>ref|XM_466605.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2494

 Score =  232 bits (117), Expect = 9e-58
 Identities = 279/333 (83%)
 Strand = Plus / Plus

                                                                       
Query: 192 atagccatggccaccggggtggcaccggctccgcttccgtacgtcaaggtccgcgacgga 251
           ||||||||||||||||| |||||||| || ||||| ||  | |||| |||||| || || 
Sbjct: 156 atagccatggccaccggagtggcaccagcgccgctcccacatgtcagggtccgtgatggt 215

                                                                       
Query: 252 ggcgtcggctacaccaagagcgtcgacttcgccaagatcctctccgttcccggtgcgctg 311
           ||| |||||| ||| | |||||||||||| || |||||| | || ||||| | | | || 
Sbjct: 216 ggcatcggcttcacgaggagcgtcgactttgctaagatcttgtcggttcctgctactcta 275

                                                                       
Query: 312 aggatggggtccgcaagaggcagggcgctcgtggtcaagagctcaagtacagagtctgat 371
           ||| |||| ||  |||||||||||| ||| |||| ||||||||||||||| |  ||||||
Sbjct: 276 agggtgggctcatcaagaggcagggtgcttgtggccaagagctcaagtaccggttctgat 335

                                                                       
Query: 372 accatggagctcgagccggcctccgaaggaagcccacttctagttcccaggcagaagtac 431
           |||||||||||||||||  | || ||||||||||||||| ||||||||||||| ||||| 
Sbjct: 336 accatggagctcgagccatcttcagaaggaagcccacttttagttcccaggcaaaagtat 395

                                                                       
Query: 432 tgcgaatctatacaccagacaaggaggaggaaaacacgcactgtgatggtcgggaacgtg 491
           || ||||||||| |  ||||||||||||| ||||| |||||||||||||| ||||| |||
Sbjct: 396 tgtgaatctatatatgagacaaggaggagaaaaacccgcactgtgatggttgggaatgtg 455

                                            
Query: 492 gcactcggcagtgatcaccccatgaggattcag 524
            |||| ||||||||||| ||||| |||||||||
Sbjct: 456 ccacttggcagtgatcatcccattaggattcag 488

>ref|XM_506856.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1669_F01.30
           mRNA
          Length = 2675

 Score =  232 bits (117), Expect = 9e-58
 Identities = 279/333 (83%)
 Strand = Plus / Plus

                                                                       
Query: 192 atagccatggccaccggggtggcaccggctccgcttccgtacgtcaaggtccgcgacgga 251
           ||||||||||||||||| |||||||| || ||||| ||  | |||| |||||| || || 
Sbjct: 149 atagccatggccaccggagtggcaccagcgccgctcccacatgtcagggtccgtgatggt 208

                                                                       
Query: 252 ggcgtcggctacaccaagagcgtcgacttcgccaagatcctctccgttcccggtgcgctg 311
           ||| |||||| ||| | |||||||||||| || |||||| | || ||||| | | | || 
Sbjct: 209 ggcatcggcttcacgaggagcgtcgactttgctaagatcttgtcggttcctgctactcta 268

                                                                       
Query: 312 aggatggggtccgcaagaggcagggcgctcgtggtcaagagctcaagtacagagtctgat 371
           ||| |||| ||  |||||||||||| ||| |||| ||||||||||||||| |  ||||||
Sbjct: 269 agggtgggctcatcaagaggcagggtgcttgtggccaagagctcaagtaccggttctgat 328

                                                                       
Query: 372 accatggagctcgagccggcctccgaaggaagcccacttctagttcccaggcagaagtac 431
           |||||||||||||||||  | || ||||||||||||||| ||||||||||||| ||||| 
Sbjct: 329 accatggagctcgagccatcttcagaaggaagcccacttttagttcccaggcaaaagtat 388

                                                                       
Query: 432 tgcgaatctatacaccagacaaggaggaggaaaacacgcactgtgatggtcgggaacgtg 491
           || ||||||||| |  ||||||||||||| ||||| |||||||||||||| ||||| |||
Sbjct: 389 tgtgaatctatatatgagacaaggaggagaaaaacccgcactgtgatggttgggaatgtg 448

                                            
Query: 492 gcactcggcagtgatcaccccatgaggattcag 524
            |||| ||||||||||| ||||| |||||||||
Sbjct: 449 ccacttggcagtgatcatcccattaggattcag 481

>dbj|AK120769.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023008D09, full
           insert sequence
          Length = 2675

 Score =  232 bits (117), Expect = 9e-58
 Identities = 279/333 (83%)
 Strand = Plus / Plus

                                                                       
Query: 192 atagccatggccaccggggtggcaccggctccgcttccgtacgtcaaggtccgcgacgga 251
           ||||||||||||||||| |||||||| || ||||| ||  | |||| |||||| || || 
Sbjct: 149 atagccatggccaccggagtggcaccagcgccgctcccacatgtcagggtccgtgatggt 208

                                                                       
Query: 252 ggcgtcggctacaccaagagcgtcgacttcgccaagatcctctccgttcccggtgcgctg 311
           ||| |||||| ||| | |||||||||||| || |||||| | || ||||| | | | || 
Sbjct: 209 ggcatcggcttcacgaggagcgtcgactttgctaagatcttgtcggttcctgctactcta 268

                                                                       
Query: 312 aggatggggtccgcaagaggcagggcgctcgtggtcaagagctcaagtacagagtctgat 371
           ||| |||| ||  |||||||||||| ||| |||| ||||||||||||||| |  ||||||
Sbjct: 269 agggtgggctcatcaagaggcagggtgcttgtggccaagagctcaagtaccggttctgat 328

                                                                       
Query: 372 accatggagctcgagccggcctccgaaggaagcccacttctagttcccaggcagaagtac 431
           |||||||||||||||||  | || ||||||||||||||| ||||||||||||| ||||| 
Sbjct: 329 accatggagctcgagccatcttcagaaggaagcccacttttagttcccaggcaaaagtat 388

                                                                       
Query: 432 tgcgaatctatacaccagacaaggaggaggaaaacacgcactgtgatggtcgggaacgtg 491
           || ||||||||| |  ||||||||||||| ||||| |||||||||||||| ||||| |||
Sbjct: 389 tgtgaatctatatatgagacaaggaggagaaaaacccgcactgtgatggttgggaatgtg 448

                                            
Query: 492 gcactcggcagtgatcaccccatgaggattcag 524
            |||| ||||||||||| ||||| |||||||||
Sbjct: 449 ccacttggcagtgatcatcccattaggattcag 481

>dbj|AK105762.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-D08, full
           insert sequence
          Length = 2494

 Score =  232 bits (117), Expect = 9e-58
 Identities = 279/333 (83%)
 Strand = Plus / Plus

                                                                       
Query: 192 atagccatggccaccggggtggcaccggctccgcttccgtacgtcaaggtccgcgacgga 251
           ||||||||||||||||| |||||||| || ||||| ||  | |||| |||||| || || 
Sbjct: 156 atagccatggccaccggagtggcaccagcgccgctcccacatgtcagggtccgtgatggt 215

                                                                       
Query: 252 ggcgtcggctacaccaagagcgtcgacttcgccaagatcctctccgttcccggtgcgctg 311
           ||| |||||| ||| | |||||||||||| || |||||| | || ||||| | | | || 
Sbjct: 216 ggcatcggcttcacgaggagcgtcgactttgctaagatcttgtcggttcctgctactcta 275

                                                                       
Query: 312 aggatggggtccgcaagaggcagggcgctcgtggtcaagagctcaagtacagagtctgat 371
           ||| |||| ||  |||||||||||| ||| |||| ||||||||||||||| |  ||||||
Sbjct: 276 agggtgggctcatcaagaggcagggtgcttgtggccaagagctcaagtaccggttctgat 335

                                                                       
Query: 372 accatggagctcgagccggcctccgaaggaagcccacttctagttcccaggcagaagtac 431
           |||||||||||||||||  | || ||||||||||||||| ||||||||||||| ||||| 
Sbjct: 336 accatggagctcgagccatcttcagaaggaagcccacttttagttcccaggcaaaagtat 395

                                                                       
Query: 432 tgcgaatctatacaccagacaaggaggaggaaaacacgcactgtgatggtcgggaacgtg 491
           || ||||||||| |  ||||||||||||| ||||| |||||||||||||| ||||| |||
Sbjct: 396 tgtgaatctatatatgagacaaggaggagaaaaacccgcactgtgatggttgggaatgtg 455

                                            
Query: 492 gcactcggcagtgatcaccccatgaggattcag 524
            |||| ||||||||||| ||||| |||||||||
Sbjct: 456 ccacttggcagtgatcatcccattaggattcag 488

>gb|AY562489.1| Zea mays hydroxymethylbutenyl 4-diphosphate synthase (Hds1) mRNA,
           complete cds
          Length = 2631

 Score =  192 bits (97), Expect = 8e-46
 Identities = 172/197 (87%)
 Strand = Plus / Plus

                                                                       
Query: 327 agaggcagggcgctcgtggtcaagagctcaagtacagagtctgataccatggagctcgag 386
           |||||||||||||||||||  |||||||| ||||| |  || || |||||||||||||||
Sbjct: 337 agaggcagggcgctcgtggcgaagagctctagtactggctcggagaccatggagctcgag 396

                                                                       
Query: 387 ccggcctccgaaggaagcccacttctagttcccaggcagaagtactgcgaatctatacac 446
           ||  | || ||||||||||||||| |||| ||||||||||||||||| ||||| | ||||
Sbjct: 397 ccatcttcagaaggaagcccacttttagtacccaggcagaagtactgtgaatcaacacac 456

                                                                       
Query: 447 cagacaaggaggaggaaaacacgcactgtgatggtcgggaacgtggcactcggcagtgat 506
           |||||||||||||||||||| || ||||||||||| ||||| ||| |||| |||||||||
Sbjct: 457 cagacaaggaggaggaaaactcgaactgtgatggtggggaatgtgccacttggcagtgat 516

                            
Query: 507 caccccatgaggattca 523
           || ||||| ||||||||
Sbjct: 517 catcccataaggattca 533



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 132 acggtgctgcgaggtgtttgtaggat 157
           |||| |||||||||||||||||||||
Sbjct: 142 acggagctgcgaggtgtttgtaggat 167

>gb|AY562488.1| Zea mays hydroxymethylbutenyl 4-diphosphate synthase (Hds1) gene,
            complete cds
          Length = 6353

 Score =  125 bits (63), Expect = 2e-25
 Identities = 96/107 (89%)
 Strand = Plus / Plus

                                                                        
Query: 417  cccaggcagaagtactgcgaatctatacaccagacaaggaggaggaaaacacgcactgtg 476
            ||||||||||||||||| ||||| | |||||||||||||||||||||||| || ||||||
Sbjct: 1187 cccaggcagaagtactgtgaatcaacacaccagacaaggaggaggaaaactcgaactgtg 1246

                                                           
Query: 477  atggtcgggaacgtggcactcggcagtgatcaccccatgaggattca 523
            ||||| ||||| ||| |||| ||||||||||| ||||| ||||||||
Sbjct: 1247 atggtggggaatgtgccacttggcagtgatcatcccataaggattca 1293



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 72/84 (85%)
 Strand = Plus / Plus

                                                                        
Query: 327  agaggcagggcgctcgtggtcaagagctcaagtacagagtctgataccatggagctcgag 386
            |||||||||||||||||||  |||||||| ||||| |  || || |||||||||||||||
Sbjct: 977  agaggcagggcgctcgtggcgaagagctctagtactggctcggagaccatggagctcgag 1036

                                    
Query: 387  ccggcctccgaaggaagcccactt 410
            ||  | || |||||||||||||||
Sbjct: 1037 ccatcttcagaaggaagcccactt 1060

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  125 bits (63), Expect = 2e-25
 Identities = 180/219 (82%)
 Strand = Plus / Minus

                                                                            
Query: 192      atagccatggccaccggggtggcaccggctccgcttccgtacgtcaaggtccgcgacgga 251
                ||||||||||||||||| |||||||| || ||||| ||  | |||| |||||| || || 
Sbjct: 23677605 atagccatggccaccggagtggcaccagcgccgctcccacatgtcagggtccgtgatggt 23677546

                                                                            
Query: 252      ggcgtcggctacaccaagagcgtcgacttcgccaagatcctctccgttcccggtgcgctg 311
                ||| |||||| ||| | |||||||||||| || |||||| | || ||||| | | | || 
Sbjct: 23677545 ggcatcggcttcacgaggagcgtcgactttgctaagatcttgtcggttcctgctactcta 23677486

                                                                            
Query: 312      aggatggggtccgcaagaggcagggcgctcgtggtcaagagctcaagtacagagtctgat 371
                ||| |||| ||  |||||||||||| ||| |||| ||||||||||||||| |  ||||||
Sbjct: 23677485 agggtgggctcatcaagaggcagggtgcttgtggccaagagctcaagtaccggttctgat 23677426

                                                       
Query: 372      accatggagctcgagccggcctccgaaggaagcccactt 410
                |||||||||||||||||  | || |||||||||||||||
Sbjct: 23677425 accatggagctcgagccatcttcagaaggaagcccactt 23677387



 Score =  113 bits (57), Expect = 6e-22
 Identities = 99/113 (87%)
 Strand = Plus / Minus

                                                                            
Query: 412      tagttcccaggcagaagtactgcgaatctatacaccagacaaggaggaggaaaacacgca 471
                ||||||||||||| ||||| || ||||||||| |  ||||||||||||| ||||| ||||
Sbjct: 23677254 tagttcccaggcaaaagtattgtgaatctatatatgagacaaggaggagaaaaacccgca 23677195

                                                                     
Query: 472      ctgtgatggtcgggaacgtggcactcggcagtgatcaccccatgaggattcag 524
                |||||||||| ||||| ||| |||| ||||||||||| ||||| |||||||||
Sbjct: 23677194 ctgtgatggttgggaatgtgccacttggcagtgatcatcccattaggattcag 23677142

>dbj|AP004124.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1669_F01
          Length = 140019

 Score =  125 bits (63), Expect = 2e-25
 Identities = 180/219 (82%)
 Strand = Plus / Minus

                                                                          
Query: 192    atagccatggccaccggggtggcaccggctccgcttccgtacgtcaaggtccgcgacgga 251
              ||||||||||||||||| |||||||| || ||||| ||  | |||| |||||| || || 
Sbjct: 118705 atagccatggccaccggagtggcaccagcgccgctcccacatgtcagggtccgtgatggt 118646

                                                                          
Query: 252    ggcgtcggctacaccaagagcgtcgacttcgccaagatcctctccgttcccggtgcgctg 311
              ||| |||||| ||| | |||||||||||| || |||||| | || ||||| | | | || 
Sbjct: 118645 ggcatcggcttcacgaggagcgtcgactttgctaagatcttgtcggttcctgctactcta 118586

                                                                          
Query: 312    aggatggggtccgcaagaggcagggcgctcgtggtcaagagctcaagtacagagtctgat 371
              ||| |||| ||  |||||||||||| ||| |||| ||||||||||||||| |  ||||||
Sbjct: 118585 agggtgggctcatcaagaggcagggtgcttgtggccaagagctcaagtaccggttctgat 118526

                                                     
Query: 372    accatggagctcgagccggcctccgaaggaagcccactt 410
              |||||||||||||||||  | || |||||||||||||||
Sbjct: 118525 accatggagctcgagccatcttcagaaggaagcccactt 118487



 Score =  113 bits (57), Expect = 6e-22
 Identities = 99/113 (87%)
 Strand = Plus / Minus

                                                                          
Query: 412    tagttcccaggcagaagtactgcgaatctatacaccagacaaggaggaggaaaacacgca 471
              ||||||||||||| ||||| || ||||||||| |  ||||||||||||| ||||| ||||
Sbjct: 118354 tagttcccaggcaaaagtattgtgaatctatatatgagacaaggaggagaaaaacccgca 118295

                                                                   
Query: 472    ctgtgatggtcgggaacgtggcactcggcagtgatcaccccatgaggattcag 524
              |||||||||| ||||| ||| |||| ||||||||||| ||||| |||||||||
Sbjct: 118294 ctgtgatggttgggaatgtgccacttggcagtgatcatcccattaggattcag 118242

>ref|XM_752536.1| Ustilago maydis 521 hypothetical protein (UM01482.1) partial mRNA
          Length = 3066

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 370  ataccatggagctcgagccggcc 392
            |||||||||||||||||||||||
Sbjct: 1949 ataccatggagctcgagccggcc 1971

>ref|XM_415558.1| PREDICTED: Gallus gallus similar to phosphohistidine phosphatase 1;
           1700008C22Rik; sex-regulated protein janus-a
           (LOC417285), mRNA
          Length = 1129

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 121 ggcgccgcgggacggtgctgcgagg 145
           ||||||||||||||| |||||||||
Sbjct: 295 ggcgccgcgggacggggctgcgagg 319

>gb|BT014629.1| Lycopersicon esculentum clone 134132R, mRNA sequence
          Length = 2527

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 469 gcactgtgatggtcgggaacgtggc 493
           ||||||||||||| |||||||||||
Sbjct: 312 gcactgtgatggttgggaacgtggc 336

>dbj|AP007161.1| Aspergillus oryzae RIB40 genomic DNA, SC012
          Length = 2668010

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 172     ttcgaagcttgggcataggca 192
               |||||||||||||||||||||
Sbjct: 2255341 ttcgaagcttgggcataggca 2255321

>gb|AF435086.1| Lycopersicon esculentum GcpE mRNA, complete cds
          Length = 2373

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 469 gcactgtgatggtcgggaacgtggc 493
           ||||||||||||| |||||||||||
Sbjct: 334 gcactgtgatggttgggaacgtggc 358

>gb|AY515283.1| Pseudemys concinna haplotype 79 cytochrome b-like (cytb) gene,
           partial sequence; tRNA-Thr and tRNA-Pro genes, complete
           sequence; and control region, partial sequence;
           mitochondrial
          Length = 1310

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 149 ttgtaggattgcgtaggcga 168
           ||||||||||||||||||||
Sbjct: 312 ttgtaggattgcgtaggcga 293

>gb|AY515281.1| Pseudemys concinna haplotype 87 cytochrome b-like (cytb) gene,
           partial sequence; tRNA-Thr and tRNA-Pro genes, complete
           sequence; and control region, partial sequence;
           mitochondrial
          Length = 1318

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 149 ttgtaggattgcgtaggcga 168
           ||||||||||||||||||||
Sbjct: 310 ttgtaggattgcgtaggcga 291

>ref|NM_101931.2| Arabidopsis thaliana unknown protein AT1G20790 mRNA, complete cds
          Length = 1308

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 183  ggcataggcatagccatggc 202
            ||||||||||||||||||||
Sbjct: 1181 ggcataggcatagccatggc 1162



 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 181  tgggcataggcatagccatggcca 204
            ||||||||||||||| ||||||||
Sbjct: 1159 tgggcataggcataggcatggcca 1136

>emb|AL929089.5| Mouse DNA sequence from clone RP24-402O2 on chromosome 11 Contains a
             novel gene (1700106J16Rik), complete sequence
          Length = 71354

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 200   ggccaccggggtggcaccggctcc 223
             |||||||||| |||||||||||||
Sbjct: 35165 ggccaccgggctggcaccggctcc 35142

>gb|AF258877.1| Deirochelys reticularia cytochrome b gene, complete cds;
           mitochondrial gene for mitochondrial product
          Length = 1190

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 149 ttgtaggattgcgtaggcga 168
           ||||||||||||||||||||
Sbjct: 849 ttgtaggattgcgtaggcga 830

>gb|AC007665.24| Mus musculus strain RIII Fibroblast cell line C127 chromosome 18 clone
             mgsriii-p1_3084, complete sequence
          Length = 85548

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 446   ccagacaaggaggaggaaaa 465
             ||||||||||||||||||||
Sbjct: 83262 ccagacaaggaggaggaaaa 83243

>gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana BAC F2D10 from chromosome I,
              complete sequence
          Length = 143879

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 181    tgggcataggcatagccatggcca 204
              ||||||||||||||| ||||||||
Sbjct: 111567 tgggcataggcataggcatggcca 111590



 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 183    ggcataggcatagccatggc 202
              ||||||||||||||||||||
Sbjct: 111545 ggcataggcatagccatggc 111564

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 62      ttccccgcgtcgctgccgtcggct 85
               |||| |||||||||||||||||||
Sbjct: 4022326 ttccgcgcgtcgctgccgtcggct 4022303

>dbj|AP006424.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT13E04, TM0314,
              complete sequence
          Length = 126349

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 181    tgggcataggcatagccatg 200
              ||||||||||||||||||||
Sbjct: 102218 tgggcataggcatagccatg 102237


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,072,282
Number of Sequences: 3902068
Number of extensions: 3072282
Number of successful extensions: 55133
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 54983
Number of HSP's gapped (non-prelim): 144
length of query: 524
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 501
effective length of database: 17,143,297,704
effective search space: 8588792149704
effective search space used: 8588792149704
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)