||||||||||||| |||||| ||||| |||||
Sbjct: 2635 ccctgcatcgtctacatcgatgagatcgacgc 2666



to top

>gb|CP000108.1| Chlorobium chlorochromatii CaD3, complete genome
          Length = 2572079

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 182  gatgtgcttgactccgcgcttctgcggccagggcggttcgatcg 225
            ||||||||||| || |||||| |||| |||||||| || |||||
Sbjct: 9289 gatgtgcttgattcggcgcttttgcgtccagggcgttttgatcg 9332



to top

>gb|CP000141.1| Carboxydothermus hydrogenoformans Z-2901, complete genome
          Length = 2401520

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                      
Query: 508    gcttgtggcttaccatgaggctggacatgccctcgtcggt 547
              |||||| |||||||||||||| || |||||| | ||||||
Sbjct: 181273 gcttgtagcttaccatgaggcgggccatgccatggtcggt 181312



to top

>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence
          Length = 1130447

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 113    ctgctcacggagatggacggcttc 136
              |||||||| |||||||||||||||
Sbjct: 100442 ctgctcaccgagatggacggcttc 100465



to top

>gb|BC007692.1| Homo sapiens spastic paraplegia 7, paraplegin (pure and complicated
            autosomal recessive), mRNA (cDNA clone IMAGE:3956605)
          Length = 2310

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 14   ccctgcatcgtcttcatcgacgagattgacgc 45
            ||||||||||||| |||||| ||||| |||||
Sbjct: 1216 ccctgcatcgtctacatcgatgagatcgacgc 1247



to top

>gb|BC071538.1| Danio rerio proteasome (prosome, macropain) 26S subunit, ATPase,
           1b, mRNA (cDNA clone MGC:86923 IMAGE:6905970), complete
           cds
          Length = 1521

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 11  gcgccctgcatcgtcttcatcgacgagattgacgcc 46
           ||||||| ||| ||||||||||| ||||| ||||||
Sbjct: 859 gcgccctccattgtcttcatcgatgagatagacgcc 894



to top

>gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome
          Length = 3481691

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 506    aagcttgtggcttaccatga 525
              ||||||||||||||||||||
Sbjct: 301864 aagcttgtggcttaccatga 301883



to top

>ref|NM_003119.2| Homo sapiens spastic paraplegia 7, paraplegin (pure and complicated
            autosomal recessive) (SPG7), nuclear gene encoding
            mitochondrial protein, transcript variant 1, mRNA
          Length = 3096

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 14   ccctgcatcgtcttcatcgacgagattgacgc 45
            ||||||||||||| |||||| ||||| |||||
Sbjct: 1225 ccctgcatcgtctacatcgatgagatcgacgc 1256



to top

>ref|NM_199367.1| Homo sapiens spastic paraplegia 7, paraplegin (pure and complicated
            autosomal recessive) (SPG7), nuclear gene encoding
            mitochondrial protein, transcript variant 2, mRNA
          Length = 2319

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 14   ccctgcatcgtcttcatcgacgagattgacgc 45
            ||||||||||||| |||||| ||||| |||||
Sbjct: 1225 ccctgcatcgtctacatcgatgagatcgacgc 1256



to top

>gb|AC091324.10| Mus musculus chromosome 7, clone RP23-7G1, complete sequence
          Length = 225556

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 273   ttgaggttcactccagagga 292
             ||||||||||||||||||||
Sbjct: 84075 ttgaggttcactccagagga 84094



to top

>gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, complete sequence
          Length = 6365727

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                       
Query: 74      ggtggggggaacgatgagagggagcagaccattaaccagctgctcacggagatgga 129
               |||||||| ||||||||||| || || ||| | || ||| | ||||||||||||||
Sbjct: 3035367 ggtgggggtaacgatgagagagaacaaaccctcaatcagttactcacggagatgga 3035422



to top

>gb|BT011963.1| Arabidopsis thaliana At3g53940 mRNA sequence
          Length = 1095

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 469 tgagaagaagaatgcagttg 488
           ||||||||||||||||||||
Sbjct: 881 tgagaagaagaatgcagttg 900



to top

>gb|AC092123.4| Homo sapiens chromosome 16 clone RP11-104N10, complete sequence
          Length = 112519

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 14    ccctgcatcgtcttcatcgacgagattgacgc 45
             ||||||||||||| |||||| ||||| |||||
Sbjct: 53225 ccctgcatcgtctacatcgatgagatcgacgc 53194



to top

>ref|XM_842897.1| Leishmania major strain Friedlin ATPase (LMJ_0292) partial mRNA
          Length = 1971

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 113  ctgctcacggagatggacggcttc 136
            |||||||| |||||||||||||||
Sbjct: 1552 ctgctcaccgagatggacggcttc 1575



to top

>ref|XM_390945.1| Gibberella zeae PH-1 chromosome 3 PRS6_ASPNG 26S PROTEASE
           REGULATORY SUBUNIT 6B HOMOLOG (FG10769.1) partial mRNA
          Length = 1266

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 19  catcgtcttcatcgacgagattgacgcc 46
           |||| |||||||||||||||| ||||||
Sbjct: 780 catcatcttcatcgacgagatcgacgcc 807



to top

>ref|XM_385706.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG05530.1)
           partial mRNA
          Length = 2466

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 24  tcttcatcgacgagattgac 43
           ||||||||||||||||||||
Sbjct: 956 tcttcatcgacgagattgac 975



to top

>emb|AL591788.1|SME591788 Sinorhizobium meliloti 1021 complete chromosome; segment 7/12
          Length = 306250

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 522   atgaggctggacatgccctc 541
             ||||||||||||||||||||
Sbjct: 54117 atgaggctggacatgccctc 54136



to top

>gb|BC035929.2| Homo sapiens spastic paraplegia 7, paraplegin (pure and complicated
            autosomal recessive), mRNA (cDNA clone IMAGE:4396303),
            partial cds
          Length = 2882

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 14   ccctgcatcgtcttcatcgacgagattgacgc 45
            ||||||||||||| |||||| ||||| |||||
Sbjct: 1017 ccctgcatcgtctacatcgatgagatcgacgc 1048



to top

>ref|XM_499951.1| Yarrowia lipolytica CLIB122, YALI0A10615g predicted mRNA
          Length = 2403

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 511  tgtggcttaccatgaggctggacatgcc 538
            |||||| |||||||||||||| ||||||
Sbjct: 1773 tgtggcctaccatgaggctggccatgcc 1800



to top

>ref|XM_500430.1| Yarrowia lipolytica CLIB122, YALI0B02574g predicted mRNA
          Length = 2292

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 23   gtcttcatcgacgagattgacgcc 46
            ||||||||||| ||||||||||||
Sbjct: 1090 gtcttcatcgatgagattgacgcc 1113



to top

>gb|AC010538.9| Homo sapiens chromosome 16 clone RP11-368I7, complete sequence
          Length = 210031

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 14     ccctgcatcgtcttcatcgacgagattgacgc 45
              ||||||||||||| |||||| ||||| |||||
Sbjct: 209158 ccctgcatcgtctacatcgatgagatcgacgc 209127



to top

>gb|AF259761.1| Ovis aries microsatellite MNS-89 sequence
          Length = 995

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 547 tgccctgatgcctgaatatg 566
           ||||||||||||||||||||
Sbjct: 798 tgccctgatgcctgaatatg 817



to top

>emb|Y16610.1|HSPARAPLE Homo sapiens mRNA for paraplegin
          Length = 3087

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 14   ccctgcatcgtcttcatcgacgagattgacgc 45
            ||||||||||||| |||||| ||||| |||||
Sbjct: 1216 ccctgcatcgtctacatcgatgagatcgacgc 1247



to top

>gb|AE008912.1| Salmonella typhimurium LT2, section 216 of 220 of the complete genome
          Length = 20216

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 548  gccctgatgcctgaatatga 567
            ||||||||||||||||||||
Sbjct: 4815 gccctgatgcctgaatatga 4796



to top

>emb|BX294138.1| Pirellula sp. strain 1 complete genome; segment 6/24
          Length = 321950

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 24   tcttcatcgacgagattgacgccgtcgg 51
            ||||||| |||||||||||||| |||||
Sbjct: 9440 tcttcattgacgagattgacgcagtcgg 9467



to top

>gb|BC036104.1| Homo sapiens spastic paraplegia 7, paraplegin (pure and complicated
            autosomal recessive), transcript variant 1, mRNA (cDNA
            clone MGC:33917 IMAGE:5274587), complete cds
          Length = 3091

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 14   ccctgcatcgtcttcatcgacgagattgacgc 45
            ||||||||||||| |||||| ||||| |||||
Sbjct: 1219 ccctgcatcgtctacatcgatgagatcgacgc 1250



to top

>emb|AL627284.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18,
            complete chromosome; segment 20/20
          Length = 88037

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 548  gccctgatgcctgaatatga 567
            ||||||||||||||||||||
Sbjct: 3877 gccctgatgcctgaatatga 3858



to top

>emb|AL132960.2|ATF5K20 Arabidopsis thaliana DNA chromosome 3, BAC clone F5K20
          Length = 119407

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 469   tgagaagaagaatgcagttg 488
             ||||||||||||||||||||
Sbjct: 73981 tgagaagaagaatgcagttg 73962



to top

>ref|NM_001002091.1| Danio rerio proteasome (prosome, macropain) 26S subunit, ATPase, 1b
           (psmc1b), mRNA
          Length = 1521

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 11  gcgccctgcatcgtcttcatcgacgagattgacgcc 46
           ||||||| ||| ||||||||||| ||||| ||||||
Sbjct: 859 gcgccctccattgtcttcatcgatgagatagacgcc 894



to top

>gb|AC114900.26| Ustilago hordei strain 4875-4 clone uhobac-2b7, complete sequence
          Length = 100829

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 19    catcgtcttcatcgacgagattgacgcc 46
             |||| |||||||||||||||| ||||||
Sbjct: 77823 catcatcttcatcgacgagatcgacgcc 77796



to top

>emb|CR609511.1| full-length cDNA clone CS0DL005YD01 of B cells (Ramos cell line) Cot
            25-normalized of Homo sapiens (human)
          Length = 2234

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 14   ccctgcatcgtcttcatcgacgagattgacgc 45
            ||||||||||||| |||||| ||||| |||||
Sbjct: 1216 ccctgcatcgtctacatcgatgagatcgacgc 1247



to top

>gb|AF236051.1| California sea lion herpesvirus terminase gene, partial cds
          Length = 448

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 499 gaagaggaagcttgtggctt 518
           ||||||||||||||||||||
Sbjct: 109 gaagaggaagcttgtggctt 90



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                           
Query: 188     cttgactccgcgcttctgcggccagggcggttcgatcggcaggt 231
               |||||||||||| | |||||||| || || ||||| ||||||||
Sbjct: 2168295 cttgactccgcgttgctgcggccgggccgcttcgaccggcaggt 2168338



to top

>gb|AY093262.1| Arabidopsis thaliana putative protein (F5K20.24) mRNA, complete cds
          Length = 1169

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 469 tgagaagaagaatgcagttg 488
           ||||||||||||||||||||
Sbjct: 884 tgagaagaagaatgcagttg 903



to top

>gb|AY062478.1| Arabidopsis thaliana putative protein (F5K20.24) mRNA, complete cds
          Length = 1397

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 469  tgagaagaagaatgcagttg 488
            ||||||||||||||||||||
Sbjct: 1089 tgagaagaagaatgcagttg 1108



to top

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 24      tcttcatcgacgagattgacgccgtcgg 51
               ||||||||||||| || |||||||||||
Sbjct: 1288491 tcttcatcgacgaaatcgacgccgtcgg 1288518



to top

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
              complete sequence
          Length = 1519138

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 105    ttaaccagctgctcacggagatggacgg 132
              |||||||||||||| || ||||||||||
Sbjct: 952336 ttaaccagctgctcgcgaagatggacgg 952309



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 18     gcatcgtcttcatcgacgagattgacgc 45
              |||| ||||||||||||||||| |||||
Sbjct: 614604 gcatagtcttcatcgacgagatcgacgc 614631



to top

>gb|AF080518.1|HSSPGSC08 Homo sapiens paraplegin (SPG7) gene, exons 8 and 9
          Length = 1068

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 14  ccctgcatcgtcttcatcgacgagattgacgc 45
           ||||||||||||| |||||| ||||| |||||
Sbjct: 815 ccctgcatcgtctacatcgatgagatcgacgc 846



to top

>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome
          Length = 2909809

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 17      tgcatcgtcttcatcgacgagattgacgccgt 48
               |||||| ||||||||||||| || ||||||||
Sbjct: 1188361 tgcatcatcttcatcgacgaaatcgacgccgt 1188392



to top

>gb|AF193618.1|AF193618 California sea lion herpesvirus terminase gene, partial cds
          Length = 375

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 499 gaagaggaagcttgtggctt 518
           ||||||||||||||||||||
Sbjct: 36  gaagaggaagcttgtggctt 17



to top

>emb|BX822250.1|CNS0A70P Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB23ZB02 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1400

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 469  tgagaagaagaatgcagttg 488
            ||||||||||||||||||||
Sbjct: 1044 tgagaagaagaatgcagttg 1063



to top

>emb|BX824565.1|CNS0A4VO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH56ZE10 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1499

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 469  tgagaagaagaatgcagttg 488
            ||||||||||||||||||||
Sbjct: 1056 tgagaagaagaatgcagttg 1075



to top

>gb|AE004548.1| Pseudomonas aeruginosa PAO1, section 109 of 529 of the complete
            genome
          Length = 10054

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 153  tcatcgtgctcgccgcgacc 172
            ||||||||||||||||||||
Sbjct: 8703 tcatcgtgctcgccgcgacc 8722



to top

>ref|XM_345541.2| PREDICTED: Rattus norvegicus similar to Ubiquitin carboxyl-terminal
           hydrolase isozyme L3 (UCH-L3) (Ubiquitin thiolesterase
           L3) (LOC366382), mRNA
          Length = 687

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 490 ttcagaacagaagaggaagc 509
           ||||||||||||||||||||
Sbjct: 199 ttcagaacagaagaggaagc 218



to top

>dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome
          Length = 3573470

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 204    tgcggccagggcggttcgatcggcaggt 231
              |||||||||| ||||||||||| |||||
Sbjct: 697074 tgcggccaggacggttcgatcgccaggt 697101



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                      
Query: 512    gtggcttaccatgaggctggacatgccctcgtcggtgccctgatgcctgaatatga 567
              |||||||||||||| ||||| || ||| | || |||||  |||||||||| |||||
Sbjct: 472337 gtggcttaccatgaagctggccacgccttggtgggtgctttgatgcctgattatga 472392



to top

>ref|NM_210204.1| Eremothecium gossypii AEL011Wp (AEL011W), mRNA
          Length = 1314

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 18  gcatcgtcttcatcgacgagattgacgc 45
           |||| ||||||||||||||||| |||||
Sbjct: 830 gcatagtcttcatcgacgagatcgacgc 857



to top

>ref|NM_210381.1| Eremothecium gossypii AER169Cp (AER169C), mRNA
          Length = 2289

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 105  ttaaccagctgctcacggagatggacgg 132
            |||||||||||||| || ||||||||||
Sbjct: 1127 ttaaccagctgctcgcgaagatggacgg 1154



to top

>emb|AL935145.12| Zebrafish DNA sequence from clone CH211-173B9 in linkage group 20,
             complete sequence
          Length = 157156

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 11    gcgccctgcatcgtcttcatcgacgagattgacgcc 46
             ||||||| ||| ||||||||||| ||||| ||||||
Sbjct: 50212 gcgccctccattgtcttcatcgatgagatagacgcc 50177



to top

>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome
          Length = 4791961

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 548     gccctgatgcctgaatatga 567
               ||||||||||||||||||||
Sbjct: 4707801 gccctgatgcctgaatatga 4707782



to top

>emb|AM118080.1| Ustilago hordei mating type region MAT-1, strain 364
          Length = 526707

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 19    catcgtcttcatcgacgagattgacgcc 46
             |||| |||||||||||||||| ||||||
Sbjct: 81459 catcatcttcatcgacgagatcgacgcc 81432



to top

>gb|AE017220.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67,
               complete genome
          Length = 4755700

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 548     gccctgatgcctgaatatga 567
               ||||||||||||||||||||
Sbjct: 4668541 gccctgatgcctgaatatga 4668522



to top

>gb|AE015451.1| Pseudomonas putida KT2440 complete genome
          Length = 6181863

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 17      tgcatcgtcttcatcgacgagattgacgccgt 48
               |||||| ||||||||||||| || ||||||||
Sbjct: 5365803 tgcatcatcttcatcgacgaaatcgacgccgt 5365772



to top

>gb|AY627304.1| Haloferax volcanii DS2 proteasome-activating nucleotidase B (panB)
           gene, complete cds
          Length = 1239

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 113 ctgctcacggagatggacggcttc 136
           |||||| |||||||||||||||||
Sbjct: 835 ctgctctcggagatggacggcttc 858



to top

>gb|BC110530.1| Homo sapiens spastic paraplegia 7, paraplegin (pure and complicated
            autosomal recessive), transcript variant 1, mRNA (cDNA
            clone MGC:126331 IMAGE:40034798), complete cds
          Length = 2660

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 14   ccctgcatcgtcttcatcgacgagattgacgc 45
            ||||||||||||| |||||| ||||| |||||
Sbjct: 1222 ccctgcatcgtctacatcgatgagatcgacgc 1253



to top

>gb|BC110531.1| Homo sapiens spastic paraplegia 7, paraplegin (pure and complicated
            autosomal recessive), transcript variant 1, mRNA (cDNA
            clone MGC:126332 IMAGE:40034799), complete cds
          Length = 2660

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 14   ccctgcatcgtcttcatcgacgagattgacgc 45
            ||||||||||||| |||||| ||||| |||||
Sbjct: 1222 ccctgcatcgtctacatcgatgagatcgacgc 1253



to top

>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica
          Length = 3066374

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 23     gtcttcatcgacgagattgacgcc 46
              ||||||||||| ||||||||||||
Sbjct: 395406 gtcttcatcgatgagattgacgcc 395429



to top

>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica
          Length = 2303261

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 511     tgtggcttaccatgaggctggacatgcc 538
               |||||| |||||||||||||| ||||||
Sbjct: 1102899 tgtggcctaccatgaggctggccatgcc 1102926



to top

>dbj|AB023310.1| Cyanidioschyzon merolae gene for FtsH2, complete cds
          Length = 4496

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 14   ccctgcatcgtcttcatcgacgagattgacgc 45
            |||||||||||||| || |||||||| |||||
Sbjct: 2490 ccctgcatcgtctttatagacgagatagacgc 2521


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,586,640
Number of Sequences: 3902068
Number of extensions: 4586640
Number of successful extensions: 81848
Number of sequences better than 10.0: 243
Number of HSP's better than 10.0 without gapping: 243
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 78174
Number of HSP's gapped (non-prelim): 3663
length of query: 570
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 547
effective length of database: 17,143,297,704
effective search space: 9377383844088
effective search space used: 9377383844088
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top