ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bah63i23
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC118627.6| Mus musculus chromosome 15, clone RP24-91E8, comp... 42 1.7
2gb|AC099020.2| Drosophila melanogaster clone BACR30H01, complete... 42 1.7
3gb|BT014109.1| Lycopersicon esculentum clone 133213F, mRNA sequence 42 1.7
4ref|XM_749213.1| Aspergillus fumigatus Af293 hypothetical protei... 42 1.7
5emb|AL732366.7| Human DNA sequence from clone RP11-393H10 on chr... 42 1.7
6gb|AC159460.9| Mus musculus chromosome 15, clone RP24-306N20, co... 42 1.7
7gb|AC055732.16| Homo sapiens 3 BAC RP11-39E4 (Roswell Park Cance... 42 1.7
8gb|AC099017.1| Drosophila melanogaster, chromosome 2L, region 37... 42 1.7
9gb|AC009597.5|AC009597 Homo sapiens chromosome 8, clone RP11-33E... 42 1.7
10gb|AC022404.7|AC022404 Homo sapiens chromosome 14 clone CTD-2308... 42 1.7
11gb|AC011362.2|AC011362 Homo sapiens chromosome 5 clone CTC-503K1... 42 1.7
12gb|AC008509.5|AC008509 Homo sapiens chromosome 5 clone CTC-449I1... 42 1.7
13gb|AC116769.11| Mus musculus chromosome 15, clone RP23-415L16, c... 42 1.7
14gb|AE003663.4| Drosophila melanogaster chromosome 2L, section 72... 42 1.7
15gb|AC005128.1|AC005128 Drosophila melanogaster, chromosome 2L, r... 42 1.7
16gb|AC007889.9| Drosophila melanogaster clone BACR48E12, complete... 40 6.7
17gb|AC007692.5| Drosophila melanogaster clone BACR06O05, complete... 40 6.7
18emb|BX936301.8| Zebrafish DNA sequence from clone CH211-261H10 i... 40 6.7
19emb|CR847806.15| Zebrafish DNA sequence from clone CH211-267J10 ... 40 6.7
20emb|Z82209.2|HS428A13 Human DNA sequence from clone RP3-428A13 o... 40 6.7
21emb|AL607022.11| Human DNA sequence from clone RP11-323N10 on ch... 40 6.7
22emb|AL499604.9| Human DNA sequence from clone RP11-23B15 on chro... 40 6.7
23emb|AL356292.21| Human DNA sequence from clone RP11-363I22 on ch... 40 6.7
24emb|AL135778.9| Human DNA sequence from clone RP1-119C5 on chrom... 40 6.7
25emb|AL732570.12| Mouse DNA sequence from clone RP23-464J2 on chr... 40 6.7
26emb|AL445064.1|TACID2 Thermoplasma acidophilum complete genome; ... 40 6.7
27emb|AJ851427.1| Gallus gallus mRNA for hypothetical protein, clo... 40 6.7
28gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete g... 40 6.7
29gb|AC008189.3|AC008189 Drosophila melanogaster, chromosome 3R, r... 40 6.7
30gb|AC096558.1| Homo sapiens BAC clone RP11-186C15 from 2, comple... 40 6.7
31gb|AC015971.4| Homo sapiens BAC clone RP11-269K22 from 2, comple... 40 6.7
32gb|AC007642.5|AC007642 Homo sapiens chromosome 17, clone hRPK.42... 40 6.7
33ref|NM_001012541.1| Gallus gallus nucleoporin 50kDa (NUP50), mRNA 40 6.7
34gb|AE003694.4| Drosophila melanogaster chromosome 3R, section 32... 40 6.7
35emb|AL079343.4|CNS00M8T Human chromosome 14 DNA sequence BAC R-4... 40 6.7
36gb|AE003605.3| Drosophila melanogaster chromosome 3R, section 3 ... 40 6.7
37emb|AL671998.10| Mouse DNA sequence from clone RP23-71G11 on chr... 40 6.7

>gb|AC118627.6| Mus musculus chromosome 15, clone RP24-91E8, complete sequence
          Length = 256158

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 348    ctgagaagattggacagtgaagttcatgt 376
              |||||| |||||| |||||||||||||||
Sbjct: 212684 ctgagaggattgggcagtgaagttcatgt 212656



to top

>gb|AC099020.2| Drosophila melanogaster clone BACR30H01, complete sequence
          Length = 155557

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 65     gtatctttgtgaaatgagtag 85
              |||||||||||||||||||||
Sbjct: 125146 gtatctttgtgaaatgagtag 125166



to top

>gb|BT014109.1| Lycopersicon esculentum clone 133213F, mRNA sequence
          Length = 1299

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 225 aagaggaagcaggttgggatg 245
           |||||||||||||||||||||
Sbjct: 389 aagaggaagcaggttgggatg 369



to top

>ref|XM_749213.1| Aspergillus fumigatus Af293 hypothetical protein (Afu3g13160)
           partial mRNA
          Length = 1851

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 320 agttgttgatattcggatctt 340
           |||||||||||||||||||||
Sbjct: 640 agttgttgatattcggatctt 620



to top

>emb|AL732366.7| Human DNA sequence from clone RP11-393H10 on chromosome X Contains a
             novel gene (FLJ14503), the EIF1A gene for eukaryotic
             translation initiation factor 1A (EIF4C, EIF1AX, eIF-1A,
             eIF-4C), the 3' end of the RPS6KA3 gene for ribosomal
             protein S6 kinase, 90kDa, polypeptide 3 (RSK, HU-2, HU-3,
             RSK2, MRX19, ISPK-1, MAPKAPK1B), a novel gene and three
             CpG islands, complete sequence
          Length = 187275

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 408   ttttgaatatatcattgtaaaatct 432
             |||||||||||| ||||||||||||
Sbjct: 23899 ttttgaatatattattgtaaaatct 23875



to top

>gb|AC159460.9| Mus musculus chromosome 15, clone RP24-306N20, complete sequence
          Length = 184875

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 451    aattcaaacaatgacaacaat 471
              |||||||||||||||||||||
Sbjct: 175061 aattcaaacaatgacaacaat 175041



to top

>gb|AC055732.16| Homo sapiens 3 BAC RP11-39E4 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 176459

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 451    aattcaaacaatgacaacaat 471
              |||||||||||||||||||||
Sbjct: 152106 aattcaaacaatgacaacaat 152086



to top

>gb|AC099017.1| Drosophila melanogaster, chromosome 2L, region 37D-37E, BAC clone
              BACR27M12, complete sequence
          Length = 157766

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 65     gtatctttgtgaaatgagtag 85
              |||||||||||||||||||||
Sbjct: 145813 gtatctttgtgaaatgagtag 145793



to top

>gb|AC009597.5|AC009597 Homo sapiens chromosome 8, clone RP11-33E15, complete sequence
          Length = 169479

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 307   gtatttggcaggtagttgttgatat 331
             |||||||||||||| ||||||||||
Sbjct: 29842 gtatttggcaggtatttgttgatat 29818



to top

>gb|AC022404.7|AC022404 Homo sapiens chromosome 14 clone CTD-2308C24 and RP11-757H14 map 14q31,
              complete sequence
          Length = 232309

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 407    attttgaatatatcattgtaa 427
              |||||||||||||||||||||
Sbjct: 222903 attttgaatatatcattgtaa 222923



to top

>gb|AC011362.2|AC011362 Homo sapiens chromosome 5 clone CTC-503K11, complete sequence
          Length = 176029

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 269    ccatatacaaaaatccatggaaaat 293
              ||||||||||||||||||| |||||
Sbjct: 103656 ccatatacaaaaatccatgcaaaat 103680



to top

>gb|AC008509.5|AC008509 Homo sapiens chromosome 5 clone CTC-449I11, complete sequence
          Length = 189456

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 269    ccatatacaaaaatccatggaaaat 293
              ||||||||||||||||||| |||||
Sbjct: 175238 ccatatacaaaaatccatgcaaaat 175214



to top

>gb|AC116769.11| Mus musculus chromosome 15, clone RP23-415L16, complete sequence
          Length = 201535

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 348    ctgagaagattggacagtgaagttcatgt 376
              |||||| |||||| |||||||||||||||
Sbjct: 199562 ctgagaggattgggcagtgaagttcatgt 199590



to top

>gb|AE003663.4| Drosophila melanogaster chromosome 2L, section 72 of 83 of the complete
              sequence
          Length = 290667

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 65     gtatctttgtgaaatgagtag 85
              |||||||||||||||||||||
Sbjct: 117432 gtatctttgtgaaatgagtag 117412



to top

>gb|AC005128.1|AC005128 Drosophila melanogaster, chromosome 2L, region 37F1-37F6, P1 clone
             DS08491, complete sequence
          Length = 60040

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 65    gtatctttgtgaaatgagtag 85
             |||||||||||||||||||||
Sbjct: 30459 gtatctttgtgaaatgagtag 30479



to top

>gb|AC007889.9| Drosophila melanogaster clone BACR48E12, complete sequence
          Length = 182182

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 197    tttgcaacattgccacattg 216
              ||||||||||||||||||||
Sbjct: 122346 tttgcaacattgccacattg 122327



to top

>gb|AC007692.5| Drosophila melanogaster clone BACR06O05, complete sequence
          Length = 184662

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 197   tttgcaacattgccacattg 216
             ||||||||||||||||||||
Sbjct: 39809 tttgcaacattgccacattg 39790



to top

>emb|BX936301.8| Zebrafish DNA sequence from clone CH211-261H10 in linkage group 9,
            complete sequence
          Length = 112250

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 398  gtgatacacattttgaatat 417
            ||||||||||||||||||||
Sbjct: 4174 gtgatacacattttgaatat 4193



to top

>emb|CR847806.15| Zebrafish DNA sequence from clone CH211-267J10 in linkage group 8,
              complete sequence
          Length = 151455

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 161    tttgagcatttgtaatcagt 180
              ||||||||||||||||||||
Sbjct: 140581 tttgagcatttgtaatcagt 140600



to top

>emb|Z82209.2|HS428A13 Human DNA sequence from clone RP3-428A13 on chromosome X Contains a
             intracellular membrane-associated calcium-independent
             phospholipase A2 (IPLA2) pseudogene, complete sequence
          Length = 154235

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 406   cattttgaatatatcattgt 425
             ||||||||||||||||||||
Sbjct: 98615 cattttgaatatatcattgt 98596



to top

>emb|AL607022.11| Human DNA sequence from clone RP11-323N10 on chromosome 10 Contains the
             5' end of the gene for alpha-catenin-like protein
             (MGC26194) (VR22), a aldo-keto reductase family 1, member
             B10 (aldose reductase) (AKR1B10) pseudogene and a CpG
             island, complete sequence
          Length = 121210

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 344   gcagctgagaagattggacagtga 367
             ||||||| ||||||||||||||||
Sbjct: 49626 gcagctgggaagattggacagtga 49603



to top

>emb|AL499604.9| Human DNA sequence from clone RP11-23B15 on chromosome 9 Contains FOXE1
             gene for forkhead box E1 (thyroid transcription factor 2),
             HEMGN gene for hemogen, 2 novel genes and 5 CpG islands,
             complete sequence
          Length = 160796

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 66    tatctttgtgaaatgagtag 85
             ||||||||||||||||||||
Sbjct: 49066 tatctttgtgaaatgagtag 49047



to top

>emb|AL356292.21| Human DNA sequence from clone RP11-363I22 on chromosome 1 Contains the
             5' end of the gene for GPP34-related protein (GPP34R), the
             gene for a novel protein (DKFZp434A1315), the CTSS gene
             for cathepsin S, a pseudogene similar to part of short
             coiled-coil protein (SCOC) and the 3' end of the CTSK gene
             for cathepsin K (pycnodysostosis), complete sequence
          Length = 154068

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 450   aaattcaaacaatgacaaca 469
             ||||||||||||||||||||
Sbjct: 72536 aaattcaaacaatgacaaca 72555



to top

>emb|AL135778.9| Human DNA sequence from clone RP1-119C5 on chromosome 6 Contains the 5'
             end of the BMP6 gene for bone morphogenetic protein 6 and
             a CpG island, complete sequence
          Length = 152786

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 450   aaattcaaacaatgacaaca 469
             ||||||||||||||||||||
Sbjct: 63952 aaattcaaacaatgacaaca 63971



to top

>emb|AL732570.12| Mouse DNA sequence from clone RP23-464J2 on chromosome 11 Contains the
             gene for a novel protein (C630032K07Rik), a novel gene,
             the 3' end of the gene for a novel protein (1700019F09Rik)
             and a CpG island, complete sequence
          Length = 102563

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 236   ggttgggatgtgtaaaacttgtca 259
             |||||||||||| |||||||||||
Sbjct: 41132 ggttgggatgtggaaaacttgtca 41109



to top

>emb|AL445064.1|TACID2 Thermoplasma acidophilum complete genome; segment 2/5
          Length = 338100

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 408    ttttgaatatatcattgtaa 427
              ||||||||||||||||||||
Sbjct: 203619 ttttgaatatatcattgtaa 203638



to top

>emb|AJ851427.1| Gallus gallus mRNA for hypothetical protein, clone 2i13
          Length = 5437

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 274  tacaaaaatccatggaaaat 293
            ||||||||||||||||||||
Sbjct: 5384 tacaaaaatccatggaaaat 5403



to top

>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome
          Length = 6260361

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 314     gcaggtagttgttgatattc 333
               ||||||||||||||||||||
Sbjct: 1369812 gcaggtagttgttgatattc 1369793



to top

>gb|AC008189.3|AC008189 Drosophila melanogaster, chromosome 3R, region 82C-82D, BAC clone
              BACR02C19, complete sequence
          Length = 188359

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 128    acgaattattcgcaaggctg 147
              ||||||||||||||||||||
Sbjct: 107467 acgaattattcgcaaggctg 107486



to top

>gb|AC096558.1| Homo sapiens BAC clone RP11-186C15 from 2, complete sequence
          Length = 169453

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 441    cagtctagtaaattcaaaca 460
              ||||||||||||||||||||
Sbjct: 164131 cagtctagtaaattcaaaca 164112



to top

>gb|AC015971.4| Homo sapiens BAC clone RP11-269K22 from 2, complete sequence
          Length = 163852

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 162   ttgagcatttgtaatcagtg 181
             ||||||||||||||||||||
Sbjct: 29573 ttgagcatttgtaatcagtg 29592



to top

>gb|AC007642.5|AC007642 Homo sapiens chromosome 17, clone hRPK.420_O_5, complete sequence
          Length = 64011

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 272   tatacaaaaatccatggaaa 291
             ||||||||||||||||||||
Sbjct: 38380 tatacaaaaatccatggaaa 38361



to top

>ref|NM_001012541.1| Gallus gallus nucleoporin 50kDa (NUP50), mRNA
          Length = 5437

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 274  tacaaaaatccatggaaaat 293
            ||||||||||||||||||||
Sbjct: 5384 tacaaaaatccatggaaaat 5403



to top

>gb|AE003694.4| Drosophila melanogaster chromosome 3R, section 32 of 118 of the
             complete sequence
          Length = 226075

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 197   tttgcaacattgccacattg 216
             ||||||||||||||||||||
Sbjct: 48770 tttgcaacattgccacattg 48751



to top

>emb|AL079343.4|CNS00M8T Human chromosome 14 DNA sequence BAC R-483C6 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 173480

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 289    aaaattccaaaaaggctggtatttggca 316
              |||||| ||||| |||||||||||||||
Sbjct: 150510 aaaattacaaaagggctggtatttggca 150483



to top

>gb|AE003605.3| Drosophila melanogaster chromosome 3R, section 3 of 118 of the complete
              sequence
          Length = 273418

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 128    acgaattattcgcaaggctg 147
              ||||||||||||||||||||
Sbjct: 194368 acgaattattcgcaaggctg 194387



to top

>emb|AL671998.10| Mouse DNA sequence from clone RP23-71G11 on chromosome X, complete
             sequence
          Length = 220669

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 275   acaaaaatccatggaaaatt 294
             ||||||||||||||||||||
Sbjct: 12265 acaaaaatccatggaaaatt 12284


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,272,683
Number of Sequences: 3902068
Number of extensions: 5272683
Number of successful extensions: 118314
Number of sequences better than 10.0: 37
Number of HSP's better than 10.0 without gapping: 37
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 118213
Number of HSP's gapped (non-prelim): 101
length of query: 497
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 475
effective length of database: 17,147,199,772
effective search space: 8144919891700
effective search space used: 8144919891700
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top