Clone Name | bah63i23 |
---|---|
Clone Library Name | barley_pub |
>gb|AC118627.6| Mus musculus chromosome 15, clone RP24-91E8, complete sequence Length = 256158 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 348 ctgagaagattggacagtgaagttcatgt 376 |||||| |||||| ||||||||||||||| Sbjct: 212684 ctgagaggattgggcagtgaagttcatgt 212656
>gb|AC099020.2| Drosophila melanogaster clone BACR30H01, complete sequence Length = 155557 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 65 gtatctttgtgaaatgagtag 85 ||||||||||||||||||||| Sbjct: 125146 gtatctttgtgaaatgagtag 125166
>gb|BT014109.1| Lycopersicon esculentum clone 133213F, mRNA sequence Length = 1299 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 225 aagaggaagcaggttgggatg 245 ||||||||||||||||||||| Sbjct: 389 aagaggaagcaggttgggatg 369
>ref|XM_749213.1| Aspergillus fumigatus Af293 hypothetical protein (Afu3g13160) partial mRNA Length = 1851 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 320 agttgttgatattcggatctt 340 ||||||||||||||||||||| Sbjct: 640 agttgttgatattcggatctt 620
>emb|AL732366.7| Human DNA sequence from clone RP11-393H10 on chromosome X Contains a novel gene (FLJ14503), the EIF1A gene for eukaryotic translation initiation factor 1A (EIF4C, EIF1AX, eIF-1A, eIF-4C), the 3' end of the RPS6KA3 gene for ribosomal protein S6 kinase, 90kDa, polypeptide 3 (RSK, HU-2, HU-3, RSK2, MRX19, ISPK-1, MAPKAPK1B), a novel gene and three CpG islands, complete sequence Length = 187275 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 408 ttttgaatatatcattgtaaaatct 432 |||||||||||| |||||||||||| Sbjct: 23899 ttttgaatatattattgtaaaatct 23875
>gb|AC159460.9| Mus musculus chromosome 15, clone RP24-306N20, complete sequence Length = 184875 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 451 aattcaaacaatgacaacaat 471 ||||||||||||||||||||| Sbjct: 175061 aattcaaacaatgacaacaat 175041
>gb|AC055732.16| Homo sapiens 3 BAC RP11-39E4 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 176459 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 451 aattcaaacaatgacaacaat 471 ||||||||||||||||||||| Sbjct: 152106 aattcaaacaatgacaacaat 152086
>gb|AC099017.1| Drosophila melanogaster, chromosome 2L, region 37D-37E, BAC clone BACR27M12, complete sequence Length = 157766 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 65 gtatctttgtgaaatgagtag 85 ||||||||||||||||||||| Sbjct: 145813 gtatctttgtgaaatgagtag 145793
>gb|AC009597.5|AC009597 Homo sapiens chromosome 8, clone RP11-33E15, complete sequence Length = 169479 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 307 gtatttggcaggtagttgttgatat 331 |||||||||||||| |||||||||| Sbjct: 29842 gtatttggcaggtatttgttgatat 29818
>gb|AC022404.7|AC022404 Homo sapiens chromosome 14 clone CTD-2308C24 and RP11-757H14 map 14q31, complete sequence Length = 232309 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 407 attttgaatatatcattgtaa 427 ||||||||||||||||||||| Sbjct: 222903 attttgaatatatcattgtaa 222923
>gb|AC011362.2|AC011362 Homo sapiens chromosome 5 clone CTC-503K11, complete sequence Length = 176029 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 269 ccatatacaaaaatccatggaaaat 293 ||||||||||||||||||| ||||| Sbjct: 103656 ccatatacaaaaatccatgcaaaat 103680
>gb|AC008509.5|AC008509 Homo sapiens chromosome 5 clone CTC-449I11, complete sequence Length = 189456 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 269 ccatatacaaaaatccatggaaaat 293 ||||||||||||||||||| ||||| Sbjct: 175238 ccatatacaaaaatccatgcaaaat 175214
>gb|AC116769.11| Mus musculus chromosome 15, clone RP23-415L16, complete sequence Length = 201535 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 348 ctgagaagattggacagtgaagttcatgt 376 |||||| |||||| ||||||||||||||| Sbjct: 199562 ctgagaggattgggcagtgaagttcatgt 199590
>gb|AE003663.4| Drosophila melanogaster chromosome 2L, section 72 of 83 of the complete sequence Length = 290667 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 65 gtatctttgtgaaatgagtag 85 ||||||||||||||||||||| Sbjct: 117432 gtatctttgtgaaatgagtag 117412
>gb|AC005128.1|AC005128 Drosophila melanogaster, chromosome 2L, region 37F1-37F6, P1 clone DS08491, complete sequence Length = 60040 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 65 gtatctttgtgaaatgagtag 85 ||||||||||||||||||||| Sbjct: 30459 gtatctttgtgaaatgagtag 30479
>gb|AC007889.9| Drosophila melanogaster clone BACR48E12, complete sequence Length = 182182 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 197 tttgcaacattgccacattg 216 |||||||||||||||||||| Sbjct: 122346 tttgcaacattgccacattg 122327
>gb|AC007692.5| Drosophila melanogaster clone BACR06O05, complete sequence Length = 184662 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 197 tttgcaacattgccacattg 216 |||||||||||||||||||| Sbjct: 39809 tttgcaacattgccacattg 39790
>emb|BX936301.8| Zebrafish DNA sequence from clone CH211-261H10 in linkage group 9, complete sequence Length = 112250 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 398 gtgatacacattttgaatat 417 |||||||||||||||||||| Sbjct: 4174 gtgatacacattttgaatat 4193
>emb|CR847806.15| Zebrafish DNA sequence from clone CH211-267J10 in linkage group 8, complete sequence Length = 151455 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 161 tttgagcatttgtaatcagt 180 |||||||||||||||||||| Sbjct: 140581 tttgagcatttgtaatcagt 140600
>emb|Z82209.2|HS428A13 Human DNA sequence from clone RP3-428A13 on chromosome X Contains a intracellular membrane-associated calcium-independent phospholipase A2 (IPLA2) pseudogene, complete sequence Length = 154235 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 406 cattttgaatatatcattgt 425 |||||||||||||||||||| Sbjct: 98615 cattttgaatatatcattgt 98596
>emb|AL607022.11| Human DNA sequence from clone RP11-323N10 on chromosome 10 Contains the 5' end of the gene for alpha-catenin-like protein (MGC26194) (VR22), a aldo-keto reductase family 1, member B10 (aldose reductase) (AKR1B10) pseudogene and a CpG island, complete sequence Length = 121210 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 344 gcagctgagaagattggacagtga 367 ||||||| |||||||||||||||| Sbjct: 49626 gcagctgggaagattggacagtga 49603
>emb|AL499604.9| Human DNA sequence from clone RP11-23B15 on chromosome 9 Contains FOXE1 gene for forkhead box E1 (thyroid transcription factor 2), HEMGN gene for hemogen, 2 novel genes and 5 CpG islands, complete sequence Length = 160796 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 66 tatctttgtgaaatgagtag 85 |||||||||||||||||||| Sbjct: 49066 tatctttgtgaaatgagtag 49047
>emb|AL356292.21| Human DNA sequence from clone RP11-363I22 on chromosome 1 Contains the 5' end of the gene for GPP34-related protein (GPP34R), the gene for a novel protein (DKFZp434A1315), the CTSS gene for cathepsin S, a pseudogene similar to part of short coiled-coil protein (SCOC) and the 3' end of the CTSK gene for cathepsin K (pycnodysostosis), complete sequence Length = 154068 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 450 aaattcaaacaatgacaaca 469 |||||||||||||||||||| Sbjct: 72536 aaattcaaacaatgacaaca 72555
>emb|AL135778.9| Human DNA sequence from clone RP1-119C5 on chromosome 6 Contains the 5' end of the BMP6 gene for bone morphogenetic protein 6 and a CpG island, complete sequence Length = 152786 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 450 aaattcaaacaatgacaaca 469 |||||||||||||||||||| Sbjct: 63952 aaattcaaacaatgacaaca 63971
>emb|AL732570.12| Mouse DNA sequence from clone RP23-464J2 on chromosome 11 Contains the gene for a novel protein (C630032K07Rik), a novel gene, the 3' end of the gene for a novel protein (1700019F09Rik) and a CpG island, complete sequence Length = 102563 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 236 ggttgggatgtgtaaaacttgtca 259 |||||||||||| ||||||||||| Sbjct: 41132 ggttgggatgtggaaaacttgtca 41109
>emb|AL445064.1|TACID2 Thermoplasma acidophilum complete genome; segment 2/5 Length = 338100 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 408 ttttgaatatatcattgtaa 427 |||||||||||||||||||| Sbjct: 203619 ttttgaatatatcattgtaa 203638
>emb|AJ851427.1| Gallus gallus mRNA for hypothetical protein, clone 2i13 Length = 5437 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 274 tacaaaaatccatggaaaat 293 |||||||||||||||||||| Sbjct: 5384 tacaaaaatccatggaaaat 5403
>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome Length = 6260361 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 314 gcaggtagttgttgatattc 333 |||||||||||||||||||| Sbjct: 1369812 gcaggtagttgttgatattc 1369793
>gb|AC008189.3|AC008189 Drosophila melanogaster, chromosome 3R, region 82C-82D, BAC clone BACR02C19, complete sequence Length = 188359 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 128 acgaattattcgcaaggctg 147 |||||||||||||||||||| Sbjct: 107467 acgaattattcgcaaggctg 107486
>gb|AC096558.1| Homo sapiens BAC clone RP11-186C15 from 2, complete sequence Length = 169453 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 441 cagtctagtaaattcaaaca 460 |||||||||||||||||||| Sbjct: 164131 cagtctagtaaattcaaaca 164112
>gb|AC015971.4| Homo sapiens BAC clone RP11-269K22 from 2, complete sequence Length = 163852 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 162 ttgagcatttgtaatcagtg 181 |||||||||||||||||||| Sbjct: 29573 ttgagcatttgtaatcagtg 29592
>gb|AC007642.5|AC007642 Homo sapiens chromosome 17, clone hRPK.420_O_5, complete sequence Length = 64011 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 272 tatacaaaaatccatggaaa 291 |||||||||||||||||||| Sbjct: 38380 tatacaaaaatccatggaaa 38361
>ref|NM_001012541.1| Gallus gallus nucleoporin 50kDa (NUP50), mRNA Length = 5437 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 274 tacaaaaatccatggaaaat 293 |||||||||||||||||||| Sbjct: 5384 tacaaaaatccatggaaaat 5403
>gb|AE003694.4| Drosophila melanogaster chromosome 3R, section 32 of 118 of the complete sequence Length = 226075 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 197 tttgcaacattgccacattg 216 |||||||||||||||||||| Sbjct: 48770 tttgcaacattgccacattg 48751
>emb|AL079343.4|CNS00M8T Human chromosome 14 DNA sequence BAC R-483C6 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 173480 Score = 40.1 bits (20), Expect = 6.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 289 aaaattccaaaaaggctggtatttggca 316 |||||| ||||| ||||||||||||||| Sbjct: 150510 aaaattacaaaagggctggtatttggca 150483
>gb|AE003605.3| Drosophila melanogaster chromosome 3R, section 3 of 118 of the complete sequence Length = 273418 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 128 acgaattattcgcaaggctg 147 |||||||||||||||||||| Sbjct: 194368 acgaattattcgcaaggctg 194387
>emb|AL671998.10| Mouse DNA sequence from clone RP23-71G11 on chromosome X, complete sequence Length = 220669 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 275 acaaaaatccatggaaaatt 294 |||||||||||||||||||| Sbjct: 12265 acaaaaatccatggaaaatt 12284 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,272,683 Number of Sequences: 3902068 Number of extensions: 5272683 Number of successful extensions: 118314 Number of sequences better than 10.0: 37 Number of HSP's better than 10.0 without gapping: 37 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 118213 Number of HSP's gapped (non-prelim): 101 length of query: 497 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 475 effective length of database: 17,147,199,772 effective search space: 8144919891700 effective search space used: 8144919891700 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)