ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bah63i24
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_478188.1| Oryza sativa (japonica cultivar-group), mRNA 143 8e-31
2dbj|AK067461.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 8e-31
3dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 139 1e-29
4dbj|AP004051.4| Oryza sativa (japonica cultivar-group) genomic D... 139 1e-29
5dbj|AP004266.3| Oryza sativa (japonica cultivar-group) genomic D... 139 1e-29
6emb|AL592285.7| Human DNA sequence from clone RP11-153I22 on chr... 44 0.55
7emb|AL158055.12| Human DNA sequence from clone RP11-348F1 on chr... 44 0.55
8gb|AY430223.1| Sargocentron punctatissimum recombination activat... 42 2.2
9gb|BC073349.1| Xenopus laevis MGC80764 protein, mRNA (cDNA clone... 42 2.2
10ref|XM_415764.1| PREDICTED: Gallus gallus similar to hypothetica... 42 2.2
11gb|BC060426.1| Xenopus laevis hypothetical protein MGC68724, mRN... 42 2.2
12emb|AL033381.2|HS856G1 Human DNA sequence from clone RP5-856G1 o... 42 2.2
13gb|AC067981.6| Homo sapiens chromosome 18, clone RP11-805E19, co... 42 2.2
14gb|AC113137.2| Homo sapiens chromosome 18, clone RP11-622J9, com... 42 2.2
15emb|BX950667.2| Gallus gallus finished cDNA, clone ChEST386h5 42 2.2
16gb|AY308777.1| Siganus doliatus recombinase activating gene-1 (R... 40 8.6
17gb|BC032416.1| Homo sapiens serine/arginine repetitive matrix 2,... 40 8.6
18gb|BC007752.2| Homo sapiens serine/arginine repetitive matrix 2,... 40 8.6
19gb|AC115830.6| Mus musculus chromosome 7, clone RP24-96A19, comp... 40 8.6
20gb|AC116768.9| Mus musculus chromosome 8, clone RP23-395P10, com... 40 8.6
21gb|AE010435.1| Methanopyrus kandleri AV19 section 134 of 157 of ... 40 8.6
22ref|XM_523881.1| PREDICTED: Pan troglodytes similar to Centrin 1... 40 8.6
23gb|AC161528.14| Mus musculus chromosome 8, clone RP23-369H18, co... 40 8.6
24gb|AC136901.17| Mus musculus chromosome 3, clone RP24-510H14, co... 40 8.6
25gb|AC161501.4| Mus musculus chromosome 3, clone RP24-150C17, com... 40 8.6
26gb|AC004493.1| Homo sapiens chromosome 16, cosmid clone 373C8 (L... 40 8.6
27gb|AC149231.2| Pan troglodytes BAC clone CH251-481H1 from 7, com... 40 8.6
28gb|AC136645.2| Rattus norvegicus 7 BAC CH230-156H17 (Children's ... 40 8.6
29gb|AC147427.2| Oryza sativa chromosome 3 B1394A07 genomic seque... 40 8.6
30ref|XM_420467.1| PREDICTED: Gallus gallus similar to Jade1 prote... 40 8.6
31gb|AC128646.5| Oryza sativa chromosome 3 BAC OSJNBb0029I19 genom... 40 8.6
32ref|XM_959184.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.6
33ref|XM_329969.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.6
34gb|AC134537.3| Mus musculus BAC clone RP24-388M1 from chromosome... 40 8.6
35ref|NM_016333.2| Homo sapiens serine/arginine repetitive matrix ... 40 8.6
36ref|NM_004066.1| Homo sapiens centrin, EF-hand protein, 1 (CETN1... 40 8.6
37gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 8.6
38emb|CT009518.6| Mouse DNA sequence from clone RP23-118M14 on chr... 40 8.6
39gb|AC092117.4| Homo sapiens chromosome 16 clone CTD-2270P14, com... 40 8.6
40emb|CT009494.4| Mouse DNA sequence from clone RP23-125D7 on chro... 40 8.6
41gb|AC132333.3| Mus musculus BAC clone RP24-226I7 from chromosome... 40 8.6
42gb|AC117237.2| Mus musculus BAC clone RP23-431G18 from 13, compl... 40 8.6
43gb|AC142338.1| Pan troglodytes BAC clone RP43-41H4 from 7, compl... 40 8.6
44gb|BC020639.1| Homo sapiens serine/arginine repetitive matrix 2,... 40 8.6
45gb|BC046104.1| Homo sapiens serine/arginine repetitive matrix 2,... 40 8.6
46emb|AL445228.13| Human DNA sequence from clone RP11-382D12 on ch... 40 8.6
47emb|AL135923.15| Human DNA sequence from clone RP11-29B9 on chro... 40 8.6
48emb|AL121782.9|HSJ585I14 Human DNA sequence from clone RP4-585I1... 40 8.6
49gb|AY270935.1| Homo sapiens clone SKT07-E8 putative promoter seq... 40 8.6
50gb|BC070050.1| Homo sapiens serine/arginine repetitive matrix 2,... 40 8.6
51gb|BC029515.1| Homo sapiens centrin, EF-hand protein, 1, mRNA (c... 40 8.6
52emb|AJ309022.1|GFL309022 Grapevine fleck virus complete genome, ... 40 8.6
53gb|AC068012.12| Homo sapiens chromosome , clone RP11-71B13, comp... 40 8.6
54emb|CR858352.1| Pongo pygmaeus mRNA; cDNA DKFZp459N2026 (from cl... 40 8.6
55emb|CR749507.1| Homo sapiens mRNA; cDNA DKFZp686B0331 (from clon... 40 8.6
56emb|CR621486.1| full-length cDNA clone CS0DD005YE16 of Neuroblas... 40 8.6
57emb|CR601265.1| full-length cDNA clone CS0DI076YI13 of Placenta ... 40 8.6
58gb|AE011667.1| Xanthomonas axonopodis pv. citri str. 306, secti... 40 8.6
59emb|CR590315.1| full-length cDNA clone CS0DI076YG15 of Placenta ... 40 8.6
60gb|AC024086.5| Homo sapiens chromosome 7 clone RP11-242F21, comp... 40 8.6
61gb|AC104236.2| Homo sapiens chromosome 15, clone RP11-24J19, com... 40 8.6
62dbj|AB179195.1| Macaca fascicularis testis cDNA clone: QtsA-1463... 40 8.6
63gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 8.6
64gb|AC158536.2| Mus musculus BAC clone RP23-29L19 from chromosome... 40 8.6
65dbj|AK002366.1| Mus musculus adult male kidney cDNA, RIKEN full-... 40 8.6
66gb|AC022486.4|AC022486 Homo sapiens BAC clone RP11-569J3 from Y,... 40 8.6
67dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.6
68dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.6
69dbj|AB002322.3| Homo sapiens mRNA for KIAA0324 protein, partial cds 40 8.6
70gb|AC069257.28| Homo sapiens 3 BAC RP11-447L10 (Roswell Park Can... 40 8.6
71gb|AC118019.11| Mus musculus chromosome 8, clone RP23-458N4, com... 40 8.6
72gb|AC093517.3| Homo sapiens chromosome 16 clone CTD-2593F12, com... 40 8.6
73gb|AC019102.13| Homo sapiens BAC clone RP11-457A20 from 2, compl... 40 8.6
74gb|AY151077.1| Sphaerospira rockhamptonensis isolate SAR3 16S ri... 40 8.6
75gb|AF242432.1|AF242431S2 Mus musculus Naip3 gene, exon 1; neuron... 40 8.6
76gb|AC078815.22| Homo sapiens 12q BAC RP11-766N7 (Roswell Park Ca... 40 8.6
77ref|XM_220207.3| PREDICTED: Rattus norvegicus serine/arginine re... 40 8.6
78gb|AC009358.6|AC009358 Human Chromosome 7 clone RP11-191E5, comp... 40 8.6
79gb|AF201422.1|AF201422 Homo sapiens splicing coactivator subunit... 40 8.6
80dbj|AP005429.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.6
81emb|AL691421.9| Mouse DNA sequence from clone RP23-21A16 on chro... 40 8.6
82emb|BX647088.1|HSM807232 Homo sapiens mRNA; cDNA DKFZp686O15166 ... 40 8.6
83ref|NG_004636.1| Homo sapiens chromosome Y palindromes P4 and P5... 40 8.6
84ref|NM_208583.1| Eremothecium gossypii ACL174Wp (ACL174W), mRNA 40 8.6
85gb|U03270.1|HSU03270 Homo sapiens centrin mRNA, complete cds 40 8.6
86dbj|AP005597.2| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 8.6
87dbj|AB016089.1| Homo sapiens mRNA for RNA binding protein, parti... 40 8.6
88dbj|AB016092.1| Homo sapiens mRNA for RNA binding protein, compl... 40 8.6
89dbj|AP001178.4| Homo sapiens genomic DNA, chromosome 18 clone:RP... 40 8.6

>ref|XM_478188.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 4057

 Score =  143 bits (72), Expect = 8e-31
 Identities = 126/144 (87%)
 Strand = Plus / Plus

                                                                        
Query: 490  actagaaatggaggaaaatgaagggtgtgccccaaggaagtactatgagtatttgcactc 549
            ||||||||| |||||||||||||||||||  |||| ||||||||| || |||||||| ||
Sbjct: 863  actagaaattgaggaaaatgaagggtgtgttccaaagaagtactacgaatatttgcagtc 922

                                                                        
Query: 550  cctaaatgacaagcagagggaggcttcatgtagtgatgtagctgttccgttaatgatcgt 609
            ||| ||||||| ||||||||| ||| |||||||||||||  || ||||  ||||||| ||
Sbjct: 923  cctgaatgacaggcagagggaagctgcatgtagtgatgtgactattccactaatgatagt 982

                                    
Query: 610  tgcaggtccaggaagtggaaagac 633
            ||| ||||||||||||||||||||
Sbjct: 983  tgctggtccaggaagtggaaagac 1006



to top

>dbj|AK067461.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013102E06, full
            insert sequence
          Length = 4056

 Score =  143 bits (72), Expect = 8e-31
 Identities = 126/144 (87%)
 Strand = Plus / Plus

                                                                        
Query: 490  actagaaatggaggaaaatgaagggtgtgccccaaggaagtactatgagtatttgcactc 549
            ||||||||| |||||||||||||||||||  |||| ||||||||| || |||||||| ||
Sbjct: 862  actagaaattgaggaaaatgaagggtgtgttccaaagaagtactacgaatatttgcagtc 921

                                                                        
Query: 550  cctaaatgacaagcagagggaggcttcatgtagtgatgtagctgttccgttaatgatcgt 609
            ||| ||||||| ||||||||| ||| |||||||||||||  || ||||  ||||||| ||
Sbjct: 922  cctgaatgacaggcagagggaagctgcatgtagtgatgtgactattccactaatgatagt 981

                                    
Query: 610  tgcaggtccaggaagtggaaagac 633
            ||| ||||||||||||||||||||
Sbjct: 982  tgctggtccaggaagtggaaagac 1005



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  139 bits (70), Expect = 1e-29
 Identities = 124/142 (87%)
 Strand = Plus / Minus

                                                                            
Query: 490      actagaaatggaggaaaatgaagggtgtgccccaaggaagtactatgagtatttgcactc 549
                ||||||||| |||||||||||||||||||  |||| ||||||||| || |||||||| ||
Sbjct: 18296270 actagaaattgaggaaaatgaagggtgtgttccaaagaagtactacgaatatttgcagtc 18296211

                                                                            
Query: 550      cctaaatgacaagcagagggaggcttcatgtagtgatgtagctgttccgttaatgatcgt 609
                ||| ||||||| ||||||||| ||| |||||||||||||  || ||||  ||||||| ||
Sbjct: 18296210 cctgaatgacaggcagagggaagctgcatgtagtgatgtgactattccactaatgatagt 18296151

                                      
Query: 610      tgcaggtccaggaagtggaaag 631
                ||| ||||||||||||||||||
Sbjct: 18296150 tgctggtccaggaagtggaaag 18296129



to top

>dbj|AP004051.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1218_C12
          Length = 105861

 Score =  139 bits (70), Expect = 1e-29
 Identities = 124/142 (87%)
 Strand = Plus / Minus

                                                                         
Query: 490   actagaaatggaggaaaatgaagggtgtgccccaaggaagtactatgagtatttgcactc 549
             ||||||||| |||||||||||||||||||  |||| ||||||||| || |||||||| ||
Sbjct: 99513 actagaaattgaggaaaatgaagggtgtgttccaaagaagtactacgaatatttgcagtc 99454

                                                                         
Query: 550   cctaaatgacaagcagagggaggcttcatgtagtgatgtagctgttccgttaatgatcgt 609
             ||| ||||||| ||||||||| ||| |||||||||||||  || ||||  ||||||| ||
Sbjct: 99453 cctgaatgacaggcagagggaagctgcatgtagtgatgtgactattccactaatgatagt 99394

                                   
Query: 610   tgcaggtccaggaagtggaaag 631
             ||| ||||||||||||||||||
Sbjct: 99393 tgctggtccaggaagtggaaag 99372



to top

>dbj|AP004266.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0038F10
          Length = 153929

 Score =  139 bits (70), Expect = 1e-29
 Identities = 124/142 (87%)
 Strand = Plus / Minus

                                                                         
Query: 490   actagaaatggaggaaaatgaagggtgtgccccaaggaagtactatgagtatttgcactc 549
             ||||||||| |||||||||||||||||||  |||| ||||||||| || |||||||| ||
Sbjct: 25765 actagaaattgaggaaaatgaagggtgtgttccaaagaagtactacgaatatttgcagtc 25706

                                                                         
Query: 550   cctaaatgacaagcagagggaggcttcatgtagtgatgtagctgttccgttaatgatcgt 609
             ||| ||||||| ||||||||| ||| |||||||||||||  || ||||  ||||||| ||
Sbjct: 25705 cctgaatgacaggcagagggaagctgcatgtagtgatgtgactattccactaatgatagt 25646

                                   
Query: 610   tgcaggtccaggaagtggaaag 631
             ||| ||||||||||||||||||
Sbjct: 25645 tgctggtccaggaagtggaaag 25624



to top

>emb|AL592285.7| Human DNA sequence from clone RP11-153I22 on chromosome 1 Contains part
              of the PDE4B gene for phosphodiesterase 4B, cAMP-specific
              (phosphodiesterase E4 dunce homolog, Drosophila), complete
              sequence
          Length = 152113

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 489    gactagaaatggaggaaaatga 510
              ||||||||||||||||||||||
Sbjct: 115037 gactagaaatggaggaaaatga 115058



to top

>emb|AL158055.12| Human DNA sequence from clone RP11-348F1 on chromosome Xp11.1-11.22
              Contains the NUDT11 gene for nudix (nucleoside diphosphate
              linked moiety X)-type motif 11, two novel genes, the NUDT10
              gene for nudix (nucleoside diphosphate linked moiety
              X)-type motif 10 and three CpG islands, complete sequence
          Length = 184873

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 216    ttaagttggaggacactttctgggaa 241
              |||||||||||| |||||||||||||
Sbjct: 138641 ttaagttggaggtcactttctgggaa 138616



to top

>gb|AY430223.1| Sargocentron punctatissimum recombination activating protein 1
           (RAG1) gene, partial cds
          Length = 1470

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 322 ccaggatgagatagaggaggtgtac 346
           |||||||||||||| ||||||||||
Sbjct: 948 ccaggatgagataggggaggtgtac 972



to top

>gb|BC073349.1| Xenopus laevis MGC80764 protein, mRNA (cDNA clone MGC:80764
           IMAGE:5512669), complete cds
          Length = 3192

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 130 gaaggagatgatggaagagga 150
           |||||||||||||||||||||
Sbjct: 861 gaaggagatgatggaagagga 841



to top

>ref|XM_415764.1| PREDICTED: Gallus gallus similar to hypothetical protein, MNCb-4760
           (LOC417516), mRNA
          Length = 1920

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 124 ggagctgaaggagatgatggaagag 148
           ||||||| |||||||||||||||||
Sbjct: 210 ggagctgcaggagatgatggaagag 234



to top

>gb|BC060426.1| Xenopus laevis hypothetical protein MGC68724, mRNA (cDNA clone
           MGC:68724 IMAGE:4057122), complete cds
          Length = 1576

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 130 gaaggagatgatggaagagga 150
           |||||||||||||||||||||
Sbjct: 742 gaaggagatgatggaagagga 722



to top

>emb|AL033381.2|HS856G1 Human DNA sequence from clone RP5-856G1 on chromosome 6p24.1-25.3,
             complete sequence
          Length = 151795

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 492   tagaaatggaggaaaatgaag 512
             |||||||||||||||||||||
Sbjct: 19487 tagaaatggaggaaaatgaag 19467



to top

>gb|AC067981.6| Homo sapiens chromosome 18, clone RP11-805E19, complete sequence
          Length = 158750

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 487   gggactagaaatggaggaaaa 507
             |||||||||||||||||||||
Sbjct: 19673 gggactagaaatggaggaaaa 19693



to top

>gb|AC113137.2| Homo sapiens chromosome 18, clone RP11-622J9, complete sequence
          Length = 167694

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 487   gggactagaaatggaggaaaa 507
             |||||||||||||||||||||
Sbjct: 73545 gggactagaaatggaggaaaa 73525



to top

>emb|BX950667.2| Gallus gallus finished cDNA, clone ChEST386h5
          Length = 865

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 124 ggagctgaaggagatgatggaagag 148
           ||||||| |||||||||||||||||
Sbjct: 370 ggagctgcaggagatgatggaagag 394



to top

>gb|AY308777.1| Siganus doliatus recombinase activating gene-1 (RAG1) gene, partial
           cds
          Length = 1455

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 322 ccaggatgagatagaggaggtgta 345
           |||||||||||||| |||||||||
Sbjct: 930 ccaggatgagataggggaggtgta 953



to top

>gb|BC032416.1| Homo sapiens serine/arginine repetitive matrix 2, mRNA (cDNA clone
           IMAGE:5215215), complete cds
          Length = 2267

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 125 gagctgaaggagatgatggaagag 148
           |||||| |||||||||||||||||
Sbjct: 430 gagctggaggagatgatggaagag 453



to top

>gb|BC007752.2| Homo sapiens serine/arginine repetitive matrix 2, mRNA (cDNA clone
           IMAGE:4110278), partial cds
          Length = 786

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 125 gagctgaaggagatgatggaagag 148
           |||||| |||||||||||||||||
Sbjct: 415 gagctggaggagatgatggaagag 438



to top

>gb|AC115830.6| Mus musculus chromosome 7, clone RP24-96A19, complete sequence
          Length = 153718

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 115   ccaggatgaggagctgaagg 134
             ||||||||||||||||||||
Sbjct: 23756 ccaggatgaggagctgaagg 23737



to top

>gb|AC116768.9| Mus musculus chromosome 8, clone RP23-395P10, complete sequence
          Length = 191757

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 132    aggagatgatggaagaggaa 151
              ||||||||||||||||||||
Sbjct: 174018 aggagatgatggaagaggaa 173999



to top

>gb|AE010435.1| Methanopyrus kandleri AV19 section 134 of 157 of the complete genome
          Length = 11400

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 127  gctgaaggagatgatggaagagga 150
            ||||||||||| ||||||||||||
Sbjct: 5185 gctgaaggagaggatggaagagga 5162



to top

>ref|XM_523881.1| PREDICTED: Pan troglodytes similar to Centrin 1 (Caltractin isoform
           2) (LOC468492), mRNA
          Length = 519

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 118 ggatgaggagctgaaggagatgat 141
           ||||||||||||| ||||||||||
Sbjct: 414 ggatgaggagctgcaggagatgat 437



to top

>gb|AC161528.14| Mus musculus chromosome 8, clone RP23-369H18, complete sequence
          Length = 206302

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 126   agctgaaggagatgatggaagagg 149
             |||||||||||||| |||||||||
Sbjct: 25638 agctgaaggagatgttggaagagg 25615



to top

>gb|AC136901.17| Mus musculus chromosome 3, clone RP24-510H14, complete sequence
          Length = 129686

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 409  gggaggagaggttgttgatg 428
            ||||||||||||||||||||
Sbjct: 9338 gggaggagaggttgttgatg 9357



to top

>gb|AC161501.4| Mus musculus chromosome 3, clone RP24-150C17, complete sequence
          Length = 155378

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    gggaggagaggttgttgatg 428
              ||||||||||||||||||||
Sbjct: 108630 gggaggagaggttgttgatg 108649



to top

>gb|AC004493.1| Homo sapiens chromosome 16, cosmid clone 373C8 (LANL), complete
             sequence
          Length = 43661

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 125   gagctgaaggagatgatggaagag 148
             |||||| |||||||||||||||||
Sbjct: 20236 gagctggaggagatgatggaagag 20213



to top

>gb|AC149231.2| Pan troglodytes BAC clone CH251-481H1 from 7, complete sequence
          Length = 217836

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 239   gaagttaatgccatcagcaa 258
             ||||||||||||||||||||
Sbjct: 47824 gaagttaatgccatcagcaa 47843



to top

>gb|AC136645.2| Rattus norvegicus 7 BAC CH230-156H17 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 204000

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 114    gccaggatgaggagctgaaggaga 137
              ||||||||| ||||||||||||||
Sbjct: 150668 gccaggatgtggagctgaaggaga 150691



to top

>gb|AC147427.2| Oryza sativa chromosome 3  B1394A07 genomic sequence, complete sequence
          Length = 175704

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 400    tgcggaggagggaggagagg 419
              ||||||||||||||||||||
Sbjct: 165913 tgcggaggagggaggagagg 165894



to top

>ref|XM_420467.1| PREDICTED: Gallus gallus similar to Jade1 protein long isoform; gene
            for apoptosis and differentiation in epithelia
            (LOC422502), mRNA
          Length = 4996

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 499  ggaggaaaatgaagggtgtg 518
            ||||||||||||||||||||
Sbjct: 1664 ggaggaaaatgaagggtgtg 1645



to top

>gb|AC128646.5| Oryza sativa chromosome 3 BAC OSJNBb0029I19 genomic sequence,
            complete sequence
          Length = 120254

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 400  tgcggaggagggaggagagg 419
            ||||||||||||||||||||
Sbjct: 4010 tgcggaggagggaggagagg 3991



to top

>ref|XM_959184.1| Neurospora crassa OR74A hypothetical protein (NCU02782.1) partial
            mRNA
          Length = 2988

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 404  gaggagggaggagaggttgt 423
            ||||||||||||||||||||
Sbjct: 2399 gaggagggaggagaggttgt 2380



to top

>ref|XM_329969.1| Neurospora crassa OR74A hypothetical protein (NCU02782.1) partial
            mRNA
          Length = 2988

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 404  gaggagggaggagaggttgt 423
            ||||||||||||||||||||
Sbjct: 2399 gaggagggaggagaggttgt 2380



to top

>gb|AC134537.3| Mus musculus BAC clone RP24-388M1 from chromosome 12, complete sequence
          Length = 221662

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 153    gcttggtgctgtcctgtggt 172
              ||||||||||||||||||||
Sbjct: 121104 gcttggtgctgtcctgtggt 121123



to top

>ref|NM_016333.2| Homo sapiens serine/arginine repetitive matrix 2 (SRRM2), mRNA
          Length = 9027

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 125 gagctgaaggagatgatggaagag 148
           |||||| |||||||||||||||||
Sbjct: 439 gagctggaggagatgatggaagag 462



to top

>ref|NM_004066.1| Homo sapiens centrin, EF-hand protein, 1 (CETN1), mRNA
          Length = 1161

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 118 ggatgaggagctgaaggagatgat 141
           ||||||||||||| ||||||||||
Sbjct: 456 ggatgaggagctgcaggagatgat 479



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 400      tgcggaggagggaggagagg 419
                ||||||||||||||||||||
Sbjct: 24469947 tgcggaggagggaggagagg 24469966



to top

>emb|CT009518.6| Mouse DNA sequence from clone RP23-118M14 on chromosome 13, complete
             sequence
          Length = 221250

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 410   ggaggagaggttgttgatgc 429
             ||||||||||||||||||||
Sbjct: 10080 ggaggagaggttgttgatgc 10099



to top

>gb|AC092117.4| Homo sapiens chromosome 16 clone CTD-2270P14, complete sequence
          Length = 211606

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 125    gagctgaaggagatgatggaagag 148
              |||||| |||||||||||||||||
Sbjct: 147649 gagctggaggagatgatggaagag 147672



to top

>emb|CT009494.4| Mouse DNA sequence from clone RP23-125D7 on chromosome 13, complete
              sequence
          Length = 206416

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 130    gaaggagatgatggaagagg 149
              ||||||||||||||||||||
Sbjct: 109807 gaaggagatgatggaagagg 109826



to top

>gb|AC132333.3| Mus musculus BAC clone RP24-226I7 from chromosome 7, complete sequence
          Length = 170540

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 115    ccaggatgaggagctgaagg 134
              ||||||||||||||||||||
Sbjct: 135043 ccaggatgaggagctgaagg 135024



to top

>gb|AC117237.2| Mus musculus BAC clone RP23-431G18 from 13, complete sequence
          Length = 200110

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 130   gaaggagatgatggaagagg 149
             ||||||||||||||||||||
Sbjct: 37345 gaaggagatgatggaagagg 37364



to top

>gb|AC142338.1| Pan troglodytes BAC clone RP43-41H4 from 7, complete sequence
          Length = 186208

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 239   gaagttaatgccatcagcaa 258
             ||||||||||||||||||||
Sbjct: 67124 gaagttaatgccatcagcaa 67105



to top

>gb|BC020639.1| Homo sapiens serine/arginine repetitive matrix 2, mRNA (cDNA clone
           IMAGE:4733822), containing frame-shift errors
          Length = 829

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 125 gagctgaaggagatgatggaagag 148
           |||||| |||||||||||||||||
Sbjct: 454 gagctggaggagatgatggaagag 477



to top

>gb|BC046104.1| Homo sapiens serine/arginine repetitive matrix 2, mRNA (cDNA clone
           IMAGE:6203679), containing frame-shift errors
          Length = 787

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 125 gagctgaaggagatgatggaagag 148
           |||||| |||||||||||||||||
Sbjct: 419 gagctggaggagatgatggaagag 442



to top

>emb|AL445228.13| Human DNA sequence from clone RP11-382D12 on chromosome 1 Contains a
             novel gene, the 5' end of the C1orf21 gene for chromosome
             1 open reading frame 21 and a CpG island, complete
             sequence
          Length = 116252

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 277   ttctgagatgaaccaggagc 296
             ||||||||||||||||||||
Sbjct: 19333 ttctgagatgaaccaggagc 19314



to top

>emb|AL135923.15| Human DNA sequence from clone RP11-29B9 on chromosome 9p23-24.3
             Contains two novel genes, complete sequence
          Length = 152470

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 301   tgccacatcttcggcaatta 320
             ||||||||||||||||||||
Sbjct: 24540 tgccacatcttcggcaatta 24559



to top

>emb|AL121782.9|HSJ585I14 Human DNA sequence from clone RP4-585I14 on chromosome 20 Contains the
             3' end of the C20orf13 gene for chromosome 20 open reading
             frame 13 and the GAPDP2 gene for
             glyceraldehyde-3-phosphate dehydrogenase pseudogene 2,
             complete sequence
          Length = 144781

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 125   gagctgaaggagatgatggaagag 148
             |||||||||||||||| |||||||
Sbjct: 28353 gagctgaaggagatgagggaagag 28376



to top

>gb|AY270935.1| Homo sapiens clone SKT07-E8 putative promoter sequence
          Length = 458

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 125 gagctgaaggagatgatggaagag 148
           |||||| |||||||||||||||||
Sbjct: 210 gagctggaggagatgatggaagag 233



to top

>gb|BC070050.1| Homo sapiens serine/arginine repetitive matrix 2, mRNA (cDNA clone
           IMAGE:30340453), partial cds
          Length = 3327

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 125 gagctgaaggagatgatggaagag 148
           |||||| |||||||||||||||||
Sbjct: 474 gagctggaggagatgatggaagag 497



to top

>gb|BC029515.1| Homo sapiens centrin, EF-hand protein, 1, mRNA (cDNA clone
           MGC:33791 IMAGE:5297994), complete cds
          Length = 1285

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 118 ggatgaggagctgaaggagatgat 141
           ||||||||||||| ||||||||||
Sbjct: 466 ggatgaggagctgcaggagatgat 489



to top

>emb|AJ309022.1|GFL309022 Grapevine fleck virus complete genome, isolate MT48, genomic RNA
          Length = 7564

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 398  attgcggaggagggaggaga 417
            ||||||||||||||||||||
Sbjct: 6420 attgcggaggagggaggaga 6401



to top

>gb|AC068012.12| Homo sapiens chromosome , clone RP11-71B13, complete sequence
          Length = 2559

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 608 gttgcaggtccaggaagtgg 627
           ||||||||||||||||||||
Sbjct: 412 gttgcaggtccaggaagtgg 431



to top

>emb|CR858352.1| Pongo pygmaeus mRNA; cDNA DKFZp459N2026 (from clone DKFZp459N2026)
          Length = 3040

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 121  tgaggagctgaaggagatgatgga 144
            |||||||| |||||||||||||||
Sbjct: 2245 tgaggagcagaaggagatgatgga 2268



to top

>emb|CR749507.1| Homo sapiens mRNA; cDNA DKFZp686B0331 (from clone DKFZp686B0331)
          Length = 4877

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 125  gagctgaaggagatgatggaagag 148
            |||||||||||||||| |||||||
Sbjct: 1687 gagctgaaggagatgagggaagag 1664



to top

>emb|CR621486.1| full-length cDNA clone CS0DD005YE16 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1439

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 125 gagctgaaggagatgatggaagag 148
           |||||| |||||||||||||||||
Sbjct: 387 gagctggaggagatgatggaagag 410



to top

>emb|CR601265.1| full-length cDNA clone CS0DI076YI13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 692

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 118 ggatgaggagctgaaggagatgat 141
           ||||||||||||| ||||||||||
Sbjct: 421 ggatgaggagctgcaggagatgat 444



to top

>gb|AE011667.1| Xanthomonas axonopodis pv. citri str. 306,  section 45 of 469 of
           the complete genome
          Length = 11789

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 91  tgatgctcagcctgctgcca 110
           ||||||||||||||||||||
Sbjct: 127 tgatgctcagcctgctgcca 146



to top

>emb|CR590315.1| full-length cDNA clone CS0DI076YG15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 692

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 118 ggatgaggagctgaaggagatgat 141
           ||||||||||||| ||||||||||
Sbjct: 421 ggatgaggagctgcaggagatgat 444



to top

>gb|AC024086.5| Homo sapiens chromosome 7 clone RP11-242F21, complete sequence
          Length = 153232

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 239   gaagttaatgccatcagcaa 258
             ||||||||||||||||||||
Sbjct: 48037 gaagttaatgccatcagcaa 48018



to top

>gb|AC104236.2| Homo sapiens chromosome 15, clone RP11-24J19, complete sequence
          Length = 160392

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 608   gttgcaggtccaggaagtgg 627
             ||||||||||||||||||||
Sbjct: 98342 gttgcaggtccaggaagtgg 98361



to top

>dbj|AB179195.1| Macaca fascicularis testis cDNA clone: QtsA-14639, similar to human
           centrin, EF-hand protein, 1 (CETN1), mRNA, RefSeq:
           NM_004066.1
          Length = 1770

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 118 ggatgaggagctgaaggagatgat 141
           ||||||||||||| ||||||||||
Sbjct: 431 ggatgaggagctgcaggagatgat 454



to top

>gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III,
             complete sequence
          Length = 907057

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 54    cattctggaaggaggcatat 73
             ||||||||||||||||||||
Sbjct: 55764 cattctggaaggaggcatat 55783



to top

>gb|AC158536.2| Mus musculus BAC clone RP23-29L19 from chromosome 13, complete sequence
          Length = 199663

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 410    ggaggagaggttgttgatgc 429
              ||||||||||||||||||||
Sbjct: 137284 ggaggagaggttgttgatgc 137303



to top

>dbj|AK002366.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610009B14 product:hypothetical protein,
           full insert sequence
          Length = 943

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 153 gcttggtgctgtcctgtggt 172
           ||||||||||||||||||||
Sbjct: 520 gcttggtgctgtcctgtggt 501



to top

>gb|AC022486.4|AC022486 Homo sapiens BAC clone RP11-569J3 from Y, complete sequence
          Length = 156357

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 415    agaggttgttgatgcattct 434
              ||||||||||||||||||||
Sbjct: 137352 agaggttgttgatgcattct 137371



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 32       cagtgcggaacgcttgatgatgca 55
                |||||||| |||||||||||||||
Sbjct: 14969703 cagtgcggtacgcttgatgatgca 14969680



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 400      tgcggaggagggaggagagg 419
                ||||||||||||||||||||
Sbjct: 24387416 tgcggaggagggaggagagg 24387435



to top

>dbj|AB002322.3| Homo sapiens mRNA for KIAA0324 protein, partial cds
          Length = 9003

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 125 gagctgaaggagatgatggaagag 148
           |||||| |||||||||||||||||
Sbjct: 415 gagctggaggagatgatggaagag 438



to top

>gb|AC069257.28| Homo sapiens 3 BAC RP11-447L10 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 188969

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 133    ggagatgatggaagaggaaa 152
              ||||||||||||||||||||
Sbjct: 183039 ggagatgatggaagaggaaa 183058



to top

>gb|AC118019.11| Mus musculus chromosome 8, clone RP23-458N4, complete sequence
          Length = 185749

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 132    aggagatgatggaagaggaa 151
              ||||||||||||||||||||
Sbjct: 176034 aggagatgatggaagaggaa 176053



to top

>gb|AC093517.3| Homo sapiens chromosome 16 clone CTD-2593F12, complete sequence
          Length = 160606

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 125    gagctgaaggagatgatggaagag 148
              |||||| |||||||||||||||||
Sbjct: 141069 gagctggaggagatgatggaagag 141092



to top

>gb|AC019102.13| Homo sapiens BAC clone RP11-457A20 from 2, complete sequence
          Length = 158242

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 403   ggaggagggaggagaggttg 422
             ||||||||||||||||||||
Sbjct: 40450 ggaggagggaggagaggttg 40431



to top

>gb|AY151077.1| Sphaerospira rockhamptonensis isolate SAR3 16S ribosomal RNA gene,
           partial sequence; mitochondrial gene for mitochondrial
           product
          Length = 414

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 533 tatgagtatttgcactccctaaat 556
           ||||||||||||||||| ||||||
Sbjct: 187 tatgagtatttgcactcactaaat 164



to top

>gb|AF242432.1|AF242431S2 Mus musculus Naip3 gene, exon 1; neuronal apoptosis inhibitory protein
             1 (Naip1) and general transcription factor IIH polypeptide
             2 (Gtf2h2) genes, complete cds
          Length = 90650

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 410   ggaggagaggttgttgatgc 429
             ||||||||||||||||||||
Sbjct: 17088 ggaggagaggttgttgatgc 17069



to top

>gb|AC078815.22| Homo sapiens 12q BAC RP11-766N7 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 163475

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 124    ggagctgaaggagatgatggaaga 147
              ||||||||||||||||| ||||||
Sbjct: 153829 ggagctgaaggagatgagggaaga 153852



to top

>ref|XM_220207.3| PREDICTED: Rattus norvegicus serine/arginine repetitive matrix 2
           (predicted) (Srrm2_predicted), mRNA
          Length = 5671

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 125 gagctgaaggagatgatggaagag 148
           |||||| |||||||||||||||||
Sbjct: 667 gagctggaggagatgatggaagag 690



to top

>gb|AC009358.6|AC009358 Human Chromosome 7 clone RP11-191E5, complete sequence
          Length = 185124

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 239   gaagttaatgccatcagcaa 258
             ||||||||||||||||||||
Sbjct: 44445 gaagttaatgccatcagcaa 44426



to top

>gb|AF201422.1|AF201422 Homo sapiens splicing coactivator subunit SRm300 (SRM300) mRNA,
           complete cds
          Length = 7789

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 125 gagctgaaggagatgatggaagag 148
           |||||| |||||||||||||||||
Sbjct: 443 gagctggaggagatgatggaagag 466



to top

>dbj|AP005429.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0701F11
          Length = 154950

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 32    cagtgcggaacgcttgatgatgca 55
             |||||||| |||||||||||||||
Sbjct: 39149 cagtgcggtacgcttgatgatgca 39126



to top

>emb|AL691421.9| Mouse DNA sequence from clone RP23-21A16 on chromosome X, complete
              sequence
          Length = 221461

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 60     ggaaggaggcatatgacatctttgagga 87
              ||||| ||||||||||||||| ||||||
Sbjct: 152284 ggaagcaggcatatgacatctgtgagga 152257



to top

>emb|BX647088.1|HSM807232 Homo sapiens mRNA; cDNA DKFZp686O15166 (from clone DKFZp686O15166)
          Length = 5322

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 125 gagctgaaggagatgatggaagag 148
           |||||| |||||||||||||||||
Sbjct: 309 gagctggaggagatgatggaagag 332



to top

>ref|NG_004636.1| Homo sapiens chromosome Y palindromes P4 and P5 (P4-P5@) on chromosome Y
          Length = 1351786

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 415     agaggttgttgatgcattct 434
               ||||||||||||||||||||
Sbjct: 1134196 agaggttgttgatgcattct 1134215



to top

>ref|NM_208583.1| Eremothecium gossypii ACL174Wp (ACL174W), mRNA
          Length = 1956

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 54  cattctggaaggaggcatat 73
           ||||||||||||||||||||
Sbjct: 929 cattctggaaggaggcatat 948



to top

>gb|U03270.1|HSU03270 Homo sapiens centrin mRNA, complete cds
          Length = 1161

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 118 ggatgaggagctgaaggagatgat 141
           ||||||||||||| ||||||||||
Sbjct: 456 ggatgaggagctgcaggagatgat 479



to top

>dbj|AP005597.2| Homo sapiens genomic DNA, chromosome 11 clone:RP11-72M10, complete
              sequence
          Length = 163324

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 316    aattaaccaggatgagatagagga 339
              ||||||||||||| ||||||||||
Sbjct: 133256 aattaaccaggataagatagagga 133233



to top

>dbj|AB016089.1| Homo sapiens mRNA for RNA binding protein, partial cds, clone: R52
          Length = 944

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 125 gagctgaaggagatgatggaagag 148
           |||||| |||||||||||||||||
Sbjct: 399 gagctggaggagatgatggaagag 422



to top

>dbj|AB016092.1| Homo sapiens mRNA for RNA binding protein, complete cds
          Length = 9027

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 125 gagctgaaggagatgatggaagag 148
           |||||| |||||||||||||||||
Sbjct: 439 gagctggaggagatgatggaagag 462



to top

>dbj|AP001178.4| Homo sapiens genomic DNA, chromosome 18 clone:RP11-806L2, complete
            sequence
          Length = 152711

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 118  ggatgaggagctgaaggagatgat 141
            ||||||||||||| ||||||||||
Sbjct: 8508 ggatgaggagctgcaggagatgat 8531


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,522,042
Number of Sequences: 3902068
Number of extensions: 6522042
Number of successful extensions: 146005
Number of sequences better than 10.0: 89
Number of HSP's better than 10.0 without gapping: 89
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 145662
Number of HSP's gapped (non-prelim): 343
length of query: 634
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 611
effective length of database: 17,143,297,704
effective search space: 10474554897144
effective search space used: 10474554897144
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top